|
| |
Journal of Bacteriology, December 2003, p . 7291-7296, Vol . 185, No . 24
Colonial Differentiation in Streptomyces coelicolor Depends on Translation of a Specific Codon within the adpA Gene
Kien T . Nguyen, Jennifer Tenor, Hansruedi Stettler, Lieu T . Nguyen, Liem D . Nguyen, and Charles J . Thompson*
Department
of Molecular Microbiology, Biozentrum, Universität Basel, 4056
Basel, Switzerland
Received 28 August 2003/
Accepted 4 September 2003
We
identified adpA as an araC-like regulatory gene
needed for colonial morphogenesis in Streptomyces
coelicolor and showed that its activity depended on a unique
TTA triplet corresponding to the leucyl-tRNA gene (bldA).
These findings partially explained the dependence of aerial mycelium
formation on a rare tRNA that is postulated to have developmental
control
functions .
Streptomyces species are multicellular bacteria that undergo a
program of colonial development that may depend on a translational
regulatory system . bldA, encoding the principal tRNA for
translation of the TTA (leucine) codon, is dispensable for vegetative
growth but is conditionally required at a later stage for the synthesis
of aerial mycelium (in all species tested) and for the biosynthesis of
some antibiotics (11,
12); for a recent
analysis and additional citations, see reference
18 . There is evidence
that accumulation of the active form of bldA tRNA to maximal
levels occurs later, at the onset of antibiotic biosynthesis and
morphological differentiation
(13,
19) . The biosynthesis of
the antibiotics actinorhodin (blue) and undecylprodigiosin (red) is
bldA dependent
(5,
20) and is activated by
the pathway-specific activator genes actII-orfIVand redZ, both containing TTA codons . For
actII-orfIV, it has been shown that replacement of the TTA
codon by an alternative leucine codon relieves its dependence on
bldA and thus allows actinorhodin biosynthesis in
bldA mutants (5);
comparable results have been obtained after mutagenesis of TTA codons
in several antibiotic resistance genes
(12) . However, at least
in some contexts and under certain nutritional conditions, TTA triplets
are mistranslated and can provide active gene products in bldA
mutants (6,
12,
18) . The target gene (or
genes) and corresponding TTA codon underlying the aerial mycelium
defect in bldA mutants have not been identified .
In
Streptomyces griseus, both aerial hypha formation and
biosynthesis of streptomycin rely on adpA, a gene containing a
TTA codon and encoding an AraC-like transcriptional regulator
(17) . This triplet is
found at the corresponding position in all known adpA
orthologs (S . coelicolor
[1], S.
griseus
[17], and
S . avermitilis
[7]), suggesting
that adpA may be a bldA-dependent regulator of aerial
hypha formation conserved within Streptomyces species . This
model was explored in the experiments described here (similar results
have been obtained by E . Takano, M . Tao, F . Long, Maureen J . Bibb, L.
Wang, W . Li, M . J . Buttner, Mervyn J . Bibb, Z . X.
Deng, and K . F . Chater, personal
communication) .
adpA, a regulator of
aerial hypha formation and antibiotic biosynthesis.
A 1.2-kb fragment encoding the
S . coelicolor AdpA protein (Swiss-Prot/TrEMBL entry
name Q9L062) was amplified by PCR with primers
adpA-N-NdeI
(GGGCTTAGCCATATGAGCCACGACTCCA; the
engineered NdeI site containing the presumed ATG start codon
is underlined) and adpA-C-BamHI
(GGATCCGAGCCGTCTGCTCACCTCACG; the
engineered BamHI site is underlined) and cloned into
pGEM-T-Easy (Promega), and its sequence was verified . To mutagenize the
gene, an apramycin resistance gene cassette on an SmaI
fragment (3) was
introduced into the unique MscI site in its central region . A
3.0-kb fragment carrying disrupted adpA was excised by
EcoRI digestion, cloned into the same site in pSET151
(2), a vector carrying the
thiostrepton resistance gene, and used to disrupt adpA in
wild-type strain J1501 (by transformation)
(10) . An
apramycin-resistant, thiostrepton-sensitive colony containing disrupted
adpA, as confirmed by PCR and Southern blot analyses, was
isolated . Inactivation of adpA dramatically slowed colonial
development on several media (R2YE and MS
[10]).
Compared to parent strain J1501, the adpA mutant (Fig.
