|
|
|
Tsitologiia, 1985 Dec, 27(12), 1335 - 46 {Mitochondrial vectors in the gene engineering of cells of lower eukaryotes}; Kazakova TB; The possibility of using the eukaryotic mitochondrial DNA and mitochondrial plasmids as suitable shuttle vectors for pro- and eukaryotic systems is discussed . Data are presented on the expression of the animal mitochondrial DNA in bacterial and yeasts cells. J Leukoc Biol, 1985 Dec, 38(6), 709 - 21 Characterization of human pericardial macrophages; Benhaiem-Sigaux N et al.; This paper deals with the study of the cell population in 13 samples of normal human pericardial fluid . Large mononuclear cells (LMC) constituted 74.1 +/- 18.5% of the total cell population . These LMC possess the characteristics of macrophages firm adherence to glass intracytoplasmic presence of vimentin without keratin, ultrastructural observation of a lysosomal apparatus cytoenzymatic activities: acid phosphatases, naphthol AS.D acetate esterase and peroxidases, and phagocytosis of Baker's yeasts . All these data clearly show that macrophages are the main component of the pericardial fluid cell population and can be of great significance in the defense mechanisms and physiology of the pericardial space. Mycopathologia, 1985 Nov, 92(2), 101 - 9 Further studies on the phylogenesis of the genus Exophiala and Hortaea; Nishimura K et al.; The conidial ontogenesis of the pathogenic black yeasts is studied at an ultrastructural level and their phylogenesis is discussed . Five cultures of Exophiala dermatitidis, four of E . jeanselmei, one of E . moniliae, one of E . spinifera and six of H . werneckii were observed using a scanning electron microscope . The conidial ontogenesis of the Exophiala species is not pleomorphic but only annellidic . There are definite differences in morphology of annellated tips among the Exophiala species . The ontogenesis of Hortaea werneckii consists of a combination of sympodial and annellidic conidiogenesis . Its sympodial anamorph is unique and the annellidic anamorph is considered to be a homology of the sympodial one. Ann Allergy, 1985 Nov, 55(5), 740 - 6 Sequential sampling of fungal air spores inside and outside the homes of mould-sensitive, asthmatic patients: a search for a relationship to obstructive reactions; Beaumont F et al.; A sequential sampling study of fungal airspores was carried out with the Andersen sampler inside and outside the homes of eight asthmatic, mould-sensitive patients . The aim of the study was to find a possible relationship between variations in airborne colony forming units (CFU) and the occurrence of increased pulmonary complaints (IPC) . Great variations in fungal prevalence occurred throughout the year, the lowest average daily concentration being 125, and the highest, 1425 CFU/m3/sample during the whole survey . Penicillium dominated the catch in seven of the eight environments . Other frequently sampled moulds were Cladosporium, yeasts, Aspergillus, and Botrytis . Sixty-six percent of IPC were noted from July through November, during which time 56% of all fungal peaks occurred . A significant difference was found between peak flow (PF) values on days with the highest mould numbers compared with PF values on days with low counts . This relation was not found for PF and indoor mould counts . No particular fungal genus was responsible for IPC in general, but in a given patient the occurrence of a special mould type may be related to obstructive reactions . It is concluded that a possible relationship exists between the prevalence of airborne fungi and IPC . Definite proof of a direct bronchial obstructive effect, however, might only be provided by means of inhalation-provocation studies with the sampled fungi. J Immunol, 1985 Nov, 135(5), 3487 - 93 Immunoregulation in disseminated murine histoplasmosis: disturbances in the production of interleukins 1 and 2; Watson SR et al.; Production of IL 1 and IL 2 by splenocytes from C57BL/6 mice was measured at wk 1, 3, 8, and 14 after i.v . inoculation with 6 X 10(5) Histoplasma capsulatum (Hc) yeasts . As compared with age-matched controls, IL 1 production by splenocytes from Hc-infected mice was reduced severely at wk 1 and 3 of infection, greater than normal at wk 8, and within normal range at wk 14 . IL 2 production was also reduced at wk 1 and 3 of infection; it was normal at wk 8 and was elevated at wk 14 . Indomethacin and catalase failed to restore IL 1 production by splenocytes from infected mice, and exogenous IL 1 did not augment IL 2 production by these cells . A factor capable of suppressing the activity of IL 2 was detected in supernatants of concanavalin A-stimulated splenocytes from infected animals at wk 1 and 3 of infection, respectively . No factor capable of suppressing IL 1 activity was detected . Thus, the deficits of cell-mediated immunity in mice with systemic Hc infection may derive, in part, from impaired amplification of the immune response consequent to abnormal generation of IL 1 and IL 2. Antibiot Med Biotekhnol, 1985 Jul, 30(7), 521 - 5 {Effect of the agitation intensity and concentration of surface-active substances on the rate of oxygen sorption by a model sulfite-albumin medium}; Vorob'eva GS et al.; The physicochemical properties of a model medium consisting of two substances, sodium sulfite and albumin, were studied . It was shown that the presence of a SAS in the sulfite solution significantly lowered the rate of oxygen sorption by the model medium . The higher the SAS concentration, the lower the sorption rate . When yeasts were grown on sulfite liquor under conditions of the reduced medium the rate of their growth and respiration did not significantly depend on aeration within wide ranges of its variation . The experiments with the model medium demonstrated that the aeration independence was due to indifference to oxygen not of the cells but of the medium as the result of its physicochemical properties . The effect of sorption hysteresis was also studied on the model medium . It was revealed that the rate of oxygen desorption from the medium was lower than that of oxygen sorption by the same medium . The effect was not observed when a nonionic SAS was added to the medium and the isoelectric point was almost reached . The effect was connected with impairment of oxygen diffusion through the medium surface film . Interaction of the substances included in the model medium was of physical nature. J Biol Chem, 1985 Jun 10, 260(11), 7108 - 13 Dihydroxyacetone synthase is an abundant constituent of the methanol-induced peroxisome of Candida boidinii; Goodman JM; Methylotrophic yeasts induce large peroxisomes when grown on methanol . The recent ability to stabilize and isolate these peroxisomes at pH 5.5 has led to the demonstration that two polypeptides comprise the bulk of the peroxisome of Candida boidinii, alcohol oxidase, and a 79-kDa species, determined by sodium dodecyl sulfate-polyacrylamide electrophoresis (Goodman, J.M., Scott, C.W., Donahue, P.N., and Atherton, J.P . (1984) J . Biol . Chem . 259, 8485-8493) . The 79-kDa peroxisomal protein is now identified as dihydroxyacetone synthase, the first enzyme in the assimilatory pathway of formaldehyde utilization . This identification is based on several criteria: The enzyme activity is mainly in a particulate fraction at pH 5.5 but not at pH 8.0 . It copurifies with alcohol oxidase and catalase on sucrose gradients . The 79-kDa protein behaves as a 135,000-kDa dimer on gel filtration, similar to the published behavior of the enzyme . The specific activity of dihydroxyacetone synthase in the pure 79-kDa preparation (3.20 units/mg of protein) is close to that reported for the purified enzyme (3.88 units/mg of protein) . Antibodies against dihydroxyacetone synthase were used to show that its synthesis, induction, and assembly are similar to that of alcohol oxidase . Neither contains a detectable cleaved leader sequence and both are assembled post-translationally . The localization of dihydroxyacetone synthase to the peroxisome may influence the regulation of the two pathways of formaldehyde utilization and may protect the cell from damage by formaldehyde. J Biol Chem, 1985 Jun 10, 260(11), 6862 - 70 Binding of glycolytic enzymes to cardiac sarcolemmal and sarcoplasmic reticular membranes; Pierce GN et al.; Glyceraldehyde-phosphate dehydrogenase and phosphoglycerate kinase activities were associated with a particulate fraction in a cardiac homogenate preparation . NaCl treatment displaced these activities from the particulate fraction . These membrane-associated glycolytic enzymes were gradually lost during the rigorous isolation procedures needed to purify sarcolemmal and sarcoplasmic reticular vesicles . However, exogenously added enzymes did bind to these purified membranes in relatively large quantities (glyceraldehyde-phosphate dehydrogenase: 1.14 mg of enzyme/mg of sarcolemma, 0.30 mg of enzyme/mg of sarcoplasmic reticulum; phosphoglycerate kinase: 1.02 mg of enzyme/mg of sarcolemma, 0.12 mg of enzyme/mg of sarcoplasmic reticulum), which suggests a nonspecific type of binding interaction . Approximately 50% of the glyceraldehyde-phosphate dehydrogenase and 90% of the phosphoglycerate kinase were inactivated upon binding . NaCl removed the enzyme from the membranes in a concentration-dependent manner similar to its effects in the particulate fraction . Dimethonium (5 mM), an organic divalent cation which screens membrane-surface charge, removed greater than 90% glyceraldehyde-phosphate dehydrogenase from the sarcolemmal membrane . These results, and those with NaCl, suggest that the binding of the enzyme to the membrane is charge-related . Phospholipids extracted from the sarcolemmal membrane were capable of binding and inactivating both glycolytic enzymes . Purified anionic phospholipids were more potent at binding and inactivating both enzymes than were neutral phospholipids . These data show that glyceraldehyde-phosphate dehydrogenase and phosphoglycerate kinase can bind to sarcolemmal and sarcoplasmic reticular membranes . This binding is reversible, charge-dependent, and inhibitory . This binding is likely to involve anionic membrane phospholipids. Pathol Biol (Paris), 1985 Jun, 33(5 Pt 2), 614 - 7 {In vitro action of a new antifungal agent, naftifine, on dermatophytes}; Regli P et al.; Naftifine is a new antifungal agent derived from naphtalenemethane amine and highly active in vitro against dermatophytes . We studied this action against more than 100 strains belonging to 16 different species of the Trichophyton, Microsporum and Epidermophyton genera . MICs were determined in a liquid or solid medium using YMA and YMB Sabouraud broths . Yeasts (Candida, Torulopsis) and certain molds such as Scopulariopsis brevicaulis showed little susceptibility . In contrast, MICs for dermatophytes ranged from 0.01 to 0.2 microgram/ml on agar (YMA Sabouraud) and from 0.2 to 2 microgram/ml in broth (YMB Sabouraud) . These values are lower than those obtained under similar conditions with imidazoles and equivalent to those obtained with tolnaflate or griseofulvin. Infect Immun, 1985 May, 48(2), 395 - 401 Impairment of granulomatous inflammatory response to Histoplasma capsulatum by inhibitors of angiotensin-converting enzyme; Deepe GS Jr et al.; Systemic infection with Histoplasma capsulatum induced a granulomatous inflammatory response in the lymphoreticular organs of C57BL/6 mice that was associated with elevated levels of angiotensin-converting enzyme (ACE) in the spleens . To determine the influence of ACE on the granulomatous response, either captopril or MK 421, two inhibitors of ACE, were administered intraperitoneally to mice 6 h after intravenous injection of H . capsulatum and then daily for 1 week . Each ACE inhibitor sharply reduced ACE activity in the spleens of infected mice . Both drugs worsened the clinical severity of infection and significantly increased the growth of H . capsulatum in livers and spleens of mice infected for 1 week . The histopathological changes in mice given captopril were more severe, with massive infiltrates of macrophages in proximity to large aggregates of yeasts . Conversely, the administration of captopril for 2 weeks during the resolving phases of infection did not slow the healing of the granulomatous lesions, nor did it provoke a relapse of infection . Captopril did not promote the growth of H . capsulatum in artificial medium . This drug was not cytotoxic to peripheral blood leukocytes or to splenic leukocytes from normal and infected mice . Administration of captopril to normal mice for 1 week did not depress the response of splenocytes of concanavalin A or to phytohemagglutinin, nor did it diminish delayed-type hypersensitivity responses in vivo . Finally, captopril did not augment the growth of H . capsulatum within macrophages . Our results suggest that ACE may participate in the regulation of the granulomatous inflammatory response to H . capsulatum and that ACE inhibition impairs the protective effects of granulomatous inflammation during acute H . capsulatum infection. Allergy, 1985 Apr, 40(3), 181 - 6 Volumetric aerobiological survey of conidial fungi in the North-East Netherlands . II . Comparison of aerobiological data and skin tests with mould extracts in an asthmatic population; Beaumont F et al.; A study was undertaken to see whether the principal airborne fungi in the North-East Netherlands were also found to be the most reactive in skin testing . Atmospheric samples were taken weekly with the Andersen sampler, from April 1981, up to and including, June 1983 . At the same time skin tests of 833 patients referred to the outpatient Departments of Pulmonology and Allergology, because of recurrent bronchial obstructive complaints and a suspected allergy, were studied for strongly positive skin reactivity to fungi . 