Biochem Biophys Res Commun, 1987 Aug 14, 146(3), 1458 - 64 The effect of DMSO on natural DNA conformation in enhancing transcription; Juang JK et al.; In the presence of 5% dimethylsulfoxide, 2.5 fold increase in vitro RNA synthesis rate by E . coli RNA polymerase was observed as superhelical pBR322 DNA was used as template . The effect of DMSO on DNA conformation was studied by: {i} measuring the dissociation constant of EtBr-DNA complex and the maximum EtBr binding site of EtBr in DNA which changed from 7.52 X 10(-7) M and 0.18 site per nucleotide to 9.61 X 10(-7) M and 0.156 site per nucleotide respectively when 10% DMSO was supplemented; and {ii} the increase of average linking number of pBR322 DNA in DMSO solution with topoisomerase I reaction . These results suggest that the stimulation of RNA synthesis may be caused by the easier initiation and elongation of RNA synthesis at some locally loosen regions of DNA affected by another torsionally more twisted counterpart regions in the DMSO microenvironment. Biochemistry, 1987 Aug 11, 26(16), 4968 - 75 Characterization of tryptophan environments in glutamate dehydrogenases from temperature-dependent phosphorescence; Strambini GB et al.; Tryptophan room temperature phosphorescence in solution was detected in glutamic dehydrogenase from bovine liver and Escherichia coli with lifetimes of 1.2 and 0.65 s, respectively . Although these enzymes possess three and five tryptophanyl residues per polypeptide chain, respectively, the temperature dependence of the phosphorescence quantum yield estimates that the room temperature emission is due, in either case, to a single residue . Long triplet-state lifetimes and very small rates of O2 quenching indicate that these tryptophanyl side chains are embedded in a highly inflexible internal region of the macromolecule . Aided by sequence homology with dehydrogenases of known structure and theoretical predictions of secondary structure {Wootton, J.C . (1974) Nature (London) 252, 542-546; Brett, M., Chambers, G.K., Holder, A . A., Fincham, J.R.S., & Wootton, J.C . (1976) J . Mol . Biol . 106, 1-22}, the phosphorescing tryptophans have been tentatively placed in the catalytic coenzyme binding domain of each enzyme . The particular sensitivity of the triplet-state lifetime in probing local changes in conformation provides a strong indication that within the time window of phosphorescence measurements the six subunits in the hexameric enzymes are equivalent . Furthermore, while in the bovine enzyme this parameter is markedly affected by the interaction with ligands which have a functional role, the constancy of the phosphorescence lifetime at various degrees of polymerization suggests that the association process is not accompanied by important conformational changes in the macromolecule. Biochemistry, 1987 Aug 11, 26(16), 5200 - 8 trans-Diamminedichloroplatinum(II), a reversible RNA-protein cross-linking agent . Application to the ribosome and to an aminoacyl-tRNA synthetase/tRNA complex; Tukalo MA et al.; A new approach allowing detection of contact points between RNAs and proteins has been developed using trans-diamminedichloroplatinum(II) as the cross-linking reagent . The advantage of the method relies on the fact that the coordination bonds between platinum and the potential acceptors on proteins and nucleic acids (mainly S of cysteine or methionine residues; N of imidazole rings in histidine residues; N7 of guanine, N1 of adenine, and N3 of cytosine residues) can be reversed, so that the cross-linked oligonucleotides or peptides in contact within a complex can be analyzed directly . The method was worked out with the ribosome from Escherichia coli and the tRNAVal/valyl-tRNA synthetase system from the yeast Saccharomyces cerevisiae . In the first system the platinum approach permitted detection of ribosomal proteins cross-linked to 16S rRNA within the 30S subunits (mainly S18 and to a lower extent S3, S4, S11, and S13/S14); in the second system major oligonucleotides of tRNAVal cross-linked to valyl-tRNA synthetase were detected in the anticodon stem and loop, in the variable loop, and in the 3' terminal amino acid accepting region . These results are discussed in light of the current knowledge on ribosome and tRNAs and of potential applications of the methodology. Biochemistry, 1987 Aug 11, 26(16), 5076 - 90 Solution structure of the Trp operator of Escherichia coli determined by NMR; Lefevre JF et al.; We have assigned the majority of the nonexchangeable protons in the NMR spectrum of the 20 base-pair fragment of DNA corresponding to the Trp operator of Escherichia coli . The sequence (CGTACTAGTTAACTAGTACG) also contains a Pribnow box (underlined) . Variation of the intrinsic spin-lattice relaxation rate constants of the H8's along the sequence indicates that the structure of the oligonucleotide is not regular . Splitting patterns of the H1' resonances in the deoxyriboses, obtained from a two-dimensional J-resolved experiment, allowed the dominant pucker mode of each nucleotide to be determined . Intranucleotide NOEs from the sugar protons H1', H2', and H3' to the base protons were used to determine the conformation of each nucleotide (puckers and glycosidic torsion angles) . The relative orientations of nucleotide units (roll, propeller twist, helical twist angle, and pitch) were calculated by using internucleotide NOEs between protons of neighboring nucleotides in the sequence . All these parameters were determined for each step along the 20-mer . The structure belongs to the B family of conformations, but variations of the local geometry are observed from step to step . Some of the variations, such as the roll and the twist angles, can be predicted by the rules of Calladine and Dickerson {Calladine, C . R., & Dickerson, R . E . (1983) J . Mol . Biol . 166, 419-441} . The puckers of the deoxyriboses of purines are found mainly in conformations near C2' endo, while those of the pyrimidines prefer C3' endo and related conformations . Glycosidic torsion angles obtained for purines are larger than those of pyrimidines . Except for this last observation, the general properties of the operator DNA structure are comparable with those of crystal structures of B DNA of other sequences. Biochemistry, 1987 Aug 11, 26(16), 5063 - 70 Kinetics of the stages of transcription initiation at the Escherichia coli lac UV5 promoter; Straney SB et al.; The kinetics of initiation by Escherichia coli RNA polymerase on the lac L8UV5 promoter was studied by a gel retardation method that separates protein-DNA complexes from free DNA . The binding constant of the closed complex, the forward and reverse rate constants of isomerization from closed to open complex, and the forward rate constant from the open to initiated complex were measured . Both the forward and reverse isomerization rates were found to be temperature dependent, and the activation energies for these steps were determined . The rates of open complex formation and dissociation were not affected by the addition of ribonucleotide triphosphates; however, the extent of dissociation was greatly reduced if the triphosphates added allowed a short, unstable RNA product to form . The dissociation rate was not affected by heparin, a polyanion competitor that sequesters the polymerase . The rate of initiated complex formation appeared to be dependent on whether the initiating moiety was a mononucleotide triphosphate or dinucleoside monophosphate and on the sequence of the dinucleoside . These results are compared to those found on both the lac L8UV5 and other bacterial and phage promoters by less direct measurements . We use the values obtained for the individual rate constants to investigate the predicted steady-state kinetics of initiation-limited transcription, with the conclusion that the rate-limiting step is formation of the open complex in the limit of low polymerase concentration . However, when RNA polymerase is saturating, the rate is determined by the transition from open complex into the stably initiated ternary complex.(ABSTRACT TRUNCATED AT 250 WORDS) Biochemistry, 1987 Aug 11, 26(16), 5213 - 20 Secondary structure of 5S RNA: NMR experiments on RNA molecules partially labeled with nitrogen-15; Gewirth DT et al.; A method has been found for reassembling fragment 1 of Escherichia coli 5S RNA from mixtures containing strand III (bases 69-87) and the complex consisting of strand II (bases 89-120) and strand IV (bases 1-11) . The reassembled molecule is identical with unreconstituted fragment 1 . With this technique, fragment 1 molecules have been constructed 15N-labeled either in strand III or in the strand II-strand IV complex . Spectroscopic data obtained with these partially labeled molecules show that the terminal helix of 5S RNA includes the GU and GC base pairs at positions 9 and 10 which the standard model for 5S secondary structure predicts {see Delihas, N., Anderson, J., & Singhal, R . P . (1984) Prog . Nucleic Acid Res . Mol . Biol . 31, 161-190} but that these base pairs are unstable both in the fragment and in native 5S RNA . The data also assign three resonances to the helix V region of the molecule (bases 70-77 and 99-106) . None of these resonances has a "normal" chemical shift even though two of them correspond to AU or GU base pairs in the standard model . The implications of these findings for our understanding of the structure of 5S RNA and its complex with ribosomal protein L25 are discussed. Biochemistry, 1987 Aug 11, 26(16), 5070 - 6 The protein synthesis initiation factor 2 G-domain . Study of a functionally active C-terminal 65-kilodalton fragment of IF2 from Escherichia coli; Cenatiempo Y et al.; Protein synthesis initiation factor 2 (IF2) is present in Escherichia coli cells as two forms which are expressed from the same gene: IF2 alpha {97.3 kilodaltons (kDa)} and IF2 beta (79.7 kDa) . During isolation, a smaller form, IF2 gamma, is generated, presumably by partial proteolysis . It has been purified to homogeneity and has an apparent mass of 70 kDa, as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis . Immunoelectrophoresis of IF2 alpha and IF2 gamma shows that IF2 gamma is immunologically partially identical with IF2 alpha . The sequence of the 15 N-terminal amino acid residues of IF2 gamma was determined and compared with that of IF2 alpha . The N-terminal amino acid of IF2 gamma corresponds to Arg-290 of IF2 alpha, suggesting that IF2 gamma is generated by proteolytic cleavage of the Lys-289-Arg-290 bond of IF2 . Assuming a C terminus identical with IF2 alpha, we calculate that IF2 gamma comprises 601 amino acid residues and has a mass of 64.8 kDa . The truncated protein was tested for activities characteristic of IF2 in three in vitro assays: fMet-tRNA(fMet) binding to 70S ribosomes, N-terminal dipeptide synthesis in a DNA-dependent transcription/translation system, and ribosome-dependent GTP hydroly97-7 . The specific activities of IF2 gamma were comparable with, or only slightly less than, those for IF2 alpha, indicating that IF2 gamma contains the active centers for interaction with fMet-tRNA(fMet), ribosomes, and GTP . A central region in the primary structure of IF2 shows extensive sequence homology with a number of GDP-binding proteins and especially with the G-domain of elongation factor Tu (EF-Tu).(ABSTRACT TRUNCATED AT 250 WORDS) FEBS Lett, 1987 Aug 10, 220(1), 126 - 8 Studies on interaction of 5 S RNA with ribosomal proteins; Kargel HJ et al.; Proteins of the large ribosomal subunit of rat liver (TP 60) were immobilized by diffusion transfer onto nitrocellulose after two-dimensional polyacrylamide gel electrophoresis (2-D PAGE) . Incubation of the TP 60 blots with 32P-labeled 5 S RNA under defined ionic conditions (300 mM KCl, 20 mM MgCl2) resulted in specific binding to a limited set of ribosomal proteins consisting of proteins L3, L4, L6, L13/15 and--to a lesser extent--L7 and L19 . Under identical conditions, blots with proteins of the small ribosomal subunit (TP 40) did not bind 5 S RNA. J Biol Chem, 1987 Aug 5, 262(22), 10801 - 6 Gene for yeast glutamine tRNA synthetase encodes a large amino-terminal extension and provides a strong confirmation of the signature sequence for a group of the aminoacyl-tRNA synthetases; Ludmerer SW et al.; The gene for the yeast Saccharomyces cerevisiae glutamine tRNA synthetase is shown here to encode a protein of 809 amino acids . This contrasts with the 551 amino acids of the Escherichia coli glutamine tRNA synthetase . The yeast GLN4 transcripts have 5' termini that start approximately 25 nucleotides in front of the long open reading frame . Much of the extra size of the yeast enzyme is due to a large amino-terminal extension . At codon 225, the yeast enzyme aligns with the amino terminus of the E . coli protein . From this point on, the two sequences have an average of 40% identity, with a few small gaps for alignment, until their respective carboxyl termini . At codon 254 of the yeast and codon 30 of the E . coli enzyme, however, there starts an exact 15-amino acid match between the two proteins . This match encompasses and is partially the same as a short sequence which is a signature sequence for the amino acid group of the bacterial aminoacyl-tRNA synthetases which are specific for different amino acids . This is the strongest sequence match found between any yeast cytoplasmic or mitochondrial aminoacyl-tRNA synthetase with its bacterial homologue . This region of the structure is associated with a nucleotide fold . The result provides strong validation of the signature sequence, especially for sequences where the homology relationships are less dramatic than in this example . Because the 224-amino acid extension of the yeast enzyme does not align with any part of the E . coli enzyme, we propose that it is not associated directly with the catalytic function of the enzyme . Its possible function is investigated in the accompanying paper. J Biol Chem, 1987 Aug 5, 262(22), 10565 - 9 Identification and nucleotide sequence of a gene encoding 