|








| |
Journal of Bacteriology, June 2004, p . 4038-4041, Vol . 186,
No . 12
Resuscitation of a Defective Prophage in Salmonella Cocultures
Nara Figueroa-Bossi* and Lionello
Bossi
Centre de Génétique Moléculaire, CNRS, Gif-sur-Yvette, France
Received 5 January 2004/ Accepted 15 March 2004
Widely studied Salmonella enterica serovar Typhimurium strains
ATCC 14028s and SL1344 harbor a cryptic ST64B prophage unable to
produce infectious virions . We found that coculturing either strain
with an isogenic sibling lacking the prophage leads to the appearance
of active forms of the virus . Active phage originates from reversion
of a +1 frameshift mutation at a monotonous G:C run in a presumptive
tail assembly pseudogene .
Prophages account for most of the genomic diversity among closely
related Salmonella strains . As an example, the two Salmonella
enterica serovar Typhimurium isolates generally used as model
systems for virulence studies worldwide, strains ATCC 14028s (3)
and SL1344 (7), have partially distinct prophage repertoires .
In addition to the Gifsy-1 and Gifsy-2 prophages found in both
strains, strain ATCC 14028s contains prophage Gifsy-3, which is
absent from SL1344 (5) . This prophage encodes type III
secreted effector protein SspH1 and the stress response regulator
irsA (5; F . Heffron, personal communication) .
Conversely, strain SL1344 carries sopE ,
which is not found in ATCC 14028s and encodes secreted G nucleotide
exchange factor SopE (5, 6) . All of the
above prophages are fully functional and produce infectious
particles upon induction by standard treatments or spontaneously at
lower levels (4, 5) .
Strains ATCC 14028s and SL1344 carry a defective ST64B prophage.
While characterizing the prophage complement of strain ATCC 14028s, a
few years ago, we tested whether a derivative cured for Gifsy-1,
Gifsy-2, and Gifsy-3 would still release phage . Aliquots from the
supernatant of a culture treated with mitomycin C (MitC) were spotted
on an array of tester strains including isolates from serovars other
than Typhimurium . Only a single plaque could be identified (with a
serovar Gallinarum host) . Phage propagated from the plaque was
subjected to limited DNA sequence analysis . The results did not
reveal any significant similarity with sequences known at the time .
Recently, however, new perusal of DNA databases showed our sequence
segments to correspond to various portions of the genome from
Salmonella phage ST64B (GenBank accession number
AY055382) . Mmolawa and coworkers identified ST64B in an induced
culture from an epidemic lysotype DT64 strain (9) .
The authors of that work visualized the virion particles by electron
microscopy and could purify phage DNA for sequence analysis;
intriguingly, however, they were unable to propagate the virus in any
strain tested, leading them to conclude that their ST64B isolate
lacked infection capability, possibly due to a tail defect (9) .
The phage ST64B sequence includes a serine tRNA gene (serU)
segment near the 3' end of the putative int gene, suggesting
that the prophage is inserted at the serU locus, adjacent to
the umuCD operon . We used oligonucleotides complementary to
regions from either side of the predicted phage chromosomal
boundaries as primers for PCR . Fragments corresponding to the
predicted attL and attR sequences were amplified with strains
ATCC 14028s and SL1344, whereas a fragment corresponding to the
attB sequence, which is diagnostic for the absence of the
prophage, was obtained with strain LT2 (data not shown) . To assess
the functional status of ST64B-like prophages in strains ATCC 14028s
and SL1344, prophage-deleted derivatives expected to become sensitive
to infection were constructed by Red-mediated exchange with a
PCR-amplified fragment (2) . This work was carried
out with Gifsy-cured strains MA6052 (ATCC 14028s) and MA6247
(SL1344) . The resulting strains, MA7549 and MA7551 (Table 1
and Fig . 1), were used as recipients for phage
infection . Aliquots (0.1 ml) from the supernatants of either
unchallenged or MitC-treated cultures of MA6052 and MA6247 were
overlaid on lawns of the corresponding recipient strains . Despite
repeated attempts (testing different plating procedures), plaques
were never observed with the samples from the untreated cultures,
while a total of two plaques were obtained from cultures exposed to
MitC in separate experiments . Altogether, these data suggested that
the ST64B prophage of both ATCC 14028s and SL1344 is defective in
regard to some step needed for the formation of infectious particles,
but it can occasionally revert to produce functional phage .
| TABLE 1 . List of strains used in this studya
|
|
|
FIG . 1 . Schematic representation of the ST64B prophage (left and right
portions) and the
(ST64B)::kan
swap construct . The ORF map combines information from the reports of
McClelland et al . (8) and Mmolawa et al . (9),
from the Sanger Institute, (http://www.sanger.ac.uk/;
Salmonella spp . comparative sequencing), and from this work . The
(ST64B)::kan
swap construct was made according to the method of Datsenko and Wanner (2) .