4.6% of the patients reacted with a wheal of 10 mm diameter or more to one or more of the tested fungi . Almost three-quarters of the airborne fungal "flora" was composed of seven genera, namely (in order of occurrence): Cladosporium (42.6%), Botrytis (8.6%), Yeasts (7%), Penicillium (5.8%), Basidiomycetes (5.7%), Aspergillus (3.7%), and Alternaria (0.9%) . In skin-testing, however, a different order of occurrence existed: namely: Beauveria (6.8%), Botrytis (6.1%), Aspergillus (4.7%), Mucor (3.8%), Epicoccum (3%), Cladosporium (2.3%), and Alternaria (1.1%) . It is concluded that the most prevailing airborne moulds are not necessarily the most potent allergens, at least in skin testing . Aspergillus and Botrytis showed a high sensitization rate, while Cladosporium and Alternaria did not . Botrytis deserves further study because of its frequent airborne occurrence and marked allergenic properties. J Clin Pathol, 1985 Apr, 38(4), 455 - 8 Rapid diagnosis of vaginal candidosis by latex particle agglutination; Hopwood V et al.; Vaginal swabs from women who on clinical evidence were thought to have vaginal candidosis were examined for yeasts by conventional laboratory methods (microscopy and culture) and also assayed for Candida antigens using a rapid (3 min) slide latex particle agglutination tests . Results showed that a diagnosis of vaginal candidosis based on clinical criteria alone is unreliable: only half of the women were subsequently confirmed as having candidosis by microscopy and culture . The new slide latex particle agglutination test gave better results, with 100% specificity, 80% sensitivity, high predictive values (greater than or equal to 91%), and an overall diagnostic efficiency of 93% . From the results of this preliminary study, slide latex particle agglutination looks a promising, rapid alternative to conventional laboratory methods for confirming a clinical diagnosis of vaginal candidosis and has the considerable advantage that it can be conveniently used in a clinical setting. Allergy, 1985 Apr, 40(3), 173 - 80 Volumetric aerobiological survey of conidial fungi in the North-East Netherlands . I . Seasonal patterns and the influence of metereological variables; Beaumont F et al.; In order to obtain actual data about the qualitative and quantitative occurrence of airborne fungi in The Netherlands, a viable-volumetric sample survey with the Andersen sampler was undertaken . From April 1981 to the end of June 1983, one day a week samples were taken on the unobstructed rooftop of a hospital in the N-E Netherlands . An average of 268 Colony Forming Units (CFU), per sample, per cubic metre of air were found . Almost three-quarters of the total catch consisted of seven genera, Cladosporium predominating . Botrytis showed in surprisingly high numbers when compared with other surveys, while Alternaria occurred in very low concentrations . Most atmospheric airborne spora were found between May and September . Aspergillus and Penicillium prevailed in the autumn and winter months, although were present the year-round . Momentary weather conditions seemed less important for the overall spore picture than the average meteorological characteristics for a whole season . The obtained aero-mycological information may be useful in determining clinical strategies for skin testing and serological investigations in patients with suspected mould allergies. J Bioenerg Biomembr, 1985 Feb, 17(1), 1 - 21 The proton pumps of the plasmalemma and the tonoplast of higher plants; Marre E et al.; Studies on intact cells, membrane vesicles, and reconstituted proteoliposomes have demonstrated in higher plants the existence of an ATP-driven electrogenic proton pump operating at the plasmalemma . There is also evidence of a second ATP-driven H+ pump localized at the tonoplast . The characteristics of both these ATP-driven pumps closely correspond to those of the plasmalemma and tonoplast proton pumps of Neurospora and yeasts. J Biol Chem, 1985 Jan 25, 260(2), 1103 - 7 Cooperativity in low-affinity Mg2+ binding to tRNA; Labuda D et al.; The Pb2+-catalyzed cleavage of tRNAPhe has been used to probe the effect of Na+ and Mg2+ binding to tRNA . Na+ is a noncompetitive inhibitor of the Pb2+-catalyzed cleavage . Millimolar Mg2+ is also a noncompetitive inhibitor . Analysis of the Mg2+ data show that at least two sites are involved in binding and that there is an interaction between the sites (cooperativity) . Low-affinity Mg2+ binding is thus different from "weak" and "strong" Mg2+ binding to tRNA characterized previously . We postulate that the alterations induced by low-affinity Mg2+ binding in tRNA mimic to some extent those brought about in RNA by the interaction with a protein factor and that at appropriate {Mg2+} the whole structure of tRNA is able to respond in a concerted way to a signal from the environment such as aminoacylation or codon binding. Dermatol Clin, 1985 Jan, 3(1), 29 - 49 The evaluation of patients with urticaria; Guin JD; Not only is urticaria a condition of disparate cause, but it also may be produced through the action of one or more of a long list of chemical mediators . This article discusses some of the accepted procedures in the evaluation of patients with urticaria, which includes not only categorization but also a search for the sources of aggravation and laboratory testing to confirm the clinical diagnosis . An example of a printed history form is included, which comprises questions that hopefully will help to identify aggravating factors as well as potential causes. Zentralbl Gynakol, 1985, 107(24), 1520 - 4 {Problems of vaginal mycoses}; Spitzbart H et al.; The problem in the diagnosis and therapy of the vaginal mycosis is discussed . With help of the electron microscopic examination we found yeasts on the surface of the vagina and within the intra- and subepithelial reach . These explained with restriction the possibility for a rezidive. CRC Crit Rev Biochem, 1985, 18(1), 31 - 90 Eukaryotic RNA polymerases; Sentenac A; This review will attempt to cover the present information on the multiple forms of eukaryotic DNA-dependent RNA polymerases, both at the structural and functional level . Nuclear RNA polymerases constitute a group of three large multimeric enzymes, each with a different and complex subunit structure and distinct specificity . The review will include a detailed description of their molecular structure . The current approaches to elucidate subunit function via chemical modification, phosphorylation, enzyme reconstitution, immunological studies, and mutant analysis will be described . In vitro reconstituted systems are available for the accurate transcription of cloned genes coding for rRNA, tRNA, 5 SRNA, and mRNA . These systems will be described with special attention to the cellular factors required for specific transcription . A section on future prospects will address questions concerning the significance of the complex subunit structure of the nuclear enzymes; the organization and regulation of the gene coding for RNA polymerase subunits; the obtention of mutants affected at the level of factors, or RNA polymerases; the mechanism of template recognition by factors and RNA polymerase. Biol Cell, 1985, 53(3), 219 - 30 In vitro multiplication and apparently indefinite subcultures of normal mouse resident peritoneal macrophages; Lombard Y et al.; Multiplication of Balb/C mouse resident peritoneal macrophages was observed, when all the cells collected in the washing fluid of the peritoneal cavity were seeded in appropriate culture medium . This multiplication began only after the appearance of a confluent monolayer of flat cells, referred to as "mesothelial" cells . The macrophages produced passed from the "mesothelial" cell layer to the suspension and could be passaged indefinitely . Each culture underwent an identical cycle of events which always included the appearance of a confluent monolayer of "mesothelial" cells . The cells transferred were characterized by their ability to phagocytose yeasts, and by the presence of Fc receptors and cytoplasmic non-specific esterases. Mycopathologia, 1984 Dec 30, 88(2-3), 173 - 80 Ultrastructural changes in Blastomyces dermatitidis after in vitro exposure to lidocaine; Taylor MR et al.; Electron microscopic examination of yeasts of Blastomyces dermatitidis, exposed in vitro to concentrations of lidocaine that occur when the drug is used for topical anesthesia, showed that lidocaine rapidly damaged intracellular structures . The extent of damage was dependent on the concentration of drug and length of exposure . The observed ultrastructural changes were very similar to those reported for other drugs that directly damage membranes . This relationship suggests that the antifungal effect of lidocaine is the result of direct membrane damage. Ann Allergy, 1984 Dec, 53(6), 486 - 92 A volumetric-aerobiologic study of seasonal fungus prevalence inside and outside dwellings of asthmatic patients living in northeast Netherlands; Beaumont F et al.; Air sampling with an Andersen sampler was carried out over a period of 21 mo, in 28 houses of asthmatic patients with an allergy for moulds . Inside, the livingroom, bedroom, and kitchen were studied, and an additional outside sample was always taken . Indoors, Penicillium showed the highest concentration, especially in the autumn and winter months, while Aspergillus and yeasts were also found frequently . The outside air was dominated by Cladosporium and Alternaria during summer months and Botrytis, Aspergillus, Mycelia sterilia and Basidiomycetes all year round . The patients showed high sensitisation towards Aspergillus, irrespective of the concentrations of the airborne fungi. Hoppe Seylers Z Physiol Chem, 1984 Nov, 365(11), 1355 - 9 Oxidation of Cu(I)-thionein by enzymically generated H2O2; Hartmann HJ et al.; Very little is known of the metabolism of copper on a molecular level . For example, there is no evidence of an oxidative breakdown of Cu(I)-thionein leading to Cu(II) . Thus it was of interest to use L- and D-amino-acid oxidases, amino oxidase and galactose oxidase to control the oxidation of Cu(I)-thionein by enzymically generated H2O2 . In the presence of these enzymes Cu(II) was generated in each case . In a more detailed study the Cu(I)-thiolate chromophores of Cu-thionein were oxidized in the presence of xanthine oxidase as deduced from spectrometrical measurements using EPR and circular dichroism . Unlike Cu2Zn2-superoxide dismutase catalase inhibited the oxidative cleavage, suggesting peroxide as the actual oxidizing agent . Possibly there is an enzymic oxidative pathway for the generation of biologically important Cu(II). Can J Biochem Cell Biol, 1984 Oct, 62(10), 956 - 63 Theory and practical application of coupled enzyme systems: one and two coupling enzymes with mutarotation of an intermediate; Brooks SP et al.; This paper provides equations to calculate the elapsed time before the concentration of the final intermediate, in a sequence of coupled enzymatic reactions, achieves a defined fraction of its steady-state concentration when one of the intermediates undergoes mutarotation . The equations can be used to predict lag times for systems involving one coupling enzyme, as is the case when hexokinase or phosphoglucomutase activity is monitored using glucose-6-phosphate dehydrogenase as the auxiliary enzyme, or for systems of two coupling enzymes, as is the case when the activities of enzymes producing ATP (such as creatine kinase) are monitored by coupling the production of ATP to hexokinase and glucose-6-phosphate dehydrogenase . The theoretical aspects of the assay have been verified using hexokinase (as the primary enzyme) and glucose-6-phosphate dehydrogenase (as the coupling enzyme) . A method of cost minimization, based on the above relationships, is also provided. J Am Acad Dermatol, 1984 Oct, 11(4 Pt 2), 747 - 9 Onychomycosis caused by Trichosporon beigelii in the United States; Fusaro RM et al.; We present the first case report of onychomycosis in the United States caused by Trichosporon beigelii in a normal, healthy man . The fungus, which was demonstrated histologically in the nails, was isolated on three different occasions with multiple cultures obtained each time. Biochimie, 1984 Sep-Oct, 66(9-10), 631 - 8 A method for deciding whether two experimental fluorescence anisotropy decay curves are significantly different; Genest D et al.; We describe a method to compare two fluorescence anisotropy decay curves . After numerical deconvolution of both decays by a non a priori method {1}, their difference, D, is considered . The variance is computed for each point of D . A confidence interval is defined which allows a decision to be made as to the significance of D . Information on the time range in which the changes of the fluorescence anisotropy decay occur is directly available . This analysis is particularly well suited for following the perturbations induced by an effector . It has been tested on 3-phosphoglycerate kinase in the presence and in the absence of ATP and 3-phosphoglycerate . We consider that this method leads to a significant improvement in the application of time resolved depolarization experiments. Dig Dis Sci, 1984 Sep, 29(9), 829 - 32 Effects of preparation-H on wound healing in the rectum of man; Subramanyam K et al.; The wound-healing property of Preparation-H, a widely used over-the-counter hemorrhoidal product was investigated in a randomized, controlled, double-blind trial . Artificial ulcers were created in the rectum of 12 healthy male volunteers and the size of these ulcers followed until complete healing by visual examination on days 4, 8, 15, and 22 . There were two groups of patients, one using placebo suppositories (placebo group) and another using Preparation-H (Preparation-H group) . On day 8, biopsies were obtained from the edge of the ulcer in both groups to assess histological healing . On day 15, all the five subjects