Microbiology Reader
Equipment to run microbiology work automatically

Growth Curves of any strain.
Microbiological calculations.

Microbiology Home
Microbioloy Reader
Growth Curves
Photo Album
Microorganisms
Software
Download
Purchasing
Contact Us


Journal of Bacteriology, December 2002, p . 6777-6785, Vol . 184, No . 24

Mutant Forms of the Azotobacter vinelandii Transcriptional Activator NifA Resistant to Inhibition by the NifL Regulatory Protein

Francisca Reyes-Ramirez,{dagger} Richard Little, and Ray Dixon*

Department of Molecular Microbiology, John Innes Centre, Norwich NR4 7UH, United Kingdom

Received 8 July 2002/ Accepted 19 September 2002


   ABSTRACT

 
The Azotobacter vinelandii {sigma}54-dependent transcriptional activator protein NifA is regulated by the NifL protein in response to redox, carbon, and nitrogen status . Under conditions inappropriate for nitrogen fixation, NifL inhibits transcription activation by NifA through the formation of the NifL-NifA protein complex . NifL inhibits the ATPase activity of the central AAA+ domain of NifA required to drive open complex formation by {sigma}54-RNA polymerase and may also inhibit the activator-polymerase interaction . To analyze the mechanism of inhibition in greater detail, we isolated NifA mutants which are resistant to the inhibitory action of NifL . Mutations in both the amino-terminal GAF domain and the catalytic AAA+ domain of NifA were isolated . Several mutants blocked inhibition by NifL in response to both nitrogen and redox status, whereas some of the mutant NifA proteins were apparently able to discriminate between the forms of NifL present under different environmental conditions . One mutant protein, NifA-Y254N, was resistant to NifL under conditions of anaerobic nitrogen excess but was relatively sensitive to NifL under aerobic growth conditions . The properties of the purified mutant protein in vitro were consistent with the in vivo phenotype and indicate that NifA-Y254N is not responsive to the nitrogen signal conveyed by the interaction of NifL with A . vinelandii GlnK but is responsive to the oxidized form of NifL when ADP is present . Our observations suggest that different conformers of NifL may be generated in response to discrete signal transduction events and that both the GAF and AAA+ domains of NifA are involved in the response to NifL .


   INTRODUCTION

 
Transcription of the genes required for the biosynthesis of molybdenum nitrogenase in Azotobacter vinelandii is regulated by the NifL-NifA system in response to redox, carbon, and energy status . The NifL and NifA proteins play a pivotal role in controlling the expression of nitrogenase and preventing synthesis of this abundant oxygen-sensitive, energy-dependent enzyme under adverse environmental conditions (8) . When conditions are inappropriate for nitrogen fixation, the NifL protein sequesters NifA in a protein-protein complex which prevents NifA, a {sigma}54-dependent transcriptional activator, from making productive interactions with the {sigma}54-RNA polymerase holoenzyme and hence inhibits the activation of transcription by NifA at nif promoters . The A . vinelandii NifA protein is composed of three conserved domains (22): an amino-terminal GAF domain (1), implicated in signaling, a central AAA+ domain (23, 34), required for transcriptional activation, and a C-terminal DNA binding domain, which tethers the activator at sites appropriate for interaction with the polymerase . Both the amino-terminal GAF domain and the central AAA+ domain of NifA have been implicated in the response to NifL . It has been proposed that the GAF domain has a regulatory function and may be involved in regulating the activity of the AAA+ domain in response to NifL (4) . Like other members of the AAA+ superfamily, the central domain of NifA has an ATPase activity which enables structural changes required for remodeling the substrate . For the {sigma}54-dependent activators, nucleotide hydrolysis leads to a conformational switch that causes the promoter-bound {sigma}54-RNA polymerase holoenzyme to undergo the transition from the closed to the open promoter complex (5, 6) . The isolated AAA+ domain of NifA is susceptible to inhibition by NifL, indicating that this domain directly interacts with the cognate regulator, although this interaction is apparently weaker than it is when the GAF domain is present . Moreover, whereas the ATPase activity of wild-type NifA is inhibited by NifL, this is not observed when the GAF domain is absent (4) .

The NifL protein is relatively unique among bacterial regulatory proteins in that it is responsive to multiple environmental signals, which are integrated to regulate the activity of its partner protein, NifA . The redox status is sensed via the amino-terminal PAS domain (32a) of NifL, which contains a flavin adenine dinucleotide (FAD) cofactor (13, 18, 29) . Whereas the oxidized form of NifL is competent to inhibit transcriptional activation by NifA, the reduced form does not inhibit NifA activity (13) . The inhibitory action of NifL is also stimulated by the presence of adenosine nucleotides which bind to the C-terminal region of NifL (9, 13, 31) . ADP binds to this domain with an approximately 10-fold-greater affinity than ATP . The C-terminal domain of NifL is also involved in sensing the nitrogen status . This is conveyed by interaction with the signal transduction protein GlnK, which is covalently modified by uridylylation in response the level of fixed nitrogen (2, 24) . Under conditions of nitrogen excess, A . vinelandii GlnK is primarily in its nonmodified form, which is competent to interact with the C-terminal domain of NifL (15, 28) . This interaction enhances the ability of NifL to inhibit NifA (17) . Under conditions of nitrogen limitation, uridylylation of GlnK prevents its interaction with NifL and consequently NifA activity is not inhibited . In addition to these signaling events, which modulate NifL activity in response to redox and fixed nitrogen status, we have recently shown that the activity of the NifL-NifA system is itself directly responsive to 2-oxoglutarate, which may provide a means of responding to the carbon status (17, 26) . This response is apparently not mediated via an interaction of 2-oxoglutarate with NifL but requires the GAF domain of NifA (16) .

To understand the mechanism whereby NifL inhibits NifA activity, we have isolated and characterized mutant forms of NifA which are resistant to inhibition by NifL . We obtained mutations in both the GAF and AAA+ domains of NifA that make the activator nonresponsive to NifL . As anticipated, many of these mutant NifA proteins are resistant to NifL under all growth conditions tested . Surprisingly, however, some mutant proteins are resistant to inhibition by NifL only in response to specific environmental cues . These observations suggest that different conformers of NifL are formed in response to discrete signal transduction events and that the mechanism of inhibition mediated by NifL in response to the redox status may be different from that imposed in response to the nitrogen status .


