|
|
|
Journal of Bacteriology, June 2003, p . 3446-3452, Vol . 185, No . 11 Quantitation of mecA Transcription in Oxacillin-Resistant Staphylococcus aureus Clinical IsolatesAdriana E . Rosato,1 William A . Craig,1 and Gordon L . Archer1,2* Departments of Medicine,1 Microbiology/Immunology, Medical College of Virginia Campus of Virginia Commonwealth University, Richmond, Virginia 23298-00492 Received 9 January 2003/ Accepted 12 March 2003
In a previous study (17), we showed that at least one repressor with a wild-type nucleotide sequence was present in 91 of 95 genetically diverse clinical Staphylococcus aureus isolates . We hypothesized that repression was evolutionarily conserved in order to prevent overproduction of a potentially toxic, regulated gene product . However, we did not assess the effectiveness of repression by directly measuring the transcription of regulated genes . A direct assessment of transcriptional regulation is of interest for several reasons . First, in an earlier study (16), members of our group identified an isolate containing mecI with wild-type repressor and promoter-operator sequences in which mecA transcription was eightfold greater than that in another isolate containing mecI with the same sequence . In the present study, we sought evidence for similar variations in mecA transcriptional repression among clinical isolates containing mecI genes with wild-type sequence . Second, we sought to confirm data generated with a single, genetically manipulated strain indicating that wild-type MecI and BlaI provided additive repression of mecA transcription when both were present in the same strain (15) . Third, we wanted to assess the extent to which mutations in mecI or blaI affected repressor function . These data might provide valuable structure-function correlates to complement studies investigating the molecular basis of MecR1-BlaR1 and MecI-BlaI signal transduction . However, all but one of the clinical isolates with mutant mecI also contained the corepressor gene, blaI, making it difficult to assess the contribution of individual repressor mutations to mecA regulation . In order to assess the function of mutant repressors, we first had to establish baseline values for transcription repression in isolates with blaI and mecI that had wild-type DNA sequence . We used real-time reverse transcription PCR (RT-PCR) as our method for transcriptional quantification . We identified groups of isolates that had all possible combinations of the two repressors with wild-type sequence: both together, both absent, and each present without the other . The values for mecA transcription among these isolates were used as standards with which to compare isolates with mecI mutations . As described in a previous publication (17), we have found, among the 26 clinical isolates with mecI mutations, a wide variety in the type and location of mutation, making it possible to attempt structure-function predictions .
Isolates with wild-type mecI and blaI.
Isolates with both wild-type mecI and blaI together, neither
repressor, or each without the other were chosen from among the
clinical isolates and other well-characterized strains in our
collection . The DNA sequence of the repressors was determined and
described previously (17) . The isolates with only wild-type
mecI came from all three clinical collections (12 isolates);
those with blaI only, containing the previously described IS1272-mediated
deletion of mecI (2), were all from the PHRI
collection, and each was of a unique spa-repeat type (12
isolates); those with both mecI and blaI were from the
PHRI and VCU collections, and each was of a unique spa-repeat
type (12 isolates); and those with neither repressor contained only
the IS1272-mediated mecI deletion (three isolates) or
laboratory-constructed mecI knockouts (three isolates) .
Well-characterized isolates (1, 12,
15, 16) were used as
comparators in the appropriate groups: COL and 450 M ( Isolates with mecI and blaI mutations. The 26 isolates with mecI mutations and the single isolate with a mutation in blaI were described previously (17) . Media. Mueller-Hinton broth and Mueller-Hinton agar (both from BBL Microbiology Systems, Cockeysville, Md.) and brain heart infusion broth and agar (Difco Laboratories, Detroit, Mich.), with and without selective additives (Sigma, St . Louis, Mo.; United States Biochemicals, Cleveland, Ohio), were used for subculture and maintenance of S . aureus strains . Southern blot analysis. The genetic location of blaI was determined by probing plasmid and chromosomal DNA of selected isolates with this gene . Plasmid and chromosomal DNA were extracted from bacterial isolates using