5'-phosphoribosylglycinamide transformylase in Escherichia coli K12; Smith JM et al.; 5'-Phosphoribosylglycinamide transformylase (EC 2.1.2.2), encoded by the purN gene of Escherichia coli, catalyzes the synthesis of 5'-phosphoribosylformylglycinamide from 5'-phosphoribosylglycinamide (GAR) . The mature protein, as deduced from the purN structural gene sequence, contains 212 amino acid residues and has a calculated Mr of 23,241 . The purN gene is located adjacent to and immediately downstream from the purM gene encoding 5'-phosphoribosyl-5-aminoimidazole (AIR) synthetase where the initiation codon for GAR transformylase overlaps the termination codon of AIR synthetase . Based on polarity studies, the expression of the purN gene originates from the purM control region and thus forms a purMN operon . The E . coli GAR transformylase shows greater homology to the GAR transformylase domain of the trifunctional Gart polypeptide of Drosophila than to the single GAR transformylase of Saccharomyces . Immediately downstream from the purN gene of the purMN operon is a region of dyad symmetry capable of forming a hairpin stem and loop structure characteristic of a rho-independent terminator. J Biol Chem, 1987 Aug 5, 262(22), 10532 - 6 Cytochrome b558 monitors the steady state redox state of the ubiquinone pool in the aerobic respiratory chain of Escherichia coli; Lorence RM et al.; The aerobic respiratory chain of Escherichia coli contains two terminal oxidases, the cytochrome o complex and the cytochrome d complex . These both function as ubiquinol-8 oxidases and reduce molecular oxygen to water . Electron flux is funneled from a variety of dehydrogenases, such as succinate dehydrogenase, through ubiquinone-8, to either of the terminal oxidases . A strain was examined which lacks the intact cytochrome d complex, but which overproduces one of the two subunits of this complex, cytochrome b558 . This cytochrome, in the absence of the other subunit of the oxidase complex, does not possess catalytic activity . It is shown that the extent of reduction of cytochrome b558 in the E . coli membrane monitors the extent of reduction of the quinone pool in the membrane . The activity of each purified oxidase was examined in phospholipid vesicles as a function of the amount of ubiquinone-8 incorporated in the bilayer . A ratio of ubiquinol-8:phospholipid as low as 1:200 is sufficient to saturate each oxidase . The maximal turnover of the oxidases in the reconstituted system is considerably faster than observed in E . coli membranes, demonstrating that the rate-limiting step in the E . coli respiratory chain is at the dehydrogenases which feed electrons into the system. J Biol Chem, 1987 Aug 5, 262(22), 10475 - 80 Structure of Escherichia coli dnaC . Identification of a cysteine residue possibly involved in association with dnaB protein; Nakayama N et al.; The nucleotide sequence of the Escherichia coli dnaC gene and the primary structure of the dnaC protein were determined . The NH2-terminal amino acid sequence of the dnaC protein matched that predicted from the nucleotide sequence of the 735-base pair coding region . The dnaC gene lacks characteristic promoter structures; neither the "Pribnow box" nor the "-35 sequence" was detected within 222 base pairs upstream from the initiator ATG codon . There is, however, a typical Shine-Dalgarno sequence 7-10 base pairs before the ATG codon . An upstream open reading frame, separated by just 2 base pairs from the coding region of dnaC, encodes the COOH-terminal half of the dnaT product (protein i; Masai, H., Bond, M . W., and Arai, K . (1986) Proc . Natl . Acad . Sci . U . S . A . 83, 1256-1260) . The dnaC protein contains 245 amino acids with a calculated molecular weight of 27,894 consistent with the observed value (29,000) . Similar to dnaG and dnaT, dnaC uses several minor codons; the significance of these minor codons to the low level expression of the protein product in E . coli cells remains to be determined . The in vitro site-directed mutagenesis method was employed to determine the functional region involved in interaction with dnaB protein . The first cysteine residue located in the NH2-terminal region of the dnaC protein (Cys69) was shown to be important for this activity . Overall sequence homology between dnaC protein and lambda P protein, functionally analogous to the dnaC protein in the lambda phage DNA replication, is not extensive . There are, however, several short stretches of homologous regions including the NH2-terminal eight amino acids and the Cys78 region of dnaC protein. J Biol Chem, 1987 Aug 5, 262(22), 10422 - 5 Inactivation of isocitrate dehydrogenase by phosphorylation is mediated by the negative charge of the phosphate; Thorsness PE et al.; The control of isocitrate dehydrogenase through phosphorylation is necessary for growth of Escherichia coli on acetate as the sole carbon source . To understand the mechanism by which phosphorylation inactivates isocitrate dehydrogenase, the sequence of icd, the isocitrate dehydrogenase structural gene, was determined and this information was used to construct mutants at the site of phosphorylation . Introduction of a negatively charged aspartate for the serine that is phosphorylated completely inactivates isocitrate dehydrogenase . Substitution of the serine with other amino acids results in a partially active enzyme in which both maximal velocity and interaction with substrates has been altered . Neither threonine nor tyrosine, when substituted for the serine at the phosphorylation site, is detectably phosphorylated by isocitrate dehydrogenase kinase. J Biol Chem, 1987 Aug 5, 262(22), 10695 - 705 Cloning and sequence analysis of the mouse genomic locus encoding the largest subunit of RNA polymerase II; Ahearn JM Jr et al.; The genomic locus (RPII215) encoding the largest subunit of mouse RNA polymerase II has been cloned by low stringency hybridization to a Drosophila RPII215 probe . The mouse gene consists of 28 exons which span 30 kilobases . Analysis of the nucleotide and predicted protein sequences indicates that the protein is comprised of two domains . There is a 1500 residue amino-terminal domain which contains seven regions strikingly similar to those in the beta' subunit of Escherichia coli RNA polymerase, and a carboxyl-terminal domain comprised of 52 repeats of a 7-amino-acid consensus sequence Tyr-Ser-Pro-Thr-Ser-Pro-Ser . Among the seven highly conserved regions are a strongly basic domain consistent with a DNA-binding site and a consensus sequence characteristic of a potential zinc-binding domain . The 5' upstream region contains three tandem sequences similar to binding sites for the transcription factor SP1 . Two of the introns in this gene splice at donor GC dinucleotides as opposed to previously described invariant GT sites . The identification of regions which are highly conserved as compared with bacterial and yeast RNA polymerase and other regions which are unique to the mouse protein suggests which domains of RNA polymerase large subunits are involved in aspects of transcription common to both procaryotes and eucaryotes and which are characteristic of transcription in higher organisms. J Mol Biol, 1987 Aug 5, 196(3), 497 - 504 RecA protein and SOS . Correlation of mutagenesis phenotype with binding of mutant RecA proteins to duplex DNA and LexA cleavage; Lu C et al.; The RecA protein of Escherichia coli is required for SOS-induced mutagenesis in addition to its recombinational and regulatory roles . We have suggested that RecA might participate directly in targeted mutagenesis by binding preferentially to the site of the DNA damage (e.g . pyrimidine dimer) because of its partially unwound nature; DNA polymerase III will then encounter RecA-coated DNA at the lesion and might replicate across the damaged site more often but with reduced fidelity . In support of this proposal, we have found that the phenotype of wild-type and mutant RecA for mutagenesis correlates with capacity to bind to double-stranded DNA . Wild-type RecA binds more efficiently to ultraviolet (u.v.)-irradiated, duplex DNA than to non-irradiated DNA . The RecA441 (Tif) protein that is constitutive for mutagenesis binds extremely well to double-stranded DNA with no lesions, whereas the RecA430 protein that is defective in mutagenesis binds poorly even to u.v.-irradiated DNA . The RecA phenotype also correlates with capacity to use duplex DNA as a cofactor for cleavage of the LexA repressor protein for SOS-controlled operons . Wild-type RecA provides efficient cleavage of LexA only with u.v.-irradiated duplex DNA; RecA441 cleaves well with non-irradiated DNA; RecA430 gives very poor cleavage even with u.v.-irradiated DNA . We conclude that the interaction of RecA with damaged double-stranded DNA is likely to be a critical component of SOS mutagenesis and to define a pathway for the LexA cleavage reaction as well. J Biol Chem, 1987 Aug 5, 262(22), 10518 - 23 Dynamics of termination during in vitro replication of ultraviolet-irradiated DNA with DNA polymerase III holoenzyme of Escherichia coli; Shwartz H et al.; During in vitro replication of UV-irradiated single-stranded DNA with Escherichia coli DNA polymerase III holoenzyme termination frequently occurs at pyrimidine photodimers . The termination stage is dynamic and characterized by at least three different events: repeated dissociation-reinitiation cycles of the polymerase at the blocked termini; extensive hydrolysis of ATP to ADP and inorganic phosphate; turnover of dNTPs into dNMP . The reinitiation events are nonproductive and are not followed by further elongation . The turnover of dNTPs into dNMPs is likely to result from repeated cycles of insertion of dNMP residues opposite the blocking lesions followed by their excision by the 3'----5' exonucleolytic activity of the polymerase . Although all dNTPs are turned over, there is a preference for dATP, indicating that DNA polymerase III holoenzyme has a preference for inserting a dAMP residue opposite blocking pyrimidine photodimers . We suggest that the inability of the polymerase to bypass photodimers during termination is due to the formation of defective initiation-like complexes with reduced stability at the blocked termini. J Mol Biol, 1987 Aug 5, 196(3), 525 - 40 Mechanism of ribosomal translocation . tRNA binds transiently to an exit site before leaving the ribosome during translocation; Robertson JM et al.; Escherichia coli ribosomes have a site (E) to which deacylated tRNA binds transiently before leaving the ribosome during translocation . The affinity of the site is Mg2+ dependent and low at physiological Mg2+ concentrations . Correct codon-anticodon interaction is unnecessary in this site . With these features, the E site cannot reduce frameshift errors through additional mRNA anchorage . Occupancy of the A site does not influence the tRNA binding in the E site, although a conformational change of elongation factor G, brought about by GTP hydrolysis, is necessary for efficient tRNA release . The tRNA can dissociate unhindered from the E site when the elongation factor is bound to the ribosome by fusidic acid . During elongation, the thermodynamically stable state is not attained, since E site occupation inhibits translocation . However, the E site can aid elongation by providing an intermediate state for tRNA dissociation, dispersing the process into more than one step. J Biol Chem, 1987 Aug 5, 262(22), 10706 - 11 The epsilon subunit and inhibitory monoclonal antibodies interact with the carboxyl-terminal region of the beta subunit of Escherichia coli F1-ATPase; Tozer RG et al.; The epitopes of two classes of monoclonal antibody and the binding site for the epsilon subunit have been mapped to the carboxyl-terminal region of the beta subunit of Escherichia coli F1-ATPase using partial CNBr cleavage, weak acid hydrolysis, and Western blots . One class of antibody, B-I, inhibits ATPase activity; the other class, B-II, recognizes an epitope not exposed on the surface of intact F1 . Data from two-dimensional gels and blots of beta cleaved with CNBr/weak acid showed that the B-I epitope lies between Asp-381 and the carboxyl-terminal Leu-459, and the B-II epitope lies between Asp-345 and Met-380 . Weak acid hydrolysis of the beta-epsilon product obtained by cross-linking F1 with a water-soluble carbodiimide yielded a fragment containing epsilon and a 13-kDa carboxyl-terminal fragment of beta indicating that epsilon interacts with this portion of beta as well . Fab fragments from the B-I antibody beta-6 could be cross-linked to the epsilon subunit in native F1 by various cross-linking agents demonstrating that the antibody and the epsilon subunit occupy adjacent, nonoverlapping sites on the beta subunit . Implications of these results for the roles of the epsilon subunit and of the carboxyl-terminal region of the beta subunit in F1 are discussed. J Biol Chem, 1987 Aug 5, 262(22), 10684 - 8 Synthesis and characterization of fluorescent dinucleotide substrate for the DNA-dependent RNA polymerase from Escherichia coli; Tyagi SC et al.; New fluorescent derivatives of dinucleoside monophosphates, (5'-AmNS)UpA/ApU/GpU/CpA, with a fluorophore, 1-aminonaphthalene-5-sulfonic acid (AmNS), attached to the first nucleotide of the dinucleoside monophosphates via a 5'-secondary amine linkage were synthesized in good yield . The chemical structure of (5'-AmNS)ApU was proved by the phosphodiesterase digestion followed by Whatman No . 