   MATERIALS AND METHODS

 
nifA mutagenesis, genetic screen, and plasmid constructions. Error-prone PCR mutagenesis of A . vinelandii nifA was carried out with Taq DNA polymerase by using standard reaction conditions . Reaction mixtures containing 0.1 ng of template pPR34, 0.2 pmol of each downstream and upstream primer, 0.1 mM (each) deoxynucleoside triphosphate, 2 mM MgCl2, and 1 U of enzyme . Reactions were performed for 30 cycles . Primers P1 (5'CAGGGAATGCCCATGAATGC3') and P25 (5'GTTGTCGACCCCGGTCAGCG3') were utilized to mutate the N terminus and the central domain of NifA up to the site corresponding to the PshA1 restriction site . PCR products were gel purified and digested with either MunI and XhoI or XhoI and PshA1 and recloned into pPR34 (31) digested with the same enzymes . A second primer combination, P24 (5'GAGTCCGGTACCGGCAAGG3') and P25 was applied to mutagenize only the central domain of NifA . In this case the resulting PCR products were digested with Asp718 and PshA1 and recloned into pPR34 .

Site-directed mutagenesis of NifA was carried out with the QuickChange site-directed mutagenesis kit (Stratagene) . XhoI-PshI fragments containing the mutations were subcloned into pPR34, and single mutations were confirmed by DNA sequencing .

To identify NifA mutants which escape inhibition by NifL, ligation mixtures were transformed by electroporation into strain ET8000 containing the reporter plasmid pRT22, which carries a Klebsiella pneumoniae nifH-lacZ translational fusion (26, 31, 33) . Transformants were selected on minimal medium plates containing (NH4)2SO4 (1 mg/ml) as a nitrogen source, supplemented with glucose (2%) as the carbon source, X-Gal (5-bromo-4-chloro-3-indolyl-ß-D-galactopyranoside; 20 µg/ml), chloramphenicol (30 µg/ml), and ampicillin (50 µg/ml) and incubated aerobically . Mutants that escape inhibition by NifL were identified as dark or light blue colonies on plates due to their ability to activate transcription under conditions inappropriate for nitrogen fixation . Plasmid DNA was recovered from candidates and introduced back into the host strain to recheck phenotypes, and the DNA sequences encoding both the N-terminal (GAF) and central domains (AAA+) of each candidate were determined . Plasmids used in this study are shown in Table 1 .


TABLE 1 . Bacterial strains and plasmids used in this study

 
To monitor the activities of the NifA mutant proteins in the absence of NifL, either SmaI-HindIII or XhoI-HindIII fragments were subcloned into the SmaI-HindIII or XhoI-HindIII sites of pPR39, which carries the 3' end of nifL and wild-type nifA (26, 31) .

The expression vector pT7-7, used previously for overexpression of wild-type NifA (3), was also used to purify the mutant protein NifA-Y254N . To facilitate the cloning of the mutated DNA fragment, an XhoI kanamycin resistance cassette from plasmid pUC-KIXX was inserted into plasmid pDB737, which encodes wild-type NifA (3), resulting in plasmid pDB737K . An Asp718-HindIII fragment encoding the Y254N mutation was cloned into pDB737K previously digested with the same enzymes, resulting in plasmid pPM1K . Plasmid DNA was isolated and sequenced to verify the corresponding mutation .

Western blotting. Western blotting was carried out as described previously with polyclonal antiserum to NifA (26, 30) . Bands were visualized with the ECL (enhanced chemiluminescence) system from Amersham .

ß-Galactosidase assays and growth conditions. To assay ß-galactosidase activity, Escherichia coli strains were transformed with plasmid pRT22, with carries a nifH-lacZ translational fusion . NifA activity was measured by determining the level of expression from the nifH promoter . To monitor the ability of NifL to inhibit NifA activity, E . coli strains were transformed with plasmids pRT22 and either pPR34 or its mutant derivatives . The activity of NifA alone was assayed by transforming E . coli strains with plasmids pRT22 and either pPR39 or its mutant derivatives (Table 1) (31) .

For ß-galactosidase assays, E . coli strains were grown to late exponential phase in Luria-Bertani medium at 30°C in the presence of appropriate antibiotics . Aliquots (50 µl) of these cultures were then inoculated into 4 ml of NFDM medium supplemented with 200 µg of casein hydrolysate ml-1 and 25 µg of glutamine ml-1 for nitrogen-limiting conditions or with 1 mg of (NH4)2SO4 ml-1 plus 25 µg of glutamine ml-1 for nitrogen excess conditions . Cultures were grown in a plastic vial (internal volume, 7 ml) sealed with a rubber closure for anaerobic conditions . When conditions required aerobiosis, 5-ml cultures were grown with vigorous shaking in 25-ml conical flasks .

Protein purification. Histidine-tagged proteins used in this work were purified as described previously (15) . A . vinelandii GlnK, {sigma}54, and integration host factor (IHF) were also purified as previously described (15, 17, 31) . NifA and NifA-Y254N were purified as described previously (3) but with the following modifications . Aerobically grown cultures of E . coli BL21(DE3) pLysS carrying either plasmid pDB737 or pPM1K were induced with IPTG (isopropyl-ß-D-thiogalactopyranoside; 1 mM) for 3 h at 30°C in Luria broth . Crude cell extract was obtained by disruption with a French press in buffer A (25 mM Tris-Cl [pH 8.0], 5% glycerol, 0.1 mM EDTA, 1 mM dithiothreitol [DTT], 50 mM NaCl), and the supernatant fraction was precipitated with ammonium sulfate to 55% saturation . The precipitate was dissolved and dialyzed at 4°C for 2 h in buffer A . For NifA-Y254N buffer A also contained 50 mM KSCN at this stage . Dialyzed protein was chromatographed on a 5-ml HiTrap heparin-Sepharose column in buffer A with a linear gradient of 50 to 500 mM NaCl . Peak fractions were pooled and applied to a 1-ml Mono Q column developed in buffer B (50 mM Tris-Cl [pH 8.0], 10% glycerol, 0.1 mM EDTA, 1 mM DTT, 50 mM NaCl, 50 mM KSCN) with a linear gradient of 50 mM to 1 M NaCl . Peak fractions, which eluted at approximately 0.5 M NaCl, were pooled and further purified by gel filtration on Superose 12 in buffer B . NifA was stored in buffer C (50 mM Tris-Cl [pH 8.0], 50% glycerol, 0.1 mM EDTA, 1 mM DTT, 50 mM NaCl) in liquid nitrogen .