Qiagen columns (Qiagen, Inc., Chatsworth, Calif.), electrophoresed through agarose, and transferred to a nylon membrane using capillary action . Probe DNA was labeled with digoxigenin and applied to membranes according to the manufacturer's instructions (Roche Molecular Biochemicals, Indianapolis, Ind.) . Signal was detected by exposing membranes to X-ray film . blaI was assumed to be plasmid encoded if the probe hybridized with a plasmid band of a size approximately equal to that of control plasmid pI258 and chromosomally encoded if the probe hybridized with only the chromosomal band . However, it is possible that in some isolates, plasmid DNA comigrated with chromosomal DNA and was mistakenly designated a chromosomal gene . Northern blot analysis. S . aureus was grown in 30 ml of brain heart infusion broth to an optical density at 600 nm of 0.6 . Cultures were centrifuged, and the bacteria were resuspended in 1,000 µl of RLT buffer (RNeasy kit; Qiagen Inc.) and added to 2-ml FastPrep Blue tubes containing ceramic matrices (Bio 101, La Jolla, Calif.) . The bacteria were lysed with a Fast Prep instrument (Bio101) at setting 6 for 40 s, placed on ice for 1 min, and centrifuged at 10,000 x g for 5 min at 4°C . The upper aqueous phase was aspirated, and total RNA was extracted using a Qiagen RNeasy kit . About 7 µg of RNA was separated by resolution through formaldehyde-containing 1% agarose . The intensities of the 23S and 16S rRNA were visualized using a 254-nm UV short-wave lamp, and quantities were adjusted so that the same amount of RNA was loaded for each bacterium . RNA was transferred from agarose to positively charged nylon membranes (Stratagene, La Jolla, Calif.) by capillary action as previously described (15) . Labeling and hybridization were done by use of the digoxigenin labeling and detection kits according to the manufacturer's instructions (Roche Molecular Biochemicals) and exposed to X-ray film . Real-time RT-PCR. Oligonucleotide primers and probes for mecA and 16S rRNA were designed with Primer Express 1.0 software form ABI Prism (Perkin-Elmer Applied Biosystems, Foster City, Calif.) and purchased from Megabase Inc (Evanston, Ill.) . The probes consisted of an oligonucleotide labeled at the 5' end with the reporter dye 6-carboxyfluorescein and with the quencher dye N,N',N'-tetramethyl-6 carboxytetramethylrhodamine at the 3' end . RT-PCR was done with the TaqMan One-Step RT-PCR Master Mix Reagents kit as described by the manufacturer (PE Applied Biosystems, Foster City, Calif.) . The RT-PCR mixture (25 µl contained 6.25 U of Multiscribe reverse transcriptase, 10.0 U of RNase inhibitor, 500 nM (each) gene-specific primer, 100 nM (each) probe, and 25 ng of total RNA template . Amplification and detection of specific products were performed with the ABI Prism 7700 sequence detection system (PE Applied Biosystems) with the following cycle profile: 1 cycle at 48°C for 30 min, 1 cycle at 95°C for 10 min, 40 cycles at 95°C for 15 s and 60°C for 1 min . The critical threshold cycle (Ct) is defined as the cycle at which the fluorescence becomes detectable above background levels and is inversely proportional to the logarithm of the initial number of template molecules . A standard curve was plotted for each primer-probe set with Ct values obtained from amplification of known quantities of RNA isolated from strain S . aureus 450 M . The standard curves were used to transform Ct values to the relative number of RNA molecules . The amount of contaminating chromosomal DNA in each sample was determined with the control reactions that did not contain reverse transcriptase . The quantity of cDNA for each experimental gene was normalized to the quantity of 16S cDNA in each sample . Each RNA sample was run in triplicate . The forward and reverse primers for mecA RT-PCR were GTTAGATTGGGATCATAGCGTCATT and TGCCTAATCTCATATGTGTTCCTGTAT, respectively, and for 16S RT-PCR they were TCCGGAATTATTGGGCGTAA and CCACTTTCCTCTTCTGCACTCA, respectively . The probes, labeled with carboxyfluorescein at the 5' end and N,N',N'-tetramethyl-6 carboxytetramethylrhodamine at the 3' end, were TTCCAGGAATGCAGAAAGACCAAAGCATGA for mecA and AAGCCCACGGCTCAACCG for 16S RNA . Assay for ß-galactosidase activity. ß-galactosidase activity was assessed in cell extracts, produced by homogenization of bacteria with glass beads for 3 min in a mini-bead-beater (BioSpec Products, Bartlesville, Okla.) using o-nitrophenyl-ß-D-galactopyranoside as a substrate, as previously described (18) . Statistical analysis. Differences between the RT-PCR values in one group versus another were assessed by analysis of variance using SPSS for Windows (SPSS Inc., Chicago, Ill.) .