1A and
2) was impaired in its ability to form aerial mycelium (bald), and
individual colonies produced more red pigment on R2YE medium . Possible
effects on blue pigment synthesis could not be determined, since our
isolate of parent strain J1501 produced very little actinorhodin under
these conditions .
 | FIG . 1 . bldA-dependent
translation of adpA (bldH) is required for colonial
morphogenesis . (A) The wild type (J1501) (left panel), the
adpA mutant (middle panel), or the adpA mutant
transformed with plasmid pIJ904::adpA(TTA)
carrying the intact wild-type gene (right panel) was grown on R2YE
medium at 30°C for 5 days . Colonies produced no diffusible blue
pigment; the darker appearance of the agar reflects photographic
conditions that were adjusted for the optimal exposure of colonies
having different levels of brightness . (B) The
bldA39 mutant strain (left panel) or the bldA39
mutant strain containing a wild-type (middle panel) or a mutant (right
panel) allele cloned in pIJ904 was grown on R2YE medium at 30°C
for 2 weeks . (C) Strains that were wild type (J1501) or
defective for aerial mycelium formation (ramR or
adpA mutants) (left panels) were transformed with
plasmids containing wild-type ramR
(ermE::ramR) or adpA
(ermE::adpA) genes cloned into
vector pHM11A to allow expression from the strong constitutive
ermE promoter (right panels) . Cultures were grown on R2YE
medium at 30°C for 1 week and photographed from the top or
bottom.
| |
 | FIG . 2 . bldA-dependent
translation of adpA (bldH) is required for aerial
mycelium formation . Scanning electron microscopic views
(14) of colonial surface
cultures grown on R2YE medium for 10 days at 30°C are shown.
adpA and bldH mutant strains were transformed with
vector pIJ904 carrying the indicated adpA alleles
[adpA(CTC), adpA allele with the CTC mutation;
adpA(TTA), adpA allele with wild-type
TTA].
| |
For complementation studies, a
1.6-kb fragment carrying the promoter and coding region of
adpA was amplified by PCR with primers
adpA-pro1-HindIII/BamHI
(GGATCCAAGCTTGGGAAAAAGCACCGGTCGACTGAC) and
adpA-C-BamHI (see above) and cloned into the
BamHI site of pIJ904
[pIJ904::adpA(TTA)].
Alternatively, to express adpA from the strong constitutive
ermE promoter, the adpA coding region was PCR
amplified with primers adpA-N-NdeI and
adpA-C-BamHI and cloned into pHM11A between the
NdeI and BamHI sites
[pHM11A::adpA(TTA)] . In the
adpA mutant, both of these plasmids suppressed the defect in
aerial mycelium formation [the results obtained with
pIJ904::adpA(TTA) are shown in Fig.
1A] . adpA
overexpression by pHM11A::adpA(TTA) in the
wild-type strain (J1501) induced rapid aerial hypha formation but
permanently suppressed pigmentation (Fig.
1C) . These results, along
with the enhanced red pigmentation of adpA mutant colonies,
showed that adpA was needed to activate morphological
differentiation and could suppress synthesis of the red-pigmented
antibiotic (undecylprodigiosin) in S . coelicolor.
However, the inverse relationship between aerial mycelium formation and
pigment biosynthesis related to adpA expression may be
indirect, representing competing processes that may or may not have
biological relevance .
adpA and
bldH109 are mutant alleles of the same gene.
While an adpA ortholog is
present in the S . coelicolor genome, a corresponding
adpA mutant allele has not been found among known
developmental genes . Several lines of evidence suggested that
bldH, one of the few unidentified mutant genes, may be such an
allele . Intercellular complementation analyses placed bldH and
bldA alleles in the same group, suggesting that they are
required for the same developmental functions
(21) . Consistent with
this suggestion, bldA tRNA may be needed to translate the
S . coelicolor adpA gene, since it contains a
rare TTA codon (1).
Initial evidence that bldH does indeed correspond to
adpA was provided by experiments showing that the cloned
adpA gene
[pIJ904::adpA(TTA)] was able to
complement the bldH109 mutant (Fig.
2) . Finally, when the adpA locus from the bldH109 mutant
was amplified by three independent PCRs, cloned separately, and
sequenced, each was found to contain an additional G residue inserted
at position +221 with respect to the annotated coding frame . We
conclude that bldH109 is a frameshift mutation in the
adpA gene .