Open promoter complex assays. NifA-promoted catalysis of open promoter complexes by {sigma}54-RNA polymerase was used to assay NifA activity and its inhibition by NifL as described previously (9, 15) . Linearized template DNA was provided by digesting plasmid pNH8 with EcoRI and BamHI to yield a 260-bp fragment, including the K . pneumoniae nifH promoter and upstream activator sequences, which was 3' end labeled with [{alpha}-32P]dGTP at the BamHI site . Reactions (reaction mixture final volume, 15 µl) were carried out in TAP buffer (50 mM Tris-acetate, 100 mM potassium acetate, 8 mM magnesium acetate, 3.5% polyethylene glycol 8000, 1 mM DTT, pH 7.9) containing 5 nM template DNA, 3.4 µg of denatured salmon sperm DNA/ml, 125 nM core RNA polymerase, 200 nM {sigma}54, 100 nM IHF, and 3.5 mM ATP . GTP (final concentration, 500 µM) was present prior to the heparin challenge to allow formation of initiated complexes, which are more stable than open promoter complexes (9) . In some cases an ATP-regenerating system was provided by adding creatine kinase (20 U/ml) and creatine phosphate (12 mM) . The reaction components (including A . vinelandii GlnK at the concentrations indicated in Fig . 3) were preincubated for 2 min at 30°C, and reactions were then initiated by the addition of either NifA alone or NifA plus NifL . After a 20-min incubation, reaction mixtures were mixed with 3 µl of dye mixture containing 50% glycerol, 0.05% bromophenol blue, 0.1% xylene cyanol, and 2 µg of heparin and immediately loaded onto a 4% (wt/vol) polyacrylamide gel (acrylamide/bisacrylamide ratio, 80:1) in 25 mM Tris-400 mM glycine, pH 8.6, which had been prerun at 180 V at room temperature down to a constant power of 2 W . Gels were run for 2.5 to 3 h at 100 V and were dried down, and the percentages of radioactivity in open complexes were quantitated with the Fujix BAS1000 phosphorimager .


 FIG . 3 . Activity of purified NifA-Y254N in vitro and response to NifL(147-519)6His and A . vinelandii GlnK . Transcriptional activation by NifA was determined by measuring open promoter complex formation as described in Materials and Methods . Each data point is the mean of two independent experiments . (A) Comparison of the activities of wild-type NifA (squares) and NifA-Y254N (triangles) . Reaction mixtures contained 4 mM GTP as a hydrolyzable nucleotide with the indicated concentrations of NifA . (B) Responses of wild-type NifA (squares) and NifA-Y254N (open triangles) to NifL(147-519)6His in the presence of ADP . Reaction mixtures contained 50 nM NifA, 3.95 mM GTP, 0.05 mM ADP, and the indicated concentrations of NifL(147-519)6His . (C) Responses of NifA (squares) and NifA-Y254N (triangles) to A . vinelandii (Av) GlnK in the presence of NifL(147-519)6His, 2-oxoglutarate, and an ATP-regenerating system . Reaction mixtures contained 50 nM NifA, 100 nM NifL(147-519)6His, 3.5 mM ATP, 0.5 mM GTP, and 0.1 mM 2-oxoglutarate . An ATP-regenerating system was provided by adding creatine kinase (20 U/ml) and creatine phosphate (12 mM).

 
For assays performed under reducing conditions (see Fig . 4A) reaction mixtures were degassed in TAP buffer and introduced into an anaerobic glove box (13) . Sodium dithionite solutions in TAP buffer were prepared separately in the glove box and added to the reaction mixture as indicated in the Fig . 4 legend . Components were then preincubated at 30°C for 2 min prior to the addition of NifA or NifA plus NifL (final concentrations are indicated in the figure legends); the proteins were also degassed in TAP buffer and introduced separately into the glove box . After a 20-min incubation, 1/5 volume of degassed dye mixture (containing heparin as described above) was added, and the reaction mixtures were removed from the glove box and subjected to electrophoresis and image analysis as described above .


 FIG . 4 . Response of NifA-Y254N to the redox status of wild-type NifL in the absence and presence of ADP . (A) Comparison of the activity of wild-type NifA and NifA-Y254N in response to NifL in the presence and absence of sodium dithionite . Assays were conducted in a glove box under anaerobic conditions as described in Materials and Methods . Lane 1, free labeled DNA; lane 2, NifA (100 nM) plus sodium dithionite; lane 3, NifA-Y254N (100 nM) plus sodium dithionite; lane 4, NifA (100 nM) plus NifL (500 nM); lane 5, NifA (100 nM) plus NifL (500 nM) plus sodium dithionite; lane 6, NifA-Y254N (100 nM) plus NifL (500 nM); lane 7, NifA-Y254N (100 nM) plus NifL (500 nM) plus sodium dithionite . (B) Responses of NifA and NifA-Y254N to the concentration of oxidized NifL . Reaction mixtures contained 4 mM GTP and 50 nM NifA protein . (C) Responses of NifA and NifA-Y254N to NifL in the presence of ADP . Reaction mixtures contained 50 nM NifA, 3.95 mM GTP, 0.05 mM ADP, and the indicated concentrations of oxidized NifL.

 

   RESULTS

 
Isolation of NifA mutants resistant to inhibition by NifL. We have shown previously that, when the A . vinelandii nifL and nifA genes are expressed from a constitutive promoter in E . coli, transcriptional activation of a nifHp-lacZ reporter is responsive to fixed nitrogen and oxygen in vivo, indicating that the Azotobacter NifL and NifA proteins are competent to interact with signal transduction components in E . coli (26, 31) . We have used this reporter system to screen for NifA mutants which escape inhibition by NifL . Previous work has demonstrated that both the N-terminal and central domains of NifA are involved in the response to NifL (4) . To generate mutant forms of NifA, we performed random PCR mutagenesis of the DNA encoding the N-terminal and central domains of NifA, recloned the mutated fragments to reconstitute the nifL-nifA operon, and screened for colonies on X-Gal indicator plates, which gave increased expression of the reporter under aerobic conditions when the plates contained excess fixed nitrogen . Under these conditions, NifL strongly inhibits NifA activity in response to both oxygen and fixed nitrogen . Hence, colonies containing wild-type nifL and nifA are white and nifA mutants which are insensitive to nifL are blue . We observed a variety of phenotypes derived from the nifA mutant PCR library ranging from dark blue to very pale blue . In some cases colonies were white with a light blue center . We reasoned that this could occur if mutant NifA proteins remained sensitive to oxygen but, in the relatively anoxic environment in the center of the colony, exhibited insensitivity to fixed nitrogen . This hypothesis was subsequently substantiated by more-detailed analysis (see below) .