3MM paper chromatographic and spectroscopic analysis of the digested products . The ability of these analogs to be incorporated into the 5' terminus of RNA chain forming fluorescent oligonucleotides by Escherichia coli RNA polymerase was studied in the presence of a synthetic DNA template . The enzymatic reaction of (5'-AmNS)UpA and {3H}UTP in the presence of poly(dA-dT) yielded (5'-AmNS)UpAp{3H}U in greater than 30% yield with the Km values of 5 and 2.5 microM and Vmax values of 17 and 25 nmol/min/mg of enzyme for (5'-AmNS)UpA and UpA, respectively . The structure of this fluorescent trinucleotide was identified by RNase A digestion and paper chromatographic analysis of the digested products . (5'-AmNS)UpA or (5'-AmNS)ApU exhibits two absorption maxima around 270 and 340-350 nm and a fluorescent emission maximum at 445 nm when excited at 340 nm . These spectral characteristics permit their use as energy donors for the transfer of energy to the intrinsic cobalt of the cobalt-substituted RNA polymerases . Upon hydrolysis of the phosphodiester bond of these analogs by venom phosphodiesterase, the absorption at 340 and 270 nm increased by 5 and 20%, respectively, while their fluorescence at 445 nm was enhanced by 25% . Thus, these analogs can be used for studying the dynamics of initiation and elongation reactions catalyzed by DNA-dependent RNA polymerases by absorption and fluorescence spectroscopies. Eur J Biochem, 1987 Aug 3, 166(3), 631 - 7 Partial purification and specificity studies of the D-glutamate-adding and D-alanyl-D-alanine-adding enzymes from Escherichia coli K12; Michaud C et al.; The D-glutamate-adding and D-alanyl-D-alanine-adding enzymes from Escherichia coli were partially purified by fast protein liquid chromatography on an anion exchanger . Their relative molecular masses, determined by gel filtration on Superose 12, were 54,000 +/- 2000 and 51,000 +/- 2000, respectively . In order to investigate the specificity of these ligases, several compounds derived from their respective nucleotide substrates were prepared . In the case of the D-Glu-adding enzyme, DDP-MurNAc-L-Ala (DDP = dihydrouridine 5'-diphosphate) and P1-MurNAc-L-Ala were substrates of the reaction . In the case of the D-Ala-D-Ala-adding enzyme, only DDP-MurNAc-L-Ala-D-Glu(-meso-A2pm) was a substrate; P1-MurNAc-L-Ala-D-Glu(-meso-A2pm) was neither a substrate nor an inhibitor . Concerning the amino acid site of the D-Glu-adding enzyme, even closely related analogues of D-glutamate hardly inhibited the reaction. Eur J Biochem, 1987 Aug 3, 166(3), 611 - 6 Studies of the functional topography of Escherichia coli RNA polymerase . Affinity labelling of RNA polymerase in a promoter complex by phosphorylating derivatives of primer oligonucleotides; Godovikova TS et al.; Amidation of the 5'-phosphate group of the heptanucleotide pdApdApdApdTpdCpdGprC and of its derivatives of the general formula (pdN)npdGprC (n = 0-5) with imidazole, N-methylimidazole, and 4-dimethylaminopyridine afforded a series of phosphorylating affinity reagents . The parent oligonucleotides of this series complementary to promoter A2 of T7 phage over the region (-5 to +2) are known to be efficient primers of the synthesis of RNA by Escherichia coli RNA polymerase with promoter A2 as template . Treatment of the complex RNA-polymerase X promoter-A2 with affinity reagents followed by addition of {alpha-32P}UTP resulted in labelling of RNA polymerase by the residues -(pdN)npdGprCprU (p = radioactive phosphate) . This affinity labelling was highly selective because elongation of the covalently bound residues (pdN)npdGprC by prU residues was catalyzed by the active center of RNA polymerase . The most efficient reagents were N-methylimidazolides . A dramatic change of the pattern of labelling of the subunits beta, beta', and sigma took place with changing n . Maximum labelling of the beta subunit occurred at n = 1 and of the sigma subunit at n = 5 . The targets in both the subunits were His residues . The alpha subunit was not specifically labelled. Eur J Biochem, 1987 Aug 3, 166(3), 533 - 8 Processing of a plant vacuolar protein precursor in vitro; Hattori T et al.; A precursor for sporamin A, the storage protein of the tuberous roots of sweet potato deposited in the vacuole, is synthesized on membrane-bound polysomes and has an extra peptide of 37 amino acids at the N-terminus of the mature form, which can be divided into an N-terminal putative signal peptide sequence (residues -37 to -17) and a segment enriched with charged amino acids (residues -16 to -1) {Hattori, T., et al . (1985) Plant Mol . Biol . 5, 313-320} . We examined the in vitro processing of the sporamin A precursor using a messenger RNA derived from a full-length cDNA by the SP6 transcription system . When the in vitro translation in a wheat germ cell-free system was carried out in the presence of dog pancreas microsomal membranes, the precursor polypeptide (Mr = 24,000) was processed into an intermediate form still larger than the mature polypeptide (Mr = 20,000) . The processed intermediate form was also produced by addition of microsomal membranes from sweet potato and potato in the translation reaction, although less efficiently compared to dog membranes . Moreover, Escherichia coli cells expressing sporamin precursor accumulated a polypeptide with the same electrophoretic mobility as the intermediate form produced in vitro . The processing by dog membranes is accompanied by translocation of the polypeptide across the membranes as assayed by resistance to externally added proteases . The N-terminal amino acid sequencing analysis of {3H}leucine-labelled intermediate form produced in vitro by dog membranes indicated that co-translational processing of the sporamin precursor by endoplasmic reticulum membranes removes only the signal peptide segment from the extra peptide, and suggested that the charged segment following the signal peptide is removed post-translationally during the transport of sporamin into vacuole . The significance of two-step processing of plant vacuolar protein precursor is discussed in relation to the two-step processing of precursors for yeast vacuolar proteins and animal lysosomal proteins. Eur J Biochem, 1987 Aug 3, 166(3), 623 - 30 The role of iron in the activation of mannonic and altronic acid hydratases, two Fe-requiring hydro-lyases; Dreyer JL; D-Altronate hydratase and D-mannonate hydratase belong to a class of Fe2+-requiring enzymes, but the function of iron in these enzymes is largely unknown . Methods are described for the convenient preparation of both these hydratases from Escherichia coli and studies related to metal activation are presented . The enzymes are inactive in the absence of a bivalent metal and a reducing agent such as dithiothreitol . Fe2+ at low concentrations activates the enzymes efficiently, but inhibits them over 2 mM . Furthermore Mn2+ is also capable of activating aldonic acid hydratases and appears to be a constituent of the enzyme active center . A marked synergistic activation is observed in the presence of both ions, raising the possibility that the enzyme has two binding sites for ions . Upon activation, the two aldonic acid hydratases incorporate a single Fe atom and contain no Fe-S core, in contrast to other characterized Fe-hydratases, such as aconitase or maleic acid hydratase . The incorporated iron is losely bound (with Kd about 4.5 mM and 20 mM for mannonate and altronate hydratase, respectively) and can be readily removed with EDTA . The enzymes exhibit no requirement for sulphide ions and are insensitive to thiol reagents . A first-order inhibition is observed with iron chelators and can be removed by competition with excess metal ions . No change in the absorption spectra is observed upon oxidation-reduction or activation with metals . The activated enzymes exhibit no electron paramagnetic (EPR) spectrum under anaerobic conditions; in the presence of oxygen, an intense EPR spectrum develops in Fe2+-activated samples with signal at g = 1.98, which upon reaction of the enzyme with the substrate moves into a species with signals at g = 4.15 and g = 9.07, with EPR parameters very similar to those of oxidized rubredoxins. J Appl Physiol, 1987 Aug, 63(2), 840 - 50 Antioxidants protect cultured bovine lung endothelial cells from injury by endotoxin; Brigham KL et al.; Endotoxin injures bovine pulmonary endothelial cells in culture but the cytotoxicity is unaffected by a host of antiinflammatory drugs . We hypothesized that agents which could decrease intracellular concentrations of toxic metabolites of O2 would prevent endotoxin effects on cultured pulmonary artery endothelial cells . We measured endotoxin-induced release of lactate dehydrogenase (LDH) from and production of prostanoids by cultured bovine pulmonary endothelial cells in the presence and absence of dimethyl sulfoxide (DMSO) and the xanthine oxidase inhibitor allopurinol . Escherichia coli endotoxin (0.001-10 micrograms/ml) caused a dose-related release of LDH and stimulated production of both prostacyclin {measured as 6-ketoprostaglandin F1 alpha (6-keto-PGF1 alpha)} and prostaglandin E2 (PGE2) . Both DMSO and allopurinol decreased endotoxin-induced LDH release; this effect was related to concentration of the drugs (0-2% for DMSO and 0-0.3 mg/ml for allopurinol) . Both drugs also prevented endotoxin-induced changes in endothelial morphology . Endotoxin increased intracellular reduction of the redox dye nitro blue tetrazolium, caused intracellular oxidation of 2',7'-dichlorofluorescein diacetate and caused release of conjugated dienes from endothelial cells; both DMSO and allopurinol inhibited those responses . DMSO, but not allopurinol, prevented endotoxin-induced production of prostacyclin and PGE2 by endothelium . Direct injury of pulmonary endothelium by endotoxin is inhibited by two chemically dissimilar drugs which have a common potential for decreasing intracellular concentrations of toxic metabolites of O2; indirect evidence suggests that potential as a mechanism for the protective effects of the drugs. J Surg Res, 1987 Aug, 43(2), 158 - 63 An assessment of monocyte procoagulant activity in patients with solid tumors; Dasmahapatra KS et al.; Generation of thromboplastin by monocytes has been shown to play a vital role in hypercoagulable states seen in malignancy . The purpose of this study was to compare the procoagulant activity in cancer patients and controls . Recalcification times (RT) of whole blood from 19 normal volunteers, 8 patients with benign polyps, 12 patients previously treated by surgery for head and neck (H&N) or colon cancer, and 13 untreated patients with various stages of H&N or colon cancer were determined . Tests were performed with and without stimulation with Escherichia coli endotoxin . The mean RT in saline (RTS) of untreated patients with early cancer (4.58 +/- 0.83 min) and that of patients with advanced cancer (5.23 +/- 1.16 min) were lower than that of controls (6.55 +/- 0.82 min), P less than 0.01 and P less than 0.05, respectively . The RTS of patients previously treated and of those with benign polyps were no different from those of controls . Activation with endotoxin significantly lowered the recalcification times (RTE) in the early (3.90 +/- 0.58 min) and advanced cancer patients (4.23 +/- 0.66 min) compared to the RTE of controls (5.69 +/- 0.75 min, P less than 0.01 for both groups) as well as compared to those with benign tumors, P less than 0.05 . The mean RTE of previously treated patients (4.72 +/- 0.58 min) was also lower than that of controls, P less than 0.05 . Our results suggest that RT is significantly reduced in cancer patients compared to that of controls . Furthermore, monocyte activation with endotoxin may enable us to distinguish cancer patients from controls as well as from those with benign tumors. Transplantation, 1987 Aug, 44(2), 254 - 60 Kinetics of natural killer cell cytotoxicity during the graft-versus-host reaction . Relationship between natural killer cell activity, T and B cell activity, and development of histopathological alterations; Ghayur T et al.; The relationships between splenic natural killer (NK) cell cytotoxicity, T and B cell function, and the development of histopathological lesions in the liver and pancreas have been studied during the course of graft-versus-host (GVH) reactions . GVH reactions were induced in (C57BL/6 X A)F1 (B6AF1) hybrids by different doses, (10,20 and 30 X 10(6)) of either parental strain C57/BL6 (B6) or A lymphoid cells . Splenic NK cell cytotoxicity was studied by employing YAC-1, an NK-cell-sensitive target . Splenic T and B cell function were assessed by mitogen responsiveness to concanavalin A, phytohemagglutinin, and Escherichia coli lipopolysaccharide, and by the in vitro plaque-forming cell response to sheep red blood cells . Histopathological lesions characteristic of GVH reactions were recognized at a time (day 8 after GVH induction) when both T and B cell functions were totally suppressed and NK cell activity was greatest . The severity of histopathological alterations later (day 16 after GVH induction) correlated with an early peak in NK cell cytotoxicity rather than with the overall NK cell activity . When low doses (10,20 X 10(6)) of B6 cells were employed to induce GVH reactions, a significant increase in NK cell activity was observed, yet neither histopathological alterations nor suppression of T and B cell functions were observed . The killing of YAC-1 targets by splenocytes obtained from the different GVH combinations could not be abrogated by pretreatment with anti-Thy 1.2 serum plus complement, suggesting that T lymphocytes were not central to this cytolytic process . These experiments demonstrated that: (1) an inverse relationship between T and B cell function and NK cell activity was observed early after GVH induction, (2) the severity of histopathological lesions and immunosuppression, as well as the degree of overall augmented NK cell activity, was determined by the dose and genotype of donor cells injected to induce GVH reactions, and (3) GVH-associated moderate-severe lesions occurred only in groups in which NK cell activity peaked early--whereas when NK cell activity peaked later, either mild or no lesions were observed, suggesting that the early rapid increase of NK cell activity may be useful for predicting the severity of GVH pathogenesis. J Cell Physiol, 1987 Aug, 132(2), 246 - 54 Interactions of dimethyl sulfoxide and granulocyte-macrophage colony-stimulating factors on the growth and maturation of HL-60 cells; Brennan JK et