in the Preparation-H group had achieved complete healing of their rectal lesion, whereas only three of six subjects in the placebo group had done so . Although the difference in healing does not achieve statistical significance, it may be that with larger numbers of patients, Preparation-H could be shown to increase the rate of wound healing in artificially created rectal ulcers in man. Immun Infekt, 1984 Aug, 12(4), 181 - 5 {Antimycotic chemotherapy in weakened resistance}; Wegmann T; Antifungal chemotherapy in weakened resistance is restricted to the following three substances: amphotericin B, 5-fluorocytosine and the azo dyes . The paper only discusses the therapy of indigenous iatrogenic fungal infections due to mycelial fungi (molds) and yeasts . The pathogenesis must be investigated in every case, since a healthy individual does not contract such a fungal infection . Prophylaxis would be more important than treatment of such complications . At the end of the paper, the therapy is summarized in a table . It is clearly seen from the table that the optimal modern therapy of systemic mycoses is a combination of 5-fluorocytosine in a normal dosage and amphotericin B at reduced dosage. Arch Dermatol, 1984 Aug, 120(8), 1059 - 60 Dermatitis due to Sporobolomyces infection; Bergman AG et al.; A 30-year-old woman had a pruritic skin lesion from which a yeastlike organism, Sporobolomyces holsaticus, was isolated . Members of this group of yeasts are found in the soil throughout the world and have been implicated only twice before in human infection . We report a third case of infection due to a Sporobolomyces organism. J Biol Chem, 1984 Jul 10, 259(13), 8485 - 93 Alcohol oxidase assembles post-translationally into the peroxisome of Candida boidinii; Goodman JM et al.; Candida yeasts rapidly form peroxisomes of simple function and composition when grown on methanol . Because the induction is both massive and rapid, this system may be useful for a detailed dissection of peroxisomal biogenesis . We report procedures to express peroxisomal proteins in cells and spheroplasts of Candida boidinii to stabilize peroxisomes in a lysate of spheroplasts and to obtain an enriched peroxisomal fraction . With these techniques we have been able to study the assembly of alcohol oxidase, a homo-octomeric flavoprotein, into the organelle in vivo . The primary translation product of alcohol oxidase comigrates on sodium dodecyl sulfate-polyacrylamide gels with the mature subunit . Pulse-chase experiments indicate that the newly synthesized monomer of alcohol oxidase has a half-life of about 20 min in intact cells and 13 min in spheroplasts before conversion to octomer . The monomer first appears in a high speed supernatant of a lysate of spheroplasts and then chases into a purified peroxisomal fraction before or during its octomerization . There is no detectable intermediary organelle involved in this process. Z Lebensm Unters Forsch, 1984 Jun, 178(6), 453 - 60 {Thallium in wine--trace element vinogram of thallium}; Eschnauer H et al.; The ultra trace element Thallium is regularly found in very low quantities in wine, in red wines with 0.2 micrograms T1/1 about twice as much as in white wines . Certain hints the origin and behaviour of such low T1-contents can be derived from additional investigations (soil, location, fertilizer, influence of wine making) . A correlation between T1 and K is known, but above that it can be shown, that similarly to Rb certain parts of the grape (grape, flesh, peel) are richer in T1 and that thereby the higher content of T1 in red wines can be explained . Slightly higher T1-levels are found in wines which grow next to cement plants or on abandoned mines . The Anodic Stripping Voltammetry in EDTA-containing base solution has proved effective for the determination of very low levels in the investigated samples . Wine and similar samples are decomposed with H2SO4-H2O2 . After extraction as T1(III) bromide Thallium is measured by anodic-stripping-voltammetry . The preceding separation of T1 from soil samples or the like is achieved by evaporation analysis. Mycopathologia, 1984 May 30, 86(2), 71 - 6 {DNA-DNA hybridization in several species of Hansenula}; Poncet S et al.; The genus Hansenula was considered a long time ago as a good pattern for phylogenetic research . In 1969, Wickerham proposed an evolutive scheme based upon morphological, physiological and ecological criteria . Recently, relatedness among yeasts were analysed by DNA-DNA hybridization in liquid medium . H . anomala var . anomala (G + C content: 37.1%) was compared with H . anomala var . schneggii (37.6%), H . subpelliculosa (33.8%) line 3, H . sydowiorum (40.1%) and H . muscicola (37.1%) . These results showed little relatedness between H . anomala var . anomala/H . ciferrii and H . anomala var . anomala/H . subpelliculosa . On the other hand, H . anomala var . schneggii shared 89.5% of its nucleotide sequences with H . anomala var . anomala . These 2 strains were considered to represent the same species . H . holstii showed 67.1% complementarity with H . anomala var . anomala: this strain is considered to represent valid species, different from H . anomala var . anomala, but H . muscicola with 72.5% relatedness to H . anomala var . anomala could be considered as a 'limit species' . An unexpected finding was that H . beckii was closely related to H . anomala var . anomala (84.8%) . These data suggested the inadequacy of current criteria used to establish the phylogenetic lines in genus Hansenula. Clin Orthop, 1984 Apr, (184), 190 - 2 Chrysosporium, a new causative agent in osteomyelitis . A case report; Stillwell WT et al.; A 24-year-old black man presented with a two-month history of swelling of the right ankle . Roentgenograms were initially read as negative . One month later the patient returned with increased pain and swelling, and roentgenograms demonstrated a large lucency involving the distal tibia . Bone scanning revealed extension of the lesion proximally, to 6 cm below the knee . Biopsy of a large tibial abscess demonstrated histocytic giant cells with budding yeasts and septate mycelia . Chrysosporium was isolated from cultures . Amphotericin B was used to treat the patient . Clinically, the infection healed within four months in a short-leg cast . Although Chrysosporium is usually a contaminant, its presence in cultures and histologic sections is evidence of pathogenicity. J Immunol Methods, 1984 Jan 20, 66(1), 27 - 33 A simple and inexpensive method for assessing in vitro candidacidal activity of leukocytes; Cutler JE et al.; Candidacidal activity of mouse neutrophils and macrophages was determined directly in microtiter plates . After a suitable period of interaction between phagocytic cells and C . albicans in the wells, the mouse cells were lysed with distilled water and corn meal agar was added to each well . Following incubation at 37 degrees C, viability was assessed using an inverted microscope and counting the number of germ tubes or microcolonies which developed . This method does not use radioisotopes or vital stains and should be applicable to other genera of yeasts. Arch Biochem Biophys, 1984 Jan, 228(1), 13 - 21 The requirement of oxygen for incorporation of carbon from D-xylose and D-glucose by Pachysolen tannophilus; Neirinck LG et al.; Oxygen was required for growth of Pachysolen tannophilus on D-xylose, as well as on D-glucose . The reason was not identical to that of other yeasts whose anaerobic growth is stimulated by supplementation of the medium with lipids or organic hydrogen acceptors, as such supplements were ineffective with P . tannophilus . The requirement of oxygen was found to be due to its involvement in the incorporation of carbon from D-xylose, and to a large extent D-glucose as well, into trichloracetic acid-insoluble material . The role it played was associated with the channeling of catabolic intermediates into biosynthetic routes, since ethanol was formed anaerobically, but aeration was required for induction of several enzymes associated with the catabolism of D-xylose . The requirement suggested that normally functioning mitochondria were necessary for incorporation and growth, but not ethanol formation . This view was supported by the inability to obtain stable petite mutants, and by the effects of inhibitors of mitochondrial function, which caused effects on incorporation and growth under aerobic conditions similar to those of anaerobiosis. Antonie Van Leeuwenhoek, 1984, 50(2), 135 - 41 Deoxyribonucleic acid base composition and taxonomy of Moniliella and allied genera; de Hoog GS et al.; DNA base compositions of representative (type) strains of Moniliella, Trichosporonoides and Hyalodendron were determined . Within Trichosporonoides over 16% variance was found . Most species separated well, but M . suaveolens showed considerable heterogeneity . The standard 2% G + C differences for species distinction is probably not applicable to these yeasts . The new combination M . pollinis is proposed for M . tomentosa var . pollinis on the basis of slight ecological, morphological and physiological differences, supported by a marked difference in % G + C. Antonie Van Leeuwenhoek, 1984, 50(1), 17 - 32 DNA base composition and DNA relatedness among species of Trichosporon Behrend; Gueho E et al.; The nuclear DNA of 28 species (30 strains investigated) of yeasts classified currently or previously in the genus Trichosporon . was analysed for its molar percentage of guanine + cytosine (mol% G + C) . This criterion, together with biochemical characteristics, suggested the separation of the organisms studied into two groups . The first group, which appears related to the Ascomycetes, includes thirteen species with a G + C content lower than 50 mol% (34.7-48.8), and lacks urease (except T . margaritiferum) . The second group appears related to the Basidiomycetes and includes fifteen species with a G + C content higher than 50 mol% (57-64) and has the ability to hydrolyse urea . A DNA homology experiment with T . beigelii and twelve other species of the second group showed very low values of complementarity with T . beigelii-labeled DNA . All these species must be considered as taxa other than T . beigelii. Microbiol Immunol, 1984, 28(6), 637 - 44 A study of cyanide-insensitive respiration in the genus Dekkera and Brettanomyces; Blondin B et al.; Dekkera intermedia and Brettanomyces custersii were shown to have a respiratory pathway resistant to cyanide, antimycin A, and azide . This respiration remained sensitive to salicylhydroxamic acid (SHAM) . The "cyanide-resistant" respiration was induced mainly at the end of the growth phase and could reach 50% of total respiratory capacity . The mitochondrial "petite colony" mutation had no effect on this oxidation pathway . The presence of this respiration pathway in these strains constitutes a compensation mechanism for the reducing activity of acetaldehyde dehydrogenase . This alternate pathway would thus be a fundamental element of the Custer effect, a characteristic feature of these strains. Acta Pathol Microbiol Immunol Scand {A}, 1984 Jan, 92(1), 1 - 8 The effect of reactive oxygen metabolites (ROM) on the attachment and ingestion phases of C3b- and IgG-mediated phagocytosis by macrophages; Thaw HH et al.; The effects of enzymatically produced reactive oxygen metabolites (ROM) on the attachment and ingestion phases of C3b- and IgG-mediated phagocytosis by cultured mouse peritoneal macrophages (MPM) was investigated using a hypoxanthine-xanthine oxidase ROM-generating system . ROM-exposure at a dose which did not affect cell viability caused a slight decrease in the percentage of phagocytosing cells . The total number of cell-associated (attached and ingested) C3b- and IgG-coated particles initially decreased in relation to controls . After 120 min the number of attached and ingested C3b-particles had returned to the level of controls, while the corresponding value for IgG-particles lagged behind . The number of ingested particles decreased in both C3b- and IgG-groups at each time-point studied (30-150 min) . A linear increase in the formation of lipid peroxidation products was measured during the period of observation, while transmission electron microscopical studies showed largely intact morphology . These results indicate that ROM species may induce membrane-related changes in inflammatory cells such as macrophages, probably due to lipid peroxidation; affecting the binding functions of the C3b- and Fc-receptors, without any obvious alteration in cellular fine structure. Scan Electron Microsc, 1984, (Pt 3), 1257 - 66 Detection of protein A gold 15 nm marked surface antigens by backscattered electrons; Walther P et al.; Colloidal gold has become an important marker in electron microscopy . Due to its scattering properties colloidal gold is easily detected in TEM . Because of the material dependent signal, preferentially backscattered electrons are used in the SEM . In the present study, we used a YAG (cerium dotted yttrium aluminum garnet) single crystal annular scintillator mounted directly below the objective pole piece . The secondary (SE) and backscattered (BSE) images of protein A gold marked cell surface proteins on two test specimens were compared: Red blood cells with a smooth and yeasts with a highly structured surface . After freeze-drying, the specimens were coated with a layer of carbon (5-10 nm) to enhance conductivity . The specimens were observed in a field emission SEM . In the SE mode a distinction between the gold particles and organic structures was hardly possible; this mode, however, gave good surface information . In the BSE mode, individual gold particles of 10 to 15 nm were easily detected . Thus the combination of the high resolution surface image and the material dependent BSE image provides an accurate localization of the surface antigens. Ann Dermatol Venereol, 1984, 111(4), 339 - 44 {Ketoconazole and onychomycosis}; Parent D et al.; We have treated 48 cases of onychomycosis (of which 37 were caused by dermatophytes, 10 by yeasts and one by Scopulariopsis brevicaulis) with 200 mg ketoconazole daily . We obtained recovery in 65 p . 