Sequencing mutant nifA alleles demonstrated that mutations giving rise to insensitivity to NifL were located in both the N-terminal and central domains of NifA (Fig . 1) . In some cases, multiple mutations were encountered, but the mutation responsible for the resistance phenotype could be distinguished by recloning specific DNA fragments to reconstitute the nifLA operon or by reintroducing single mutations by site-directed mutagenesis .


 FIG . 1 . Diagrammatic representation of the domain structure of A . vinelandii NifA and the mutation isolated in this study . Grey rectangles, amino terminal (GAF) domain, central (AAA+) domain, and C-terminal DNA binding domain (D); solid lines, linker regions . Mutations analyzed in this study are shown beneath the domains.

 
In vivo properties of the mutants. Measurement of ß-galactosidase activity from the nifHp-lacZ reporter in wild-type E . coli strain ET8000 indicated that the mutant NifA proteins could be divided into several different classes based on their response to NifL . The mutations L120P, R155C, K230E, and E356K gave rise to constitutive NifA activity, and the associated mutants showed little response to NifL when strains were grown either with excess fixed nitrogen or under aerobic conditions (Table 2) . The activities of these mutant proteins were similar to the activity demonstrated by NifA in the absence of NifL (Table 2) . Since the stoichiometry of NifL and NifA is important in maintaining bona fide gene regulation (11, 12, 31), it is possible that the phenotype of the mutants could reflect increased stability of NifA and consequent "titration" of the signals transmitted by NifL to NifA . However, Western blotting indicated that the mutant proteins accumulated to levels similar to that of wild-type NifA under the growth conditions used for the ß-galactosidase assays (Fig . 2) .


TABLE 2 . Response of NifA mutant proteins to wild-type NifL in E . coli ET8000

 

 FIG . 2 . Stability of mutant proteins under various growth conditions as determined by Western blotting . All strains carried plasmid pRT22 and either plasmid pPR34, which encodes NifL and NifA, or a derivative of this plasmid encoding a mutant form of NifA (Table 1) . Samples were taken from cultures grown under the conditions used for the ß-galactosidase assays in Table 2, with limiting nitrogen under anaerobic conditions (-N -O), limiting nitrogen under aerobic conditions (-N +O), excess nitrogen under anaerobic conditions (+N -O), or excess nitrogen under aerobic conditions (+N +O) . Equivalent levels of total cell protein were subjected to electrophoresis and Western blotting with anti-NifA antiserum as described in Materials and Methods . (A) NifA accumulation under conditions of nitrogen limitation . Lanes: 1, wild-type NifA; 2, NifA-L120P; 3, NifA-K230E; 4, NifA-E394K; 5, NifA-F395S; 6, NifA-A294V; 7, NifA-R155C; 8, NifA-E356K; 9, NifA-Y254N . (B) NifA accumulation under nitrogen excess conditions . Lanes: 1, wild-type NifA; 2, NifA-Y254N; 3, NifA-A294V; 4, purified NifA; 5, NifA-F395S; 6, NifA-E394K . (C) Accumulation of NifA-F263S under various growth conditions . Cells contained wild-type NifA in lanes 1, 3, and 5 and NifA-F263S in lanes 2, 4, and 6.

 
In contrast to the constitutive mutants, NifA-Y254N was sensitive to NifL inhibition under aerobic growth conditions but showed substantial resistance to inhibition by NifL when cultures were grown anaerobically under conditions of nitrogen excess (Table 2) . Western blotting indicated that this mutant protein is apparently as stable as wild-type NifA under both anaerobic and aerobic growth conditions (Fig . 2) . Therefore, the differential response of the mutant protein to the fixed nitrogen and oxygen status is unlikely to be a consequence of differences in protein stability . It therefore appears that NifA-Y254N can discriminate between the form of NifL present under anaerobic, N excess conditions and that present under aerobic conditions .

A different mutant phenotype was displayed by NifA-A249V and the double mutant NifA-E394K,F395S in the presence of NifL . These mutants exhibited high levels of activity under nitrogen-limiting, anaerobic conditions compared with wild-type NifA but remained responsive to NifL under aerobic growth conditions or in the presence of excess fixed nitrogen (Table 2) . We have show previously that A . vinelandii NifL retains some inhibitory function even under conditions that are appropriate for nitrogen fixation in E . coli, suggesting that factors required to maintain NifL in its inactive form may be limiting under our assay conditions (26) . Thus, the NifA-A249V and NifA-E394K,F395S proteins are apparently responsive to regulation by NifL but escape the inhibitory function of NifL observed under nitrogen-fixing conditions with wild-type NifA (Table 2) . Site-directed mutagenesis was performed to examine the activities of single NifA-E394K and NifA-F395S mutant proteins . Interestingly, NifA-E394K was more resistant to NifL under aerobic conditions than the double mutant (Table 2), whereas NifA-F395S escaped the inhibitory function of NifL only under anaerobic, nitrogen-limiting conditions (Table 2) . Although NifA-F395S is apparently less stable than wild-type NifA under the latter conditions, the difference in the responses of NifA-E394K and NifA-F395S to NifL cannot be explained by differences in the stabilities of the two mutant proteins (Fig . 2) . The dominance of the F395S mutation with regard to the phenotype of the double mutant may suggest that the phenylalanine residue at position 395 is required for the resistance of NifA-E394K to the oxidized form of NifL .

Another interesting phenotype was exhibited by NifA-F263S, which had more activity in the presence of fixed nitrogen than under nitrogen-limiting conditions (Table 2) . This mutant protein exhibited relatively high levels of activity under both anaerobic and aerobic conditions, suggesting that it is resistant to the oxidized form of NifL . The F263S mutation apparently influences the stability of NifA since lower levels of the mutant protein accumulated compared with the wild type under all the growth conditions tested (Fig . 2C) . However, the level of accumulation did not correlate with the activities observed under the different growth conditions, suggesting that the mutation influences activity in addition to stability .

To ensure that the responses of mutant NifA proteins were associated with the presence of NifL, we also cloned the mutations into plasmid pPR39, which lacks almost the entire coding sequence of NifL (with the exception of residues 454 to 519) and whose product exhibits no inhibitory activity against NifA (26, 31) . All the mutant proteins exhibited activities characteristic of wild-type NifA in the absence of NifL (Table 3 and unpublished results), with the exception of NifA-F263S, which showed low activity under nitrogen-limiting conditions compared with wild-type NifA . Thus, the apparent reversal of the nitrogen response exhibited by this mutant protein is apparently not modulated by the presence of NifL (Table 3), and therefore the F263S mutation alters a response intrinsic to NifA .