PCR Primers were 60 bases long, with the last 20 bases (indicated by
italics) annealing to template plasmid pKD4 (2) .
Primer sequences used were ACTGTACTTCTGCTTGTCTTTTGCCGTTCCCTCATAGTCTCATATGAATATCCTCCTTAG
(pp339) and TTAACTCCCTTCCGGTTAGCCGATAACAGAATCCAGTACATGTAGGCTGGAGCTGCTTCG
(pp340) . Red-mediated recombination resulted in the replacement of the
segment between coordinates 293 and 39819 of the ST64B genome map with a
kanamycin resistance gene (kan) . The procedure was carried out
separately in strains MA6052 and MA6247 (Table 1) and
yielded strains MA7549 and MA7551, respectively . A filled arrow above
the prophage map shows the ORF generated by a reversion of the +1
frameshift mutation (see the text).
|
|
Accumulation of ST64B phage revertants in cocultures. We have
shown that phage originating from spontaneous induction of a
lysogenic strain can multiply if this strain is cocultured with an
isogenic sibling that lacks the prophage (1) . We figured
that this feature might be exploited to select for amplification
of rare ST64B revertants that may arise spontaneously in a culture .
Cocultures were inoculated with a 1:5 mixture of bacteria from
parental strain MA6052 or MA6247 and the respective ST64B prophage-deleted
derivative MA7549 or MA7551 . Bacteria (approximately 1,000 in
the inoculum) were allowed to reproduce at 37°C without agitation
until stationary phase . Cultures were then diluted 200-fold and
incubated further under the same conditions for 6 to 12 h . The
subculturing routine was repeated four times . At each dilution step,
aliquots from supernatants were tested for the presence of
plaque-forming particles . As predicted, plaques were observed as
early as the first subculture, and their number rose sharply,
reaching a peak between the second and third subculturing step . Phage
obtained from resuspended plaques was confirmed to have ST64B
immunity . This phage was used to isolate newly lysogenized
derivatives . Interestingly, in most instances, the lysogenization
event was accompanied by the loss of kanamycin resistance, suggesting
that the incoming virus is able to dislodge the kan cassette
occupying the att site in the recipient strains (Fig.
1) . (This property is not unique to ST64B phage;
work in our laboratory has shown that Salmonella Fels-2 and
SopE
bacteriophages [11] can dislodge each other's
prophage from the chromosome [our unpublished data] . Unlike the ATCC
14028s- and SL1344-derived parents, newly lysogenized strains release
active ST64B phage spontaneously at significant frequencies
(approximately 3 x 104 PFU/ml in
a full-density grown culture), and phage yield increases by three
orders of magnitude following exposure to MitC . As initially
postulated, the coculture conditions appeared to have led to the
amplification of an ST64B phage revertant .
Reactivation of ST64B phage results from reversion of a +1 frameshift
mutation in a tail operon gene. To gather clues as to the possible
nature of prophage alteration, the ST64B sequence (9)
was compared to other phage genomes by using the BLASTX program . This
analysis revealed that two putative genes lying adjacent to each
other in different frames in the ST64B tail operon (coding for
proteins SB21 and SB22) (Fig . 1) are similar to the
two halves of an uninterrupted open reading frame (ORF) in other
phages, including phages P27 and Mu (see below) . This finding
suggested the presence of a frameshift mutation in the ST64B ORF .
Consistent with this hypothesis, a monotonous G:C run (a typical
frameshift mutation hotspot [13]) could be seen
immediately upstream of the stop codon terminating SB21 translation .
To analyze the structure of this region in the ST64B prophage of ATCC
14028s- and SL1344-derived strains, DNA fragments spanning the G:C
repeat were amplified by PCR and subjected to sequence analysis .