100 of the cases of onyxis caused by dermatophytes and in 80 p . 100 of the cases of onychomycosis due to Candida . The one patient presenting an infection with Scopulariopsis brevicaulis recovered in 13 months . The average duration necessary to obtain complete recovery was 6 1/2 months for onychomycosis of the hands due to dermatophytes and 12 1/2 months for those of the feet . Perionyxis due to Candida needed 2 months of treatment with this drug, however 6 months of treatment were necessary to obtain recovery for onycholysis due to Candida . Biological tests remained normal and the side-effects were minimal and essentially gastrointestinal in our study . Ketoconazole is an effective treatment for onychomycosis: it is active against the different mycotic agents infecting nails and well tolerated by the patient . Several minor effects such as itching, nausea, headache and more serious reactions such as erythrodermia and hepatitis have been reported . Regular control and biological tests are therefore necessary . Patients with other diseases should avoid the use of ketoconazole for treatment of onychomycosis. Mycopathologia, 1983 Nov 21, 83(2), 65 - 73 Saprophytic fungi isolated from the hair of domestic and laboratory animals with suspected dermatophytosis; Aho R; Hair samples from domestic and laboratory animals with suspected dermatophytosis were examined for the presence of saprophytic fungi . A nutritionally poor base medium, developed by the author, was used in the isolation and identification of the saprophytes . Three hundred and ninety-four specimens were examined of which 246 were from dogs, 75 from cats, 30 from horses, 19 from cows, 12 from guinea pigs, 5 from rats, 2 from parakeets, 2 from chinchillas and one each from a goat, a mink and a lesser panda (Ailurus fulgens) . Moulds classified in 32 genera were isolated . The commonest in order of frequency were members of the genera Penicillium, Cladosporium, Aspergillus, Mucor, Aureobasidium, Alternaria, Scopulariopsis, Trichoderma and Trichothecium . The yeasts that were isolated were not identified . Aureobasidium pullulans was isolated significantly more often (chi 2 test p less than 0.025) from the dog samples than those from cats, Cladosporium spp . in the samples from dogs than horses, Mucor spp . from the cow samples than horses, Penicillium spp . from the dog samples than those of cats or horses . Skin infections caused by any of the contaminants were not encountered. Biochem J, 1983 Nov 15, 216(2), 385 - 92 Biosynthesis in vitro of complement subcomponents C1q, C1s and C1 inhibitor by resting and stimulated human monocytes; Bensa JC et al.; The capacity of cultured human monocytes to synthesize and to secrete the subcomponents of C1 and C1 inhibitor was examined . Non-stimulated monocytes secreted C1q and C1s from day 5 of culture . C1s reached a plateau immediately at its maximum level, whereas C1q secretion increased progressively until the end of the second week . Between day 12 and day 25, C1q secretion remained nearly constant (1-15 fmol/day per microgram of DNA, depending on the donor), whereas C1s secretion decreased and even in some cases stopped . C1r and C1 inhibitor were not secreted in detectable amounts by these resting cells . Stimulation of monocytes by yeasts, immunoglobulin G-opsonized sheep red blood cells or latex beads did not modify consistently C1q and C1s secretion . Activation by conditioned media from mitogen-, antigen- or allogeneic-stimulated lymphocyte cultures increased C1q production from 2 to 7 times and re-activated C1s secretion . Under the same conditions of activation, C1 inhibitor was secreted (up to 300 fmol/day per microgram of DNA) and C1r became detectable in culture supernatants . Isolated human monocytes are thus able to synthesize the whole C1 subcomponents; C1, if assembled, could be protected from non-immunological activation by locally produced C1 inhibitor . Activated monocytes appear to be a good tool for studying the assembly of C1 subcomponents and the role of C1 inhibitor in this process. South Med J, 1983 Nov, 76(11), 1460 - 1 Osteomyelitis of the hand due to Torulopsis holmii; Murdock CB et al.; Yeasts belonging to the genus Torulopsis, though generally considered saprophytes, are capable of causing serious illness in compromised patients . Torulopsis infections in patients with no apparent underlying disease are rare . We have described a previously healthy man who had osteomyelitis due to Torulopsis holmii as a complication of a penetrating hand injury . Despite in vitro susceptibility of the organism to amphotericin B and flucytosine and prolonged therapy with these agents, the infection relapsed after an apparent initial response. J Prosthet Dent, 1983 Oct, 50(4), 459 - 65 A six-year retrospective study of Molloplast-B-lined dentures . Part II: Liner serviceability; Schmidt WF Jr et al.; A 6-year retrospective investigation was conducted into the serviceability of Molloplast-B-lined dentures with the following results: The Molloplast-B-lined denture is not a temporary expedient but can remain serviceable for a time competitive with that of conventional acrylic resin dentures . All the soft liners were still serviceable after 4 years and 83% after 6 years . The longevity of the soft liner is dependent on correct processing procedures and proper home care . The three liners judged as unserviceable exhibited excessive wrinkling, and all had been soaked in a bleach-type cleanser . The resilience of the liner is dependent on its thickness . The optimum thickness is approximately 3 mm . The resilience of the liner did not decrease with time . No noticeable wear of the soft liner was observed . Staining was present in about half the soft liners . Smoking was commonly associated with staining and odor of the soft liner. Antimicrob Agents Chemother, 1983 Oct, 24(4), 575 - 8 Comparison of ketoconazole and amphotericin B in interference with thymidine uptake by and blastogenesis of lymphocytes stimulated with Histoplasma capsulatum antigens; Alford RH et al.; Human peripheral blood lymphocytes stimulated with Histoplasma capsulatum yeasts were exposed in culture to graded concentrations of ketoconazole or amphotericin B and subsequently assessed for membrane integrity, thymidine uptake, and blastogenesis . Lymphocyte reactivity varied with concentration and duration of exposure to ketoconazole . Overt membrane toxicity resulted from exposure to 40 micrograms of ketoconazole per ml for 5 days, diminished thymidine uptake occurred with concentrations as low as 5 micrograms/ml, and 15 to 20 micrograms/ml caused a marked decrease in thymidine uptake and eventually diminished blastogenesis . The antilymphocyte action of ketoconazole was neutralized by increasing the concentration of human serum in cultures to 40% regardless of its cholesterol content . Amphotericin B activity was qualitatively similar but less pronounced. Zentralbl Bakteriol Mikrobiol Hyg {A}, 1983 Sep, 255(2-3), 368 - 79 On the renin-like activity of Candida proteinases and activation of blood coagulation in vitro; Ruchel R; Several secretory acid proteinases from C . albicans and C . tropicalis as well as membrane extracts from two strains of C . albicans were compared for their renin-like activity and for their ability to activate blood coagulation . The highest renin-like activity as measured fluorometrically, was found in the membrane extract of C . albicans 113, it accounted for approximately a tenth of the activity of pure human renin . Activation of blood coagulation by acid Candida proteinases is due to the trypsinogen kinase effect, it was detected preferentially at the level of factor X (Stuart-Prower) . Conversion of factor X at rates sufficiently rapid to be of biological significance was effected by several proteinases tested . The highest activity was found in the membrane extract of C . albicans CBS-2730 and involves a proteinase of the serine type . Both renin-like activity and conversion of factor X are examples of limited proteolysis; they are discussed with respect to strain-specific pathogenicity in opportunistic yeasts. Sabouraudia, 1983 Sep, 21(3), 179 - 84 In-vitro inhibitory activities of 2 new orally absorbable imidazole derivatives: BAY n 7133 and BAY 1 9139; Fromtling RA et al.; The inhibitory activities of 2 new orally absorbed antifungal imidazole derivatives, BAY n 7133 and BAY 1 9139, were compared in vitro with those of ketoconazole and miconazole . Clinical isolates of pathogenic fungi tested included 35 yeasts, 62 dimorphic fungal pathogens, 37 filamentous fungi and 31 dermatophytes . LY 121019, a semisynthetic analog of echinocandin B, was included in tests with the pathogenic yeasts . Both BAY n 7133 and BAY 1 9139 were found to be broad spectrum antifungal agents . The spectra of these newer compounds were comparable to those of ketoconazole and miconazole; however only BAY n 7133 resembled these latter 2 imidazoles quantitatively in terms of the degree of antifungal activity as indicated by measurable MICs . In contrast, the spectrum of LY 121019 appeared to be confirmed only to isolates of Candida. Nature, 1983 Aug 18-24, 304(5927), 630 - 3 Cell cycle control by timer and sizer in Chlamydomonas; Donnan L et al.; Conservation of cell cycle control mechanisms is indicated by the presence of functionally homologous division control genes in unrelated yeasts and by the nonspecific action of oncogenes, but it remains uncertain what property of a growing cell results in the initiation of events leading to division . Response to a critical size is indicated by the longer growth period of smaller cells prior to division, which is consistent with deferment of division events until a minimum size is attained; however, in the same cell types faster growing cells are larger and this is more easily explained if division follows a timed period during which faster growing cells grow more, as is postulated for mammalian cells . Therefore, either time- or size-dependent controls might be the sole significant mechanism; we report here, however, that both controls do function in Chlamydomonas since cycle duration is under timer control and cell size determines the number of division rounds committed at the end of each cycle, and hence whether 2, 4, 8 or 16 daughter cells are formed. Can J Microbiol, 1983 May, 29(5), 546 - 51 Complementary DNA-25S ribosomal RNA hybridization: an improved method for phylogenetic studies; Baharaeen S et al.; In a new combination of techniques for ribosomal RNA hybridization, complementary DNA is synthesized on 25S ribosomal RNA fragments generated by mild alkali treatment, by the enzymatic addition of polyadenylic acid tails, hybridization of these tails with oligo deoxyribosylthymine, and reverse transcription in the presence of tritiated TTP . Hybridization reactions are performed in solution . Heteroduplexes are collected on diethylaminoethylcellulose filter discs after treatment with S1 nuclease . The problems presented by secondary rRNA structure are avoided by denaturation before reverse transcription and before hybridization . The high percentage of duplex formation (78-87%), the low standard deviation of relative binding (averaging +/- 1.30% relative binding), and small differences in reciprocal hybridizations (1.71-5.18% relative binding), as well as the elimination of complications resulting from differences in the number of rRNA cistrons in nuclear DNA, make this method preferable to the membrane-filter technique commonly used in phylogenetic classifications based on the homology of large rRNAs. Ann Microbiol (Paris), 1983 Mar-Apr, 134A(2), 149 - 54 Selective interaction of a Fucus vesiculosus lectin-like mucopolysaccharide with several Candida species; Criado MT et al.; A complex carbohydrate specific lectin-like mucopolysaccharide extracted from the brown alga Fucus vesiculosus was found to agglutinate Candida guilliermondii cells but not those of other species of the same genus (except for a weak agglutination with C . krusei) . The selective binding of this mucopolysaccharide correspondingly affected the growth of the yeasts . The results suggest that there are notable differences--at least with respect to the receptors for the F . vesiculosus mucopolysaccharide--between C . guilliermondii, C . krusei and the other Candida species. Sabouraudia, 1983 Mar, 21(1), 15 - 25 Mode of action of 5-fluorocytosine and 5-fluorouracil in dematiaceous fungi; Polak A; The mode of action of 5-fluorocytosine (5FC) and 5-fluorouracil (5FU) in dematiaceous fungi was studied and compared with results of experiments in yeasts and Aspergillus species . In dematiaceous fungi 5FU is more potent than 5FC . The high activity of 5FU is related to a good and rapid uptake of this compound into the fungus cell . Both compounds exert fungistatic and fungicidal activity . A correlation exists between the amount of 5FU incorporated into RNA and its antifungal activity . The resistance frequency to 5FC varies from 2 x 10(-3) to 1 x 10(-7); resistance frequency to 5FU is generally lower . Addition of 5FC and 5FU to logarithmically multiplying cells inhibits increases of cell numbers and cell constituents after a delay period . The effects on the increase of protein and carbohydrate are more delayed than on the increase of DNA and RNA, indicating unbalanced growth . The concept of a dual biochemical mechanism, i.e . incorporation of 5FU into RNA and formation of 5-fluorodeoxy UMP leading to inhibition of DNA synthesis, previously proposed for the antifungal action of 5FC is also applicable to the action of 5FC and 5FU