Transcription and
translation of adpA.
To monitor the promoter activity of the
adpA upstream sequence, it was fused to the reporter gene,
xylE, in vector pXE4
(pXE4::padpA) . A 0.5-kb fragment covering
the adpA promoter region was amplified by PCR with primers
adpA-pro1-HindIII/BamHI and
adpA-pro2/BamHI
(GGATCCCAGCACCGCGACGATCTCCTTG) and cloned into the
HindIII and BamHI sites of pXE4
(10), generating a fusion
with xylE (8).
XylE enzyme activity increased markedly just before and during aerial
hypha formation and then gradually decreased (Fig.
3) . Thus, the adpA promoter was apparently under developmental
control, and the timing of its expression was coordinated with aerial
hypha formation .
 | FIG . 3 . adpA
promoter activity is developmentally regulated.
Pregerminated spores (106) of wild-type strain J1501/pXE4
and strain J1501/pXE4::padpA were plated
on thiostrepton-containing R2YE medium, covered with cellophane
membranes, and incubated at 30°C . Extracts were prepared as
described previously
(15), and catechol
dioxygenase activity was calculated as the rate of change in the
optical density at 375 nm per minute, expressed as specific activity
(units per milligram of protein; standard deviation bars are based on
assays of three biological replicate samples) . The XylE activity of the
control strain carrying only vector pXE4 was insignificant
(<0.005 U/mg) (data not shown) . SM, substrate mycelium; AHF,
aerial hypha formation; RED, undecylprodigiosin production; SP,
sporulation.
| |
To test whether the translation of adpA
mRNA was dependent on bldA, perhaps related to the
accumulation of an active form of bldA tRNA
(13,
19), the unique TTA codon
in adpA was changed to CTC . The mutant allele was generated by
a two-stage PCR mutagenesis approach
(15) with primers
adpA-pro1-HindIII/BamHI and
adpA-C-BamHI together with primers adpA/CTC1
(ACAGGTCTCTCCCGGAGGAGATCG; the mutated
codon is underlined) and adpA/CTC2
(TCTCCTCCGGGAGAGACCTGTCGA; the mutated
codon is underlined) . The PCR product was cloned into pGEM-T-Easy, and
its sequence was verified . The insert was removed by BamHI
digestion and cloned into the BamHI site of pIJ904
[pIJ904::adpA(CTC)] . In the
bldA mutant background, the adpA allele with the CTC
mutation (Fig . 1B) was
able to induce aerial hypha formation (Fig.
1B) . In contrast, the
cloned wild-type TTA-containing allele had no apparent effect on the
bldA mutant (Fig.
1B) . Scanning electron
microscopic inspection (Fig.
2) of the colony surface
showed that pIJ904::adpA(CTC) allowed the
bldA strain to form some aerial hyphae and spores having a
wild-type appearance, while the wild-type construct
[pIJ904::adpA(TTA)] had no
effect (data not shown) . The fact that aerial hypha formation in the
pIJ904::adpA(CTC)-complemented
bldA strain was significantly delayed and reduced compared to
that in the wild-type strain could have been due to defective
transcriptional control of the cloned gene . However, it may indicate
the requirement for additional bldA targets that facilitate
aerial hypha formation, including TTA-containing genes outside the
adpA locus . Finally, it is also possible that, in the
bldA mutant background, the mutant CTC codon facilitated
translation of the cloned adpA copy but translational arrest
at the native TTA-containing chromosomal copy had a polar effect on the
expression of other developmental genes located
downstream .
adpA activity
requires ramR.
ramR is a response regulator
gene within a cluster of genes needed for aerial hypha formation in
both S . coelicolor
(15,
16) and S.
griseus (amfR)
(17) . In S.
coelicolor, its overexpression accelerates aerial mycelium
formation in wild-type strains and restores aerial hypha formation in
most defective mutants, including bldA and bldH
mutants . ramR promoter activity is dependent on several
developmental genes, including the bldA and bldH
genes (9) . Thus,
ramR apparently serves as one of the final steps of the
regulatory cascade leading to aerial hypha formation
(15) .