TABLE 3 . Activity of mutant NifA proteins in the absence of NifL

 
Influence of nitrogen-regulatory genes on the activities of mutant forms of NifA in the presence of NifL. We have previously demonstrated that the nitrogen response of the A . vinelandii NifL-NifA system in E . coli involves the PII paralogues GlnB and GlnK and a gene or metabolite influenced by the presence of NtrC (26) . It was therefore of interest to determine whether nitrogen-regulatory genes influence the activities of the mutant forms of NifA which escape inhibition by NifL . As anticipated, NifA-E356K, which shows constitutive NifA activity in the presence of NifL, did not respond to the nitrogen-regulatory mutations (Table 4) . In contrast, NifA-A249V was sensitive to the fixed nitrogen signal conveyed by NifL in the glnB and glnK backgrounds but exhibited little response to fixed nitrogen in the glnB ntrC background (Table 4) . Thus, like the nitrogen response of wild-type NifA, that of NifA-A249V apparently requires glnB and ntrC (26) . Similar results were observed with the NifA-E394K,F395S double mutant (data not shown) . The responses of these mutant proteins to excess fixed nitrogen therefore parallel that shown previously for wild-type NifA . In contrast, the activity of NifA-Y254N was far less responsive to the nitrogen-regulatory mutations, congruent with its relative insensitivity to nitrogen regulation in the wild-type E . coli background . Since NifA-Y254N is sensitive to redox control mediated by NifL (Table 2), it appears that this mutant NifA protein can discriminate between the inhibitory forms of NifL present under aerobic conditions and that present under anaerobic, N excess conditions .


TABLE 4 . Influence of nitrogen-regulatory mutations on the activity of NifA mutant proteins in the presence of wild-type NifL

 
Influence of NifL on transcriptional activation by NifA-Y254N in vitro. The NifA-Y254N protein was overexpressed from the T7 promoter and purified by procedures similar to those used for wild-type NifA . The ability of NifL to inhibit NifA activity in vitro was determined by measuring open promoter complexes formed by NifA at the nifH promoter in the presence of the {sigma}54-RNA polymerase holoenzyme and IHF (9) . To simplify assays for measuring the response of NifA-Y254N to NifL, we made use of the truncated NifL(147-519) protein, which is responsive to the status of fixed nitrogen but which does not show the redox response, since it lacks the redox-sensitive PAS domain (26, 31) . This truncated NifL protein therefore enables measurement of the nitrogen response of NifL in vitro, in the absence of the redox response (15, 17) . We have shown previously that the inhibitory activity of NifL is stimulated by adenosine nucleotides and that this response is alleviated in the presence of 2-oxoglutarate, which is an allosteric effector of the NifL-NifA system (17) . The inhibitory activity of NifL is also stimulated by interaction with the PII-like protein encoded by A . vinelandii glnK via the interaction of this protein with the C-terminal kinase-like domain of NifL (15) . Our current model for nitrogen control of the NifL-NifA system suggests that the nonmodified form of the A . vinelandii GlnK protein stimulates NifL activity under conditions of nitrogen excess . The ability of NifA-Y254N to respond to NifL in the presence of ADP, 2-oxoglutarate, and A . vinelandii GlnK was therefore of interest . To examine the response of the mutant protein to the redox switch mediated by NifL, we measured NifA activity aerobically in the presence of oxidized wild-type NifL or made use of a glove box to measure the response to reduced NifL in the presence of sodium dithionite (13) .

NifA-Y254N had activity identical to that of wild-type NifA in promoting the formation of open promoter complexes by the {sigma}54-RNA polymerase holoenzyme (Fig . 3A), and therefore the in vivo phenotype of this mutant cannot readily be explained on the basis of increased NifA activity per se . In contrast to the activity of wild-type NifA, which is inhibited by the ADP-bound form of NifL(147-519)6His, the ability of NifA-Y254N to form open promoter complexes was not greatly influenced by NifL(147-519)6His in the presence of ADP (Fig . 3B) . Since NifA-Y254N was resistant to NifL in the presence of ADP, it was not possible to measure relief of inhibition in response to 2-oxoglutarate (17) . Addition of this ligand did not influence the activity of the mutant protein in the presence of NifL and ADP or ATP (data not shown) . A . vinelandii GlnK, even when present in considerable excess, had little influence on the activity of NifA-Y254N when 2-ketoglutarate, ATP, and NifL(147-519)6His were also present (Fig . 3C) . In contrast, the addition of A . vinelandii GlnK increased inhibition by NifL(147-519)6His in the presence of wild-type NifA, as shown previously . Thus, NifA-Y254N is resistant to the negative influence that A . vinelandii GlnK exerts on NifL(147-519)6His in vitro, commensurate with its relative insensitivity to nitrogen regulation in vivo .

We also measured the response of NifA-Y254N to the redox switch mediated by native NifL in vitro . As shown previously (13), when NifL was reduced by sodium dithionite under anaerobic conditions in a glove box, it did not inhibit wild-type NifA but was activated by the oxidized form of NifL in the absence of dithionite (Fig . 4A, compare lanes 5 and 4) . In contrast, NifA-Y254N apparently did not respond to the redox switch mediated by NifL and was active in the presence of both oxidized and reduced NifL (Fig . 4A, compare lanes 6 and 7) . In similar assays performed under aerobic conditions, NifA-Y254N was resistant to oxidized NifL, except when NifL was present in considerable excess (Fig . 4B) . However when ADP was present in addition to oxidized NifL, NifA-Y254N was susceptible to inhibition, albeit at higher concentrations of oxidized NifL than those observed with the wild-type NifA protein (Fig . 4C) . Hence, the presence of ADP in combination with oxidized NifL gave rise to inhibition of NifA-Y254N activity .


   DISCUSSION

 
The mechanism of inhibition of A . vinelandii NifA activity by NifL is intricate, involving the formation of a protein complex which inhibits ATP hydrolysis by the activator . NifL may also act at a stage subsequent to ATP binding or hydrolysis to prevent engagement of the activator with the {sigma}54-RNA polymerase holoenzyme . Both the amino-terminal GAF domain and the central AAA+ domain of NifA have been implicated previously in the response to NifL, and, accordingly, mutations in both domains which render NifA resistant to the inhibitory functions of NifL were obtained in this study .