Results showed that in the case of both parental strains (MA6052 and
MA6247), the same 8-bp G:C run found in the published ST64B sequence
is present (Fig . 2) . In contrast, the G:C repeat is
1 bp shorter in the derivatives lysogenized by the active form of the
virus (strains MA7566 and MA7569), resulting in the fusion of the
SB21 and SB22 ORFs in a single reading frame (Fig . 2) .
These findings strongly suggest that reversion of the +1 frameshift
mutation is directly responsible for the reactivation of the phage .
The full-length version of the SB21 ORF is hereafter referred to
as SB21* . Sequences were deposited in the National Center for
Biotechnology Information database (GenBank accession numbers
AY552603 and
AY552604) .
|
FIG . 2 . DNA sequence analysis of the region containing the end of the
SB21 ORF of prophage ST64B in strains MA6052 (ATCC 14028s) and MA6247
(SL1344) and in strains lysogenized by active phage variants . The region
of interest was PCR amplified from the chromosome of the indicated
strains and subjected to DNA sequence analysis . The following
oligonucleotides were used as primers for PCR amplification and
sequencing: pp439 (TGCCGGTTATTGCTGATG) and pp440 (CGGCAAAATATGGTCACG).
|
|
Epidemic DT104 strains carry a functional ST64B-like prophage with an
uninterrupted SB21* ORF. The presence of the ST64B prophage in
clinical, phage-type DT104 isolates was assessed by PCR amplification
of the predicted attL and attR boundaries . This
analysis showed that all three strains analyzed (Table
1) carried the prophage (data not shown) . We then examined the
status of the SB21-SB22 region . DNA sequence analysis of a
PCR-amplified fragment showed that all three strains contain a unique
ORF with a G:C repeat of the same length (7 bp) as that in the
revertants described above (data not shown) (GenBank accession
numbers
AY552605,
AY574196, and
AY574197) . To test whether these strains produce functional ST64B
phage, derivatives in which the prophage was deleted were constructed
by transduction (Table 1) and used as recipients to
detect the presence of plaque-forming particles in cultures of the
respective parent strains that were either unchallenged or exposed to
MitC . Plaques were observed in all cases (less than 103
PFU/ml in untreated cultures grown to stationary phase, increasing to
approximately 106 PFU in the MitC-treated samples) . These
values are lower than those observed with the strains carrying the
prophage revertants; nonetheless, they clearly indicate that
all three DT104 strains harbor a functional ST64B prophage . In each
case, the resulting phage was found to have the same immunity as
ST64B phage isolated from ATCC 14028s and SL1344 (ST64B14028
and ST64B1344); like the latter, they showed the ability
to displace a kanamycin resistance marker from the att site
upon integration (data not shown) .
The predicted product of the SB21* ORF is a 359-amino-acid protein
which resembles proteins l52 and gp47 of phages P27 (12) and
Mu (10), respectively (87 and 44% overall similarity) .
Although the function of these proteins is unknown, the location of
their coding sequences within the tail operon of the respective
phages, in the vicinity of a putative baseplate assembly gene,
suggests their possible involvement in tail assembly . The apparent
lack of visible tails in the ST64B phage preparation of Mmolawa et
al . (9) is generally consistent with this idea . Also
consistent with this idea is the recent finding that cultures from
strain SL1344 dam methylase mutants accumulate ST64B capsid
protein in their supernatants, but no infectious virions are produced
(J . Casadesus and F . Garcia del Portillo, personal communication) .
Apparently, the defective ST64B prophage in strain SL1344 is
induced in the dam mutant background, confirming that the SB21*
alteration does not hamper the induction process . The data presented
here strongly suggest that the +1 frameshift mutation in the
SB21* gene is the sole defect of the ST64B prophage in strains SL1344
and ATCC 14028s . Coculturing either of these strains with strains
that support ST64B phage growth rapidly selects for revertants of the
mutation . Conceivably, this mechanism allows regeneration of the
virus in an environment where mixed strain conditions may not be
uncommon . In contrast, since the +1 frameshift in the SB21* gene does
not relieve the genomic burden associated with prophage presence, or
the capacity to undergo spontaneous induction (lethal to the host),
the forces that selected for the mutation in strains SL1344 and ATCC
14028s, or in a common ancestor, remain elusive .
