|








| |
Journal of Bacteriology, June 2003, p . 3416-3428, Vol . 185,
No . 11
Type
IV-Like Pili Formed by the Type II Secreton: Specificity, Composition, Bundling,
Polar Localization, and Surface Presentation of Peptides
Guillaume Vignon,1 Rolf Köhler,1 Eric Larquet,2,
Stéphanie Giroux,3 Marie-Christine Prévost,3 Pascal Roux,4
and Anthony P . Pugsley1*
Unité de Génétique Moléculaire (CNRS URA 2172),1 Groupe de
Microscopie Structurale Moléculaire (CNRS URA 2185),2 Plateau
Technique de Microscopie Electronique,3 Centre d'Imagerie Dynamique,
Institut Pasteur, Paris, France4
Received 14 January 2003/ Accepted 19 March 2003
The secreton or type II secretion machinery of gram-negative bacteria
includes several type IV pilin-like proteins (the pseudopilins) that
are absolutely required for secretion . We previously reported the
presence of a bundled pilus composed of the pseudopilin PulG on the
surface of agar-grown Escherichia coli K-12 cells
expressing the Klebsiella oxytoca pullulanase (Pul) secreton
genes at high levels (N . Sauvonnet, G . Vignon, A . P . Pugsley,
and P . Gounon, EMBO J . 19:2221-2228, 2000) . We show here that PulG is
the only pseudopilin in purified pili and that the phenomenon is not
restricted to the Pul secreton reconstituted in E . coli
or to PulG . For example, high-level expression of the endogenous E.
coli gsp secreton genes caused production of bundled pili
composed of the pseudopilin GspG, and the Pul secreton was able
to form pili composed of PulG-like proteins from secreton systems of
other bacteria . PulG derivatives in which the C terminus was extended
by the addition of eight different peptides were also assembled into
pili and functioned in secretion . Three of the C-terminal peptides
were shown to be exposed along the entire length of the assembled
pili . Hence, the C terminus of PulG may represent a permissive site
for the insertion of immunogenic epitopes or other peptide sequences .
One of these PulG variants, with a six-histidine tag at its C
terminus, formed nonpolar, nonbundled pili, suggesting that bundle
formation and polar localization are not correlated with the ability
of PulG to function in secretion . We propose that the PulG pilus is
an artifactual manifestation of a periplasmic "pseudopilus" and
that cycles of pseudopilus extension and retraction within the
periplasm propel pullulanase through secretin channels in the outer
membrane . Abnormally long pili that extend beyond the outer membrane
are produced only when pilus length control and retraction are
deregulated by overproduction of the major pseudopilus subunit
(PulG) .
The secreton or type II secretion (T2S) system permits the energy-dependent
secretion of a limited number of specific proteins from the
periplasm in gram-negative bacteria (33) . Many of the 12 or
more secreton components share extensive sequence similarity
with components of the type IV piliation (T4P) system in gram-negative
bacteria (24, 33) . In the T2S
system, these "shared" components include the pilins themselves
(called pseudopilins in the secreton system) and prepilin peptidase,
the enzyme that removes a short N-terminal peptide and then
N-methylates type IV pilin precursors (25,
29, 35, 37) and type IV
pilin-like proteins . The N-terminal prepeptide and approximately
20-residue hydrophobic domains of the type IV pilins and pseudopilins
are highly conserved (24, 33) .
In the pullulanase (PulA)-specific secreton from Klebsiella
oxytoca, there are five type IV pseudopilins (PulG, PulH, Pull,
PulJ, and PulK) (31, 36,
40) .
In the absence of any direct evidence for the assembly of pseudopilins
into a pilus (34, 38), they were
proposed to form a small, intraperiplasmic structure (the
pseudopilus) that constitutes an essential element of the secreton .
However, we subsequently observed that agar-grown E . coli
K-12 carrying all of the 14 pul secreton genes on pBR322
(pCHAP231) produced long, bundled, predominantly polar pili that
reacted with antibodies against the major pseudopilin PulG (43) .
Thus, the relationship between the T2S and T4P systems extends beyond
their similar compositions . These long pili do not appear to
interfere with pullulanase secretion (43) .
In this report, we examine the production of PulG pili in greater
detail . In particular, we examine whether the phenomenon is
restricted to the Pul secreton and to PulG, the apparently polar
localization of the PulG pilus bundles, the composition of the pilus
filament, the insertion of foreign epitopes at a permissive site at
the C terminus of the pilin, and their exposure on the surface of the
assembled filament . We also examine how the PulG pilus spans the
outer membrane and the role of minor pseudopilins in its assembly .
Bacterial strains, plasmids, and growth conditions. The
bacterial strains used in this study were derivatives of
Escherichia coli K-12 strain MC4100 [F- araD139
(argF-lac)U169
psL150 relA1 flbB5301 deoC1 ptsF25] .
PAP7501 (MC4100 F'Tn10 lacIq1
malE44
malG510 fimAB::kan sacB) is a derivative of PAP7460
that lacks type I pili (43) . PAP7502, a derivative of
PAP7500 (36), is the same as PAP7501 except that
it carries the entire pul gene cluster integrated in the
chromosome, and PAP9001 is the same as PAP7501 except that it lacks
the F' that carries the lacIq1 repressor gene . The
Klebsiella strains used were K . planticola ATCC
15050 (20) and K . oxytoca UNF5023 (10) .
Plasmids carrying pulG homologues are listed in Table 1 .
The exeG, espG, and xpsG genes in these plasmids
were first amplified from plasmids supplied by S . Peter Howard,
Michael Bagdasarian, and Nien-Tai Hu, respectively, with
oligonucleotides that flank the genes and that introduce unique
restriction endonuclease cleavage sites at either end . These
fragments were then cloned into the appropriate vector (Table
1), and the production of the corresponding pilin
was examined with antibodies against PulG, GspG (Olivera Francetic),
or XpsG (Nien-Tai Hu) (cross-reactions were sufficiently strong to
permit the detection of all pseudopilins with these antisera) .
Several independent clones of each pseudopilin gene were tested .
pCHAP1380 was constructed by subcloning the xcpG (xcpT)
gene from pT7.T (Alain Filloux) as a 900-bp EcoRI-HindIII
fragment . (The gene homologous to pulG in the xcp gene
cluster of Pseudomonas aeruginosa is generally referred
to as xcpT [2] . We propose that the name be
changed to xcpG, in agreement with the standard nomenclature
of the T2S genes.)
| TABLE 1 . Plasmids used in this study
|
|
Bacteria were grown at 30°C in Luria-Bertani (LB) broth or on LB agar
(21) with appropriate antibiotics (ampicillin, 100
µg/ml; chloramphenicol, 25 µg/ml; kanamycin, 50 µg/ml) and, where
appropriate, 0.4% maltose to induce pul gene expression or 1
mM isopropyl-ß-D-thiogalactopyranoside (IPTG)
to induce genes expressed from lacZp .
Epitope insertions. We used a previously constructed mutant
form of pulG carried by pCHAP162D (35) in
which a DraI site was created at the end of pulG,
converting a lysine residue at position 139 to phenylalanine . We
designed linkers with flanking blunt (5') and EcoRI (3')-compatible
ends and coding for c-myc, Strep-tag, lymphocytic choriomeningitis
virus (LCMV) nucleoprotein, and FLAG epitopes and inserted them
into the DraI and EcoRI sites of this pulG gene (the EcoRI
site is downstream from pulG at the end of the 3'-truncated
pulH gene in pCHAP162D) . The genes were then subcloned into
pSU19 .