The GAF domain of NifA is not absolutely required for NifL to inhibit NifA (4), but, when this domain is absent, the interaction between NifL and a truncated form of NifA is less stable (21) . Furthermore, the catalytic activity of the central domain is no longer susceptible to inhibition by NifL when the GAF domain is removed (4) . Protein footprinting experiments suggest that, when the NifL-NifA complex is formed, residues in the GAF domain and in the Q linker between the GAF and central domains are protected from proteolysis (20) . Hence the N-terminal GAF domain may directly contact NifL, or changes in the conformation of this domain may control the interaction of NifL with the central domain of NifA . We have also postulated that the GAF domain of NifA may be involved in intramolecular repression of the central domain in response to NifL (4) . The two mutations in the GAF domain isolated in this study may lock the domain in a conformation that prevents intramolecular repression of the central domain . GAF domains are present in diverse signaling proteins, some of which are known to act as receptors for the binding of small molecules (14) . Modeling the NifA GAF domain on the YKG9 prototype structure (14) indicates that the mutations L120P and R155C are located in surface-exposed loops . Leu 120 is predicted to lie in a loop between ß sheets 4 and 5 . Residues in this loop are susceptible to proteolysis in the absence of NifL (16; R . Little and R . Dixon, unpublished results) . The predicted location of Arg 155 is in the ß6-{alpha}5 loop, which in cyclic GMP (c-GMP)-phosphodiesterase is proposed to fold over the bound c-GMP (14) . These observations are interesting in the light of our recent finding that the GAF domain is required for the response of the NifL-NifA system to 2-oxoglutarate and that the isolated GAF domain binds 2-oxoglutarate (16; R . Little and R . Dixon, unpublished results) .

Members of the AAA+ family function as oligomers, often as hexamers arranged in a ring structure (23, 34) . The binding of a nucleotide promotes the oligomerization of {sigma}54-dependent activators (10, 27, 35), and it is likely that NifL perturbs nucleotide-dependent interactions required for protomer association and/or conformational changes necessary for the interaction of NifA with {sigma}54-RNA polymerase . Mutations in the central AAA+ domain of NifA which result in constitutive insensitivity to NifL may affect residues which are either required for direct interaction with NifL or involved in intramolecular repression mediated by the GAF domain when NifL is present . Interestingly, mutations giving rise to constitutive resistance to NifL, namely, K230E and E356K, are charge changes, perhaps indicating that these mutations disrupt ionic protein-protein interactions . A lysine or arginine residue is conserved at position 230 in NifA proteins from the {gamma} subdivision of the proteobacteria but is not conserved in other members of the {sigma}54-dependent activator family and thus could provide specificity for the NifL interaction . Sequence alignments with known AAA+ structures suggest that this residue is located in a loop (equivalent to the {alpha}5-ß12 loop in p97) . The glutamate residue at position 356 is also conserved in NifA proteins but not in other {sigma}54-dependent activators . Structure based alignments suggest that this residue is located in a loop region in the "minimum AAA+ consensus," a conserved feature characteristic of the AAA+ family (36) .

A . vinelandii NifL is responsive to multiple environmental signals such that the ability of NifA to activate transcription is inhibited by NifL under conditions which disfavor nitrogen fixation . It is possible that, although different signals (e.g., redox and fixed nitrogen) are perceived independently by NifL, transduction of the signals and consequent inhibition of NifA activity occur via a unitary mechanism in which a common conformational change in NifL leads to the formation of the NifL-NifA complex . Alternatively, the independent perception of different signals could lead to discrete differences in the inhibitory conformers of NifL and in the natures of the complexes formed under different environmental conditions . The results presented in this paper provide some support for the latter model since we have isolated NifA mutants that are insensitive to NifL in response to particular environmental cues .

A distinctive feature of the NifA-A249V and NifA-F395S mutants is greater resistance to NifL under N-limiting, anaerobic conditions, but these mutant proteins remain sensitive to NifL under nitrogen excess or under aerobic conditions . The mutations may alter the conformation of NifA so that it is more resistant to the form of NifL present in E . coli under nitrogen-limiting, anaerobic conditions . The alanine at position 249 is highly conserved in {sigma}54-dependent activators, whereas F395 is only conserved in NifA proteins from the {gamma} subdivision of the proteobacteria . The in vivo properties of the NifA-E394K protein are more complex since the mutation renders NifA insensitive to NifL under aerobic conditions . But the protein retains some response to fixed nitrogen under anaerobic conditions, suggesting that it is more sensitive to the nitrogen signal transmitted by NifL when NifL is in its reduced form . Structure-based alignments with the AAA+ family suggest that residues 394 and 395 are located in an {alpha} helix, with residue E394 being surface exposed .

The properties of the F263S mutation are particularly intriguing because, although this substitution leads to resistance to NifL, the mutant protein displays an inverted nitrogen response, which is a characteristic of the mutant NifA protein per se since this property is conferred in the absence of NifL . Although we cannot rule out the possibility that the mutant phenotype is a consequence of changes in NifA stability, the mutation may alter the interaction of the central AAA+ domain with the GAF domain so that the activity of the mutant protein is intrinsically responsive to the binding of 2-oxoglutarate .

The Y254N mutation in NifA is located in a predicted {alpha} helix located immediately downstream of the Walker A (P-loop) motif in the central domain (25) . The tyrosine residue at this position is not conserved in NifA proteins, and in some cases this residue is an asparagine, as when the Y254N mutation occurs . Notably, however, in such examples, NifA is not regulated by a NifL-like protein in the host diazotroph . The Y254N mutation confers resistance to NifL under conditions of nitrogen excess, but the mutant remains responsive in vivo to oxidized NifL present in E . coli . The inability of NifL to transmit the nitrogen status to NifA-Y254N was evident from the lack of response to nitrogen-regulatory mutations in E . coli . The biochemical properties of the purified mutant protein are consistent with these observations since, in contrast to wild-type NifA, the NifA-Y254N protein is resistant to the ADP-bound form of NifL(147-519) and the presence of A . vinelandii GlnK does not enable NifL(147-519) to inhibit NifA-Y254N . Therefore, NifL(147-519) is apparently unable to assume a conformation which is competent to inhibit NifA-Y254N, even when activated by the GlnK protein (15) . Our in vitro experiments also indicate that this mutant protein is not responsive to the redox status of native NifL, unlike wild-type NifA (Fig . 4A) . However, it should be noted that these assays were conducted in the absence of adenosine nucleotides, which potentiate the activity of NifL (9, 13) . In the presence of ADP, NifA-Y254N was responsive to oxidized NifL, albeit at higher concentrations than those observed with wild-type NifA . Our results therefore demonstrate that NifA-Y254N can discriminate between NifL(147-519) and the oxidized form of native NifL in vitro . Taken together, the in vivo and in vitro data suggest that NifA-Y254N is insensitive to the nitrogen signal transmitted by NifL under anaerobic conditions but is sensitive to the oxidized form of NifL, although less so than wild-type NifA . Since NifA-Y254N can apparently discriminate between the form of NifL present under oxidizing conditions and that present under conditions of nitrogen excess, it is likely that the nature of the inhibitory complex formed between reduced NifL and NifA in the presence of A . vinelandii GlnK is different from the nature of the complex formed between NifL and NifA under oxidizing conditions . Thus, discrete conformers of NifL may be generated in response to different environmental cues .