al.; We have studied the interactions of dimethyl sulfoxide (DMSO), Giant Cell Tumor (GCT) cell-conditioned medium (GCT CM), and highly purified granulocyte-macrophage colony-stimulating factors (GM-CSF) on the growth and maturation of a highly passaged population of HL-60 cells . DMSO produced dose-dependent inhibition of HL-60 growth in liquid and semisolid media . Growth was partially to completely restored by the addition of GCT CM to cultures . Experiments in which cell volume, cell cycle kinetics, tritiated thymidine (3HTdr) incorporation, cell number, and nitroblue tetrazolium (NBT) reduction were compared during culture indicated that DMSO inhibited the spontaneous increase in cell volume and flow of cells through the cell cycle which occurred in the first day of culture, the increase in 3HTdr incorporation which was detectable by day 2; and the increment in cell counts which occurred by day 3 . These effects were opposed by GCT CM . In contrast, the DMSO-induced increase in NBT reduction which occurred by day 6 was not influenced by GCT CM . The major principle opposing DMSO was GM-CSF, since (1) highly purified GM-CSF from GCT cells and recombinant GM-CSF from COS cells transfected with the Mo cell GM-CSF gene overcame greater than 50% of DMSO inhibition; and (2) conditioned media from cells not producing CSF, G-CSF from GCT cells, and recombinant G-CSF from Escherichia coli transfected with the G-CSF gene from 5,637 cells were inactive . DMSO had little or no effect on the elaboration of autostimulatory activity by HL-60 cells . DMSO is a useful agent for inhibiting the spontaneous growth of HL-60 cells and restoring their dependence on GM-CSF, a property which may be mediated through the effects of DMSO on cell cycle kinetics and/or maturation. Proc Natl Acad Sci U S A, 1987 Aug, 84(16), 5580 - 4 Topography and stoichiometry of acidic proteins in large ribosomal subunits from Artemia salina as determined by crosslinking; Uchiumi T et al.; The 60S subunits isolated from Artemia salina ribosomes were treated with the crosslinking reagent 2-iminothiolane under mild conditions . Proteins were extracted and fractions containing crosslinked acidic proteins were obtained by stepwise elution from CM-cellulose . Each fraction was analyzed by "diagonal" (two-dimensional nonreducing-reducing) NaDodSO4/polyacrylamide gel electrophoresis . Crosslinked proteins below the diagonal were radioiodinated and identified by two-dimensional acidic urea-NaDodSO4 gel electrophoresis . Each of the acidic proteins P1 and P2 was crosslinked individually to the same third protein, P0 . The fractions containing acidic proteins were also analyzed by two-dimensional nonequilibrium isoelectric focusing-NaDodSO4/polyacrylamide gel electrophoresis . Two crosslinked complexes were observed that coincide in isoelectric positions with monomeric P1 and P2, respectively . Both P1 and P2 appear to form crosslinked homodimers . These results suggest the presence in the 60S subunit of (P1)2 and (P2)2 dimers, each of which is anchored to P0 . Protein P0 appears to play the same role as L10 in Escherichia coli ribosomes and may form a pentameric complex with the two dimers in the 60S subunits. Protein Eng, 1987 Aug-Sep, 1(4), 353 - 8 Expression of synthetic genes coding for completely new, nutritionally rich, artificial proteins; Biernat J et al.; Synthetic genes (A, AB and AHB) constructed and cloned into pKK233-2 vector were recloned from the parent plasmid into the new procaryotic expression vectors pGFY221N and pBI052 . Gene AF-B (coding for all amino acids besides phenylalanine) was obtained by 'cassette mutagenesis' from gene AB . The plasmid pGFY221N was constructed from pGFY218L by replacing the PstI by an NcoI site; plasmid pBI052 was derived from pGFY221N through replacing the 221-bp EcoRI/NcoI fragment with a synthetic DNA segment of 52 bp representing the Escherichia coli atpE gene translational initiation region . The genes A, AB, AHB and AF-B in the vector pGFY221N were expressed with a six-amino-acid-long leader sequence; in pBI052 the genes were expressed directly . In vitro expression experiments were successfully with all the genes except with the AHB gene integrated into pGFY221N . In the E . coli minicell system expression was demonstrated with the A gene in pGFY221N and the AF-B and AHB genes in pBI052 . Complete translation of the expressed genes AB, AF-B and AHB in either the in vitro or in vivo systems could be shown by using 35S-labelled N-terminal methionine and C-terminal cysteine . Both amino acids occur only once in the peptide sequences. Protein Eng, 1987 Aug-Sep, 1(4), 339 - 43 Expression of the synthetic gene of an artificial DDT-binding polypeptide in Escherichia coli; Moser R et al.; This paper reports the expression of an artificial functional polypeptide in bacteria . The gene of a designed 24-residue DDT-binding polypeptide (DBP) was inserted between the BamHI and PstI cleavage sites of plasmid pUR291 . The hybrid plasmid, pUR291-DBP, was cloned in Escherichia coli JM109 . After induction by isopropyl-beta-D-thiogalactopyranoside a fusion protein was expressed in which DBP was linked to the COOH-terminus of beta-galactosidase . DBP, which is stable to trypsin, was obtained by tryptic digestion of the fusion protein and subsequent fractionation of the tryptic peptides by reversed-phase h.p.l.c . Recombinant and chemically synthesized DBP showed identical chromatographic properties, amino acid composition, and chymotryptic digestion patterns . Both the beta-galactosidase-DBP fusion and isolated recombinant DBP bound DDT . The fusion protein was 25 times as potent as the designed 24-residue DBP in activating a cytochrome P-450 model system using equimolar catalytic amounts of the two proteins. Protein Eng, 1987 Aug-Sep, 1(4), 333 - 8 Point mutation of alanine (31) to valine prohibits the folding of reduced lysozyme by sulfhydryl-disulfide interchange; Imoto T et al.; In the preceding paper in this issue, we described the overproduction of one mutant chicken lysozyme in Escherichia coli . Since this lysozyme contained two amino acid substitutions (Ala31----Val and Asn106----Ser) in addition to an extra methionine residue at the NH2-terminus, the substituted amino acid residues were converted back to the original ones by means of oligonucleotide-directed site-specific mutagenesis and in vitro recombination . Thus, four kinds of chicken lysozyme {Met-1Val31Ser106-, Met-1Ser106-, Met-1Val31- and Met-1 (wild type)} were expressed in E . coli . From the results of folding experiments of the reduced lysozymes by sulfhydryl-disulfide interchange at pH 8.0 and 38 degrees C, followed by the specific activity measurements of the folded enzymes, the following conclusions can be drawn: (i) an extra methionine residue at the NH2-terminus reduces the folding rate but does not affect the lysozyme activity of the folded enzyme; (ii) the substitution of Asn106 by Ser decreases the activity to 58% of that of intact native lysozyme without changing the folding rate; and (iii) the substitution of Ala31 Val prohibits the correct folding of lysozyme . Since the wild type enzyme (Met-1-lysozyme) was activated in vitro without loss of specific activity, the systems described in this study (mutagenesis, overproduction, purification and folding of inactive mutant lysozymes) may be useful in the study of folding pathways, expression of biological activity and stability of lysozyme. Protein Eng, 1987 Aug-Sep, 1(4), 327 - 32 Construction of a plasmid vector for the regulatable high level expression of eukaryotic genes in Escherichia coli: an application to overproduction of chicken lysozyme; Miki T et al.; A novel expression vector pKP1500 for synthesizing unfused protein in Escherichia coli was constructed . pKP1500 perserves the tac promoter, the lacZ SD sequence, unique restriction sites (EcoRI, SmaI, BamHI, SalI, PstI and HindIII) and the rrnB terminators of pKK223-3, but the replication origin is replaced with that of pUC9 . Construction of this plasmid is based upon the observation that the copy number control of pUC9 is temperature dependent . At 28 degrees C, the copy number of pKP1500 is less than 25 per chromosome, approximately the same copy number as that of pKK223-3, which contains the replication origin of pBR322, whereas at 42 degrees C, the copy number increases about 10 times and reaches up to 230 copies per chromosome . The main advantage of this system is that the temperature-dependent copy control and regulatable expression of the tac promoter make cells carrying pKP1500 derivatives stable against selective pressure by detrimental overproduction of foreign proteins at a low temperature and permits high expression of cloned DNAs at a high temperature . When chicken lysozyme cDNA carrying the initiation codon (ATG) immediately upstream from the Lys1 codon was inserted downstream from the tac promoter and the SD sequence, the pKP1500 derivative produced lysozyme at about 25% of the total cellular proteins . This value is more than 10 times higher than that obtained with the pKK223-3 derivative carrying the same lysozyme cDNA . By comparison, the expression of eukaryotic genes from the tac promoter reported by others has usually been less than a few % of the total cellular protein.(ABSTRACT TRUNCATED AT 250 WORDS) Zentralbl Bakteriol Mikrobiol Hyg {A}, 1987 Aug, 266(1-2), 231 - 8 The chromosomal fur gene regulates the extracellular haemolytic activity encoded by certain hly plasmids; Grunig HM et al.; The haemolytic activity encoded by thirteen hly-plasmids of different origin and sources was examined as a function of the Fe3+-concentration in E . coli fur+ and E . coli fur- strains, respectively . In E . coli fur+ the relatively low haemolytic activity of five hly-plasmids isolated in Berne and one isolated in Paris was increased significantly under iron-limiting growth conditions . Contrastingly, in E . coli fur- strains containing the same plasmids, a considerably higher amount of secreted haemolysin was detected . This activity could not be further increased by limiting the extracellular iron concentration . Seven other hly-plasmids expressed similar and non-inducible amounts of secreted haemolysin in both E . coli fur+ and E . coli fur- strains . These results indicate that the extracellular haemolytic activity encoded by certain hly-plasmids was controlled by the chromosomally encoded fur gene. Radioisotopes, 1987 Aug, 36(8), 389 - 94 Determination of DNA by sub- and super-equivalence method of isotope dilution analysis using enzyme reaction; Yoshioka H et al.; Sub- and super-equivalence method of isotope dilution analysis (SSE-IDA) using enzyme reaction was first applied for the determination of biological substance, DNA . Radioactive DNA (pUC18) to be analysed was prepared by incorporating 3H-thymidine in growing E . coli . A part of DNA was cut into the linear form (L-form) DNA under definite conditions using a restriction enzyme HindIII, following the separation of each by gel electrophoresis . Radioactivites of separated L-form DNA of two series were measured . The quantity of DNA was obtained by a graph method of SSE-IDA . As preliminary experiments, it was examined under what conditions the enzyme reaction proceeds as zeroth or first order reaction . We used the enzyme and substrate concentrations near zeroth order, where ordinary subst-IDA seems not to give a satisfactory results . As the results, 0.25 microgram of DNA was determined the error of about 10%. Agents Actions, 1987 Aug, 21(3-4), 366 - 70 High-level C5a gene expression and recovery of recombinant human C5a from Escherichia coli; Mollison KW et al.; Poor expression of a synthetic gene for the inflammatory mediator, C5a, was observed in E . coli grown in rich media . Varying the media composition markedly improved expression, although C5a levels still declined rapidly at the end of log phase . Using a protease-deficient strain, C5a was recovered at stationary phase in high yield (13 mg/liter of culture) . Recovery was dependent on guanidinium hydrochloride extraction to solubilize the protein and glutathione treatment to promote correct folding . Two-thirds of the C5a retained an amino-terminal methionine . Both forms of recombinant C5a had activity similar to serum-derived C5a in binding to human neutrophil receptors and inducing chemotaxis . The 700-fold improvement in yield made it feasible to obtain gram amounts of C5a and provides an efficient system for site-directed mutagenesis. Z Urol Nephrol, 1987 Aug, 80(8), 483 - 90 {Autovaccination in chronic pyelonephritis in the animal experiment--effect of cyclophosphamide on splenic and thymus lymphocytes}; Straube E et al.; In rats with experimental pyelonephritis, cyclophosphamide leads to changes in the spleen and thymus lymphocyte populations . When cyclophosphamide was given five times a week from the fifth week of infection on, the population of electrophoretically slow moving spleen lymphocytes, which are believed to be B-lymphocytes, decreased in the seventh week . This effect is independent of autovaccination . During the same period the number of immature slow moving thymus lymphocytes decreased . Further treatment with cyclophosphamide until the twelfth week of infection led to the differences almost disappearing in the histogramm . Cyclophosphamide showed a slight effect on antibody production and did not influence the elimination of infective agents from the kidneys of animals with pyelonephritis. Poult Sci, 1987 Aug, 66(8), 1276 - 82 Selection for early responsiveness of chicks to Escherichia coli and Newcastle disease virus; Pitcovski J et al.; A broiler chicken population was divergently selected for high or low early immune responses to Escherichia coli and to Newcastle disease virus (NDV) vaccines . Four selection cycles were performed in one replicate, and a single cycle in a second replicate . Selection was based on sire-family averages of a titer index (TI) calculated as the mean titer of antibodies produced by offspring