Site-directed substitution of M+5 in pulK. pulK
mutant plasmid pCHAP5236 was generated with a QuikChange
site-directed mutagenesis kit (Stratagene) . Oligonucleotides
5'ATCGCCCTGCTCGAGGTGCTGCTGATCCTC3' and 5'ATCAGCAGCACCTCGAGCAGGGCGATGCC3'
were used for PCR amplification steps with a pCHAP1271 (pulK+)
template . Selected clones were sequenced to confirm the presence
of the correct mutation .
Immunoblotting. Procedures for immunoblotting were
essentially as used previously (43) . Proteins were
separated by sodium dodecyl sulfate (SDS)-polyacrylamide gel
electrophoresis (PAGE) in gels containing 12 or 13% acrylamide,
electroblotted onto nitrocellulose membranes, and incubated first
with specific antiserum [polyclonal anti-PulG at 1/6,000, anti-GspG
at 1/1,000, anti-XpsG at 1/2,000, anti-XcpG(T) at 1/2,000 (Alain
Filloux), anti-PulA at 1/10,000, monoclonal anti-LCMV nucleoprotein
epitope at 1/1,000 (Claude Leclerc), anti-LamB at 1/5,000, monoclonal
anti-His6 (Clontech), monoclonal anti-c-myc (Invitrogen),
monoclonal anti-FLAG (Sigma), or polyclonal anti-Strep-tag
(IBA), as recommended by the manufacturers] and then with horseradish
peroxidase-coupled anti-rabbit or anti-mouse immunoglobulin G
(1/1,000; Amersham) . The membranes were developed by enhanced
chemiluminescence (Amersham) .
Pullulanase assays. Surface-exposed pullulanase on liquid-
or agar-grown cells resuspended in phosphate-buffered saline was
measured in cells permeabilized in 0.5% octylpolyoxyethylene
essentially as previously described (20) .
Secretion levels are expressed as the percentage of the enzyme
activity (permeabilized cells) that could be detected in whole cells .
Detection of pili. Bacteria were grown overnight on LB
maltose agar . Immunogold labeling and transmission electron
microscopy (TEM) were performed as described by Sauvonnet et al . (43),
with specific antibodies diluted to 1:100 and with 10-nm gold beads
on the secondary antibodies . Specimens were examined with a Philips
CM12 transmission electron microscope operated under standard
conditions in the 80- to 120-kV accelerating voltage range .
Purified pili were examined by TEM under low-dose conditions (10
electrons/Å2) at -700-nm defocus with a Philips CM12
transmission electron microscope operated at a 120-kV accelerating
voltage .
For scanning electron microscopy (SEM) analysis, bacteria applied
to poly-L-lysine-coated coverslips were immunogold
labeled with anti-PulG antibodies as described above and then fixed
in 2.5% (vol/vol) glutaraldehyde in 0.1 M cacodylate buffer (pH 7.2)
overnight at 4°C . Cells were washed three times for 5 min (each
time) in 0.2 M cacodylate buffer (pH 7.2), postfixed for 1 h in 1%
(wt/vol) osmium tetroxide in 0.2 M cacodylate buffer (pH 7.2), and
then rinsed with distilled water . Bacteria were dehydrated through a
graded series of 25, 50, 75, and 95% ethanol solutions for 10 min
(each time) and washed three times for 15 min (each time) in 100%
ethanol . Dehydrated cells were consecutively immersed in 25, 50, 75,
and 75% (vol/vol) hexamethyldisilazane in ethanol for 5 min (each
time), immersed twice in 100% hexamethyldisilazane for 5 min (each
time), and quickly air dried . Coverslips were sputter coated twice
with carbon, and samples were examined with a JEOL JSM 6700F scanning
electron microscope with scanning electron image (SEI) and
backscatter detectors .
Immunofluorescence labeling was performed as previously described
(12), with specific antibodies diluted to 1/100 and with
Alexa Fluor 488 goat anti-rabbit immunoglobulin G (Molecular Probes) .
Bacteria were stained with propidium iodide (Molecular Probes) .
Samples were examined with a Zeiss confocal laser scanning microscope .
Shearing. Bacteria were harvested from the plates and
resuspended in phosphate-buffered saline to an optical density at 600
nm of 1.0 and then centrifuged twice at 13,000
x g in a microcentrifuge for 5 min
(each time) to separate the bacteria (the pellet fraction) from the
pilus-enriched supernatant (sheared fraction) . Both fractions were
precipitated with 10% trichloroacetic acid and loaded onto SDS-12%
polyacrylamide gels for immunoblotting .
Purification and analysis of PulG filaments. Plasmid
pCHAP1362, encoding the PulG-His6 variant, was transformed
into E . coli strain PAP9001 carrying pCHAP1216, providing all
of the Pul components necessary for pilus growth and secretion
in trans . Cells were grown overnight at 30°C on heavily
inoculated LB-maltose agar supplemented with ampicillin and
chloramphenicol . The bacterial lawn was resuspended in 1x
phosphate-buffered saline with a glass spreader . Pili were sheared
off by vortexing and vigorous pipetting and then centrifuged (5 min,
20,000 x g) . Subsequently,
the supernatant (sheared) fraction was ultracentrifuged (1 h, 150,000
x g) to concentrate the pili and
remove soluble proteins . The resulting pellet was resuspended in 10
mM HEPES buffer, pH 7.5, and mixed with TALON cobalt affinity resin
(Clontech) in 50 mM sodium phosphate buffer, pH 7.2, containing 300
mM NaCl . The resin was washed several times with the same buffer,
and bound pili were eluted with 150 mM imidazole . The purified
pili were concentrated by a second ultracentrifugation step, and the
resulting pellet was suspended in small volumes of 10 mM HEPES
buffer, pH 7.5, and analyzed by TEM and SDS-PAGE .
A threshold level of PulG is required for PulG assembly into pili.
We reported previously that pseudopilin PulG assembled into bundled,
apparently polar pili on the surface of E . coli expressing
the pul secreton genes only when the bacteria were grown on
agar plates and when pulG expression was increased (36,
43) . Pili can be detected by SDS-PAGE and
immunoblotting of PulG in the supernatant after shearing of bacteria
harvested from plates and resuspended in liquid (43)
or by direct immunovisualization with secondary antibodies coupled to
gold beads (immunoelectron microscopy [immuno-TEM] [43])
or to a fluorescent dye (immunofluorescence microscopy; Fig.
1) . These methods were used to examine two
Klebsiella strains from which pul genes have been cloned,
encapsulated K . planticola ATCC 15050 (20)
and nonencapsulated K . oxytoca UNF5023 (10) .
PulG pili were not detected by shearing when these bacteria were
grown on agar containing maltose to induce expression of the pul
genes (Fig . 2) . These data confirm that expression
of the chromosomal pul locus is not sufficient to cause pilus
production . However, in both cases, introduction of pCHAP1205,
carrying the UNF5023 pulG gene, caused the appearance of PulG
in the sheared fraction (Fig . 2; note that specific release
of PulG was indicated by the absence of outer membrane protein
LamB from the sheared fractions) . Furthermore, the Klebsiella
strains overexpressing pulG possessed pili (Fig . 2)
that were indistinguishable from those observed in recombinant E.
coli (Fig . 1) . Thus, abnormally high-level
pulG expression is required for PulG pilus formation in
Klebsiella and the presence of the capsule does not interfere
with pilus production .