Class three (missense) mutations were found in 11 isolates . Two and three isolates had identical mutations (Leu116Ser and Ala11Val, respectively), while the final six isolates each had a unique mutation . In one of these isolates, SA47 (stop124Lys), the translational termination of the open reading frame was replaced by a lysine, extending the protein sequence by 18 amino acids . Five of the eight unique mutations in mecI were in amino acids that were conserved between mecI and blaI . There was a single isolate that contained mutant blaI; mecI was deleted in this isolate . There were four missense mutations in this isolate, each at a residue that was not conserved between blaI and mecI . At one position, the blaI mutation changed the amino acid to the one found at the comparable position in mecI (E64N) (Fig . 2) . Transcription of mecA in isolates with mecI and blaI
mutations. All of the isolates with mecI mutations but one
contained blaI with wild-type sequence, as shown in a previous
study (17) . Thus, the mecA transcription
results for the isolates with mecI mutations (mut mecI-blaI)
were compared to those for two groups of isolates ( The nonsense mutation at amino acid 68, found in 12 isolates, was
predicted to inactivate MecI, leaving only BlaI as the sole mecA
transcriptional regulator . The data were consistent with this
prediction . The values for mecA transcription in this group (mut
mecI blaI, 181.6 ± 76; range, 102 to 330) were not
statistically different from values for those in the group having
BlaI but no MecI ( The mecA transcription values of the four isolates with frameshift mutations were all greater than 200 (306, 330, 801, and 1,172), making it likely that the mutation completely inactivated mecI, as predicted (Table 1) . There were nine different missense mutations in 11 isolates (Table 1) . Mutations in 7 of the 11 isolates had mecA transcription values that were less than 70 (mean, 45; range, 21 to 66), while mutations in four isolates yielded values ranging from 201 to 1,907 . One of the isolates with high mecA transcription values (261 and 256) had the same missense mutation (A11V) as two isolates with low transcription values (22 and 35) . There were no differences in blaI or mec promoter-operator sequences or mecI RBS sequences among these three isolates . Northern blot analysis of mecA transcription. The RT-PCR results for some isolates were confirmed by Northern blot analysis . The same RNA used for RT-PCR analysis was examined by Northern blotting for the following isolates: six with the same missense mutation, all four with frameshift mutations, six with nonsense mutations, and two each with wild-type repressor combinations (both together, each without the other, and neither) . The relative intensity of the mecA transcript by Northern blot analysis was consistent with the relative values generated using RT-PCR in each instance . Representative Northern blot results are shown in Fig . 3 . Sequence analysis of mecR1 and induction of mecA transcription. In four isolates containing mecI without blaI and mecA transcription values >1,000, the DNA sequence of mecR1 was determined . In all four isolates the sequence was wild- type, identical to that of N315 . In addition, all of the isolates with mecI mutations were induced overnight by growing them in 0.3 µg of oxacillin/ml, and mecA transcription was determined by RT-PCR . Although there was a wide range of transcription values following induction, mecA transcription values increased at least twofold for each isolate . This suggests that BlaR1 was functional in these strains, because mutation would have led to constitutive BlaI-mediated repression .
In the present study, when we examined baseline, uninduced repression of mecA in clinical isolates that contained only mecI with wild-type DNA sequence, mecA transcription was from 6- to 131-fold greater than that seen with a well-studied comparator strain (N315P) and a laboratory construct (450 M::630) . A single nucleotide difference in the mecI RBS (GGAA versus GGAG) (Fig . 4) between clinical isolates and laboratory strains was shown to be responsible for some of the difference in mecA transcription, increasing it from 7.3- to 8.2-fold in isogenic constructs . However, the magnitude of increase in mecA transcription due to mecI RBS mutations does not completely explain the 26- to >100-fold increases in transcription seen in some clinical isolates compared to laboratory constructs . It is unlikely that changes in MecR1 account for these differences, since the mecR1 sequence was wild type in four of these isolates . It is likely, therefore, that uninduced transcription of mecA can be greatly increased by mechanisms that do not involve mutations in mecI, its RBS, or its promoter-operator target . Additional genes outside of the regulatory operon may be involved in repression and induction, as proposed initially by Cohen and Sweeney (4) and as recently documented for beta-lactamase induction in Bacillus sp . (6) . Identification of accessory genes and gene products involved in repression and induction of mecA transcription will be required for a full understanding of this regulatory network . One observation made with laboratory constructs was confirmed in this study . In a previous study, members of our group had observed that there appeared to be an additive or synergistic interaction between BlaI and MecI, and the two repressors were shown to form heterodimers in the yeast two-hybrid assay (15) . In the present study, in clinical isolates containing both wild-type mecI and blaI, mecA transcription was at a lower level than in isolates containing either one alone . This occurred despite the apparent reduced effect of wild-type mecI alone . The additive activity of the two repressors may have been due to direct interactions between the proteins at the mec promoter-operator . We demonstrated in a previous study (15) that increasing either MecI oligomerization or mecI gene dosage increased mecA transcription