vaccinated with either E . coli or NDV at 18 or 10 days of age, respectively . After the first selection cycle, TI of the early-high (EH) line were 22 and 38% greater than those of the early-low (EL) line in Replicates A and B, respectively . After four selection cycles, the average immune response to E . coli and NDV of Line EH exceeded that of Line EL by 68% . Viability was greater in the EH than in the EL line . Realized family heritabilities were .72 and .67 in Replicates A and B, respectively and the levels of response to the two antigens were not genetically correlated . The immune response of the EH line developed earlier than that in the EL line as shown by fewer nonresponders against E . coli and the higher response of this line against the two antigens at young ages . Mortality after challenge at 18 days of age and general mortality from hatching to 20 wk of age was lower in Line EH than in Line EL . Body weights at 7 wk were higher in EH than EL chicks. Genes Dev, 1987 Aug, 1(6), 626 - 35 Control of synthesis and positioning of a Caulobacter crescentus flagellar protein; Loewy ZG et al.; The Caulobacter crescentus flagellum is assembled during a defined time period in the cell cycle . Two genes encoding the major components of the flagellar filament, the 25K and the 27.5K flagellins, are expressed coincident with flagellar assembly . A third gene, flgJ, is also temporally regulated . The synthesis of the product of flgJ, the 29K flagellin, occurs prior to the synthesis of the other flagellin proteins . We demonstrate here that the time of initiation of flgJ expression is independent of chromosomal location but is dependent upon cis-acting sequences present upstream of the flgJ structural gene . Evidence that there is transcriptional control of flgJ expression includes the following: (1) The initial appearance of flgJ message was coincident with the onset of 29K flagellin protein synthesis, and (2) expression of an NPT II reporter gene driven by the flgJ promoter was temporally correct . Post-transcriptional regulation might contribute to the control of expression, because the flgJ mRNA persisted for a longer period of time than did the synthesis of the 29K protein . The 29K flagellin was found only in the progeny swarmer cell after cell division . In a mutant strain that failed to assemble a flagellum, the 29K flagellin still segregated to the presumptive swarmer cell, demonstrating that positioning of the protein is independent of filament assembly . Analysis of a chimeric flgJ-NPT II transcriptional fusion showed that the flgJ regulatory sequences do not control the segregation of the 29K flagellin to the swarmer cell progeny, suggesting that correct segregation depends on the protein product. Genes Dev, 1987 Aug, 1(6), 556 - 64 Escherichia coli tryptophan repressor binds multiple sites within the aroH and trp operators; Kumamoto AA et al.; DNase I footprinting and methylation protection studies have been used to analyze the binding of Escherichia coli Trp repressor to the trpR, aroH, and trp operators . The methylation protection assay shows that Trp repressor binds in two successive major grooves of the trpR operator, three successive major grooves of the aroH operator, and four successive major grooves of the trp operator . The simplest model that explains the difference in Trp repressor interaction at the three operators is that the aroH and trp operators are composed of multiple, helically stacked binding sites . When viewed in three dimensions, each site is positioned on a different face of the DNA, and together process up the surface of the DNA helix . Analysis of a deletion derivative of the trp operator supports this model. Genes Dev, 1987 Aug, 1(6), 525 - 31 Induction of the heat shock regulon does not produce thermotolerance in Escherichia coli; VanBogelen RA et al.; The addition of isopropyl thio-beta-D-galactoside (IPTG) to Escherichia coli cells containing multiple copies of the heat shock regulatory gene htpR (rpoH) under the control of an IPTG-inducible promoter (P-tac) induced 15 of the 17 polypeptides of the heat shock (HTP) regulon . The time course and magnitude of the induction closely resembled that caused by a shift to 42 degrees C . Nevertheless the two means of inducing the heat shock regulon differed in outcome . Cultures grown at 28 degrees C and induced by incubation at 42 degrees C for 15 min gave significant protection against a challenge temperature of 50 degrees C, but no protection was afforded by a 15-min IPTG treatment at 28 degrees C . It could be shown that there was no interference by IPTG with the development of thermotolerance at 42 degrees C . Also, treatment of a wild strain of E . coli with various toxic agents revealed no correlation between the development of thermotolerance and the induction of any subset of the heat shock proteins . Thermotolerance appears to develop by processes other than the htpR-dependent induction of heat shock proteins. Anal Biochem, 1987 Aug 1, 164(2), 434 - 8 A reverse-phase high-performance liquid chromatography assay for dihydroxy-acid dehydratase; Smyk-Randall EM et al.; A sensitive method for assaying dihydroxy-acid dehydratase activity is described . This enzyme produces alpha-ketoisovaleric and alpha-keto-beta-methylvaleric acids, respectively, in the biosynthesis of valine and isoleucine . These alpha-keto acids, after derivatization with 2,4-dinitrophenyl-hydrazine, were separated and quantified by reverse-phase high-performance liquid chromatography on a Zorbax octadecylsilane C-18 column . As little as 50 pmol of alpha-ketoisovaleric was detected in assays using cell-free extracts from Escherichia coli, whose measured specific activity was 8 mumol of alpha-ketoisovaleric acid produced per hour per milligram protein. Mol Cell Biol, 1987 Aug, 7(8), 2845 - 56 Heterologous expression and characterization of the human R-ras gene product; Lowe DG et al.; We directly expressed human R-ras 23,000-dalton protein (p23) cDNA in Escherichia coli under the control of the trp promoter . GTP-dependent phosphorylation of a p23 threonine 85 substitution mutant was observed . This result is in direct analogy to the autokinase activity of H-ras and K-ras threonine 59 substitution mutants . Normal p23 protein was detected in the human fibrosarcoma cell line HT1080 by immunoprecipitation with rabbit antibodies raised against an E . coli-expressed R-ras fusion protein . The R-ras p23 protein was found to be 3H labeled in the presence of {9,10(n)-3H}palmitic acid and is associated with the P100 membrane fraction of HT1080 cells . These data suggest that human R-ras p23 has biochemical properties very similar to those of the p21 products of the H-, K-, and N-ras proto-oncogenes . We constructed an R-ras minigene and engineered the expression of normal and mutant alleles from the simian virus 40 early region promoter . Normal and mutant R-ras gene products were authenticated by transient expression in COS-7 cells and immunoprecipitation . The valine 38-substituted R-ras p23 displayed reduced electrophoretic mobility . R-ras p21-like proteins, made by eliminating the first 26 R-ras codons, displayed evident mobility differences between the pro form and mature form, along with a valine 12 substitution-dependent change in electrophoretic mobility . Rat-1 fibroblasts were transfected with normal and mutant R-ras alleles and normal and activated H-ras alleles . Unlike the human T24 bladder oncogene-encoded p21, mutant R-ras alleles do not cause monolayer focus formation or growth in soft agar of rat fibroblasts. Mol Gen Genet, 1987 Aug, 209(1), 78 - 82 Asymmetric cytosine deamination revealed by spontaneous mutational specificity in an Ung- strain of Escherichia coli; Fix DF et al.; A collection of 164 spontaneous lacI- mutations were recovered from a uracil-DNA glycosylase deficient (Ung-) strain of Escherichia coli and analyzed by DNA sequencing . As predicted by genetic studies, G:C----A:T transitions predominated among base substitution events . However, DNA sequence analysis indicated that these events did not occur at random . Of the 31 G:C----A:T transitions recovered, 24 involved cytosine residues located in the nontranscribed strand of the gene and 15 of the 31 transitions occurred at cytosines located on the 3' side of 3 or more A:T base pairs . These differentials likely reflect the more single-stranded character of the non-transcribed strand of the gene and of regions rich in A:T base pairs . In addition, mutation at the frameshift hotspot was altered in the Ung- strain, suggesting a role for DNA repair in the formation of structural intermediates that potentiate these events . Also, the analysis of non-hotspot frameshifts, deletions and duplications showed that many involved local DNA sequence . Specifically, several of the frameshift, deletion and duplication mutations occurred near the sequence 5'-CTGG-3' . Thus, DNA sequence analysis of mutational specificity in an Ung- strain has provided evidence that gene expression, DNA repair and DNA context can all potentially influence the classes and frequencies of spontaneous mutation. Mol Gen Genet, 1987 Aug, 209(1), 71 - 7 Cotransformation of Aspergillus nidulans: a tool for replacing fungal genes; Wernars K et al.; When a non-selected DNA sequence was added during the transformation of amdS320 deletion strains of Aspergillus nidulans with a vector containing the wild-type amdS gene the AmdS+ transformants were cotransformed at a high frequency . Cotransformation of an amdS320, trpC801 double mutant strain showed that both the molar ratio of the two vectors and the concentration of the cotransforming vector affected the cotransformation frequency . The maximum frequency obtained was defined by the gene chosen as selection marker for transformation . Cotransformation was used to induce a gene replacement in A . nidulans . An amdS320 strain was transformed to AmdS+ and cotransformed with a DNA fragment containing a fusion between a non-functional A . nidulans trpC gene and the Escherichia coli lacZ gene . Ten AmdS+, LacZ+ transformants with a Trp- mutant phenotype were selected . All of these strains could be transformed with a functional copy of the A . nidulans trpC gene, but only two strains yielded TrpC+ transformants which, with a low frequency, had a LacZ- phenotype . These latter transformants had also lost the AmdS+ phenotype . Southern blotting analysis of DNA from these transformants confirmed the inactivation of the wild-type trpC gene, but revealed that amdS vector sequences were also involved in the gene replacement events. Mol Gen Genet, 1987 Aug, 209(1), 56 - 60 Heterogeneity in the level of ampicillin resistance conferred by pBR322 derivatives with different DNA supercoiling; Aleixandre V et al.; Cloning of an EcoRI restriction fragment, containing the 900 bp gamma-terminal sequence of transposon Tn1000, into pBR322, resulted in two plasmids, pICV63 and pICV64, which differed in the orientation of the cloned fragment within the replicon and in the level of ampicillin resistance conferred on the host cell . The DNAs of these plasmids differ in superhelicity and we suggest that a change in supercoiling of pICV63 DNA leads to this plasmid conferring resistance to only low levels of ampicillin, probably by reducing the expression of the bla gene . This hypothesis is supported by the fact that topA or supX mutations, which abolish topoisomerase I, reduce still further the level of resistance to ampicillin of pICV63-containing cells, whereas the gyrB226 compensatory mutation renders these cells more ampicillin resistant . Plasmid pICV63, therefore, enables mutant alleles of genes governing DNA topology to be recognized. Mol Gen Genet, 1987 Aug, 209(1), 188 - 92 OriC plasmids do not affect timing of chromosome replication in Escherichia coli K12; Koppes LJ; The variability of the time interval between successive rounds of chromosome replication was estimated by density-shift experiments, by measuring the conversion of heavy DNA to hybrid density and light DNAs upon transfer of a steady-state culture growing in medium with {13C}glucose and 15NH4Cl to medium with light isotopes . The coefficient of variation (CV%) for the interreplication time of the Escherichia coli K12 chromosome was found to be 17%, i.e . similar to that for interdivision time . The presence of additional copies of oriC in the cell on a high copy number plasmid did not increase the CV of interreplication time . It is concluded that a single rate-limiting event is unlikely to time the initiation of chromosome replication . The regulation of initiation at oriC and the coordination with cell division is discussed. Mol Gen Genet, 1987 Aug, 209(1), 179 - 87 The functional stability of the lacZ transcript is sensitive towards sequence alterations immediately downstream of the ribosome binding site; Petersen C; Various synthetic DNA sequences were inserted downstream of the fourth codon of the Escherichia coli lacZ gene on plasmids containing a hybrid lacZ-galK operon . Several different sequences, one as short as 10 bp, reduced the functional stability of the lacZ message three- to fourfold, whereas others had little or no effect . Introduction of synthetic sequences into a plasmid containing the intact lac operon resulted in similar reductions of mRNA stability . The sequence alterations also reduced the translational efficiency and transcription through lacZ as monitored by measurements of galactokinase synthesis from the downstream galK gene . There was no correlation between the average translational frequency and the stability of the lacZ message indicating that some of the inserted sequences reduced mRNA stability directly and not as a consequence of their effect on translation . The reduction of transcription through the lacZ gene correlated with the reduction of translation in agreement with current models of transcriptional polarity. Mol Gen Genet, 1987 Aug, 209(1), 122 - 8 Genetic analysis of the parB+ locus of plasmid R1; Rasmussen PB et al.; Plasmid R1 in Escherichia coli carries two loci which independently contribute to the stable maintenance of the plasmid . A genetic analysis of one of these, parB+, was carried out, and it was shown that the minimal region exerting stabilizing activity comprises at most 580 bp . The nucleotide sequence of the parB+ locus was determined, and indicated the presence of two genes, of which one probably codes for a 52 amino acid polypeptide, whereas the other gene product may be an untranslated RNA . These suggestions, based on the nucleotide sequence information, were supported by gene expression studies employing lac fusions . An incompatibility phenotype connected to parB+ was localized to that part of the 580 bp parB+ region which seems to encode the untranslated RNA. J Biochem (Tokyo), 1987 Aug, 102(2), 427 - 32 Involvement of the fatty acid oxidation complex in acetyl-CoA-dependent chain elongation of fatty acids in Escherichia coli; Nishimaki-Mogami T et al.; The activity of acetyl-CoA-dependent chain elongation of fatty acids in Escherichia coli was enhanced when the organism was grown on oleic acid as the sole carbon source, but not detected when grown on glucose . Antibodies raised against fatty acid oxidation complex of E . coli inhibited both the reaction catalyzed by crotonase and the chain elongation in a similar manner, showing that the oxidation complex participates in the chain elongation . The activities of condensation and the activities of NADH- and NADPH-dependent 3-ketoacyl reduction in the cell-free extract were precipitated by antibodies to the complex in parallel with those of 3-ketoacyl-CoA thiolase and crotonase . These results together with the presence of NADPH-dependent trans-2-enoyl-CoA reductase in E . coli (Mizugaki, et al . (1982) Chem . Pharm . Bull . 