|
FIG . 1 . Immunofluorescence microscopy of E . coli K-12
(control) and derivatives carrying pCHAP231 {all pul genes
[PulG], pCHAP1216 [pCHAP231
pulG]
and pCHAP4010 [gspG+] [GspG] or pCHAP1216 and
pCHAP1380 [xcpG(T)+] [XcpT]} harvested from
L-agar plates containing maltose to induce expression of the pul
secreton genes carried by pCHAP231 . The primary antibodies used were
directed against the specific pseudopilins (anti-PulG was used for the
control cells shown) . Bacteria are stained red with propidium iodide
(Molecular Probes), and bundled pili appear green because of the binding
of primary antibodies, followed by Alexa Green 488-labeled secondary
antibodies . Note that pili attach more tightly than bacteria to the
poly-L-lysine-coated glass slides and that the
bacteria wash off during processing to leave unattached pili on the
slide.
|
|
|
FIG . 2 . Shearing (A) and immunofluorescence microscopy (B) of
Klebsiella strains ATCC 15050 and UNF5023 with or without additional
copies of the pulG gene on pCHAP1205 . The bacteria were grown on
LB agar containing maltose and IPTG (for strains with pCHAP1205) . In the
shearing analysis (A), sheared and cell-associated proteins were
separated by SDS-PAGE and immunodetected with antibodies against PulG
and the integral outer membrane protein LamB . E . coli K-12
strains carrying pCHAP231 and pCHAP1216 (pCHAP231
pulG)
were included as positive and negative controls, respectively . Details
of the immunofluorescence study were as for Fig . 1.
|
|
Semiquantitative immunoblot analyses were used to estimate the amount
of PulG present in or associated with bacteria expressing pulG
at different levels (under lacZp control in plasmids with
different copy numbers and with or without induction by IPTG or in
the absence of the lacIq1 repressor) . We estimate that
the amount of PulG needed for pili to be detected by shearing,
both in Klebsiella and in E . coli carrying the cloned
pul genes, is three to five times that found in maltose-induced
strains with chromosomal copies of the pul gene cluster .
PulG is not the only major pseudopilin that can assemble into surface
pili. To determine whether pseudopilin assembly is unique to the Pul
secreton, we examined the endogenous E . coli K-12
chitinase-specific (Gsp) secreton (14) . The entire
gsp gene cluster was carried by medium-copy-number pCHAP4278
in E . coli K-12 MC4100 with an hns mutation that
causes derepression (14), and gspG expression
was further increased by additional copies of the gene on pCHAP4010 .
Surface pili that could be sheared from the cells (data not
shown) and that reacted with antiserum raised against the major Gsp
pseudopilin, GspG, were detected when these bacteria were grown on
agar (Fig . 3) . Both plasmids were required for the
detection of pili .
|
FIG . 3 . Immunofluorescence microscopy of E . coli K-12
strain MC4100 hns carrying pCHAP4278 (gspAB gspC-O+)
and pCHAP4010 (gspG) of the same strain without plasmids . The
primary antibodies were directed against GspG . Other details are as for
Fig . 1.
|
|
To extend these analyses, we expressed pulG homologues cloned
from the secreton gene clusters of several species of gram-negative
bacteria in E . coli carrying pCHAP1216 (pul+
pulG)
and examined the recombinant strains for the ability to secrete
pullulanase (complementation of
pulG)
and pilus assembly . The outG genes from Erwinia
chrysanthemi and E . carotovora were already known
to complement pulG (31) . This was found to be the case
also for the P . aeruginosa xcpG (xcpT)
gene, the E . coli K-12 gspG gene, the Vibrio
cholerae epsG gene, and the Aeromonas hydrophila
exeG gene (Table 2) . Furthermore, all six of
these pseudopilins were detected in the sheared fractions from
bacteria grown on agar surfaces (Table 2) . In
immunofluorescence and/or immuno-TEM studies, GspG (Fig.
1), XcpG (XcpT) (Fig . 1), ExeG, and E.
carotovora OutG (OutGEca; Fig . 4)
were all detected in bundled, polar structures similar to those
formed by PulG . However, production of E . chrysanthemi
OutG (OutGEch) resulted in diffuse surface fluorescent labeling .
Examination by immuno-TEM revealed that OutGEch (Fig.
4) and EpsG formed diffuse, nonbundled pili .
TABLE 2 . Complementation of
pulG
and assembly of pili by homologues of pulG cloned and expressed
in E . coli
|
|
|
FIG . 4 . Immuno-TEM of E . coli K-12 carrying plasmids
pCHAP1216 (pul+
pulG)
and pCCP2229 (outGEch) or pCCP2245 (outGEca)
and grown on agar containing IPTG and maltose . Pili were labeled with
PulG antibodies, followed by secondary antibodies tagged with 10-nm gold
beads.
|
|
In contrast, the PulG homologue XpsG from Xanthomonas campestris
could not substitute for PulG in pullulanase secretion and did
not form pili in these assays (Table 2) . This was not due to
a failure of prepilin peptidase PulO to cleave preXpsG, which
would prevent XpsG assembly (43), because XpsG in a strain
with PulO migrated slightly faster than when produced without PulO,
as was observed with all of the other prepseudopilins tested
(data not shown) . Sequence alignments revealed that XpsG is less
closely related to PulG than are the other pseudopilins tested, in
the usually well-conserved hydrophobic N-terminal region and
especially in the downstream hydrophilic region (Table
2; Fig . 5) .
|
FIG . 5 . Phylogenetic analysis of representative proteins in the PulG
family with ClustalX . Proteins whose assembly into pili by the Pul
secreton is tested here are shown in bold characters . The other proteins
are EptG encoded by a plasmid found in E . coli strain O157
(44), XcpG(T) from Burkholderia cepacia,
HxcG(T) from P . aeruginosa (1), LspG
from Legionella pneumophila (42), and
GspG from Xylella fastidiosa . This figure was prepared by
Dominique Vidal-Ingigliardi.
|
|
Minor pseudopilins are not detected in purified PulG pili. To
facilitate the purification of pili, we used a derivative of PulG
carrying six histidine residues at its C terminus (35) .
When producing bacteria were examined by immuno-TEM, this PulG
variant was detected as single filaments similar to those formed by
OutGEch (Fig . 4) and EpsG and radiating from the
entire cell surface (Fig . 6) . Pili purified by
cobalt affinity chromatography were found to contain three bands upon
analysis by SDS-PAGE (Fig . 7) . The two
faster-migrating bands both reacted with antiserum against PulG and
with His6 monoclonal antibodies (data not shown) .
N-terminal sequence analysis indicated that the faster-migrating band
was mature, N-methylated PulG (35), while the upper, less
intense band was cleaved but unmethylated PulG . Thus, a small
amount of unmethylated PulG can be incorporated into PulG filaments,
in line with the observation that unmethylated PilA pilin can be
incorporated into P . aeruginosa type IV pili (29) .
SDS-PAGE and Coomassie blue or silver staining failed to detect any
other proteins in the size range of the minor pseudopilins (14 to
35 kDa) in the purified pili, even with heavily loaded gels .
Furthermore, immunoblotting with antisera against PulK and PulI
failed to detect these minor pseudopilins in purified PulG-His6
pili . Therefore, PulG appears to be the only pseudopilin in the
PulG filament .
|
FIG . 6 . Immuno-TEM of E . coli K-12 carrying plasmids
pCHAP1216 (pul+
pulG)
and pCHAP4278 (pulG-His6) . Pili were labeled with PulG
antibodies, followed by secondary antibodies labeled with 10-nm gold
beads.
|
|
|
FIG . 7 . SDS-PAGE analysis of affinity-purified PulG-His6
pili . Proteins were stained with Coomassie brilliant blue.
|
|
The slow-migrating band in PulG-His6 pilus preparations comigrated
with and reacted with antiserum against pullulanase (PulA) .