 


   ACKNOWLEDGMENTS

 
We think Gary Sawers and Mike Merrick for their comments on the manuscript .

F.R.-R . was supported by TMR Marie Curie Research Training Grant FMBICT983125 from the European Community . R.L . and R.D . were supported by the BBSRC Competitive Strategic Grant to the John Innes Centre .


   FOOTNOTES

 
* Corresponding author . Mailing address: Department of Molecular Microbiology, John Innes Centre, Colney Ln., Norwich NR4 7UH, United Kingdom . Phone: 44 1603-450747 . Fax: 44 1603-450778 . E-mail: ray.dixon{at}bbsrc.ac.uk .

{dagger} Present address: School of Biological Sciences, University of East Anglia, Norwich NR4 7TJ, United Kingdom .


   REFERENCES

 

  1. Aravind, L., and C . P . Ponting. 1997 . The GAF domain: an evolutionary link between diverse phototransducing proteins . Trends Biochem . Sci . 22:458-459.
  2. Arcondéguy, T., R . Jack, and M . Merrick. 2001 . PII signal transduction proteins, pivotal players in microbial nitrogen control . Microbiol . Mol . Biol . Rev . 65:80-105.
  3. Austin, S., M . Buck, W . Cannon, T . Eydmann, and R . Dixon. 1994 . Purification and in vitro activities of the native nitrogen fixation control proteins NifA and NifL . J . Bacteriol . 176:3460-3465.
  4. Barrett, J., P . Ray, A . Sobczyk, R . Little, and R . Dixon. 2001 . Concerted inhibition of the transcriptional activation functions of the enhancer-binding protein NIFA by the anti-activator NIFL . Mol . Microbiol 39:480-494.
  5. Buck, M., M . T . Gallegos, D . J . Studholme, Y . Guo, and J . D . Gralla. 2000 . The bacterial enhancer-dependent {sigma}54 ({sigma}N) transcription factor . J . Bacteriol . 182:4129-4136.
  6. Chaney, M., R . Grande, S . R . Wigneshweraraj, W . Cannon, P . Casaz, M . T . Gallegos, J . Schumacher, S . Jones, S . Elderkin, A . E . Dago, E . Morett, and M . Buck. 2001 . Binding of transcriptional activators to sigma 54 in the presence of the transition state analog ADP-aluminum fluoride: insights into activator mechanochemical action . Genes Dev . 15:2282-2294.
  7. Coutts, G., G . Thomas, D . Blakey, and M . Merrick. 2002 . Membrane sequestration of the signal transduction protein GlnK by the ammonium transporter AmtB . EMBO J . 21:536-545.
  8. Dixon, R. 1998 . The oxygen-responsive NIFL-NIFA complex: a novel two-component regulatory system controlling nitrogenase synthesis in {gamma}-proteobacteria . Arch . Microbiol . 169:371-380.
  9. Eydmann, T., E . Söderbäck, T . Jones, S . Hill, S . Austin, and R . Dixon. 1995 . Transcriptional activation of the nitrogenase promoter in vitro: adenosine nucleosides are required for inhibition of NifA activity by NifL . J . Bacteriol . 177:1186-1195.
  10. Farez-Vidal, M., T . Wilson, B . Davidson, G . Howlett, S . Austin, and R . Dixon. 1996 . Effector-induced self-association and conformational changes in the enhancer-binding protein NTRC . Mol . Microbiol . 22:779-788.
  11. Govantes, F., E . Andujar, and E . Santero. 1998 . Mechanism of translational coupling in the nifLA operon of Klebsiella pneumoniae . EMBO J . 17:2368-2377.
  12. Govantes, F., J . A . Molina-Lopez, and E . Santero. 1996 . Mechanism of coordinated synthesis of the antagonistic regulatory proteins NifL and NifA of Klebsiella pneumoniae . J . Bacteriol . 178:6817-6823.
  13. Hill, S., S . Austin, T . Eydmann, T . Jones, and R . Dixon. 1996 . Azotobacter vinelandii NIFL is a flavoprotein that modulates transcriptional activation of nitrogen-fixation genes via a redox-sensitive switch . Proc . Natl . Acad . Sci . USA 93:2143-2148.
  14. Ho, Y . S., L . M . Burden, and J . H . Hurley. 2000 . Structure of the GAF domain, a ubiquitous signaling motif and a new class of cyclic GMP receptor . EMBO J . 19:5288-5299.
  15. Little, R., V . Colombo, A . Leech, and R . Dixon. 2002 . Direct interaction of the NifL regulatory protein with the GlnK signal transducer enables the Azotobacter vinelandii NifL-NifA regulatory system to respond to conditions replete for nitrogen . J . Biol . Chem . 277:15472-15481.
  16. Little, R., S . Perry, V . Colombo, F . Reyes-Ramirez, and R . Dixon. 2002 . Integration of nitrogen, oxygen and redox status by the Azotobacter vinelandii regulatory complex, p . 238-242 . In T . Finan, M . O'Brian, D . Layzell, K . Vessey, and B . Newton (ed.), Nitrogen fixation: global perspectives . CABI International, Wallingford, Oxford, United Kingdom.
  17. Little, R., F . Reyes-Ramirez, Y . Zhang, W . C . van Heeswijk, and R . Dixon. 2000 . Signal transduction to the Azotobacter vinelandii NIFL-NIFA regulatory system is influenced directly by interaction with 2-oxoglutarate and the PII regulatory protein . EMBO J 19:6041-6050.
  18. Macheroux, P., S . Hill, S . Austin, T . Eydmann, T . Jones, S.-O . Kim, R . Poole, and R . Dixon. 1998 . Electron donation to the flavoprotein NifL, a redox-sensing transcriptional regulator . Biochem . J . 332:413-419.
  19. MacNeil, T., D . MacNeil, and B . Tyler. 1982 . Fine-structure deletion map and complementation analysis of the glnA-glnL-glnG region in Escherichia coli J . Bacteriol . 150:1302-1313.
  20. Money, T., J . Barrett, R . Dixon, and S . Austin. 2001 . Protein-protein interactions in the complex between the enhancer binding protein NifA and the sensor NifL from Azotobacter vinelandii . J . Bacteriol . 183:1359-1368.
  21. Money, T., T . Jones, R . Dixon, and S . Austin. 1999 . Isolation and properties of the complex between the enhancer binding protein NifA and the sensor NifL . J . Bacteriol . 181:4461-4468.
  22. Morett, E., and L . Segovia. 1993 . The {sigma}54 bacterial enhancer-binding protein family: mechanism of action and phylogenetic relationship of their functional domains . J . Bacteriol . 175:6067-6074.
  23. Neuwald, A . F., L . Aravind, J . L . Spouge, and E . V . Koonin. 1999 . AAA+: a class of chaperone-like ATPases associated with the assembly, operation, and disassembly of protein complexes . Genome Res . 9:27-43.
  24. Ninfa, A., and M . Atkinson. 2000 . PII signal transduction proteins . Trends Microbiol . 8:172-179.
  25. Osuna, J., X . Soberon, and E . Morett. 1997 . A proposed architecture for the central domain of the bacterial enhancer binding proteins based on secondary structure prediction and fold recognition . Protein Sci . 6:543-555.
  26. Reyes-Ramirez, F., R . Little, and R . Dixon. 2001 . Role of Escherichia coli nitrogen regulatory genes in the nitrogen response of the Azotobacter vinelandii NifL-NifA complex . J . Bacteriol . 183:3076-3082.
  27. Rippe, K., N . Mucke, and A . Schulz. 1998 . Association states of the transcription activator protein NtrC from E . coli determined by analytical ultracentrifugation . J . Mol . Biol . 278:915-933.
  28. Rudnick, P., C . Kunz, M . K . Gunatilaka, E . R . Hines, and C . Kennedy. 2002 . Role of GlnK in NifL-mediated regulation of NifA activity in Azotobacter vinelandii . J . Bacteriol . 184:812-820.
  29. Schmitz, R . A. 1997 . NifL of Klebsiella pneumoniae carries an N-terminally bound FAD cofactor, which is not directly required for the inhibitory function of NifL . FEMS Microbiol . Lett . 157:313-318.
  30. Screen, S., J . Watson, and R . Dixon. 1994 . Oxygen sensitivity and metal ion-dependent transcriptional activation by NIFA protein from Rhizobium leguminosarum biovar trifolii. Mol . Gen . Genet . 245:313-322.
  31. Söderbäck, E., F . Reyes-Ramirez, T . Eydmann, S . Austin, S . Hill, and R . Dixon. 1998 . The redox- and fixed nitrogen-responsive regulatory protein NIFL from Azotobacter vinelandii comprises discrete flavin and nucleotide-binding domains . Mol . Microbiol . 28:179-192.
  32. Studier, F., A . Rosenberg, J . Dunn, and J . Dubendorff. 1990 . Use of T7 RNA polymerase to direct expression of cloned genes . Methods Enzymol . 185:60-89.
  33. Taylor, B . L., and I . B . Zhulin. 1999 . PAS domains: internal sensors of oxygen, redox potential, and light . Microbiol . Mol . Biol . Rev . 63:479-506.
  34. Tuli, R., and M . J . Merrick. 1988 . Over-production and characterization of the nifA gene product of Klebsiella pneumoniae—the transcription activator of nif gene expression . J . Gen . Microbiol . 134:425-432.
  35. Vale, R . D. 2000 . AAA proteins . Lords of the ring . J . Cell Biol . 150:F13-F19.
  36. Wikstrom, P., E . O'Neill, L . C . Ng, and V . Shingler. 2001 . The regulatory N-terminal region of the aromatic-responsive transcriptional activator DmpR constrains nucleotide-triggered multimerisation . J . Mol . Biol . 314:971-984.
  37. Zhang, X., A . Shaw, P . A . Bates, R . H . Newman, B . Gowen, E . Orlova, M . A . Gorman, H . Kondo, P . Dokurno, J . Lally, G . Leonard, H . Meyer, M . van Heel, and P . S . Freemont. 2000 . Structure of the AAA ATPase p97 . Mol . Cell 6:1473-1484.