30, 2503-2511) indicate that the acetyl-CoA-dependent chain elongation of fatty acids in E . coli occurs by the reversal of fatty acid oxidation other than the step of enoyl reduction. Eur J Clin Microbiol, 1987 Aug, 6(4), 386 - 91 Comparison of the response of Escherichia coli to fosfomycin and fosmidomycin; Kanimoto Y et al.; The responses of Escherichia coli to fosfomycin and fosmidomycin were investigated by continuous turbidimetric monitoring of cultures exposed to the drugs and by microscopy . The activity of both agents was potentiated by glucose-6-phosphate, suggesting that they share the inducible hexose phosphate transport system in Escherichia coli, but several differences of response were also detected: the inoculum effect was much smaller with fosfomycin than with fosmidomycin; inhibition of bacterial growth occurred much more rapidly with fosfomycin than with fosmidomycin; and fosfomycin was able to induce the formation of spheroplasts much more rapidly than fosmidomycin . Stable resistance to fosfomycin and fosmidomycin was readily induced in cultures of Escherichia coli, and some resistant variants retained susceptibility (or partial suceptibility) to the other compound . These observations suggest that although fosfomycin and fosmidomycin may be transported into Escherichia coli by a similar mechanism, the intracellular target site may be different. EMBO J, 1987 Aug, 6(8), 2489 - 92 Influence of the codon following the AUG initiation codon on the expression of a modified lacZ gene in Escherichia coli; Looman AC et al.; In a lacZ expression vector (pMC1403Plac), all 64 codons were introduced immediately 3' from the AUG initiation codon . The expression of the second codon variants was measured by immunoprecipitation of the plasmid-coded fusion proteins . A 15-fold difference in expression was found among the codon variants . No distinct correlation could be made with the level of tRNA corresponding to the codons and large differences were observed between synonymous codons that use the same tRNA . Therefore the effect of the second codon is likely to be due to the influence of its composing nucleotides, presumably on the structure of the ribosomal binding site . An analysis of the known sequences of a large number of Escherichia coli genes shows that the use of codons in the second position deviates strongly from the overall codon usage in E . coli . It is proposed that codon selection at the second position is not based on requirements of the gene product (a protein) but is determined by factors governing gene regulation at the initiation step of translation. EMBO J, 1987 Aug, 6(8), 2473 - 7 tRNA nucleotidyltransferase is not essential for Escherichia coli viability; Zhu L et al.; The role of tRNA nucleotidyltransferase in Escherichia coli has been uncertain because all tRNA genes studied in this organism already encode the -C-C-A sequence . Examination of a cca mutant, originally thought to contain 1-2% enzyme activity, indicated that it actually produces an inactive fragment of 40 kd compared to 47 kd for the wild-type enzyme due to a nonsense mutation in its cca gene . To confirm that the residual activity in extracts of this strain is due to another enzyme, and that tRNA nucleotidyltransferase is non-essential, we have interrupted the cca gene in vitro, and transferred this mutant gene to a variety of strains . In all cases mutant strains are viable, although as much as 15% of the tRNA population contains defective 3' termini, and no tRNA nucleotidyltransferase is detectable . Mutant strains grow slowly, but can be restored to more normal growth by a relA mutation or by a decrease in RNase T activity . In the latter case the amount of defective tRNA decreases dramatically . These findings indicate that tRNA nucleotidyltransferase is not essential for E . coli viability, and therefore, that all essential tRNA genes in this organism encode the -C-C-A sequence. EMBO J, 1987 Aug, 6(8), 2469 - 72 Start sites for bidirectional in vitro DNA replication inside the replication origin, oriC, of Escherichia coli; Seufert W et al.; In vitro replication of mini-chromosomes in the absence of DNA ligase activity resulted in replication products with single-strand breaks at specific sites . The occurrence of these nicks was coupled to an active replication process, therefore we expect them to represent start sites for DNA replication . Two positions within oriC for each of the two leading strands of bidirectional replication were found . Within each position are one or two start sites . Counterclockwise synthesis started at positions 194/199 and 265/272, clockwise synthesis at positions 209/219 and 254 . The start positions are located close to DnaA protein binding sites . A model for initiation accommodating this observation is discussed. Br J Pharmacol, 1987 Aug, 91(4), 721 - 8 Effect of nafazatrom and indomethacin on pulmonary removal of prostaglandin E1 after endotoxin in rabbits; Gillis CN et al.; 1 We compared the effects of endotoxin on pulmonary prostaglandin E1 (PGE1) removal in groups of rabbits pretreated with the cyclo-oxygenase inhibitor, indomethacin, or nafazatrom (Bay g 6575), which has been shown to increase plasma prostacyclin concentrations . 2 In untreated animals, endotoxin transiently decreased pulmonary removal of {3H}-PGE1, caused pulmonary hypertension, systemic hypotension and increased plasma concentrations of PGE2 and 6-keto-PGF1 alpha . 3 Indomethacin pretreatment prevented the transient decrease in pulmonary removal of {3H}-PGE1 in response to endotoxin, prevented the haemodynamic effects and inhibited prostaglandin synthesis . Pretreatment with nafazatrom did not affect the decreased pulmonary removal of {3H}-PGE1, exacerbated the haemodynamic response, reduced survival and potentiated the increase in circulating 6-keto-PGF1 alpha . 4 We conclude that indomethacin acts to prevent the depression of pulmonary {3H}-PGE1 removal by eliminating surface area changes associated with endotoxin-induced pulmonary vasoconstriction . 5 These data suggest that nafazatrom treatment results in exacerbation of the endotoxin-induced systemic hypotension presumably due to its effect on increased plasma prostacyclin during the later phase of endotoxaemia. Biol Chem Hoppe Seyler, 1987 Aug, 368(8), 971 - 9 Structure of the yeast isoleucyl-tRNA synthetase gene (ILS1) . DNA-sequence, amino-acid sequence of proteolytic peptides of the enzyme and comparison of the structure to those of other known aminoacyl-tRNA synthetases; Englisch U et al.; The ILS1 gene encoding for cytoplasmic isoleucyl-tRNA synthetase from Saccharomyces cerevisiae was subcloned from a 5.4-kb insert of the shuttle vector YEp13 to M13mp8 and M13mp9 . Nucleotide sequence analysis of a 4.3-kb BamHI-HpaI fragment revealed a single open reading frame from which we deduced the amino-acid sequence of the enzyme . Independently obtained amino-acid sequence information from ten tryptic peptides of the purified enzyme confirmed the gene-derived structure . The enzyme is comprised of 1073 amino-acids consistent with earlier determinations of its molecular mass . The codon usage of ILS1 is typical of abundant yeast proteins . A significant homology to E . coli isoleucyl- and valyl-tRNA synthetases as well as to yeast valyl-tRNA synthetase was detected . The characteristic amino-acid residues of the aminoacyl-adenylate site and of the potential binding site of the 3'-end of tRNA found in other synthetases are present in the structure. Biochem J, 1987 Aug 1, 245(3), 875 - 80 Purification and characterization of glutathione reductase encoded by a cloned and over-expressed gene in Escherichia coli; Scrutton NS et al.; An expression vector, pKGR, for the gor gene from Escherichia coli encoding glutathione reductase was constructed by subcloning of an AvaII fragment of the Clarke & Carbon bank plasmid pGR {Greer & Perham (1986) Biochemistry 25, 2736-2742} into the plasmid pKK223-3 . The expression of glutathione reductase from the plasmid pKGR was found to have been successfully placed under the control of the tac promoter . Transformation of E . coli cells with this plasmid resulted in 100-200-fold increase in glutathione reductase activity in cell-free extracts . A rapid purification procedure for the enzyme, based on affinity chromatography on Procion Red HE-7B-CL-Sepharose 4B, was developed . The purified enzyme was homogeneous as judged by SDS/polyacrylamide-gel electrophoresis, and all its properties were consistent with the DNA sequence of the gene {Greer & Perham (1986) Biochemistry 25, 2736-2742} and with those previously reported for E . coli glutathione reductase {Mata, Pinto & Lopez-Barea (1984) Z . Naturforsch . C . Biosci . 39, 908-915} . These experiments have enabled an investigation of the protein chemical and mechanistic properties of the enzyme by site-directed mutagenesis. Arch Dis Child, 1987 Aug, 62(8), 776 - 9 United Kingdom multicentre clinical trial of somatrem; Milner RD et al.; In a multicentre clinical trial 54 children aged 4.0 to 17.3 years, who had growth hormone deficiency that had not previously been treated, were given biosynthetic methionyl growth hormone (somatrem) 4 units three times a week by subcutaneous or intramuscular injection for one year . Height was measured every three months for at least one year before and during treatment . Forty two patients responded to treatment with an increase in growth of greater than 1.5 cm/year . The remaining 12 who grew more slowly were less obviously short and had a higher pretreatment growth than those who responded . The three who responded and the one who did not had undergone therapeutic spinal irradiation before starting the drug . If a whole year's pretreatment growth rate of less than 5 cm/year had been used as a diagnostic criterion the prediction of those who responded would have slightly improved . About two thirds of the patients developed antibodies against growth hormone and Escherichia coli protein; these were, however, of low and fluctuating titre and binding capacity, and did not influence the response to treatment . No adverse side effects were encountered . We conclude that somatrem is a safe and effective alternative to pituitary growth hormone. Acta Med Okayama, 1987 Aug, 41(4), 161 - 3 Serum antibodies to Escherichia coli in breast-fed and bottle-fed infants; Ogura H; Titers of antibody against Escherichia coli in human milk and in the sera of 11 breast-fed infants, 6 bottle-fed infants and 9 infants in the post-weaning period were measured by the passive hemagglutination method . High antibody titers were observed in human milk in the first 4 days after parturition, but the titer decreased rapidly thereafter . None of the healthy, breast-fed infants had detectable serum antibodies, while a breast-fed infant with a perianal E . coli abscess had antibodies . On the other hand, 4 of the 6 bottle-fed infants and all of the 9 infants in the post-weaning period had antibodies . The significance of these results was discussed. Prostaglandins Leukot Med, 1987 Aug, 28(3), 255 - 65 Prostaglandin and thromboxane levels during endotoxin-induced respiratory failure in pigs; Hardie EM et al.; Arterial plasma concentrations of thromboxane B2 (TxB2), prostaglandin F2 alpha (PGF2 alpha) and 6-keto-prostaglandin F1 alpha (PGF1 alpha) were measured during endotoxin-induced acute respiratory failure (ARF) in anesthetized 10-12 wk old pigs . A 4.5 hour (hr) infusion of endotoxin resulted in a biphasic pattern of ARF . Phase 1 (0-2 hr) was characterized by increased pulmonary artery pressure, pulmonary vascular resistance (PVR), and alveolar-arterial O2 gradient (delta A-aO2), and decreased cardiac index (CI) and lung dynamic compliance (LDC) . Following a return of PVR and CI values towards baseline, a second phase (2-4.5 hr) of deteriorating function occurred and was characterized by additional increases in PVR and delta A-aO2 and decreases in CI and LDC . Baseline (i.e., 0 hr) plasma TxB2 concentrations were 241 +/- 24 pg/ml; these values peaked at 0.5 hr (3228 +/- 712 pg/ml) and declined to 1635 +/- 453 pg/ml at 4.5 hr . Plasma concentrations of PGF2 alpha slowly increased from a baseline value of 154 +/- 32 pg/ml to 2355 +/- 