PulA could not be separated from PulG by treatment with 500 mM NaCl,
followed by gel filtration on Superose 6 or cobalt affinity
chromatography (data not shown) . PulA did not bind to the cobalt
resin in the absence of PulG-His6, and both proteins
cosedimented upon immunoprecipitation with antisera against PulG
(data not shown) and, thus, are tightly bound . In an attempt to
determine whether PulA binds only to assembled PulG filaments, we
added 0.6% octyltetraoxyethylene detergent, which dissociated the
filaments, and performed a second cycle of affinity chromatography .
PulG bound less well to the cobalt resin in the presence of
detergent, but PulA did not bind at all, indicating that PulA adheres
only to assembled PulG filaments . This observation suggests that PulG
may contribute to pullulanase recognition at some stage in the
secretion process . However, pilus-bound PulA represents only a small
proportion of the total amount of protein present in the purified
pili (Fig . 6) and of the total pool of PulA present
on the cell surface . Immunogold staining of bacteria with PulG-His6-containing
pili failed to demonstrate any PulA associated with the pilus,
although PulA covered the cell surface, as reported previously for
liquid-grown bacteria (10) (data not shown) .
Therefore, PulA may associate with PulG pili when the two are
released from the surface by shearing (pullulanase is normally
anchored to the cell surface but is released by shearing [8]) .
Purified PulG-His6 pilus filaments were negatively stained with
2% uranyl acetate and examined by TEM . The filaments were estimated
to be 6 to 7 nm in diameter (Fig . 8, left panel) . Minor
kinks or blebs occasionally observed along the filaments may
correspond to bound PulA (Fig . 8, right panel) .
|
FIG . 8 . TEM of purified PulG-His6 pili after negative
staining with 2% uranyl acetate . A sample of tobacco mosaic virus (18-nm
diameter) was included in the sample in the left panel as a size marker.
|
|
Role of minor pseudopilins in PulA secretion and PulG assembly.
Mutations that incapacitate the minor pseudopilin genes pulI,
pulJ, and pulK in derivatives of pCHAP231 all block secretion,
whereas inactivation of pulH has no effect (31) .
The latter result was surprising because the pulH-like outH
gene of E . chrysanthemi is required for secretion under
some circumstances (17) . To test whether pulH
is required for pullulanase secretion at low copy numbers, we
introduced the appropriate plasmid (pCHAP1324; pCHAP231
pulH)
into MC4100 carrying a pcnB::Tn10 mutation that
reduces the plasmid copy number (18) . In this context, the
pulH
mutation reduced pullulanase secretion to <20% (compared to
100% with pCHAP231) . Secretion was restored to 100% by a plasmid,
pCHAP1331, with pulH cloned under lacZp control and a
p15-derived replication origin that is not affected by pcnB .
Thus, pulH is required for secretion at low pul secreton gene
copy numbers . Individually, none of the other pseudopilin genes
(pulG, pulI, pulJ, or pulK) could compensate for the
absence of pulH at low copy numbers .
In contrast to pulI, pulH, pulJ, and pulK are not
required for the formation of the PulG pilus in pcnB+
strains carrying derivatives of pCHAP231 (43) and
apparently are not part of it (see above) . pulI is required
for efficient piliation (43) but, again, does not
appear to be part of the PulG pilus (see above) . To determine whether
the abundance of any of the minor pilins could diminish PulG pilus
production, their expression was increased by introducing plasmids
bearing their respective genes under lacZp control (Table
1) into a strain already bearing pCHAP231 . In all cases,
the pseudopilin gene was expressed under lacZp control and,
in the cases of pulH, pulI, pulJ, and pulK,
approximately 50 bp of the upstream gene was fused in frame to the
ATG of the lacZ gene in the vector to avoid problems of
translation polarity and to ensure maximum expression (31) .
PulG was inefficiently released by shearing when PulK, the largest of
the pseudopilins (40), was overproduced (Fig.
9A and C) . Furthermore, low levels of LamB were
released from these bacteria by shearing, implying that the low
levels of PulG were probably released by membrane disruption rather
than by shearing of pili (Fig . 9A) . Indeed,
immuno-TEM analysis confirmed the absence of PulG pili on the
bacteria overproducing PulK (Fig . 9B) . Thus, overproduction
of the minor pseudopilin PulK abolished piliation although secretion
was not affected, suggesting that PulK may be involved in pilus
length control . Increased pulH, pulI, and pulJ expression
did not affect the yield of PulG released by shearing (Fig.
9B), which may indicate that these genes are not
involved in pilus length control, although the increase in expression
might have been insufficient to have an observable effect . As
expected, higher-level expression of pulG (pCHAP1205)
increased the amount of PulG released by shearing (Fig .
9A) .
|
FIG . 9 . Effects of increased levels of pseudopilins on the ability of
E . coli K-12 to assemble PulG pili . Strain PAP7501 carrying
pCHAP231 and additional plasmids bearing pseudopilin genes under lacZp
control were grown on LB agar containing maltose and IPTG . Harvested
cells were subjected to shearing analysis (A) or examined by immuno-TEM
with primary antibodies against PulG and secondary antibodies with 10-nm
gold beads (B) . Proteins blotted onto nitrocellulose membranes (A) were
probed with antibodies against PulG and LamB . The band migrating
slightly above PulG does not react with PulG antibodies . Control cells
for the shearing experiment carried pCHAP1216, the
pulG
derivative of pCHAP231 (lane 2;
G) .
In these samples, the band migrating faster than PulG is the truncated
PulG protein that is not assembled into pili . The plasmids bearing the
minor pilin genes were pCHAP1205 (pulG), pCHAP1331 (pulH),
pCHAP1351 (pulI), pCHAP1328 (pulJ), and pCHAP1271 (pulK) .
K* (lane 8) indicates that the cells carry pCHAP5236, which is the same
as pCHAP1271 except that the pulK gene has a mutation converting
the methionine at position +5 to glutamate . In the samples from the
strain overproducing PulG (lane 3), the band migrating more slowly that
PulG is the PulG dimer that is not dissociated in SDS . Panel C shows
overproduction of PulK arising from the presence of the pulK gene
on pCHAP1271 (lanes 4 and 5) . Lane 1 shows the level of PulK in cells
with pCHAP231 . Lanes 2 and 3 are controls lacking the entire pul
gene cluster or with the pCHAP231 derivative pCHAP1325 (pulK::kan-2),
respectively . The immunoblot of total cell extracts of maltose-grown
PAP7501 strains bearing the indicated plasmids was probed with
antibodies against PulK that react with an unrelated protein migrating
at the position of PulK in strains lacking this protein.
|
|
Certain mutations in pulG have differential effects on secretion
and piliation. We previously reported a series of insertion,
substitution, and deletion mutations in pulG, some of which
abolished the ability of the encoded protein to function in
pullulanase secretion (35) . We screened many of
these mutations for their effects on pilus assembly, as determined by
the shearing assay, and tested their abilities to complement a
pulG
mutation when the bacteria are grown on agar (Table 3) .
In general, the data from the secretion assay were the same as those
reported previously except that the blocked secretion due to the Q-2R
substitution (35) could not be reproduced (Table
3) and the I+5T, M+6L double substitution abolished
secretion, contrary to what was observed previously (35) .