on the dematiaceous fungi. Acta Odontol Scand, 1983, 41(1), 33 - 44 A combined clinical, mycological and histological study of denture stomatitis; Bergendal T et al.; The clinical and histological appearance of the different types of denture stomatitis are in many respects very similar and confluent . In order to study the correlation between clinical and histological appearance and amount of yeasts, 48 patients with denture stomatitis and 24 with a healthy palatal mucosa were examined . The terms atrophic and hyperplastic denture stomatitis were introduced . The intensity of the palatal erythema and the growth of yeasts were most prominent among patients with hyperplastic lesions . Dryness and soreness of the mouth, angular cheilitis, spontaneous hemorrhage, glossitis and leukoplakias were found to a varying extent . No statistical evidence of correlation between the intensity of clinical erythema, amount of yeasts and grade of subepithelial inflammation could be found . The disease has most certainly a background other than solely increased growth of yeasts. J Mol Appl Genet, 1983, 2(3), 301 - 14 Multiple, discrete 35S transcripts of cauliflower mosaic virus; Condit C et al.; We have devised a modification of the Berk and Sharp procedure that allows us to detect the presence of a diverse population of 35S full-length, genomic viral transcripts of cauliflower mosaic virus (CaMV) . Using this procedure we have been able to identify and characterize four such 35S transcripts . The first 35S RNA that we have mapped, 35S-1, is a slightly longer than full-length transcript, beginning approximately at nucleotide 7500 and ending at nucleotide 7650 and corresponds to a previously characterized 35S transcript of the CabbB-JI strain of CaMV . The second transcript, 35S-2, begins and ends near nucleotide 8000 on the genome map . The third and fourth 35S RNAs, 35S-3, and 35S-4, have their 5' ends lying, respectively, at approximately nucleotides 1200 and 2100, while their 3' ends lie near nucleotides 1300 and 1900 . In addition to the four characterized 35S RNAs, we present evidence for a fifth 35S RNA which may begin and end near nucleotide 5700. Rev Epidemiol Sante Publique, 1983, 31(1), 21 - 38 {Methodology for detecting enteric viruses in sea water}; Nestor I; Within the set of measures to protect the marine environment against ever greater viral pollution, the methodology for the detection of human virus in seawater is of primary importance as a means of evaluating the efficiency of protective measures . So far only a limited number of methods have been applied to determine the presence of enteritis virus in sea-water . These methods are the ones already used to study soft water . However, the specific characteristics of sea-water require certain modifications to these methods . Experimental research or on site examinations have to date made significant contribution to the methodology . The importance of the problems posed to hygienists and to health policy makers calls for efforts to perfect these methodologies . The results obtained in this respect, both in the laboratory and in the field, are encouraging . They confirm that the techniques developed are suitable, in the majority of cases, for the detection of enteritis virus in the marine environment, but they still remain to be perfected . The present work takes as its basis both data from the literature and the results of personal experiments. Digestion, 1983, 28(3), 158 - 63 Candida overgrowth in gastric juice of peptic ulcer subjects on short- and long-term treatment with H2-receptor antagonists; Boero M et al.; Candida overgrowth in gastric juice of peptic ulcer subjects under therapy with H2-receptor (H2-R) antagonists has been detected in 21.4 and 53.8% of cases after short- and long-term treatment respectively, and in 8% of controls . Both types of H2-R antagonists, ranitidine and cimetidine, were equally associated with production of yeasts . The location of ulcers, whether gastric or duodenal, seems to have no influence on fungal growth . Females were more susceptible than males to develop Candida in gastric juice . In the short-term course with H2-R blockers fungal colonization of gastric juice was associated with delay of the rate of ulcer healing . Fungal detection in gastric juice was not associated with mucosal invasion by Candida since in none of the patients who had a biopsy for gastric ulcer was Candida detected by histology. Z Hautkr, 1982 Jul 15, 57(14), 1055 - 74 {The role of clothing in the transmission of pathogenic fungi }; Thurner J et al.; Laboratory studies were made to examine the possibility of transmission of pathogenic fungi through textiles . 1 . Dermatophytes were proven to be present in clothing and leather articles worn over areas infected by fungi . In patients known to be infected with Pityriasis versicolor, contaminated scales were obtained from their textiles, the fungi could be demonstrated . 2 . Artificially infected textiles were found to harbor dermatophytes and pathogenic yeasts for a number of weeks without limiting the survival capacity of the fungi . 3 . At low temperatures, fungi were not affected by various detergents . Under conditions simulating machine washings (30 minutes exposure time) at a temperature of 60 degrees C any washing agent was sufficient to cause irreversible damage . At higher temperatures the time for killing the fungi was diminished . These results were confirmed by experiments with contaminated material from patients (scales, hairs, nail particles). Dtsch Med Wochenschr, 1982 Jun 4, 107(22), 845 - 8 {Fungal infestation of gastroduodenal ulcers: incidence and significance (author's transl)}; Hochter W et al.; In a prospective study of 132 cases of gastroduodenal ulcer, proven by endoscopic biopsy, there were 59 in which fungi were cultered (44.7%) . There was no significant difference in incidence between gastric ulcer (46.2%) and duodenal ulcer (42.6%), or between benign and malignant gastric ulcer (47.2 and 42.1%, respectively) . Most of the fungi were yeasts of the genus Candida and Torulopsis . The mycel phase was demonstrable only in the native or histological preparation (16.7% {native} and 10.6% {histological} positive findings) . In all those cases in which pseudomycels were demonstrated the culture count was especially high (more than 20 colonies) . In most of these there was an additional disease which may be associated with immunological insufficiency (e.g . diabetes, chronic alcoholism, malignoma) . The presence of pseudomycelia or more than 20 colonies in the culture from gastroduodenal ulcers are thus less of a pointer as to whether the local lesion is benign or malignant than to a general weakening of the organism's defence mechanisms. Biokhimiia, 1982 Jun, 47(6), 977 - 86 {Use of immobilization in the study of glyceraldehyde 3-phosphate dehydrogenase . Immobilized monomers}; Muronets VI et al.; Active immobilized monomers of glyceraldehyde 3-phosphate dehydrogenase were prepared by means of dissociation of the tetrameric enzyme molecule covalently bound to Sepharose via a single subunit . The conditions were elaborated to achieve the inactivation and solubilization of the non-covalently bound subunits leaving the monomer coupled to the matrix intact . This procedure differs from the previously developed method of matrix-bound oligomeric enzymes dissociation in a detail which was found to be essentially important . The widely used method includes complete denaturation of all subunits during treatment with urea followed by reactivation of the immobilized one, whereas only the non-covalently bound subunits suffer denaturation under the conditions developed in the present work . The immobilized monomers of glyceraldehyde 3-phosphate dehydrogenase exhibit Vmax and Km (for NAD and substrate) values similar to those found for the immobilized tetramer . Reassociation of the immobilized monomers with soluble enzyme subunits obtained in the presence of urea produces matrix-bound tetrameric species . Immobilized trimers ae formed upon incubation of matrix-bound monomers in a diluted apoenzyme solution . The immobilized monomeric, trimeric and tetrameric enzyme species were used to study the role of subunit interactions in cooperative phenomena exhibited by the dehydrogenase. Ann Allergy, 1982 Jun, 48(6), 333 - 9 A comparative study of the incidence of indoor and outdoor mold spores in Bangkok, Thailand; Bunnag C et al.; The culture plate method was used in this survey of the indoor and outdoor incidence of the atmospheric molds in Bangkok Metropolis in the year 1977 . The over-all sampling showed the prevalence of yeasts, Aspergillus, Hermodendrum and non-sporulated white fungi as the frequency of occurrence; each of them was over 50% . In general the incidence was high in the winter months and low in the rainy season except for Aspergillus, Fusarium and Curvularia which did not decline during the rainy period . Observations indicated that there are only slight differences between the incidence and the types of airborne fungi recovered from the exposed plates in the bedrooms and outside the houses in and around Bangkok Metropolis. Cancer Res, 1982 Apr, 42(4), 1530 - 6 Induction of maturation in cultured human monocytic leukemia cells by a phorbol diester; Tsuchiya S et al.; Suspension cultures of a human monocytic leukemia cell line, THP-1, were treated with 0.16 to 160 nM 12-O-tetradecanoylphorbol-13-acetate (TPA) . In an original cell line, THP-1-O, cultured again from -80 degrees cryopreservation, more than 80% of the cells adhered to the glass substrate with marked morphological change within 3 hr of TPA treatment . Adherent cells became flat and amoeboid in shape, and many microvilli and flaps of the cell surface disappeared . Well-developed Golgi apparatus, rough endoplasmic reticula, and a large amount of free ribosomes were seen in the cytoplasm . On the other hand, in THP-1-R cells cultured continuously without cryopreservation for 26 months, approximately 80% of the cells adhered to the substrate 48 hr after TPA treatment . Round and ovoid shapes were kept in THP-1-R cells treated with TPA . Surface Fc receptors for immunoglobulin G were present on more than 90% of THP-1-O and THP-1-R cells and were little affected by treatment with TPA . Sixty to 70% of the TPA-treated THP-1-O and THP-1-R cells were able to phagocytize yeasts and immunoglobulin G-coated sheep erythrocytes . Less than 20% of the untreated THP-1 cells were able to phagocytize yeasts and immunoglobulin G-coated sheep erythrocytes . In histochemical staining, alpha-naphthyl butyrate esterase was enhanced after treatment with TPA . Lysozyme activity in culture supernatants was not affected by TPA treatment . When exposed to latex beads and TPA, increased 14CO2 production from {1-14C}glucose in THP-1-O cells was observed . These results indicate that, after treatment with TPA, human monocytic leukemia cells may be converted into mature cells with functions of macrophages. Genetika, 1982 Mar, 18(3), 499 - 502 {Evolutionary changes in the genetic code, predictable on basis of the hypothesis of physical predetermination of the structure of codon bases}; Sukhodolets VV; According to the earlier proposed hypothesis on the structural correspondence between amino acids and doublets from the first codon bases (Sukhodolets 1980), the UGA triplet corresponds to tryptophan and the AGX triplets - to the termination codons . It is notably this sense of the UGA and AGA, AGG, respectively, that was reported for mitochondrial codes . Thereby, a proposal is indirectly confirmed that meanings of the UGA (nonsense) and AGA, AGG (arginine) in the normal cytoplasmic code is the result of evolutionary changes. Gut, 1982 Feb, 23(2), 137 - 9 Gastro-oesophageal candidiasis; Scott BB et al.; A prospective search for gastro-oesophageal candidiasis was made by histological examination of all the biopsies taken from 465 patients endoscoped consecutively during a 12 month period . The criterion for diagnosis was the demonstration of infiltration of tissue or ulcer slough by yeasts and hyphae . Nineteen cases of candidiasis were found giving an overall incidence of 4% . There were 12 cases with oesophageal candidiasis, two with both oesophageal and gastric candidiasis, and five with gastric candidiasis . In none of the patients was candidiasis suspected before endoscopy . Symptoms referable to the candidiasis were uncommon and radiology was not helpful in diagnosis . There was associated local pathology (particularly peptic ulceration and carcinoma of the stomach or oesophagus) in all except two patients, which suggests that the candidiasis is usually secondary to mucosal damage . In the series, candidiasis was present in 27% of patients with oesophageal cancer, 20% of patients with gastric cancer, 16% of patients with benign gastric ulcers, and 15% of patients with oesophagitis. Antonie Van Leeuwenhoek, 1982, 48(3), 257 - 64 Distribution of carotenoids and sterols in relation to the taxonomy of Taphrina and Protomyces; van Eijk GW et al.; Species of the genera Taphrina Fr . and Protomyces Unger were screened for the presence of carotenoid pigments and the sterols ergosterol and brassicasterol . All strains produced carotenoids in variable amounts: Taphrina: 0.3--39 micrograms/g dry weight; protomyces: 65--99 micrograms/g dry weight . It was concluded that the two genera cannot be separated on the basis of presence or absence of carotenoids . Thirty strains (24 species) of Taphrina produced brassicasterol as the principal sterol; twenty-one strains (17 species) did not form ergosterol . Only four isolates (4 species) produced ergosterol without formation of brassicasterol . Brassicasterol was the major sterol in 3 species of Protomyces, whereas ergosterol was absent . Brassicasterol is a rather unique sterol within the fungal kingdom and has hitherto not been