 

 

 

Free Online Full-text Article

 

 

 

 

What Is Water Purification?, What Is Biofilter?, What Is Botulism?, What Is Pcr?, What Is Growth Medium?, o, Bacterium, n, Bacteriology, n, Microbe, e, Microorganisms, e, Microbes, n, Salmonella typhimurium, r, Enterobacteriacea, r, Haemophilus, s, Cell cultures, o, Microorganism, o, Escherichia coli, i, Bacteriological, n, Antibiotics, n, Antibiotics, c, Streptococci, o, Cell suspensions, e, Bacteroides, e, Escherichia coli, n, Streptococci, s, Escherichia coli, a, Streptococci, i, Bacteria, o, Cryptococci, i, Streptococcal, o, Microorganism, c, Lactobacillus




 

   Scientific Publications - Work Done by Microbiology Reader Bioscreen C

Agricultural Microbiology
Anaerobic Microbiology
Antimicrobial Susceptibility
Artificial Atmosphere
Bioassay of Antibiotics
Biofilm Microbiology
Bioreactor Technology
Biotechnology
Cell Biology
Clinical Microbiology
Environmental Microbiology
Experiments with Yeast
Fermentation
Food Microbiology
Functional Genomics
Gene Technology
Growth Media Development
Growth Rate and Lag Time
Industrial Microbiology
Medical/Pharmaceutical Field
Microbiological Assay
Microbiological Research
Microbiology of Cosmetics

go to a specific theme...

Military Microbiology
Molecular Microbiology
Mutagenicity and Genotoxicity
Oral Microbiology
Patents
Postantibiotic Studies
Soil Microbiology
Spore Microbiology
Veterinary Microbiology
Waste/Wastewater Treatment
Water Microbiology
Wine Microbiology

 


 

© 2005 Transgalactic Ltd (manufacturer of Bioscreen C software) | Privacy Statement | P.O. Box 1393, 00101 Helsinki, Finland, phone: +358 9 85172920, fax: +358 9 8749481, e-mail: microbiology@bionewsonline.com
 

 

 

Last modified: May 25, 2005