In most cases, mutations that prevented secretion also blocked
piliation whereas mutations that had no effect on secretion did not
affect piliation (Table 3) . However, two notable
exceptions were the mutations replacing the E+5 residue, which
abolished secretion (Table 3) (35) but did
not prevent pilus formation (Table 3) . In the P.
aeruginosa type IV pilin PilA, E+5 is required for methylation
and pilin assembly (27, 50)
although methylation is not required for pilus assembly (28,
29) . Thus, PulG differs from PilA in that E+5 is not required
for its assembly into a pilus . This observation is intriguing
because it confirms that the ability of PulG to promote secretion can
be uncoupled from its ability to assemble into pili . The interesting
observation that the insertion of various peptides at the C terminus
of PulG affects neither secretion nor piliation (Table
3) will be pursued in greater detail below .
| TABLE 3 . Effects of mutations in pulG on its ability to promote
secretion and assemble into pilia
|
|
PulK is unusual among pseudopilins in that it lacks the canonical
glutamate at position +5 . To test whether the absence of E+5 from
PulK is important for its function, methionine +5 of PulK carried by
pCHAP1271 was replaced with a glutamate . This substitution had no
effect on the ability of the plasmid to complement the pulK
mutation carried by pCHAP1325 in either pullulanase secretion or PulG
pilus assembly (data not shown) . Thus, the universal absence of E+5
from PulK and its homologues does not affect its processing by
prepilin peptidase (4, 36) and is not
necessary for its function . Overproduction of this PulK variant
inhibited piliation (but not secretion) in the same way as wild-type
PulK (Fig . 9) .
The C terminus of PulG is a permissive insertion site. We
have already noted that addition of His6 to the C terminus
of PulG did not affect its ability to promote pullulanase secretion
or its assembly into pili (Table 3), although the resulting
pili were unable to form bundles and were not polar (Fig . 6
and 7) . Insertion of the sequences FVLVV and FATKD at
the C terminus of PulG also did not affect secretion or piliation
(Table 3), but the pili were bundled . However, the
sequence FVMVMVM at the C terminus (pCHAP162DC5) destabilized PulG,
caused the bacteria to grow slowly (35), and did
not permit piliation (Table 3), although low-level
pullulanase secretion was observed (35) . The
sequence inserted into this variant of PulG is very hydrophobic and
may not be released efficiently from the plasma membrane during PulG
export by the Sec machinery .
The fact that PulG-His6 filaments bind avidly to cobalt-coated
beads suggests that the His6 tag is exposed along the surface
of the entire filament . Unfortunately, we could not test this
possibility directly because the His6 monoclonal antibodies
failed to react with these filaments in immuno-TEM experiments .
Since the sequences FVLVV and FATKD were equally well tolerated at
the C terminus of PulG, we extended our studies to PulG derivatives
bearing the following sequences: peptide 1, GSAWSHPQFEK (Strep-tag)
(45), recognized by a commercial polyclonal antibody
and capable of binding to streptactin-coated beads (IBA GmbH);
peptide 2, EQKLISEEDL, the c-myc epitope (13)
recognized by a commercial monoclonal antibody (Invitrogen); peptide
3, YPYDVPDYA, the FLAG epitope (6) recognized by a
commercial monoclonal antibody (Sigma); peptide 4, RPQASGVYM, an LCMV
nucleoprotein epitope (47); peptide 5,
RPQASGVYMGNLTAG, a longer version of peptide 4 .
In all five cases, PulG carrying the peptide was assembled into
bundled pili and promoted pullulanase secretion . Thus, only the
histidine tag abolished the formation of pilus bundles .
Immunoblotting with PulG antibodies revealed that all five PulG
derivatives were slightly larger than wild-type PulG, as expected
(data not shown) . However, only PulG bearing peptide 1, 2, or 3
reacted with the peptide-specific antibodies in immunoblotting
experiments . Furthermore, all three peptides were detected along the
entire length of the bundled pilus by immuno-TEM with the appropriate
peptide-specific antibodies (see the example in Fig .
10) . The failure of the antibodies directed against the LCMV
peptide to react with PulG bearing peptides 4 and 5 is unexplained .
|
FIG . 10 . Immuno-TEM of E . coli producing PulG pili without
(left) or with (right) a c-myc tag at the C terminus of the pseudopilin
PulG . The primary antibodies used were specific for the c-myc epitope,
which is present in PulG encoded by pCHAP5246 but absent from PulG
encoded by pCHAP1362 (and therefore was not labeled; arrows).
|
|
We previously reported data suggesting that PulG with ß-lactamase
(BlaM) fused to its C terminus functions in secretion (34) .
However, although PulG-BlaM was detected in bacteria carrying
pCHAP1216 (pCHAP231
pulG)
and expressing the pulG-blaM gene fusion from a
compatible plasmid, pili were not detected, indicating that PulG-BlaM
cannot be assembled .
Secretin PulD is not absolutely essential for PulG pilus assembly.
The secretin PulD, which is absolutely required for pullulanase
secretion (9), forms ring-like structures (22)
similar to those formed by secretin PilQ, which is required for pilus
biogenesis (3, 7), leading to the
idea that both pullulanase and PulG pili may traverse the outer
membrane via the PulD channel (43) . In
Neisseria gonorrhoeae strains in which pilus retraction is abolished
by a pilT mutation, the absence of PilQ does not abolish PilE
pilin assembly but does prevent the extrusion of pili through
the outer membrane, causing membrane blebbing and the appearance of
abnormal, deformed pili on the bacterial surface (55) .
Overexpression of pulG results in a phenomenon (uncontrolled
pilus elongation) similar to that caused by a mutation in pilT .
Immuno-SEM of E . coli carrying pCHAP231 revealed the
presence of bundled pili that were strongly labeled by PulG
antibodies (Fig . 11B) that were not present when
pulG was deleted (Fig . 11A) . Deletion of
pulD (pCHAP1226) also completely abolished pilus formation, as
reported previously (38), but also increased membrane
blebbing (Fig . 11C) . When pulG expression
was further increased in these bacteria by introducing pCHAP1205 (pulG+),
exaggerated membrane blebbing was observed, together with stunted,
deformed pili that were poorly labeled by PulG antibodies (Fig.
11D) . Furthermore, immuno-TEM of these
pulD
strains after negative staining confirmed the surface deformation
seen by SEM (Fig . 11E) and revealed the presence
of numerous vesicle-like structures bearing misshapen pili that were
labeled, albeit inefficiently, by PulG antibodies when PulG was
produced in very large amounts (Fig . 11F) . The
poor labeling of pili in Fig . 11D and F may indicate that
PulG is covered by part of the outer membrane (55) .
Thus, as with PilE, a secretin is not absolutely essential for PulG
pilus assembly but the pili that are produced are deformed and,
apparently, are unable to traverse the outer membrane or do so by
causing severe membrane perturbation .
|
FIG . 11 . (A to D) Immuno-SEM of E . coli strain PAP9001
immunogold labeled with anti-PulG antibodies . Except for the main image
in panel C (see details), all SEM pictures were taken with SEI and
backscatter detectors . (A) Bacteria expressing all of the pul
genes except pulG (PAP9001/pCHAP1216) . Pili are not detected, and
only background labeling is observed . (B) Bacteria expressing all of the
pul genes, including pulG (pCHAP231) . Specific labeling is
observed on pili that interconnect the bacteria . (C) Bacteria expressing
all of the pul genes except pulD (encoding the secretin;
pCHAP1226) . The main image was obtained with an SEI detector alone for
clearer resolution of the bacterial cell surface . The image of the same
bacterium in the top inset was taken with backscatter detectors . (D)
Bacteria expressing all of the pul genes except pulD
(pCHAP1226) and overexpressing pulG (pCHAP1205) . Note the
reappearance of surface pili because of higher-level pulG
expression, despite the absence of secretin (compare panels C and D) . (E
and F) Immuno-TEM of bacteria similar to those in panels C and D.
|
|
Pseudopili or real pili? The data presented here confirm and
extend our previous observation that PulG can be assembled into pili
provided that pulG expression is increased compared to the
level maximally achieved by maltose-induced induction of the
chromosomal pulC-O operon, of which it is part . We
believe that PulG pili are aberrant manifestations of another
structure, probably the elusive "pseudopilus" (34,
38), that has more physiological relevance . One
idea that we find particularly attractive is that the pseudopilus
acts as a piston that pushes secreted proteins into the large
compartment in the lumen of the secretin channel (22,
23), allowing release of the proteins into the
medium and subsequent pilus retraction . This "piston" model of T2S,
first proposed by Hobbs and Mattick (16), is based
on the well-documented phenomenon of type IV pilus elongation and
retraction that produces twitching motility and related patterns of
bacterial movement across solid surfaces (19,
49) . Although the mechanisms involved remain unclear, it seems to
be accepted that pilus elongation is promoted by an ATPase (PilB
in P . aeruginosa, PilF in Neisseria) and that pilus
retraction results from disassembly promoted by another, related
ATPase (PilT in both bacteria) that operates in reverse (53,
54) . The factors controlling pilus length and the
switch from elongation to retraction are unknown .