found in the red yeasts . Therefore, this sterol is of taxonomic significance in contrast with ergosterol, which is widespread among fungi. Z Allg Mikrobiol, 1982, 22(2), 83 - 90 {Effect of phosphate starvation on growth and macromolecular composition of Candida spec . H}; Bruckner B et al.; With Candida spec . H during phosphate starvation the changes occurring in the macromolecular cell composition and growth parameters were studied . In the absence of exogenous phosphate, but in the presence of carbon source (n-alkanes or glucose) and nitrogen source, the cells exponentially grow some time, whereas cell composition undergoes several changes . Both the nucleic acid and protein levels of the yeasts decreased . At the same time lipids were accumulated, especially with n-alkanes as carbon source . The carbohydrate content increased only slight, although the carbon source was in excess . The results were discussed. Infection, 1982, 10(2), 71 - 5 The effect of amphotericin B lozenges on the presence and number of Candida cells in the oropharynx of neutropenic leukemia patients; de Vries-Hospers HG et al.; A retrospective evaluation was made on the value of amphotericin B lozenges in the selective elimination of yeasts from the oropharynx . Four different groups of severely granulocytopenic patients were studied . All 77 patients received amphotericin B orally as a suspension or as tablets . Four amphotericin B lozenges were also administered daily for topical antimycotic decontamination of the oropharynx . This was done in the presence of colonization-resistance decreasing factors such as a nasogastric tube (Group I, 19 patients) or mucosal damage (Group III, 25 patients) and in patients with four or more consecutive throat swab cultures with yeasts (Group IV, 11 patients) . The 22 patients in Group II did not receive lozenges . The addition of lozenges resulted in a decrease in the mean "growth density" of Candida cells in the oropharynx . This reduction was significant in Group III (p less than 0.01) and Group IV (p less than 0.02) and became evident during the first week of treatment . In patients with a nasogastric tube, however, 51.8% of the throat swab cultures revealed yeasts . Increasing the dose of the lozenges might improve the results in these patients . Topical treatment of the oropharynx with amphotericin B lozenges is advocated for patients who are susceptible to Candida infections. Med Cutan Ibero Lat Am, 1982, 10(5), 343 - 6 {Onyxis caused by Malassezia (Pityrosporum) ovalis}; Civila ES et al.; Onychia by Malassezia ovalis are described for the first time . They are observed mainly on the hands of young or adult women with semiological characteristics of aphlegmatic onycholysis . In clinical materials M . ovalis is seen as yeasts only or as yeasts and typical hyphae . Cultures are easily obtained on Sabouraud medium containing 2% of bile . It is thought that these lesions are example of an opportunistic mycosis since predisposing local factors are almost always present . Oral or topic treatment with imidazole derivatives has shown to be effective. Mycopathologia, 1981 Oct 10, 76(1), 27 - 32 Superficial mycoses in Italy; Caretta G et al.; A total of 1244 cases suspected of superficial mycoses were analysed in a period of 12 months in Italy . Dermatophytoses were found in 62.4%; the other common disease was Pityriasis versicolor (44.1%)., The predominant species Epidermophyton floccosum (34,2%) was strikingly high in relation to other statistics; this species was commonest in tinea cruris . Among the other dermatophytes M . canis was predominant (31.3%) commonest in tinea corporis, followed by T . mentagrophytes (17,8%) and T . rubrum (10,3%) . A high rate of yeasts was found in tinea manum (81.6%) and tinea pedis (47.7%) . ? Sabouraudia, 1981 Jun, 19(2), 143 - 5 {Presence of Pityrosporum ovale in the ear of newborn infants}; Randjandiche M; Lipophilic yeasts of the genus Pityrosporum were found in random samples from the external ear of 7% of 101 neonates and 8% of 111 infants 3 days old . The yeasts were also found in 70.4% of 132 specimens from adult female external genitalia . There were no isolations of Pityrosporum from 46 intravaginal specimens or samples of baby oil. Med Trop (Mars), 1981 Mar-Apr, 41(2), 207 - 13 {Digestive disorders in histoplasmosis . Report of a case of ulcerous enterocolitis caused by Histoplasma capsulatum (author's transl)}; Aubry P et al.; Report of a new American histoplasmosis caused by Histoplasma capsulatum in a young adult Haitian, and review of the digestive disorders as reported in the previous medical papers . In the present case, the first localization detected was a granulomatous hepatitis which lead to the disclosure of an ulcerous entercolitis . Tuberculosis and Crohn disease were first suspected, but their treatment induced a worse turn of the patient's condition and compelled to a laparotomy, which shown ulcerous entercolitis with associated lymph-nodes . Per operative pathological examination gave evidence of Histoplasma capsulatum yeasts . Treatment, first with miconazole and later on with amphotericin B could not prevent the death of the patient affected by a deficiency of cell mediated immunity . Disseminated histoplasmosis is rare: 1 out of 5,000 cases of American histoplasmosis-digestive disorders are generally detected by surgery or post-mortem examination . They occur in 20 p . 100 of the cases envolving the whole digestive tract from mouth to anus, giving mucous ulcerations, difficult to detect by X ray . Endoscopic control with biopsies has therefore a great value . In Histoplasma duboisii, histoplasmosis digestive disorders are very unusual and localized to intestine . They may be detected by surgery, or by endoscopies . In the reported case, in spite of the geographical origin of the patient, the diagnosis of American histoplasmosis was not retained because of the negativity of the immunological tests and of the biopsies performed before surgery . An afterward checking of these biopsy specimens gave evidence of a few yeasts . Special dyeing technique may have made the diagnosis somewhat earlier; this is important because new non toxic imidazole drugs seem to be active against these yeasts. Z Allg Mikrobiol, 1981, 21(1), 19 - 26 {Comparative physiological studies of Candida spec . H and its mutant H 13 during nitrogen starvation}; Bruckner B et al.; With Candida spec . H and the mutant H13 during nitrogen starvation we studied the changes occurring in the macromolecular cell composition . In the absence of nitrogen, but in the presence of n-alkanes as carbon source, both the nucleic acid and protein levels of the dried yeasts rapidly decreased . At the same time carbohydrates and lipids were accumulated . Candida spec . H predominantly increased carbohydrate content, whereas the mutant accumulated significantly higher amounts of lipids . The main components of the cellular carbohydrates and the fatty acid content were analyzed, and the results were discussed. Neoplasma, 1981, 28(4), 385 - 95 Establishment and characterization of permanent cell lines from patients with acute and hairy cell leukemia; Stockbauer P et al.; Four cell lines were established from peripheral blood of patients with leukemia . All lines express the Epstein--Barr virus nuclear antigen (EBNA) and therefore should be classified as lymphoblastoid cell lines . However, one of the lines UHKT-5 established from a patient with acute myelomonocytic leukemia has some features not typical for lymphoblastoid cell lines . The cells resemble to macrophages with the phagocytic ability for yeasts, strong alpha-naphthylacetate esterase positivity in phagocytizing cells and unusually long villi . Another line UHKT-7 established from a patient with hairy cell leukemia expresses the same isotype of membrane immunoglobulins as the original hairy cells. Kosm Biol Aviakosm Med, 1981 Jan-Feb, 15(1), 3 - 9 {Chemical protection of the body against irradiation with high-energy protons}; Vorob'ev EI et al.; Comparison of chemical protection against electromagnetic radiations (X- and gamma-rays) and high-energy proton radiations give evidence that the mechanism of antiradiation effects of radioprotectors and other biological protectors against different radiations is identical . On the basis of the data published in the literature it has been shown that the degree of radiation protection of animals and other biological objects in comparable doses differs insignificantly during exposures to proton and standard irradiations. Genetika, 1981, 17(2), 222 - 32 {Mobile dispersed genetic elements in eukaryotes and their possible relationship to carcinogenesis}; Georgiev GP et al.; During last three years, the mobile dispersed genetic elements (mdg) were isolated from the genome of Drosophila melanogaster, yeasts and mammals . According to a number of their properties, mdg elements are quite similar to endogenous pro-retroviruses . It is known that in many cases oncogeneity of retroviruses depends on the incorporation of the certain host genes (potential oncogenes) into the viral genome . We suggest that in some cases mdg elements could entrap the potential oncogenes in the course of transposition . As a result, oncogenes become uncontrollable by host regulatory systems and may induce cell transformation . Another possible mechanism underlying switch off of the gene responsible for differentiation control may be mdg transposition to a region in close vicinity of the gene . As transposition of mdg elements seems to occur rather often, they may be regarded as one of the most important factors of genome rearrangements leading to cell transformation. Nucleic Acids Res, 1980 Dec 11, 8(23), 5535 - 9 The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum; Hori H et al.; The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU . A model for the secondary structure of this 5S rRNA is proposed . The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Am J Med Technol, 1980 Nov, 46(11), 821 - 36 Diagnostic clinical parasitology: II . Identification of the intestinal protozoa; Garcia LS et al.; This article (the second in a series of four papers on clinical diagnostic parasitology) presents information on the diagnostic morphology of the protozoa which infect humans . The description of morphological characteristics includes information on atypical morphology as well as the classic descriptions . Because these organisms are the most difficult to identify, extensive detail is included to illustrate the morphological variability. C R Seances Acad Sci D, 1980 Sep 15, 291(2), 207 - 10 {Absence of interstrand cross-links in DNA treated wtih 3-carbethoxypsoralen and 365 nm irradiation}; Magana-Schwencke N et al.; In contrast to 8-MOP photoaddition on DNA, the renaturation capacity of heat or alkali denatured DNA treated with 3-CPs is absent . This shows that DNA interstrand cross-links are not produced by 3-CPs photoaddition even by a dose which leads to 10(-5) survivors . At equimolar concentrations of 3-CPs or 8-MOP (5 x 10(-4) M) and a dose of 10 kJ.m-2 of 365 nm radiation, 1 molecule of 3-CPs for 4 x 10(3) nucleotides and 1 molecules of 8-MOP for 9 x 10(3) nucleotides are fixed in vivo . Since wild type cells are about 4 times more sensitive to 8-MOP than to 3-CPs photoaddition, it implies that cross-links are important in genotoxicity and that monoadditions are more easily repaired than cross-links. J Clin Microbiol, 1980 Jul, 12(1), 84 - 7 Activation of streptolysin S-related cellular potential hemolysin by grinding with glass beads; Calandra GB et al.; Cellular potential hemolysin, the precursor to extracellular streptolysin S, was activated by grinding with glass beads on a Vortex mixer . Hemolysin activity was markedly enhanced by the addition of ribonucleic acid-core during the grinding . Determinants for optimum results with the beads included small bead size, prewashing of beads with acetic acid, and appropriate bead volume during grinding . The increased sensitivity of this technique over those previously used revealed cellular potential hemolysin in cells grown in the presence of glucose, which inhibits streptolysin S production . The basis for the increased sensitivity of this procedure may be due to the binding of cellular potential hemolysin or ribonucleic acid to the beads. Sabouraudia, 1980 Jun, 18(2), 149 - 56 {Experimental dermatitis caused by Pityrosporum ovale and (or) Pityrosporum orbiculare in the guinea pig and the mouse}; Drouhet E et al.; An experimental dermatitis was established for the guinea pig and Swiss white mouse by topical application of cultures of Pityrosporum ovale, isolated from pityriasis capitis and from P . arbiculare isolated from pityriasis versicolor . Histology showed the development of the yeasts in the stratum corneum, with hyperkeratosis at the follicular ostium and in the pilous bulb: the clinical and histological appearances resembled human seborrheic dermatitis . The nude (nu/nu) mouse, the hair-less mouse and the nude rat were not susceptible to this experimental infection, probably because of the dystrophy of their pilous follicles and sebaceous glands . The experimental model permitted evaluation of antifungal agents . The Pityrosporum dermatitis disappeared rapidly after topical application of econazole or amphotericin B . No pathological differences were observed between the strains tested. J Bacteriol, 1980 Jun, 142(3), 945 - 52 Basic amino acids and inorganic polyphosphates in Neurospora crassa: independent regulation of vacuolar pools; Cramer CL et al.; At least 78%, and perhaps all, of inorganic polyphosphate is shown to be contained within the vesicles (vacuoles) of Neurospora crassa, where over 97% of the soluble arginine, lysine, and ornithine pools are known to accumulate . Furthermore, synthetic polyphosphate can concentrate arginine up to 400-fold from dilute (0.01 mM) solutions in equilibrium dialysis . For these reasons and because the molar ratio of basic amino acids and polyphosphate phosphorus is approximately 1, we tested the hypothesis that there was an obligate physiological relationship between them . Experiments in which nitrogen starvation and arginine excess were imposed upon cells showed that polyphosphate content was insensitive to changes in the basic amino acid content . Experiments involving phosphate starvation and restoration showed that basic amino acid content was almost wholly independent of polyphosphate pools . Moreover, the normal high degree of compartmentation of arginine in vesicles was maintained despite polyphosphate depletion, and arginine was still exchanged across the vesicular membrane . We conclude that N . crassa, like yeasts, can regulate polyphosphates and basic amino acids independently, and that the accumulation of basic amino acids in vesicles may depend upon an energy-requiring mechanism in addition to the demonstrated charge interaction with polyphosphate. Mol Cell Biochem, 1980 May 7, 30(3), 165 - 70 The phagocytosis stimulating peptide tuftsin: further look into structure-function relationships; Stabinsky Y et al.; Sixteen new analogs of the phagocytosis-stimulating peptide tuftsin have been synthesized . The biological activities of these synthetic peptides, in which either the C-terminal or both C- and N-terminals are chemically altered, were evaluated by studying their effects on the phagocytosis of heat-killed yeasts and on the reduction of the dye nitroblue tetrazolium by normal human polymorphonuclear leukocytes . The results demonstrate that the integrity of the guanidine side chain of arginine at position four of tuftsin is crucial for maximal activity . Modification, even in side chain length, of the guanidine leads to decreasing activity . Preservation of the positive charge of position four of tuftsin yields analogs possessing considerable activity . Simultaneous alterations of both C- and N-terminal results in diminishing activities . The results of this study are discussed in relation to the structural features of tuftsin . It appears that interaction between the carboxyl of Arg4 and the amino group of Thr1 which would indicate a specific conformation such as a 4 leads to 1 beta-turn are not favored. Mycopathologia, 1980 May 1, 71(1), 17 - 22 {Relationship between the spectral properties and antifungal properties of amphoterecin B and candicidine}; Coulon J et al.; The antifungal activities of polyen macrolides Amphotericine B and Candicidine are investigated . The deep spectral changes of the absorption and of the circular dichroism show various states of micellar preparations which are: a) in aqueous medium, aggregats of different spectral characteristics, the antifungal activity of which being modulated by the preparation . b) aggregats of antifungal heptaen with membrane-sterol responsable of the antifongal activity . c) aggregats in hydrophobic solutions which spectroscopic properties are sterol-complex like . Our results suggest an explanation of the spectral changes and can point out some favorable characteristics for an optimal activity of these antifungals against yeasts. Mikrobiologiia, 1980 Mar-Apr, 49(2), 298 - 301 {Comparative study of Candida zeylanoides and Candida vinaria}; Blagodatskaia BM et al.; Candida zeylanoides (Castellani) Langeron et Guerra 1920 and Candida vinaria Ohara, Nonomura et Yunome ex . M . Th . Smith 1973 were comparatively studied . The species were found to differ in the assimilation of nine carbon sources, the vitamin requirements, the resistance to elevated NaCl concentrations, the ability to utilize hydrocarbons . The ultrafine structure of the cell wall and the type of budding in C . vinaria are as in ascomycetous yeasts while the cell wall structure and the formation of buds in C . zeylanoides are as in basidiomycetous ones. Biochem J, 1980 Mar 1, 185(3), 783 - 6 Maleylacetate reductase from Trichosporon cutaneum; Gaal AB et al.; The enzyme catalysing the reduction of maleylacetate to 3-oxoadipate was purified 150-fold from Trichosporon cutaneum, induced for aromatic metabolisms by growth with resorcinol as a major carbon source . The enzyme separated upon electrofocusing into three species with PI values 4.6, 5.1 and 5.6 . They had similar catalytic properties and the same molecular weight. Can J Microbiol, 1980 Feb, 26(2), 190 - 5 The lipid components of Candida boidinii and Hansenula polymorpha grown on methanol; Rattray JB et al.; The lipid contents of Candida boidinii and Hansenula polymorpha grown on 2% glucose were low . Increased quantities were present in C . boidinii grown on 1 or 4% methanol and in H . polymorpha on 1% methanol . The lipid compositions of both yeasts were characterized by low levels of triacylglycerol and high contents of unsaturated fatty acid and phospholipid . Growth on methanol did not affect the quantity of total phospholipid in C . boidinii, but resulted in a decreased value for H . polymorpha grown on 4% methanol . Modification of the phospholipid composition of both yeasts involved a general increase in the phosphatidylserine-phosphatidylinositol levels at the expense of phosphatidylcholine . The possible relationship between the phospholipid component and the development of membranous systems accompanying growth on methanol has been considered. Cancer, 1980 Jan 15, 45(2), 367 - 71 Systemic mycosis due to Trichosporon cutaneum: a report of two additional cases; Evans HL et al.; Two additional cases of systemic mycosis due to Trichosporon cutaneum are reported and are compared with the previously published case of Rivera and Cangir . Both patients (a four-year-old male and a 57-year-old female) had acute leukemia for which they were receiving chemotherapy, and both presented with fever that was unresponsive to conventional antibiotics . Both had positive blood cultures for Trichosporon cutaneum . The disease was further documented in the four-year-old male by renal biopsy and by bone marrow culture; he was treated with apparent success with amphotericin B . However, the 57-year-old female died shortly after the begining of similar treatment, and autopsy demonstrated involvement of the left kidney, spleen, bone marrow, and liver . The organism in both these cases, as well as the case of Rivera and Cangir, exhibited both hyphal and yeastlike forms in tissue sections . We believe that the therapeutic success in the case of the four-year-old male was primarily related to his remission from leukemia. Zentralbl Gynakol, 1980, 102(9), 492 - 5 {Resistance problems in treatment of vaginal mycoses? (author's transl)}; Spitzbart H; The authors isolated 135 yeasts from patients who had undergone repeated treatment for mycoses . Analyses were made to determine resistance to Nystatin and Clotrimazol . Secondary resistance was exhibited by Candida species, but their pathogenicity still is controversial. Folia Microbiol (Praha), 1980, 25(4), 328 - 31 Excretion of peptides by Rhodosporidium torudoides; Chatterjee SP et al.; Strains of Rhodospordium torloides produced two peptides into the culture filtrate . Peptide I contained 6 amino acids and peptide II contained 5 amino acids . The peptides however, are, not homologous to the alpha-factor, and become assimilated at a later phase of growth. Ann Med Interne (Paris), 1980, 131(2), 95 - 8 {A case of disseminated histoplasmosis due to Histoplasma capsulatum (author's transl)}; Aubry P et al.; A case is reported of American histoplasmosis due to Histoplasma capsulatum presenting as a hepatic granulomatosis . The patient was a young adult from Haiti and investigations revealed the presence of an ulcerous enterocolitic suggesting tuberculosis or Crohn's disease . The condition became worse after antituberculous therapy and corticoids, and operation was necessary . Extemporaneous histological examination, of the colonic ulcerations showed Histoplasma capsultaum yeasts . The patient, who had a cellular immunity deficiency, died during antifungal treatment with amphotericin B of the disseminated histoplasmosis is rare: 1 case in 5000 American histoplasmosis cases . Digestive tract lesions, usually detected during operation or autopsy, are found in about 20% of cases . In the present observations the diagnosis of American histoplasmosis was based on the country of origin of the patient, but this was not confirmed: the immunological reactions were and remained negative and no yeasts were demonstrated after staining of pre-operative biopsy specimens (colon and liver particularly) . Also, serial sections conducted after the diagnosis had been established demonstrated the presence of Histoplasma capsulatum in the colon sample removed during colonoscopy. Am J Clin Pathol, 1980 Jan, 73(1), 137 - 40 Congenital Torulopsis glabrata infection in man; Quirke P et al.; A case of congenital infection by Torulopsis glabrata in a premature 0.52-kg female infant born at 23 weeks' gestation to a 37-year-old, gravida 7 mother is reported . The infant succumbed to an intrauterine pneumonia and fungemia . Acute chorioamnionitis was present . Budding yeasts were found in the lungs and amniotic membranes and in large numbers within the lumen of the gut . The role of a retained intrauterine contraceptive device in predisposing to the ascending infection is discussed. Int Arch Allergy Appl Immunol, 1980, 62(3), 355 - 8 Local anaphylactoid responses in rats; West GB; The relative activities of 15 agents inducing anaphylactoid responses in the paws of two types of genetically different rats have been determined . Three groups were identified: group 1, where activity was much higher in R rats than in NR rats; group 2 where activity was low in both R and NR rats, and group 3, where activity was equally high in both R and NR rats . The influence of changes in the blood sugar level on these responses was also investigated in the three groups. Acta Derm Venereol, 1980, 60(6), 531 - 3 Age incidence of Pityrosporum orbiculare on human skin; Faergemann J et al.; We have investigated the incidence of the lipophilic fungi Pityrosporum orbiculare and P . ovale on clinically normal skin in newborn children and in children at the age of 6 months, 1 year, 5 years, 10 years, and 15 years . P . orbiculare was absent in children of less than 5 years of age . It was present in the highest incidence (93%) in the 15-year-old children, about the same frequency as in adults . The colonization starts during the period when the sebaceous glands become active . P . ovale could not be cultured and this may depend on geographical variations in the distribution of these yeasts. Sabouraudia, 1979 Dec, 17(4), 415 - 8 The preservation of medically important fungi; Gentles JC et al.; Details are given of a method, first described in 1962, for preservation of fungi in anhydrous silica gel . It is shown that the procedure is suitable for use with dermatophytes, yeasts and other fungi of medical importance and that they may be preserved for periods of 5 years or more. Tsitologiia, 1979 Nov, 21(11), 1337 - 41 {Effect of RNA and histone preparations on the properties of lymphoid cells}; Svirnovskii AI et al.; Preparations of RNA and histones change the electrophoretic mobility of lymphoid cells, the intensity of their respiration and anaerobic glycolysis, and thermo-merchanical properties of DNA-complexes isolated from lymphoid cells . RNA and histones exert their influence on the properties of DNP-systems and the rate of anaerobic glycolysis in the opposite manner . But both these preparations depress the electrophoretic mobility and oxygen consumption. Mol Cell Biochem, 1979 Oct 15, 27(2), 97 - 116 Squalene synthetase; Popjak G et al.; In the first part of the review the background to the discovery of the asymmetric synthesis of squalene from two molecules of farnesyl pyrophosphate and NADPH is described, then the stereochemistry of the overall reaction is summarized . The complexity of the biosynthesis of squalene by microsomal squalene synthetase demanded the existence of some intermediate(s) between farnesyl pyrophosphate and squalene . This demand was satisfied by the discovery of presqualene pyrophosphate, an optically active C30 substituted cyclopropylcarbinyl pyrophosphate, the absolute configuration of which at all three asymmetric centers of the cyclopropane ring was deduced to be R . Possible mechanisms for the biosynthesis of presqualene pyrophosphate and its reductive transformation into squalene are presented . In the second part of the review the nature of the enzyme is discussed . The question whether presqualene pyrophosphate is an obligate intermediate in the biosynthesis of squalene is examined, with the firm conclusion that it is . It is as yet uncertain whether the two half reactions of squalene synthesis, i.e . (i) 2 x farnesyl pyrophosphate leads to presqualene pyrophosphate; (ii) presqualene pyrophosphate + NADPH (NADH) leads to squalene, are catalyzed by one or two enzymes or by a large complex with two catalytic sites . Evidence is cited for the existence on the enzyme of two distinct binding sites with different affinities for the two farnesyl pyrophosphate molecules . The types of enzyme preparations available at present are described and types of experiments carried out with these are critically examined . The implications of the properties of a low molecular weight squalene synthetase solubilized with deoxycholate from microsomal membranes is discussed and a model for the enzyme in an organized membrane structure is presented. Boll Soc Ital Biol Sper, 1979 Sep 30, 55(18), 1809 - 15 {Unusual fatty acids in turkeys fed a diet containing "Toprina" . III . Composition of higher fatty acids in the heart and skeletal muscle}; Borgatti AR et al.; Total lipids (TL), phospholipids (PL) and fatty acid composition of TL and PL were estimated in breast, leg