Like the
overexpression of ramR, the overexpression of adpA in
wild-type S . coelicolor induced rapid aerial mycelium
formation (Fig . 1C) . The
fact that this effect was not significant in the ramR mutant
(Fig . 1C) suggested that
adpA activity was dependent on ramR . In the
complementary experiment, the overexpression of ramR in either
adpA (Fig . 1C) or
bldH (15)
mutants was able to accelerate aerial hypha formation . These results
provide additional evidence that ramR functions downstream of
adpA or bldH .
Concluding
remarks.
We have presented
evidence suggesting that adpA transcription is activated
during aerial hypha formation and that its TTA triplet is required for
aerial mycelium formation . However, we reemphasize that these and other
studies of bldA do not prove that the activity of a specific
tRNA reflects a bona fida regulatory system
(18) or that it is
necessarily peculiar to developmental systems in Streptomyces.
Interestingly, a recent comparison of the levels of charged tRNAs that
carry the same amino acid (isoacceptors) relative to the nonrandom
distributions of their corresponding codons in Escherichia
coli genes suggested that the selective use of alternative
isoacceptors can regulate certain functions
(4) . The model predicts
that under amino acid starvation conditions, charged tRNA isoacceptors
corresponding to preferred codons will be depleted first and that those
corresponding to rare codons will remain relatively abundant . Selective
codon usage in genes encoding enzymes involved in amino acid
biosynthesis or their corresponding regulatory elements (attenuators)
suggests that it may provide translational regulatory functions during
starvation . By analogy, developmental genes containing the rare TTA
codon in Streptomyces may be preferentially translated during
starvation responses associated with antibiotic biosynthesis and
colonial morphogenesis .
This
work was supported by Swiss National Science Foundation grants
31-59156.99 and 3100AO-100293/1 .
We thank D . Fink, S.
P . Salvatore, and K . Chater for sharing information prior to
publication, Marcus Dürrenberger and Marcel Dueggelin for
electron micrographs, and Urs Jenal for critical reading of the
manuscript .
* Corresponding
author . Mailing address: Department of Molecular Microbiology,
Biozentrum, Universität Basel, Klingelbergstr . 50/70, 4056 Basel,
Switzerland . Phone: 41 61 267 2116 . Fax: 41 61 267 2118 . E-mail:
Charles-J.Thompson{at}unibas.ch .
Present
address: Cubist Pharmaceuticals, 65 Hayden Ave., Lexington, MA
02421 .
- Bentley,
S . D., K . F . Chater, A . M.
Cerdeno-Tarraga, G . L . Challis, N . R . Thomson,
K . D . James, D . E . Harris, M . A . Quail,
H . Kieser, D . Harper, A . Bateman, S . Brown, G . Chandra, C . W.
Chen, M . Collins, A . Cronin, A . Fraser, A . Goble, J . Hidalgo, T.
Hornsby, S . Howarth, C . H . Huang, T . Kieser, L . Larke, L.
Murphy, K . Oliver, S . O'Neil, E . Rabbinowitsch, M . A.
Rajandream, K . Rutherford, S . Rutter, K . Seeger, D . Saunders, S . Sharp,
R . Squares, S . Squares, K . Taylor, T . Warren, A . Wietzorrek, J.
Woodward, B . G . Barrell, J . Parkhill, and D . A.
Hopwood. 2002 . Complete genome sequence of the model
actinomycete Streptomyces coelicolor A3(2).Nature
417:141-147.
- Bierman,
M., R . Logan, K . O'Brien, E . T . Seno, R . N.
Rao, and B . E . Schoner. 1992 . Plasmid
cloning vectors for the conjugal transfer of DNA from
Escherichia coli to Streptomyces
spp . Gene
116:43-49.
- Blondelet
Rouault, M . H., J . Weiser, A . Lebrihi, P . Branny, and
J . L . Pernodet. 1997 . Antibiotic resistance
gene cassettes derived from the omega interposon for use in E.
coli and Streptomyces . Gene
190:315-317.
- Elf,
J., D . Nilsson, T . Tenson, and M . Ehrenberg. 2003.
Selective charging of tRNA isoacceptors explains patterns of codon
usage . Science
300:1718-1722.
- Fernandez-Moreno,
M . A., J . L . Caballero, D . A . Hopwood,
and F . Malpartida. 1991 . The act cluster
contains regulatory and antibiotic export genes, direct targets for
translational control by the bldA tRNA gene of
Streptomyces . Cell
66:769-780.