The piston model is supported by the observation that the absence
of secretin PulD, the portal via which pullulanase is proposed to
cross the outer membrane, blocks both pullulanase secretion and the
appearance of long PulG pili on the cell surface without preventing
PulG assembly into filaments (Fig . 11D) . However,
unlike the T4P system, the secreton has only one ATPase (PulE in the
Pul secreton), which is related both to PilB/F and to PilT . How,
then, could retraction occur? We propose that elongation and
retraction of PulG pseudopili are both stimulated by PulE or that the
electrochemical potential across the plasma membrane that is required
for secretion (30) is directly or indirectly
responsible for PulG pilus disassembly . We further propose that
elongation may be arrested and disassembly (retraction) may be
triggered by incorporation into the base of the filament of a minor
pseudopilin, possible PulK (Fig . 9), or by the release
of pullulanase into the lumen of the PulD secretin channel . In
this scenario, pilus growth beyond the outer membrane would result
from the increased levels of PulG, which titrate the hypothetical
"stop-assembly" signal (PulK?) or stimulate rapid and uncontrolled
assembly of PulG pili . In this context, the observation that a small
amount of pullulanase copurifies with PulG pili is particularly
interesting since it is the only interaction between pullulanase and
a secreton component that we have been able to detect so far . This
may suggest that the two proteins interact as part of the secretion
cascade .
Although we find this model attractive, it is not fully supported
by all of the observations reported here and elsewhere . For example,
the fact that very high-level expression of pulG in a strain
lacking the secretin PulD causes membrane deformation and production
of aberrant pili (Fig . 11D) similar to those
observed in an N . gonorrhoeae pilT pilQ mutant (55)
suggests that PulG pili span the outer membrane via the lumen of the
PulD secretin channel . Thus, these pili would be expected to
prevent secretion by blocking the channel, but this does not appear
to be the case (43) . This enigma was discussed previously
(43), when we proposed the possible coexistence of open
(functional) channels and channels plugged by PulG pili in the same
cell . Another possibility is that the surface-associated pullulanase
that we detected in agar-grown, PulG pilus-producing bacteria
was secreted before the secretin channels were plugged by PulG .
Unfortunately, it is not possible to perform kinetic experiments on
pullulanase secretion with bacteria grown on agar .
The fact that several different PulG homologues from bacteria
whose secretons are not interchangeable can be assembled into pili by
the Pul secreton and can replace PulG in secretion indicates that
pseudopilins are not the main determinants of secretion specificity,
a role probably played by PulC and/or PulD (5,
17, 31, 48) . However,
the type IV pilin PpdD can be assembled but cannot substitute for
PulG in secretion (43) . Thus, a pilus-like
structure is not itself sufficient to act as a piston to permit
secretion . PpdD pilus growth may not be controlled by components of
the Pul secreton (e.g., PulK) so that it cannot form the short
pseudopili that stimulate secretion .
Bundling and polar localization of PulG pili. Two PulG
homologues (OutGEch and EpsG) and PulG-His6 all formed
nonbundled pili but still promoted pullulanase secretion, indicating
that functionality in pullulanase secretion does not correlate
with bundle formation . The mechanism of bundle formation by type IV
pili is not understood . PulG pilus bundles appear to be located at a
cell pole, raising the possibility that the entire secreton is
located at the pole and, hence, that secretion occurs here . Indeed,
recent studies indicate that components of the V . cholerae
Eps secreton are located at the cell pole, where secretion was
observed (46) . However, nonbundled PulG-His6
pili were evenly distributed over the cell, suggesting that the
ability of (pseudo)pili to form polar bundles is not correlated with
the ability of the protein to function in secretion . These data do
not necessarily cast doubt on the reported polar localization of the
secreton in V . cholerae, since our studies were carried
out in a heterologous system (K . pneumoniae pul secreton
genes expressed in E . coli) at higher levels of major
pseudopilin production and under growth conditions different from
those used in the study of the V . cholerae Eps
secreton . Furthermore, we suspect that the elongated pseudopili that
we observed upon increased pulG expression are redundant
structures that do not function in secretion; hence, their location
does not necessarily reflect the site at which secretion occurs .
The failure of PulG-His6 to form bundles is probably due to
the polyhistidine tag, since replacement of His6 with other
short peptides did not prevent bundling . Structural analyses of
purified PulG monomers and of PulG filaments, currently under way,
should reveal more information on the packing of the subunits in the
pili and on surface-exposed residues . The sequences of the OutGEch
and OutGEca proteins and of EpsG and ExeG are so closely
related (91% overall identity in both cases) that it may be possible
to identify bundle-inducing amino acids by site-directed mutagenesis .
All four proteins are sufficiently related to PulG that it may be
possible to predict their structures from that of PulG, providing
more information on the bundling phenomenon .
Polyvalent foreign epitope presentation by PulG pili. The
fortuitous finding that PulG can form pili even when its C terminus
is extended by at least 15 amino acids suggests that these pili may
be useful as carriers of polyvalent immunogenic peptides . One of the
potential advantages of such a system is that repeated exposure of
one or more epitopes along the length of the pilus should increase
immunogenicity . The possible use of pili for such purposes is not a
new idea (11, 39, 41,
51), but many previous studies failed because
insertions prevented polymerization of the pilus filament because of
the unpredictable structural constraints . It will be interesting to
determine the length and number of the foreign peptides that can be
tagged onto PulG, whether there are other permissive sites for
epitope insertion, and whether inserted peptides are immunogenic when
delivered either on whole bacteria or in purified pili . Bacteria
producing pili bearing appropriate peptides exposed along their
entire length may also bind avidly to specific ligands or receptors .
However, there are at least three potential drawbacks to the use
of PulG pili for these purposes: their fragility (they were not
designed to withstand shear forces), their failure to assemble in
liquid-grown cultures (43), and the unsuitability of E.
coli K-12 for use as a live vaccine strain . Some of these
problems can be easily overcome . For example, the entire pul
gene cluster can be expressed in strains of Salmonella
enterica serovar Typhimurium that are better suited for use as
live vaccines . Problems related to the extreme fragility and lack of
production of PulG pili in liquid cultures are more difficult to
resolve . Interestingly, we have repeatedly observed that E .
coli K-12 expressing maltose-induced pul secreton genes
carried by the pBR322 derivative pCHAP231 or K . oxytoca
UNF5023 expressing chromosomal pul genes and plasmid-encoded
pulG exhibit enhanced biofilm formation in a simple microtiter
dish assay (15, 32) (data not shown) . The
significance of this observation is difficult to ascertain, although
it presumably indicates that PulG pili are produced under these
circumstances . Although type IV pili have been shown to play a role
in biofilm formation (26, 52),
we note that PulG pili adhere very tightly to glass and plastic and
form dense networks that link bacteria together (Fig .