738 pg/ml at 4.5 hr, while PGF1 alpha values increased from 54 +/- 2 pg/ml at 0 hr to 503 +/- 172 pg/ml at 4.5 hr . Time-matched control pigs showed no changes in pulmonary hemodynamics or in plasma TxB2, PGF2 alpha or PGF1 alpha levels . These results indicate that cyclooxygenase products are increased during both phases of endotoxin-induced ARF in pigs. Pediatr Res, 1987 Aug, 22(2), 130 - 4 Nonimmunoglobulin fraction of human milk inhibits the adherence of certain enterotoxigenic Escherichia coli strains to guinea pig intestinal tract; Ashkenazi S et al.; The protecting effect of human milk against intestinal infections has been well documented, but its mechanism not completely understood . We have examined the effect of the nonimmunoglobulin fraction (NIgF) of human milk and colostrum on bacterial adherence to the intestinal tract . The NIgF was prepared by passing the milk through an immunosorbent column containing rabbit antihuman gamma-globulin (IgG and IgA) . The effluent fraction did not contain gamma-globulins as shown by immunodiffusion on agarose and by using rabbit antihuman Ig, that was then detected with fluorescently-labeled goat antirabbit Ig . The effect of the NIgF of human milk on the adherence of enterotoxigenic Escherichia coli strains to guinea pig intestinal tract was quantitatively determined using radiolabeled bacteria which were incubated with suspensions of viable intestinal cells . Thirteen to 17 bacteria adhered per intestinal cell . NIgF of human milk and colostrum (300 microliter, 6.7 mg) caused about 50% inhibition of the adherence of enterotoxigenic E . coli strains whose attachment was mediated by colonization factor antigen I and II . No inhibition was noted on the adherence of enterotoxigenic E . coli strains containing type I pili . The inhibitory activity resisted boiling and proteolytic digestion with trypsin, but was completely abolished by periodate treatment, indicating that carbohydrate residues were probably involved . Examination of the effect of NIgF of human milk on bacterial adherence to intact intestinal surfaces revealed comparable results . Observations with scanning electron microscopy confirmed, morphologically, the attachment of the bacteria and the inhibitory effect of human milk.(ABSTRACT TRUNCATED AT 250 WORDS) Eur J Obstet Gynecol Reprod Biol, 1987 Aug, 25(4), 347 - 53 Effects of castration, exogenous testosterone and estrogen on endotoxin response in male rats; Schmidt EH et al.; Using an experimental model of continuous endotoxin infusion, the effects of castration, testosterone and estrogen substitution on disseminated intravascular coagulation in male rats were investigated . Male rats which are not pretreated react in the same way to an endotoxin infusion as female animals, with an increase in free plasma hemoglobin, decrease of fibrinogen level, decrease of hematocrit and platelets and glomerular fibrin depositions . Different experimental groups of testectomized rats were pretreated with (i) 0.3 micrograms (pregnancy-conserving dose) or (ii) 30 micrograms ethinylestradiol (ovulation-suppression dose) or (iii) 250 mg testosterone . They were then compared to groups of animals treated with sesame oil as well as untreated group of rats . The pretreatment with testosterone and estrogens in the small-dose group had only an insignificant effect on the shock sequence . Only those animals which were treated with a high dose of estrogens showed a dramatic enhancement of their endotoxin sensitivity . It was also shown that in male animals an increased estrogen level might mediate a state of 'preparation', but testosterone does not 'prepare' castrated rats for the generalized Schwartzman reaction . The possible significance of enhancement of endotoxin toxicity by estrogens in explaining some pathophysiological characteristics of disseminated intravascular coagulation in pregnancy is discussed. Arch Surg, 1987 Aug, 122(8), 909 - 12 In vivo determination of modulated migration of radiolabeled leukocytes; Bengtson A et al.; A method to determine migration of phagocytic cells in vivo has been evaluated . It was used to analyze leukocyte migration during ischemia, peritonitis, and after pretreatment with methylprednisolone . Phagocytic cells were labeled in vitro with 150 megabecquerel (4.05 mCi) of technetium Tc 99m colloid and reinfused . Saline 0.03 mg and 3.0 mg of endotoxin per kilogram per rat were injected subcutaneously in duplicate . Four hours later, a standardized amount of skin and subcutaneous tissue from the area of injection was removed and weighed . A dose-related accumulation of radiolabeled leukocytes to endotoxin was found in healthy controls but not in animals with hypoperfusion or peritonitis or those pretreated with methylprednisolone . This in vivo method to calculate leukocyte migration will give reproducible results with a mean difference between duplicate samples of less than 6%. Antimicrob Agents Chemother, 1987 Aug, 31(8), 1274 - 7 Detection of a second mechanism of resistance to gentamicin in animal strains of Escherichia coli; Chaslus-Dancla E et al.; One mechanism of plasmid-mediated resistance to gentamicin in Escherichia coli strains isolated from animals is due to the synthesis of the aminoglycoside 3-N-acetyltransferase type IV . A second mechanism of plasmid-mediated resistance to gentamicin was detected in animal strains of E . coli in France and is due to the production of the aminoglycoside 3-N-acetyltransferase type II . The molecular relationships among plasmids encoding this enzyme were studied. Transplantation, 1987 Aug, 44(2), 249 - 53 Effect of immunization with Escherichia coli J5 on graft-versus-host disease induced by minor histocompatibility antigens in mice; Moore RH et al.; We have used a cell-wall-deficient mutant of Escherichia coli (E coli J5) to study the effect of active and passive immunization against bacterial endotoxin (ET) in a murine model of acute graft-versus-host disease (GVHD) induced by minor histocompatibility antigens . C57BL/B6 (H-2b) mice were irradiated and grafted with 1 X 10(7) anti-Thy-1.2 and complement-treated bone marrow cells and 5 X 10(7) spleen cells from LP/J (H-2b) donors . Groups of mice were immunized against J5--either actively immunized with killed J5 cells or pure J5 lipopolysaccharide or passively immunized with rabbit anti-J5 antiserum (R alpha J5) . Controls included irradiation controls, negative controls (conventional mice grafted with depleted bone marrow only), positive controls (conventional mice grafted with bone marrow and spleen cells), and mice passively immunized with normal rabbit serum (NRS) . Positive control mice developed GVHD and all died by day +77 . Active immunization partially protected against the rapid weight loss due to GVHD (P less than 0.05) but mice had an earlier onset of GVHD (P less than 0.05) and a shortened survival after onset (P less than 0.05) . Median survival time (MST) and overall survival were unchanged . Passive immunization with R alpha J5 delayed death (P less than 0.01), increased MST (P = 0.01), increased overall survival (P less than 0.01), and protected against weight loss (P = 0.01) . NRS had no beneficial effect. J Clin Microbiol, 1987 Aug, 25(8), 1519 - 23 HeLa cell adherence and cytotoxin production by enteropathogenic Escherichia coli isolated from infants with diarrhea in Thailand; Echeverria P et al.; Enteropathogenic Escherichia coli (EPEC) strains isolated from hospitalized infants with diarrhea in Thailand were examined for HeLa cell adherence and cytotoxin production . Of 101 strains examined, 56 adhered to HeLa cells in a localized pattern (LA), 27 adhered in a diffuse pattern (DA), and 18 did not adhere . All 56 LA EPEC strains were O:K serotype O119:K69 . A total of 20 (83%) of 24 EPEC O86:K61 strains and 7 (38%) of 19 EPEC strains belonging to six other O:K serotypes exhibited DA . All LA EPEC strains hybridized with a DNA probe for genes encoding EPEC adherence factor, whereas none of the 27 DA or 18 nonadherent EPEC strains hybridized with EPEC adherence factor probe . Sonic extracts of 57 (58%) of 98 EPEC strains tested at a dilution of 1:100 caused greater than 25% mortality of HeLa cell monolayers . A total of 50 (88%) of 57 cytotoxic sonic extracts were inhibited to various degrees by a 1:500 dilution of polyclonal rabbit antisera to purified Shiga toxin . The mean percent inhibition of cytotoxic sonic extracts by anti-Shiga toxin was 67% (range, 29 to 89%) . Fifty percent (38 of 56) of LA EPEC strains, fifty-two percent (14 of 27) of DA EPEC strains, and fifty-three percent (8 of 15) of nonadherent EPEC strains produced Shiga-like toxins . Both adherence and low levels of cell-associated cytotoxins were identified in EPEC strains from Thailand, but there did not appear to be an association between these two factors. J Clin Microbiol, 1987 Aug, 25(8), 1472 - 5 HeLa cell-adherent enteropathogenic Escherichia coli in children under 1 year of age in Thailand; Echeverria P et al.; Enteropathogenic Escherichia coli (EPEC) was isolated from 11% of 148 Hmong children under 1 year old with diarrhea at a refugee camp in northern Thailand . Of 16 children with EPEC-associated diarrhea, 11 were infected with EPEC that adhered to HeLa cells in a diffuse pattern, 3 were infected with EPEC that adhered to HeLa cells in a localized adherence (LA) pattern, and 2 were infected with EPEC that were nonadherent . In Bangkok, EPEC was isolated from 6% of 64 children under 1 year old with diarrhea and 7% of 56 children of the same age without diarrhea . Of four children with diarrhea, two were infected with EPEC with an LA pattern, and two were infected with nonadherent EPEC . Of four children without diarrhea, one was infected with EPEC with an LA pattern, one was infected with EPEC that adhered in a diffuse pattern, and two were infected with nonadherent EPEC . The 21 EPEC isolates with an LA pattern hybridized with the EPEC adherence factor DNA probe . EPEC was the only enteric pathogen identified in 16 (80%) of 20 children with EPEC-associated diarrhea . EPEC was as frequently isolated from children under 1 year old as were other bacterial enteric pathogens . The problem of identifying EPEC with pools of polyvalent antisera are described, and the need to identify additional enteropathogenic determinants of EPEC is discussed. J Clin Microbiol, 1987 Aug, 25(8), 1438 - 41 Identification of enterotoxigenic Escherichia coli with synthetic alkaline phosphatase-conjugated oligonucleotide DNA probes; Seriwatana J et al.; Alkaline phosphatase-conjugated (AP) 26-base oligonucleotide DNA probes were compared with the same probes labeled with gamma-32P for the identification of heat-labile (LT) and heat-stable (ST) enterotoxigenic Escherichia coli (ETEC) . The AP oligonucleotide probes were as sensitive as the radiolabeled (RL) probes in detecting LT and STA-2 target cell DNA, but the AP ST probe, which differed from STA-1 by two bases, was less sensitive than the RL probe in detecting STA-1 DNA (6.25 versus 0.78 ng) . Of 94 ETEC that were identified with the RL probe, the AP probes detected 93% (28 of 30) of ST, 73% (25 of 34) of LT, and 67% (20 of 30) of LTST ETEC . When colony lysates of these ETEC were examined, the AP probes identified all 94 ETEC . In examinations of stool blots, the RL and AP probes were shown to have sensitivities of 71 and 59%, specificities of 91 and 86%, positive predictive values of 87 and 73%, and negative predictive values of 86 and 74%, respectively . AP oligonucleotide probes to detect ETEC were less sensitive in detecting ETEC by colony or stool blot hybridization than the RL probes but could be used by laboratories without access to radioisotopes to examine colony lysates. Genetics, 1987 Aug, 116(4), 541 - 5 A method for gene disruption that allows repeated use of URA3 selection in the construction of multiply disrupted yeast strains; Alani E et al.; In this paper, we describe a 3.8-kb molecular construct that we have used to disrupt yeast genes . The construct consists of a functional yeast URA3 gene flanked by 1.1-kb direct repeats of a bacterial sequence . It is straightforward to insert the 3.8-kb segment into a cloned target gene of interest and then introduce the resulting disruption into the yeast genome by integrative transformation . An appropriate DNA fragment containing the disruption plus flanking homology can be obtained by restriction enzyme digestion . After introducing such fragments into yeast by transformation, stable integrants can be isolated by selection for Ura+ . The important feature of this construct that makes it especially useful is that recombination between the flanking direct repeats occurs at a high frequency (10(-4)) in vegetatively grown cultures . After excision, only one copy of the repeat sequence remains behind . Thus in the resulting strain, the Ura+ selection can be used again, either to disrupt a second gene in similar fashion or for another purpose. Biull Eksp Biol Med, 1987 Aug, 104(8), 212 - 5 {Complementation analysis of derepressed mutants of F-like plasmids of Escherichia coli}; Shchipkov VP et al.; Complementation analysis of a number of conjugative transfer functions was performed in derepressed (drd) mutants of E . coli F-like plasmids . The major part of double plasmid complexes investigated has revealed the formation of complementation transfer inhibitor of Fin V-type, or less frequently--the formation of Fin U-type inhibitor . An additional complementation analysis of drd plasmids defective at Fin V region genes has demonstrated at least three genes (denoted A, B, C) in the structure of this region. Am J Physiol, 1987 Aug, 253(2 Pt 2), F244 - 50 Renal effects of endotoxin in the male rat; Churchill PC et al.; A new model of acute reduction in renal function induced by a 2-h infusion of endotoxin (Escherichia coli 026:B6 lipopolysaccharide, 5 mg X kg-1 X h-1) was developed in the anesthetized male rat . In the absence of significant glomerular fibrin deposition, inulin clearance (glomerular