- Gramajo,
H . C., E . Takano, and M . J . Bibb.1993 . Stationary-phase production of the antibiotic
actinorhodin in Streptomyces coelicolor A3(2) is
transcriptionally regulated . Mol . Microbiol.
7:837-845.
- Ikeda,
H., J . Ishikawa, A . Hanamoto, M . Shinose, H . Kikuchi, T . Shiba, Y.
Sakaki, M . Hattori, and S . Omura. 2003 . Complete
genome sequence and comparative analysis of the industrial
microorganism Streptomyces avermitilis . Nat.
Biotechnol.
21:526-531.
- Ingram,
C., M . Brawner, P . Youngman, and J . Westpheling. 1989.
xylE functions as an efficient reporter gene in
Streptomyces spp.: use for the study of galP1, a
catabolite-controlled promoter . J . Bacteriol.
171:6617-6624.
- Keijser,
B . J., G . P . Van Wezel, G . W . Canters,
and E . Vijgenboom. 2002 . Developmental regulation of
the Streptomyces lividans ram genes:
involvement of RamR in regulation of the ramCSAB operon.J . Bacteriol.
184:4420-4429.
- Kieser,
T., M . J . Bibb, M . J . Buttner, K . F.
Chater, and D . A . Hopwood. 2000 . Practical
Streptomyces genetics . The John Innes Foundation, Norwich, United
Kingdom.
- Lawlor,
E . J., H . A . Baylis, and K . F.
Chater. 1987 . Pleiotropic morphological and antibiotic
deficiencies result from mutations in a gene encoding a tRNA-like
product in Streptomyces coelicolor A3(2).Genes Dev.
1:1305-1310.
- Leskiw,
B . K., E . J . Lawlor, J . M.
Fernandez-Abalos, and K . F . Chater. 1991.
TTA codons in some genes prevent their expression in a class of
developmental, antibiotic-negative, Streptomyces mutants.Proc . Natl . Acad . Sci . USA
88:2461-2465.
- Leskiw,
B . K., R . Mah, E . J . Lawlor, and K . F.
Chater. 1993 . Accumulation of
bldA-specified tRNA is temporally regulated in
Streptomyces coelicolor A3(2) . J.
Bacteriol.
175:1995-2005.
- Müller,
T., R . Guggenheim, M . Düggelin, and C . Scheidegger.1991 . Freeze-fracturing for conventional and field
emission low-temperature scanning electron microscopy: the scanning
cryo unit SCU 020 . J . Microsc.
161:73-83.
- Nguyen,
K . T., J . M . Willey, L . D . Nguyen,
L . T . Nguyen, P . H . Viollier, and C . J.
Thompson. 2002 . A central regulator of morphological
differentiation in the multicellular bacterium Streptomyces
coelicolor . Mol . Microbiol.
46:1223-1238.
- O'Connor,
T . J., P . Kanellis, and J . R . Nodwell.2002 . The ramC gene is required for morphogenesis
in Streptomyces coelicolor and expressed in a cell
type-specific manner under the direct control of RamR . Mol.
Microbiol.
45:45-57.
- Ohnishi,
Y., S . Kameyama, H . Onaka, and S . Horinouchi. 1999.
The A-factor regulatory cascade leading to streptomycin biosynthesis in
Streptomyces griseus: identification of a target gene
of the A-factor receptor . Mol . Microbiol.
34:102-111.
- Trepanier,
N . K., S . E . Jensen, D . C . Alexander, and
B . K . Leskiw. 2002 . The positive activator
of cephamycin C and clavulanic acid production in Streptomyces
clavuligerus is mistranslated in a bldA mutant.Microbiology
148:643-656.
- Trepanier,
N . K., G . D . Nguyen, P . J . Leedell, and
B . K . Leskiw. 1997 . Use of polymerase chain
reaction to identify a leucyl tRNA in Streptomyces
coelicolor . Gene
193:59-63.
- White,
J., and M . Bibb. 1997 . bldA dependence of
undecylprodigiosin production in Streptomyces
coelicolor A3(2) involves a pathway-specific regulatory
cascade . J . Bacteriol.
179:627-633.
- Willey,
J., J . Schwedock, and R . Losick. 1993 . Multiple
extracellular signals govern the production of a morphogenetic protein
involved in aerial mycelium formation by Streptomyces
coelicolor . Genes Dev.
7:895-903.
Free Online Full-text Article
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
|