Nucleotide sequence accession numbers. The nucleotide sequences
for the portions of the SB21 gene analyzed in this study have
been deposited in GenBank under accession numbers
AY552603,
AY552604,
AY552605,
AY574196, and
AY574197 .
We thank F . Garcia del Portillo, J . Casadesus, and F . Heffron for
sharing unpublished data . We are grateful to Maud Silvain for DNA
sequence analysis . We thank Wolfgang Rabsch for the generously
providing strains RKI4898/03 and RKI6256/03 and Sergio Uzzau for
providing strain SSM859 .
This work was supported by the Centre National de la Recherche
Scientifique, France .
* Corresponding author . Mailing address: Centre de Génétique
Moléculaire, CNRS, 91198 Gif-sur-Yvette cedex, France . Phone: 33 1 69 82 38 11 .
Fax: 33 1 69 82 38 77 . E-mail:
figueroa@cgm.cnrs-gif.fr .
- Bossi, L., J . A . Fuentes, G . Mora, and N . Figueroa-Bossi.
2003 . Prophage contribution to bacterial population dynamics . J . Bacteriol .
185:6467-6471 .
- Datsenko, K . A., and B . L . Wanner. 2000 . One-step
inactivation of chromosomal genes in Escherichia coli K12 using PCR
products . Proc . Natl . Acad . Sci . USA 97:6640-6645 .
- Fields, P . I., R . V . Swanson, C . G . Haidaris, and F . Heffron.
1986 . Mutants of Salmonella typhimurium that cannot survive within the
macrophage are avirulent . Proc . Natl . Acad . Sci . USA 83:5189-5193.
- Figueroa-Bossi, N., and L . Bossi. 1999 . Inducible
prophages contribute to Salmonella virulence in mice . Mol . Microbiol.
33:167-176.
- Figueroa-Bossi, N., S . Uzzau, D . Maloriol, and L . Bossi.
2001 . Variable assortment of prophages provides a transferable repertoire of
pathogenic determinants in Salmonella . Mol . Microbiol . 39:260-272.
- Hardt, W . D., H . Urlaub, and J . E . Galán. 1998 . A
substrate of the centisome 63 type III protein secretion system of
Salmonella typhimurium is encoded by a cryptic bacteriophage . Proc . Natl .
Acad . Sci . USA 95:2574-2579 .
- Hoiseth, S . K., and B . A . D . Stocker. 1981 .
Aromatic-dependent Salmonella typhimurium are non-virulent and
effective as live vaccines . Nature 291:238-239.
- McClelland, M., K . E . Sanderson, J . Spieth, S . W . Clifton, P .
Latreille, L . Courtney, S . Porwollik, J . Ali, M . Dante, F . Du, S . Hou, D .
Layman, S . Leonard, C . Nguyen, K . Scott, A . Holmes, N . Grewal, E . Mulvaney, E .
Ryan, H . Sun, L . Florea, W . Miller, T . Stoneking, M . Nhan, R . Waterston, and
R . K . Wilson. 2001 . Complete genome sequence of Salmonella enterica
serovar Typhimurium LT2 . Nature 413:852-856.
- Mmolawa, P . T., H . Schmieger, and M . W . Heuzenroeder.
2003 . Bacteriophage ST64B, a genetic mosaic of genes from diverse sources
isolated from Salmonella enterica serovar Typhimurium DT 64 . J .
Bacteriol . 185:6481-6485 .
- Morgan, G . J., G . F . Hatfull, S . Casjens, and R . W . Hendrix .
2002. Bacteriophage Mu genome sequence: analysis and comparison with
Mu-like prophages in Haemophilus, Neisseria and Deinococcus .
J . Mol . Biol . 317:337-359.
- Pelludat, C., S . Mirold, and W . D . Hardt. 2003 . The SopE
phage integrates into the ssrA gene of Salmonella enterica
serovar Typhimurium A36 and is closely related to the Fels-2 prophage . J .
Bacteriol . 185:5182-5191 .
- Recktenwald, J., and H . Schmidt. 2002 . The nucleotide
sequence of Shiga toxin (Stx) 2e-encoding phage
P27
is not related to other Stx phage genomes, but the modular genetic structure
is conserved . Infect . Immun . 70:1896-1908 .
- Roth, J . R. 1974 . Frameshift mutations . Annu . Rev .
Genet . 8:319-346.
Free Online Full-text Article
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
|