filtration rate, GFR) was reduced from 8.50 +/- 0.34 to 4.01 +/- 0.45 ml X kg-1 X min-1 (P less than 0.0005), and p-aminohippuric acid clearance was reduced from 23.7 +/- 0.8 to 15.0 +/- 1.8 ml X kg-1 X min-1 (P less than 0.0005), indicating a hemodynamic basis for the reduction in GFR . The lack of morphological tubular injury and a decreased fractional Na excretion (from 2.63 +/- 0.27 to 0.54 +/- 0.09%, P less than 0.00005) exclude a significant contribution of tubular mechanisms to the reduction in GFR . Administration of theophylline, a competitive adenosine receptor antagonist, concurrently with or immediately after the endotoxin infusion, restored inulin and PAH clearances and fractional Na excretion toward normal . Moreover, the renal effects of endotoxin were mimicked by intravenous administration of N6-(L-phenylisopropyl)-adenosine (L-PIA), an adenosine receptor agonist, and the effects of L-PIA in turn were also antagonized by theophylline . These data suggest that adenosine plays a significant role in mediating the hemodynamic derangements of this model. Am J Physiol, 1987 Aug, 253(2 Pt 1), E130 - 4 IP3-dependent Ca2+ release in permeabilized hepatocytes of endotoxemic and septic rats; Spitzer JA et al.; Inositol trisphosphate-dependent Ca2+ release was measured in saponin-permeabilized hepatocytes isolated from acutely (2 mg/100 g body wt iv) or chronically (0.1 mg X 100 g body wt-1 X 24 h-1 for 30 h) endotoxin-treated (ET, Escherichia coli) rats or from animals rendered septic by cecal ligation and puncture . A decrease of this parameter was observed in acutely ET-treated rats (52%, P less than 0.01) and after 30 h of continuous ET infusion (33%, P less than 0.01) . Sepsis was associated with an elevated Ca2+ release (34%, P less than 0.01) as compared with the sham-operated animals . We conclude that during endotoxicosis and sepsis alterations of intracellular Ca homeostasis take place, reaching sites beyond the level of the plasma membrane . Such alterations could account in part for metabolic and functional changes associated with these pathologic states . In addition, ET treatment provides the first known intervention resulting in the modulation of inositol trisphosphate-dependent Ca2+ release. Surgery, 1987 Aug, 102(2), 200 - 5 A single dose of endotoxin activates neutrophils without activating complement; Moore FD Jr et al.; Both complement (C) and neutrophils (PMN) are activated in critically ill patients . To evaluate the role of endotoxin in this response, we studied C activation products and PMN cell surface receptors in seven normal subjects before and after endotoxin (USRef 20 U/kg) or saline solution administered on separate occasions . By 4 hours, with endotoxin only, all subjects had myalgia, headache, an increase in body temperature and heart rate, and leukocytosis that returned to normal by 24 hours . At the same time, PMN cell surface receptors for the complement opsonin C3b increased, as measured by indirect immunofluorescence, rising to 251 +/- 44% of baseline by 4 hours (p less than 0.01) and remaining elevated at 24 hours (237 +/- 16%, p less than 0.01) . PMN receptors for iC3b increased to 308 +/- 49% of baseline by 4 hours (p less than 0.02) and returned to normal by 24 hours . There was no change in plasma of C3a desArg, C4a desArg, and C5a desArg (4 hours: mean C3a: 153.4 +/- 11.5 ng/ml versus 176.2 +/- 16.2 ng/ml for saline solution, p = ns; C4a: 159.6 +/- 32 ng/ml versus 151.4 +/- 21 ng/ml, p = ns; C5a: undetectable) . To confirm the lack of C activation, we examined PMN chemotaxis (CTX) to C5a for any impairment caused by prior in vivo exposure to C5a . CTX to C5a was unaffected (4 hours: 109% +/- 22% of normal versus 114% +/- 10% for saline solution, p = ns) . PMN CTX to formyl-methionyl-leucine-phenylalanine and PMN phagocytosis and killing of S . aureus were also unaffected by endotoxin . Thus, a single dose of endotoxin produced a subjective febrile illness and precipitated sustained PMN activation as indicated by increased PMN cell surface complement receptor number in the absence of C activation. Proc Natl Acad Sci U S A, 1987 Aug, 84(16), 5690 - 4 Three-dimensional structure of the bifunctional enzyme N-(5'-phosphoribosyl)anthranilate isomerase-indole-3-glycerol-phosphate synthase from Escherichia coli; Priestle JP et al.; N-(5'-Phosphoribosyl)anthranilate isomerase-indole-3-glycerol-phosphate synthase from Escherichia coli is a monomeric bifunctional enzyme of Mr 49,500 that catalyzes two sequential reactions in the biosynthesis of tryptophan . The three-dimensional structure of the enzyme has been determined at 2.8-A resolution by x-ray crystallography . The two catalytic activities reside on distinct functional domains of similar folding, that of an eightfold parallel beta-barrel with alpha-helices on the outside connecting the beta-strands . Both active sites were located with an iodinated substrate analogue and found to be in depressions on the surface of the domains created by the outward-curving loops between the carboxyl termini of the beta-sheet strands and the subsequent alpha-helices . They do not face each other, making "channeling" of the substrate between active sites virtually impossible . Despite the structural similarity of the two domains, no significant sequence homology was found when topologically equivalent residues were compared. Proc Natl Acad Sci U S A, 1987 Aug, 84(16), 5550 - 4 Escherichia coli contains a soluble ATP-dependent protease (Ti) distinct from protease La; Hwang BJ et al.; The energy requirement for protein breakdown in Escherichia coli has generally been attributed to the ATP-dependence of protease La, the lon gene product . We have partially purified another ATP-dependent protease from lon-cells that lack protease La (as shown by immunoblotting) . This enzyme hydrolyzes {3H}methyl-casein to acid-soluble products in the presence of ATP and Mg2+ . ATP hydrolysis appears necessary for proteolytic activity . Since this enzyme is inhibited by diisopropyl fluorophosphate, it appears to be a serine protease, but it also contains essential thiol residues . We propose to name this enzyme protease Ti . It differs from protease La in nucleotide specificity, inhibitor sensitivity, and subunit composition . On gel filtration, protease Ti has an apparent molecular weight of 370,000 . It can be fractionated by phosphocellulose chromatography or by DEAE chromatography into two components with apparent molecular weights of 260,000 and 140,000 . When separated, they do not show proteolytic activity . One of these components, by itself, has ATPase activity and is labile in the absence of ATP . The other contains the diisopropyl fluorophosphate-sensitive proteolytic site . These results and the similar findings of Katayama-Fujimura et al . {Katayama-Fujimura, Y., Gottesman, S . & Maurizi, M . R . (1987) J . Biol . Chem . 262, 4477-4485} indicate that E . coli contains two ATP-hydrolyzing proteases, which differ in many biochemical features and probably in their physiological roles. Proc Natl Acad Sci U S A, 1987 Aug, 84(16), 5535 - 9 Lactose permease of Escherichia coli: properties of mutants defective in substrate translocation; Overath P et al.; Mutants of lactose permease of Escherichia coli with amino acid changes (Gly-24----Glu; Gly-24----Arg; Pro-28---Ser; Gly-24, Pro-28----Glu-Ser and Gly-24, Pro-28----Arg-Ser) within a putative membrane-spanning alpha-helix (Phe-Gly-Leu-Phe-Phe-Phe-Phe-Tyr-Phe-Phe-Ile-Met-Gly- Ala-Tyr-Phe-Pro-Phe-Phe-Pro-Ile) are incorporated into the cytoplasmic membrane . The mutant proteins retain the ability to bind galactosides, and the affinity for several substrates is actually increased . However, the rate of active transport is decreased to 0.01% of the wild-type rate in the mutants carrying Arg-24 or Arg-24, Ser-28 . Kinetic analysis demonstrates that the two mutants require 10 min to cause occupied binding sites for galactoside and H+ to change their exposure from the periplasm to the cytoplasm as compared to 50 ms in the wild type . The effect is less pronounced when these sites are unoccupied. Mutat Res, 1987 Aug, 179(2), 135 - 42 High-frequency spontaneous deletion of DNA sequences flanked by direct DNA repeats which also contain an internal palindrome; Lloyd RS et al.; The DNA sequences associated with a very high-frequency, spontaneous deletion event have been determined to be two 11-base direct repeats which also contain an internal 6-base palindrome . A parental M13 replicative form (RF) DNA harboring DNA fragments of the T4 denV gene contained these direct repeats and could only be maintained at 5% of the total RF DNA within an infected cell . The remaining RF DNA was deleted for all intervening sequences between the direct repeats (2.2-kb), but one copy of the direct repeat was retained after the deletion had occurred . This site-specific deletion was highly reproducible in that if parental-sized M13 RF DNA was gel purified and transformed back into cells, the deletion occurred at precisely the same sequence as before . Electron microscopic analyses of DNA extracted from cells transformed with parental-sized DNA revealed the presence of excised 2.2-kb double-stranded circular DNA molecules . This observation thus rules out a copy choice replication/deletion mechanism to account for this high-frequency deletion event. J Bacteriol, 1987 Aug, 169(8), 3844 - 9 fhuC and fhuD genes for iron (III)-ferrichrome transport into Escherichia coli K-12; Coulton JW et al.; The nucleotide sequence for a 1,900-base-pair region of the Escherichia coli chromosome that includes the genes fhuC and fhuD was determined . Within this sequence are two open reading frames: nucleotides 127 to 921 and nucleotides 924 to 1811 . These coding regions specify a FhuC protein with an Mr of 28,423 and a mature FhuD protein with an Mr of 29,610 . The deduced amino acid sequence of FhuC shows extensive homology with those of components of some bacterial transport systems which are peripheral proteins of the cytoplasmic membrane . Because the FhuD protein contains a typical signal sequence of 30 amino acids at the amino terminus and displays characteristics of a soluble protein, it may be exported into the periplasm. J Bacteriol, 1987 Aug, 169(8), 3826 - 8 Chlamydial hemagglutinin identified as lipopolysaccharide; Watkins NG et al.; Chlamydial lipopolysaccharide (LPS) agglutinated mouse and rabbit erythrocytes but not human, guinea pig, or pronghorn antelope erythrocytes . Hemagglutination was not specific for Chlamydia spp., as rough LPSs from Coxiella burnetii and Escherichia coli also agglutinated erythrocytes from the same animal species . Nonagglutinated and agglutinated erythrocytes bound equivalent amounts of LPS, indicating that hemagglutination was not due to a specific interaction of chlamydial LPS with erythrocytes . Thus, hemagglutination by chlamydial LPS is not mediated by specific receptor-ligand interactions but is a property of the altered surface of the LPS-coated erythrocytes. J Bacteriol, 1987 Aug, 169(8), 3770 - 7 Identification and partial characterization of a novel bipartite protein antigen associated with the outer membrane of Escherichia coli; Owen P et al.; A study by crossed immunoelectrophoresis performed in conjunction with precipitate excision and polypeptide analysis identified a new antigen complex in the envelope of Escherichia coli ML308-225 . This antigen corresponds to antigen 43 in the crossed immunoelectrophoresis profile of membrane vesicles (P . Owen and H . R . Kaback, Proc . Natl . Acad . Sci . USA 75:3148-3152, 1978) . Immunoprecipitation experiments conducted with specific antiserum revealed that the complex was expressed on the cell surface and that it contained, in equal stoichiometry, two chemically distinct polypeptides termed alpha and beta (Mrs of 60,000 and 53,000, respectively) . The beta polypeptide was heat modifiable, displaying an apparent Mr of 37,000 when solubilized at temperatures below 70 degrees C . Analysis of fractions obtained following cell disruption, isopycnic centrifugation, and detergent extraction indicated that both alpha and beta polypeptides were components of the outer membrane . The two polypeptides were not linked by disulfide bonds, and neither was peptidoglycan associated . The complex contained no detectable lipopolysaccharide, enzyme activity, fatty acyl groups, or other cofactors . Neither correlated with E . coli proteins of similar molecular weight which had previously been shown to be associated with the outer membrane . Antibodies were raised to individual alpha and beta polypeptides . Each of these sera was shown to be subunit specific when tested against denatured membrane proteins . In contrast, each immunoglobulin preparation coprecipitated both alpha and beta polypeptides when tested against undenatured proteins derived from Triton X-100-treated membranes . The results reveal the presence of a novel bipartite protein antigen in the outer membrane of E . coli. J Bacteriol, 1987 Aug, 169(8), 3743 - 9 Evidence for multiple K+ export systems in Escherichia coli; Bakker EP et al.; The role of the K+ transport systems encoded by the kefB (formerly trkB) and kefC (formerly trkC) genes of Escherichia coli in K+ efflux has been investigated . The rate of efflux produced by N-ethylmaleimide (NEM), increased turgor pressure, alkalinization of the cytoplasm, or 2,4-dinitrophenol in a mutant with null mutations in both kef genes was compared with the rate of efflux in a wild-type strain for kef . The results show that these two genes encode the major paths for NEM-stimulated efflux . However, neither efflux system appears to be a significant path of K+ efflux produced by high turgor pressure, by alkalinization of the cytoplasm, or by addition of high concentrations of 2,4-dinitrophenol . Therefore, this species must have at least one other system, besides those encoded by kefB and kefC, capable of mediating a high rate of K+ efflux . The high, spontaneous rate of K+ efflux characteristic of the k