11B) . Therefore, the adherent bacterial masses that result may
not correspond to the organized structures that are generally
considered to be biofilms .
This work was supported, in part, by EC research contract HPRN-CT-2000-00075
and by grants to G.V . from the Fondation pour la Recherche Médicale
and the Caisse Nationale d'Assurance Maladie et Maternité des
Travailleurs Non Salariés des Professions Non Agricoles .
We are grateful to Michael Bagdasarian, Alan Collmer, Alain
Filloux, Olivera Francetic, Peter Howard, and Nien-Tai Hu for cloned
copies of pseudopilin genes and for antisera, to Olivera Francetic
for help with experiments on GspG, to Dominique Vidal-Ingigliardi for
computer analyses, to Christine Schmidt for help with the electron
microscopy, to Frank Ebel for help with fluorescence microscopy and
for help in preparing antisera against PulK and PulI, to Claude
Leclerc for helpful discussions concerning the potential use of PulG
in epitope delivery and for antibodies, to Jacques D'Alayer for
microsequencing, and to all of the members of the Unité de Génétique
Moléculaire for support .
* Corresponding author . Mailing address: Unité de Génétique
Moléculaire, Institut Pasteur, 25, rue du Dr . Roux, 75724 Paris Cedex 15,
France . Phone: 33/1-145688494 . Fax: 33/0-145688960 . E-mail: max@pasteur.fr .
Present address: Laboratoire de Minéralogie-Cristallographie Paris,
CNRS UMR 7590, Université Pierre et Marie Curie, 75252 Paris Cedex
05, France .
- Ball, G., E . Durand, A . Lazdunski, and A . Filloux. 2002 .
A novel type II secretion system in Pseudomonas aeruginosa . Mol .
Microbiol . 43:475-485.
- Bally, M., A . Filloux, M . Akrim, G . Ball, A . Lazdunski, and
J . Tommassen. 1992 . Protein secretion in Pseudomonas aeruginosa:
characterization of seven xcp genes and processing of secretory
apparatus components by prepilin peptidase . Mol . Microbiol . 6:1121-1131.
- Bitter, W., M . Koster, M . Latijnhouwers, H . de Cock, and J .
Tommassen. 1998 . Formation of oligomeric rings by XcpQ and PilQ, which are
involved in protein transport across the outer membrane of Pseudomonas
aeruginosa . Mol . Microbiol . 27:209-219.
- Bleves, S., A . Lazdunski, J . Tommassen, and A . Filloux.
1998 . The secretion apparatus of Pseudomonas aeruginosa: identification of a
fifth pseudopilin, XcpX . Mol . Microbiol . 27:31-40.
- Bouley, J., G . Condemine, and V . E . Shevchik. 2001 . The
PDZ domain of OutC and the N-terminal region of OutD determine the secretion
specificity of the type II out pathway of Erwinia chrysanthemi .
J . Mol . Biol . 27:205-219.
- Brizzard, B . L., R . G . Chubert, and D . L . Vizard. 1994 .
Immunoaffinity purification of FLAG epitope-tagged bacterial alkaline
phosphatase using a novel monoclonal antibody and a peptide elution .
BioTechniques 16:730-735.
- Collins, R . F., L . Davidsen, J . P . Derrick, R . C . Ford, and
T . Tonjum. 2001 . Analysis of the PilQ secretin from Neisseria
meningitidis by transmission electron microscopy reveals a dodecameric
quaternary structure . J . Bacteriol . 183:3825-3832 .
- d'Enfert, C., C . Chapon, and A . P . Pugsley. 1987 . Export
and secretion of the lipoprotein pullulanase by Klebsiella
pneumoniae . Mol . Microbiol . 1:107-116.
- d'Enfert, C., I . Reyss, C . Wandersman, and A . P . Pugsley.
1989 . Protein secretion by gram-negative bacteria: characterization of two
membrane proteins required for pullulanase secretion by Escherichia
coli K-12 . J . Biol . Chem . 264:17462-17468 .
- d'Enfert, C., A . Ryter, and A . P . Pugsley. 1987 . Cloning
and expression in Escherichia coli of the Klebsiella
pneumoniae genes for production, surface localization and secretion of the
lipoprotein pullulanase . EMBO J . 6:3531-3538.
- Der Vartarian, M., M . C . Mechin, B . Jaffeux, Y . Bertin, I .
Felix, and B . Gaillard-Martinie. 1994 . Permissible peptide insertions
surrounding the signal peptide-mature protein junction of the ClpG prepilin:
CS31A fimbriae of Escherichia coli as carriers of foreign
sequences . Gene 148:23-32.
- Ebel, F., T . Podzadel, M . Rohde, A . U . Kresse, S . Krämer, C .
Deibel, C . A . Guzman, and T . Chakraborty. 1998 . Initial binding of Shiga
toxin-producing Escherichia coli to host cells and subsequent
induction of actin rearrangements depend on filamentous EspA-containing
surface appendages . Mol . Microbiol . 30:147-161.
- Evans, G . I., G . K . Lewis, G . Ramsay, and J . M . Bishop.
1985 . Isolation of monoclonal antibodies specific for human c-myc
proto-oncogene product . Mol . Cell . Biol . 5:3610-3616.
- Francetic, O., D . Belin, C . Badaut, and A . P . Pugsley.
2000 . Expression of the endogenous type II secretion pathway in Escherichia
coli leads to chitinase secretion . EMBO J . 19:6697-6703 .
- Genevaux, P., S . Muller, and P . Bauda. 1996 . A rapid
screening procedure to identify mini-Tn10 insertion mutants of
Escherichia coli K-12 with altered adhesion properties . FEMS
Microbiol . Lett . 142:27-30.
- Hobbs, M., and J . S . Mattick. 1993 . Common components in
the assembly of type 4 fimbriae, DNA transfer systems, filamentous phage and
protein-secretion apparatus: a general system for the formation of
surface-associated protein complexes . Mol . Microbiol . 10:233-243.
- Lindeberg, M., G . P . C . Salmond, and A . Collmer. 1996 .
Complementation of deletion mutations in a cloned functional cluster of
Erwinia chrysanthemi out genes with Erwinia
carotovora out homologs reveals OutC and OutD as candidate
gatekeepers of species-specific secretion of proteins via the type II pathway .
Mol . Microbiol . 20:175-190.
- Lopilato, J., S . Bortner, and J . Beckwith. 1986 .
Mutations in a new chromosomal gene of Escherichia coli K-12,
pcnB, reduce plasmid copy number of pBR322 and its derivatives . Mol . Gen .
Genet . 205:285-290.
- Merz, A . J., M . So, and M . P . Sheetz. 2000 . Pilus
retraction powers bacterial twitching motility . Nature 407:98-101.
- Michaelis, S., C . Chapon, C . d'Enfert, A . P . Pugsley, and M .
Schwartz. 1985 . Characterization and expression of the structural gene for
pullulanase, a maltose-inducible secreted protein of Klebsiella
pneumoniae . J . Bacteriol . 164:633-638.
- Miller, J . H. 1972 . Experiments in molecular genetics .
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
- Nouwen, N., N . Ranson, H . Saibil, B . Wolpensinger, A . Engel,
A . Ghazi, and A . P . Pugsley. 1999 . Secretin PulD: association with pilot
protein PulS, structure and ion-conducting channel formation . Proc . Natl .
Acad . Sci . USA 96:8173-8177 .
- Nouwen, N., H . Stahlberg, A . P . Pugsley, and A . Engel.
2000 . Domain structure of secretin PulD revealed by limited proteolysis and
electron microscopy . EMBO J . 19:2229-2236 .
