|
|
|
|
|
|
Novel Resistance-Nodulation-Cell Division Efflux System AdeDE in Acinetobacter Genomic DNA Group 3. Sze-Lok Chau, 2004.Resistance-nodulation-cell division type efflux pump AdeDE was identified in acinetobacters belonging to genomic DNA group 3 . Inactivation of adeE showed that it may be responsible for reduced susceptibility to amikacin, ceftazidime, chloramphenicol, ciprofloxacin, erythromycin, ethidium bromide, meropenem, rifampin, and tetracycline . However, unlike what was found for other similar efflux systems, the open reading frame for the outer membrane component was not found downstream of the adeDE gene cluster . The Gonococcal Fur Regulon: Identification of Additional Genes Involved in Major Catabolic, Recombination, and Secretory Pathways. Shite Sebastian, 2002.In this study, we have characterized the in vitro binding of Neisseria gonorrhoeae Fur to several well-defined iron transport genes, as well as to additional genes involved in major catabolic, secretory, and recombination pathways of gonococci . The gonococcal Fur protein was recombinantly expressed in Escherichia coli HBMV119 . Fur was isolated from inclusion bodies and partially purified by ion-exchange chromatography . Gonococcal Fur was found to bind to the promoter/operator region of a gene encoding the previously identified Fur-regulated periplasmic binding protein (FbpA) in a metal ion-dependent fashion, demonstrating that purified Fur is functional . In silico analysis of the partially completed gonococcal genome (FA1090) identified Fur boxes in the promoters of several genes, including tonB, fur, recN, secY, sodB, hemO, hmbR, fumC, a hypothetical gene (Fe-S homolog), and the opa family of genes . By using purified gonococcal Fur, we demonstrate binding to the operator regions of tonB, fur, recN, secY, sodB, hemO, hmbR, fumC, the Fe-S homolog gene, and the opa gene family as determined by an electrophoretic mobility shift assay . While gonococcal Fur was demonstrated to bind to the promoter regions of all 11 opa genes (opaA through -K), we did not detect binding of purified E . coli Fur with 8 of the 11 opa members, indicating that target DNA sequence specificities between these two closely related proteins exist . Furthermore, we observed differences in the relative strengths of binding of gonococcal Fur for these different genes, which most likely reflect a difference in affinity between gonococcal Fur and its DNA targets . This is the first report that definitively demonstrates the binding of gonococcal Fur to its own promoter/operator region, as well as to the opa family of genes that encode surface proteins . Our results demonstrate that the gonococcal Fur protein binds to the regulatory regions of a broad array of genes and indicates that the gonococcal Fur regulon is larger than originally proposed . Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus. Takayuki Horiuchi, 2002.The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus . Deletion of dofA and dofB did not affect the vegetative growth and development of M . xanthus . dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development . The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants . The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant . These results are consistent with those of the pulse-labeling experiments . dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants . The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated . The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested . Role of narK2X and narGHJI in Hypoxic Upregulation of Nitrate Reduction by Mycobacterium tuberculosis. Charles D. Sohaskey, 2003.Mycobacterium tuberculosis is one of the strongest reducers of nitrate in the genus Mycobacterium . Under microaerobic conditions, whole cells exhibit upregulation of activity, producing approximately eightfold more nitrite than those of aerobic cultures of the same age . Assays of cell extracts from aerobic cultures and hypoxic cultures yielded comparable nitrate reductase activities. Mycobacterium bovis produced only low levels of nitrite, and this activity was not induced by hypoxia . M. tuberculosis has two sets of genes, narGHJI and narX of the narK2X operon, that exhibit some degree of homology to prokaryotic dissimilatory nitrate reductases . Each of these were knocked out by insertional inactivation . The narG mutant showed no nitrate reductase activity in whole culture or in cell-free assays, while the narX mutant showed wild-type levels in both assays . A knockout of the putative nitrite transporter narK2 gene produced a strain that had aerobic levels of nitrate reductase activity but failed to show hypoxic upregulation. Insertion of the M . tuberculosis narGHJI into a nitrate reductase Escherichia coli mutant allowed anaerobic growth in the presence of nitrate . Under aerobic and hypoxic conditions, transcription of narGHJI was constitutive, while the narK2X operon was induced under hypoxia, as measured with a lacZ reporter system and by quantitative real-time reverse PCR . This indicates that nitrate reductase activity in M. tuberculosis is due to the narGHJI locus with no detectable contribution from narX and that the hypoxic upregulation of activity is associated with the induction of the nitrate and nitrite transport gene narK2 . Production of Optically Pure D-Lactic Acid in Mineral Salts Medium by Metabolically Engineered Escherichia coli W3110. Shengde Zhou, 2003.The resistance of polylactide to biodegradation and the physical properties of this polymer can be controlled by adjusting the ratio of L-lactic acid to D-lactic acid . Although the largest demand is for the L enantiomer, substantial amounts of both enantiomers are required for bioplastics . We constructed derivatives of Escherichia coli W3110 (prototrophic) as new biocatalysts for the production of D-lactic acid . These strains (SZ40, SZ58, and SZ63) require only mineral salts as nutrients and lack all plasmids and antibiotic resistance genes used during construction . D-Lactic acid production by these new strains approached the theoretical maximum yield of two molecules per glucose molecule . The chemical purity of this D-lactic acid was  98% with respect to soluble organic compounds . The optical purity exceeded 99% . Competing pathways were eliminated by chromosomal inactivation of genes encoding fumarate reductase (frdABCD), alcohol/aldehyde dehydrogenase (adhE), and pyruvate formate lyase (pflB) . The cell yield and lactate productivity were increased by a further mutation in the acetate kinase gene (ackA) . Similar improvements could be achieved by addition of 10 mM acetate or by an initial period of aeration . All three approaches reduced the time required to complete the fermentation of 5% glucose . The use of mineral salts medium, the lack of antibiotic resistance genes or plasmids, the high yield of D-lactate, and the high product purity should reduce costs associated with nutrients, purification, containment, biological oxygen demand, and waste treatment .
Bacteriophage Ecology in Commercial Sauerkraut Fermentations. Z. Lu, 2003.Knowledge of bacteriophage ecology in vegetable fermentations is essential for developing phage control strategies for consistent and high quality of fermented vegetable products . The ecology of phages infecting lactic acid bacteria (LAB) in commercial sauerkraut fermentations was investigated . Brine samples were taken from four commercial sauerkraut fermentation tanks over a 60- or 100-day period in 2000 and 2001 . A total of 171 phage isolates, including at least 26 distinct phages, were obtained . In addition, 28 distinct host strains were isolated and identified as LAB by restriction analysis of the intergenic transcribed spacer region and 16S rRNA sequence analysis . These host strains included Leuconostoc, Weissella, and Lactobacillus species . It was found that there were two phage-host systems in the fermentations corresponding to the population shift from heterofermentative to homofermentative LAB between 3 and 7 days after the start of the fermentations . The data suggested that phages may play an important role in the microbial ecology and succession of LAB species in vegetable fermentations . Eight phage isolates, which were independently obtained two or more times, were further characterized . They belonged to the family Myoviridae or Siphoviridae and showed distinct host ranges and DNA fingerprints . Two of the phage isolates were found to be capable of infecting two Lactobacillus species . The results from this study demonstrated for the first time the complex phage ecology present in commercial sauerkraut fermentations, providing new insights into the bioprocess of vegetable fermentations .
|
© 2005
Transgalactic Ltd (manufacturer of Bioscreen C software) |
Privacy Statement | P.O. Box
1393, 00101 Helsinki, Finland,
Last modified: May 25, 2005
| ||||||