and cardiac muscles of turkeys, males and females, fede diets containing 0%, 10% and 15% of Candida lipolytica cultivated on n-alkanes by industrial method ("Toprina") . LT and PL were also valued in "Toprina" and diets . With increasing concentration of dietary yeasts it was observed that: a) Pl increased in diets, breast and leg muscles; b) fatty acids 15:0 and 17:0 increased, 17:1 and 17:2, typical of the product, appeared and increased in the tissues. Boll Soc Ital Biol Sper, 1979 Sep 30, 55(18), 1802 - 8 {Unusual fatty acids in turkeys fed a diet containing "Toprina" . II . Composition of the higher fatty acids of the liver, brain and adipose tissue}; Borgatti AR et al.; Total lipids (TL), phospholipids (PL) and fatty acid composition of TL and PL were estimated in adipose tissue, liver and brain of turkeys, males and females, fed diets containing 0%, 10% and 15% of Candida lipolytica cultivated on n-alkanes by industrial metod ("Toprina") . TL and PL were also valued in "Toprina" and diets . It was observed that: a) PL increased in diets, adipose tissue and liver, not in brain; b) with increasing concentrations of dietary yeasts fatty acids 15:0 and 17:0 increased, 17:1 and 17:2 typical of product appeared and increased in adipose tissue and liver only, not in brain. Sabouraudia, 1979 Sep, 17(3), 331 - 8 Comparative study of the effect of thiabendazole and fungizone on Histoplasma capsulatum in macrophages; Subbaratnam S et al.; The antifungal properties of Fungizone (amphotericin B intravenous solution) and thiabendazole on Histoplasma capsulatum within guinea pig macrophages were compared using the staining method and a newly developed plating method to determine the viability of intracellular H . capsulatum . The two methods were compared to determine the effectiveness of Fungizone and thiabendazole on H . capsulatum within macrophages . Fungizone was fungicidal for intracellular H . capsulatum, killing 99.9% of the yeasts at a concentration of 0.5 microgram/ml . There was some indication that non-viable intracellular yeasts were stained which could result in misinterpretation of the effectiveness of Fungizone using the staining method unless the yeasts are very closely examined for staining abnormalities . There was a good correlation between the two methods to demonstrate suppression of the multiplication of intracellular H . capsulatum in macrophages treated with 50 microgram/ml of thiabendazole . Thiabendazole was lethal for some intracellular H . capsulatum. Mikrobiologiia, 1979 Jul-Aug, 48(4), 599 - 603 {Cyanide-resistant respiration in Torulopsis candida}; Il'chenko AP et al.; The effect of cyanide and the inhibitors of cyanide-resistant oxidase--hydroxamic acids on endogenous respiration and oxidation of a number of substrates by Torulopsis candida resting cells taken at different stages of growth on glucose and hexadecane was studied and made it possible to arrive at the following conclusions . 1 . The effect of cyanide on endogenous respiration of T . candida differs during its growth on glucose and hexadecane . On hexadecane, irrespective of the growth phage, cyanide inhibits endogenous respiration by 70--75% . On glucose, cyanide inhibits endogenous respiration not more than by 35% and only at the exponential growth phase whereas it stimulates endogenous respiration in the course of other growth stages . 2 . The effect of cyanide on respiration of the resting cells of T . candida which oxidize glucose, hexadecane, primary alcohols and tetradecanoic acid hardly depends on the growth stage . It is determined mainly by the nature of a substrate to be oxidized . 3 . Hydroxamic acid have no effect on the cell respiration in the absence of cyanide . However, in its presence, they entirely inhibit both endogenous respiration and oxidation of the aforementioned substrates . 4 . Under almost all above experimental conditions, the sensitivity of cell respiration to cyanide changes only slightly at different stages of growth on either glucose or hexadecane . This feature markedly distinguishes T . candida among other cyanide-resistant yeasts. Laryngol Rhinol Otol (Stuttg), 1979 May, 58(5), 466 - 8 {Contribution on household dust allergy (author's transl)}; Hussarek-Heinlein M et al.; In 1970 the allergy out-patient department of the First Otolaryngological University Hospital of Vienna reported for the first time about the increasing significance of mould fungus allergies in the respiratory tract . RAST now makes in possible to analyze the indivudual fractions of a household dust sensitization by way of experiments . We have seen that in the case of positive RAST reactions to household dust, which is a mixed antigen unspecific as such, evidence can be found for at least one of the antigens "mould fungus", "household dust mite", or "animal hair" in positive RAST categories . Among the 107 cases of the RAST categories 2 und 3 with respect to household dust (h3) a household-dust mite sensitization was evidenced in 88 percent, the respective figures for animal hair sensitization being 49 percent and for mould fungus sensitization 43 percent. Monatsschr Kinderheilkd, 1979 Apr, 127(4), 175 - 8 {Present state of antimycotic therapy (author's transl)}; Meinhof W; In the local treatment of various forms of dermatophytosis tolnaftate used to be the most convincing drug . More recent developments have led to a group of imidazol derivatives which have a broader spectrum and are also effective against yeasts . Polyene antibiotics are still very useful in the treatment of Candida mycoses . There are only few drugs available for systemic treatment of mycoses . Grisefulvin is only effective against dermatophytes.Amphotericin B, given intravenously, is a very useful drug against a series of systemic mycoses but it's value is decreased by serious side effects . Fluorocytosin shows less unwanted effects than Amphotericin B, but many fungi are resistent against this antimycotic or may become so during treatment . Of the imidazol group only miconazole is available for systemic intravenous therapy . Further developments of systemic antimycotics are of great importance. J Biol Buccale, 1979 Mar, 7(1), 27 - 30 {Oral protozoans and diabetes: study in 117 patients}; Cambon M et al.; A study on the presence of oral Entamoeba gingivalis and Trichomonas tenax has been carried out on calculus or dental plaque from 117 diabetic subjects . Statistical analysis of results shows no correlation between diabetes and protozoa . The same frequency was found between diabetic and normal subjects . Nevertheless, a significant relation has been found between the diabetes and the yeasts. MMW Munch Med Wochenschr, 1979 Jan 5, 121(1), 29 - 32 {Particular features of mycotic carriers (author's transl)}; Wegmann T; Although we are all carriers of fungi, an infection is rare . Therefore, the following questions are discussed: Why do these actually saprophytic germs become pathogenic at all? Why have opportunistic fungus infections increased? The diagnosis of a fungus infection due to saprophytic pathogens is difficult, as the demonstration of a fungus does not necessarily imply disease . The case history with relevant predisposing factors is an essential clue to the diagnosis . As a matter of principle, the diagnosis of a systemic mycosis should only be established by exclusion. Br J Dermatol, 1978 Oct, 99(4), 405 - 9 Genital warts: incidence of associated genital infections; Kinghorn GR; Two hundred and seventy-eight men and 200 women who presented to a Special Treatment Clinic with genital warts were screened for accompanying genital infections . One hundred and twenty-nine of 212 presentations (61%) in women compared to 98 of 303 presentations (32%) in men were accompanied by another genital infection P less than 0.001) . Recurrent presentation with warts was commoner in men (P less than 0.001) . In both sexes recurrences were less likely to be accompanied by another genital infection . (P less than 0.002) . Yeasts (25%), C . vaginale (21%), N.gonorrhoea (12%) and T . vaginalis (12%) were the commonest pathogens in women . Non-specific genital infection (17%) and gonorrhoea (10%) were the commonest accompanying infections in men . The identification and treatment of these infections, especially in women, is important for the rapid eradication of warts, for, by increasing genital moisture they can create and maintain a favourable environment for wart proliferation . In addition to screening all patients with warts for other sexually transmitted diseases, women should be screened for yeasts and C . vaginale. Andrologia, 1978 Sep-Oct, 10(5), 385 - 9 The occurrence of simple and mixed fungal infections in patients at the department of andrology/Hamburg (1972--1976); Chernov A; Skin scales from 228 patients, referred to the Department of Andrology at the University of Hamburg during 1972--76, were examined mycologically, because of being suspect of mycotic infections . In 54 cases dermatophytes were isolated, and yeasts were found in 13 cases . Nocardia minutissima and Malassezia furfur were present in 138 and 25 cases, respectively . In 12 patients, mixed infections were diagnosed; the infective organisms were yeasts in 46.2% of the cases, dermatophytes in 11.1%, and Malassezia furfur was represented in 8% . The infections were localized in the inguinal region in 208 patients. Sabouraudia, 1978 Sep, 16(3), 229 - 32 Scalp carriage of Pityrosporum species: the effect of physiological maturity, sex and race; Noble WC et al.; The change in carriage rates of Pilyrosporum sp . over the years before and after puberty were studied in Caucasoid and Negroid children using a semiquantitative cultural technique . Caucasoids yielded yeasts more often than did negroids; older or sexually mature children yielded yeasts more often than did prepubertal children . There appeared to be a decrease in numbers of yeasts isolated a few years after the pubertal peak. Med Hypotheses, 1978 Sep-Oct, 4(5), 497 - 515 Theorectical mechanisms for synthesis of carcinogen-induced embryonic proteins: III . The tRNA methylases; methylation mechanism and function; Hancock RL et al.; It is contended that redundant repressed tRed) with carcinogens in adult cells . Supportive evidence, especially from molecular model building, is presented for a mechanism of tRNA methylation . In this mechanism the adenine moiety of S-adenosyl-L-methionine base-pairs with uracil for all tRNA methylations . Furthermore it is proposed that such methylations are required during the transcription of a tRNA molecule in order to limit the number of possible conformers that can occur before further development of the molecule takes place . This theory of the function for methyl groups is discussed in the light of the properties found for hypomethylated tRNAs. Mol Cell Biochem, 1978 May 31, 19(3), 135 - 46 Biosynthesis of mitochondrial membrane proteins: co-ordination with special reference to cytochrome c oxidase; Freedman JA et al.; This paper reviews mechanisms by which the rate of synthesis of subunits of mitochondrial inner membrane protein complexes and the assembly of these subunits are co-ordinated . Current models are evaluated and critically discussed in the light of some recent evidences . The focus is on the incorporation of cytoplasmically-synthesized cytochrome c oxidase subunits in the development of a newer model, which introduces some twists into a combination of several current ideas . A mechanism which governs both organized assembly and the co-ordination of rates of polypeptide synthesis is illustrated and the principles of the model are applied to the elucidation of some odd features of certain mutants . The possibilities that mitochondrial ATPase and cytochrome c reductase may also be synthesized and assembled according to this model are discussed. Am Rev Respir Dis, 1978 Apr, 117(4), 695 - 703 Mouse model of pulmonary blastomycosis: utility, simplicity, and quantitative parameters; Harvey RP et al.; A murine model of pulmonary mycotic disease using Blastomyces dermatitidis is defined quantitatively . Intranasal inoculation with yeasts avoids delays in growing microconidia and can be performed with routine precautions without sophisticated biohazard facilities . The particles rapidly reach the bronchioles and alveoli, producing a progressive focal pneumonia, studied histologically . In vitro growth conditions are defined to titer inocula reproducibly with visual methods . Median survival can be titrated with the challenge inocula . Although initial postchallenge lung cultures are not always positive, replication eventually proceeds, at a rate defined for various challenge sizes, to a ceiling of 10(7) to 10(8) colony-forming units per g of tissue incompatible with life . Lung weight correlates closely with colony-forming units per g above a threshold . Lethality correlates with initial body weight and with age . During the course of infection, weight is an accurate predictor of mortality . Extrapulmonary dissemination occurs as a premortem event in protracted infections . A wide variation in fungal strain virulence is documented . Quantification of these features of the model makes it useful for study of host response or therapeutic intervention, because efficacy can be related to stage of disease and parasitic burden. Chest, 1978 Apr, 73(4), 546 - 9 Successful medical therapy for endocarditis due to Candida parapsilosis . A clinical and epidemiologic study; Mayrer AR et al.; A heroin addict with asymmetric septal hypertrophy and persistent fungemia with Candida parapsilosis was treated with amphotericin B and flucytosine (5-fluorocytosine) . The diagnosis of endocarditis was based on the subsequent development of a murmur of mitral regurgitation and echocardiographic evidence of prolapse of the posterior leaflet of the mitral valve . Cure was effected with antifungal therapy alone . Thus, when th |