repression . The addition of BlaI to MecI could effectively increase the amount of available repressor protein and the number of protein-protein interactions . A major goal of the present study was to assess the effect that the various mecI mutations identified in clinical isolates had on mecA transcription as an aid to structure-function analysis of the repressor molecule . This goal was made difficult by the presence of corepressors, MecI and BlaI, in most of the isolates in which mecI was mutant and by the possible contribution, noted above, of additional unknown genes involved in repressor activity . However, evaluation of isolates with wild-type repressor sequence as comparators for isolates with mutations enabled us to make some observations about the effect of mutations on mecI function . First, nonsense and frameshift mutations were predicted to truncate the protein at positions that would have removed the carboxyl terminus . The cleavage site that inactivates the repressor following induction, presumably by preventing dimerization, is 22 amino acids from the carboxyl terminus in BlaI (19) and in the same relative position in MecI (G . Archer and M . Bosilevac, unpublished observations) (Fig . 2) . Thus, all of the nonsense and frameshift mutations were predicted to inactivate repressor activity . The mecA transcription values for these isolates were similar to those for isolates in which BlaI alone regulated transcription, suggesting that MecI function was absent . Second, we found four blaI missense mutations in a single isolate containing this repressor alone . The value for mecA transcription for this isolate (431) was slightly higher than the highest value in isolates containing blaI alone with wild-type sequence (346) but more than 10-fold below the value of isolates with no repressor (mean, 6,302) . This suggests that these mutations did not markedly affect repressor function . The mutations (Y37N, S63Y, E64N, and N72I) were all at amino acids that were nonconserved between MecI and BlaI, two proteins that have 68% amino acid identity overall (Fig . 2) . One mutation changed the amino acid from the one found in BlaI to its counterpart in MecI (E64N) . It is reasonable to assume that the areas of nonidentity between the two proteins define parts of structure that are either nonessential for repressor function or that can be highly polymorphic and still not abolish activity . Third, we examined mecA transcription in isolates that had eight different mecI missense mutations . Six of the mutations changed amino acids that were conserved between MecI and BlaI . The mutations at six nucleotides, changing five amino acids and one stop codon (A11V, I7V, D39G, P42L, L48,F and stop124K) in seven isolates, had mecA transcription values that were <70, not significantly different from values seen in a subset of isolates with two wild-type repressors . This suggests that these mutations left much of MecI repressor activity intact . Three mutations replaced amino acids conserved between BlaI and MecI, and although two (A11V and I7V) were in the amino terminus of the protein in an area without identified function, the other (L48F) was in a region that is predicted to be the helix-turn-helix conformation that mediates DNA binding . Conservation of function in this case may be more related to the nature of the amino acid substitution than to its location . The other three mutations either were at amino acids that were different between MecI and BlaI (D39G and P42L) (Fig . 2) or extended the protein by 19 amino acids by mutating the translational stop . One of these mutations has been studied previously (D39G) (18) . Examination of purified protein and isogenic constructs containing this mutation showed that the mutation reduced repressor activity sixfold . However, transcription was still repressed sevenfold over that seen in the absence of repressor . The clinical isolate in which this mecI mutation was found also contained blaI . The RT-PCR transcription values provide evidence that MecI-BlaI additive repression can take place even when one of the proteins has a mutation that reduces its activity . Three final isolates had two mecI mutations that markedly altered transcriptional repression . Both mutations substituted amino acids that were conserved between MecI and BlaI, one (R52I) in the DNA binding domain and the other (L116S) in the carboxyl terminus, a region thought to be critical for dimerization (9) . It is interesting that a nonsense mutation at the preceding amino acid (E115stop) in another clinical isolate altered mecA transcription to the same degree as the L116S missense mutation in one of two isolates with the same mutation (transcription values of 226 versus 201 and 194, respectively) . These data support the functional importance of the carboxyl terminus of the protein and suggest that the L116S substitution has a major effect on repressor activity . The structure-function clues gleaned from the analysis of repressor mutations in clinical isolates will have to await data from the crystal structure for confirmation of suggestions outlined above . However, the data should help the analysis of crystals and provide sites at which the molecules could be modified for more detailed structure-function analysis .
What Is Functional Genomics?,
What Is Yeast?,
What Is Biofilter?,
What Is Genetics?,
What Is Amino Acid?,
a,
Microbe,
o,
Bacteria,
r,
Microbiology,
n,
Microorganisms,
s,
Bacterium,
r,
Escherichia coli,
r,
Fermentations,
a,
Yeasts,
s,
Escherichia coli,
e,
Antimicrobial,
r,
Clostridia,
a,
Enterobacters,
a,
Antimicrobials,
i,
Campylobacter,
s,
Microorganism,
c,
Escherichia coli,
c,
Microorganisms,
s,
Yeasts,
r,
Eubacter,
r,
Streptococci,
e,
Pseudomonas aeruginosa,
i,
Bacteriophages,
o,
Staphylococcus aureus,
s,
Streptococcal,
e,
Salmonella,
o,
Streptococci
|
© 2005
Transgalactic Ltd (manufacturer of Bioscreen C software) |
Privacy Statement | P.O. Box
1393, 00101 Helsinki, Finland,
Last modified: May 25, 2005
| ||||||