- Nunn, D. 1999 . Bacterial type II protein export and
pilus biogenesis: more than just homologies? Trends Cell Biol . 9:402-408.
- Nunn, D . N., and S . Lory. 1993 . Cleavage, methylation,
and localization of the Pseudomonas aeruginosa export proteins
XcpT, -U, -V, and -W . J . Bacteriol . 4375-4382.
- O'Toole, G . A., and R . Kolter. 1998 . Flagellar and
twitching motility are necessary for Pseudomonas aeruginosa
biofilm development . Mol . Microbiol . 30:295-304.
- Pasloske, B . L., and W . Paranchych. 1988 . The expression
of mutant pilins in Pseudomonas aeruginosa: fifth position
glutamate affects pilin methylation . Mol . Microbiol . 2:489-495.
- Pasloske, B . L., D . G . Scraba, and W . Paranchych. 1989 .
Assembly of mutant pilins in Pseudomonas aeruginosa: formation
of pili composed of heterologous subunits . J . Bacteriol . 171:2142-2147.
- Pepe, J . C., and S . Lory. 1998 . Amino acid substitutions
in PilD, a bifunctional enzyme of Pseudomonas aeruginosa: effect
on leader peptidase and N-methyltransferase activities in vitro
and in vivo . J . Biol . Chem . 273:19120-19129 .
- Possot, O., L . Letellier, and A . P . Pugsley. 1997 .
Energy requirement for pullulanase secretion by the main terminal branch of
the general secretory pathway . Mol . Microbiol . 24:457-464.
- Possot, O., G . Vignon, N . Bomchil, F . Ebel, and A . P .
Pugsley. 2000 . Multiple interactions between pullulanase secreton
components involved in stabilization and cytoplasmic membrane association of
PulE . J . Bacteriol . 182:2142-2152 .
- Pratt, L . A., and K . Kolter. 1998 . Genetic analysis of
Escherichia coli biofilm formation: roles of flagella motility,
chemotaxis and type I pili . Mol . Microbiol . 30:285-293.
- Pugsley, A . P. 1993 . The complete general secretory
pathway in gram-negative bacteria . Microbiol . Rev . 57:50-108.
- Pugsley, A . P. 1996 . Multimers of the precursor of a
type IV pilin-like component of the general secretory pathway are unrelated to
pili . Mol . Microbiol . 20:1235-1245.
- Pugsley, A . P. 1993 . Processing and methylation of PulG,
a pilin-like component of the general secretory pathway of Klebsiella
oxytoca . Mol . Microbiol . 9:295-308.
- Pugsley, A . P., N . Bayan, and N . Sauvonnet. 2001 .
Disulphide bond formation in secreton component PulK provides a possible
explanation for the role of DsbA in pullulanase secretion . J . Bacteriol .
183:1312-1319 .
- Pugsley, A . P., and B . Dupuy. 1992 . An enzyme with type
IV prepilin peptidase activity is required to process a component of the
general extracellular protein secretion pathway of Klebsiella
oxytoca . Mol . Microbiol . 6:751-760.
- Pugsley, A . P., and O . Possot. 1993 . The general
secretory pathway of Klebsiella oxytoca: no evidence for
relocalization or assembly of pilin-like PulG protein into a multiprotein
complex . Mol . Microbiol . 10:665-674.
- Rani, D., M . Bayer, and D . Schifferli. 1999 . Polymeric
display of immunogenic epitopes from herpes simplex virus and transmissible
gastroenteritis virus surface proteins on an enteroadherent fimbria . Clin .
Diagn . Lab . Immunol . 6:30-40 .
- Reyss, I., and A . P . Pugsley. 1990 . Five additional
genes in the pulC-O operon of the gram-negative bacterium
Klebsiella oxytoca UNF5023 that are required for pullulanase
secretion . Mol . Gen . Genet . 222:176-184.
- Rondot, S., K . G . Anthony, S . Dübel, N . Ida, S . Wiemann, K .
Beyreuther, L . S . Frost, M . Little, and F . Breitling. 1998 . Epitopes to
F-pilin are incorporated into functional recombinant pili . J . Mol . Biol .
279:589-603.
- Rossier, O., and N . P . Cianciotto. 2001 . Type II
secretion is a subset of the PilD-dependent processes that facilitate
intracellular infection by Legionella pneumophila . Infect .
Immun . 69:2092-2098 .
- Sauvonnet, N., G . Vignon, A . P . Pugsley, and P . Gounon.
2000 . Pilus formation and protein secretion by the same machinery in
Escherichia coli . EMBO J . 19:2221-2228 .
- Schmidt, H., B . Henkel, and H . Karch. 1997 . A gene
cluster related to type II secretion pathway operons of gram-negative bacteria
is located on the large plasmid of enterohemorrhagic Escherichia
coli O157 strains . FEMS Microbiol . Lett . 148:265-272.
- Schmidt, T . G., J . Koepke, R . Frank, and A . Skerra.
1996 . Molecular interactions between the Strep-tag affinity peptide and its
cognate target, streptavidin . J . Mol . Biol . 255:753-766.
- Scott, M., Z . Dossani, and M . Sandkvist. 2001 . Directed
polar secretion of protease from single cells of Vibrio cholerae
via the type II secretion pathway . Proc . Natl . Acad . Sci . USA 94:13978-13983.
- Sebo, P., C . Fayolle, O . d'Andria, D . Ladant, C . Leclerc,
and A . Ullmann. 1995 . Cell-invasive activity of epitope-tagged adenylate
cyclase of Bordetella pertussis allows in vitro presentation of
a foreign epitope to CD8+ cytotoxic T cells . Infect . Immun . 63:3851-3857.
- Shevchik, V . E., J . Robert-Badouy, and G . Condemine.
1997 . Specific interaction between OutD, an Erwinia chrysanthemi
outer membrane protein of the general secretory pathway, and secreted
proteins . EMBO J 16:3007-3016 .
- Skerker, J . M., and H . C . Berg. 2001 . Direct observation
of extension and retraction of type IV pili . Proc . Natl . Acad . Sci . USA 98:6901-6904 .
- Strom, M . S., and S . Lory. 1991 . Amino acid
substitutions in pilin of Pseudomonas aeruginosa: effect on
leader peptide cleavage, amino-terminal methylation, and pilus assembly . J .
Biol . Chem . 266:1656-1664 .
- Thiry, G., A . Clippe, T . Scarcez, and J . Petre. 1989 .
Cloning of DNA sequences encoding foreign peptides and their expression in the
K88 pili . Appl . Environ . Microbiol . 55:984-993.
- Watnick, P . I., and R . Kolter. 1999 . Steps in the
development of a Vibrio cholerae El Tor biofilm . Mol . Microbiol.
34:586-595.
- Whitchurch, C . B., M . Hobbs, S . P . Livingstone, V .
Krishnapillai, and J . S . Mattick. 1991 . Characterization of a
Pseudomonas aeruginosa twitching motility gene and evidence for a
specialized protein export system widespread in bacteria . Gene 101:33-44.
- Wolfgang, M., H.-S . Park, S . F . Hayes, J . P . M . van Putten,
and M . Koomey. 1998 . Suppression of an absolute defect in type IV pilus
biogenesis by loss-of-function mutations in pilT, a twitching motility
gene in Neisseria gonorrhoeae . Proc . Natl . Acad . Sci . USA 95:14973-14978 .
- Wolfgang, M., J . P . M . van Putten, S . F . Hayes, D . Dorward,
and M . Koomey. 2000 . Components and dynamics of fiber formation define a
ubiquitous biogenesis pathway for bacterial pili . EMBO J . 19:6408-6418 .
Free Online Full-text Article
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
|