Microbiology Reader
Equipment to run microbiology work automatically

Growth Curves of any strain.
Microbiological calculations.

Microbiology Home
Microbioloy Reader
Growth Curves
Photo Album
Microorganisms
Software
Download
Purchasing
Contact Us


Applied and Environmental Microbiology, June 2003, p . 3152-3157, Vol . 69, No . 6

Aerobic Denitrifying Bacteria That Produce Low Levels of Nitrous Oxide

Naoki Takaya,1 Maria Antonina B . Catalan-Sakairi,1 Yasushi Sakaguchi,1 Isao Kato,1 Zhemin Zhou,1 and Hirofumi Shoun2*

Institute of Applied Biochemistry, University of Tsukuba, Tsukuba, Ibaraki 305-8572,1 Department of Biotechnology, Graduate School of Agricultural and Life Sciences, University of Tokyo, Bunkyo-Ku, Tokyo 113-8657, Japan2

Received 25 November 2002/ Accepted 17 March 2003


   ABSTRACT

 
Most denitrifiers produce nitrous oxide (N2O) instead of dinitrogen (N2) under aerobic conditions . We isolated and characterized novel aerobic denitrifiers that produce low levels of N2O under aerobic conditions . We monitored the denitrification activities of two of the isolates, strains TR2 and K50, in batch and continuous cultures . Both strains reduced nitrate (NO3-) to N2 at rates of 0.9 and 0.03 µmol min-1 unit of optical density at 540 nm-1 at dissolved oxygen (O2) (DO) concentrations of 39 and 38 µmol liter-1, respectively . At the same DO level, the typical denitrifier Pseudomonas stutzeri and the previously described aerobic denitrifier Paracoccus denitrificans did not produce N2 but evolved more than 10-fold more N2O than strains TR2 and K50 evolved . The isolates denitrified NO3- with concomitant consumption of O2 . These results indicated that strains TR2 and K50 are aerobic denitrifiers . These two isolates were taxonomically placed in the ß subclass of the class Proteobacteria and were identified as P . stutzeri TR2 and Pseudomonas sp . strain K50 . These strains should be useful for future investigations of the mechanisms of denitrifying bacteria that regulate N2O emission, the single-stage process for nitrogen removal, and microbial N2O emission into the ecosystem .


   INTRODUCTION

 
Nitrous oxide (N2O) is a gaseous nitrogen oxide that is present at a concentration of about 350 ppb in the atmosphere . The concentration of this compound was maintained below 300 ppb in the global nitrogen cycle before the 20th century . However, recent reports suggest that the atmospheric concentration of N2O is now increasing at a rate as high as 0.3% per year (1) . N2O has a 200- to 300-fold-stronger greenhouse effect than carbon dioxide (CO2) and has the potential to destroy the ozone layer (17) . Therefore, the N2O balance is critical to the natural environment . The proposed sources of N2O are chemical industries, burning fossil fuels, and biomass, as well as soil denitrification of nitrogenous compounds resulting from excess agricultural fertilizer (3, 6, 25) . Another critical source of N2O is wastewater treatment plants, in which considerable amounts of nitrogen pollutants removed from treated water are released into the atmosphere as N2O, as well as dinitrogen (N2) .

Currently, nitrogen removal in wastewater treatment plants is essentially based on the activity of nitrifying and denitrifying microorganisms, both of which are inhabitants of activated sludge . Nitrifying bacteria aerobically oxidize ammonium contaminants to nitrite (NO2-) and nitrate (NO3-), which are then reduced by denitrifying bacteria to gaseous nitrogen forms such as N2O and N2 . Efficient wastewater treatment relies on successively exposing water to aerobic and anaerobic conditions, since nitrification and denitrification are aerobic and anaerobic processes, respectively (4, 18) . These properties represent a shortcoming of current systems since both denitrification and nitrification produce N2O as a by-product in the absence of correctly regulated oxygen (O2) concentrations (2, 20) . For example, the denitrifying activity of most denitrifying bacteria is suppressed when anaerobiosis is insufficient and they cannot catalyze the final step of denitrification (reduction of N2O to N2) and produce N2O (2, 8, 13, 19) . Because complete removal of dissolved O2 is difficult before the anaerobic denitrification that follows aerobic nitrification, current systems release considerable amounts of N2O during denitrification .

To overcome this problem, novel aerobic denitrifying bacteria are required that could be used for constructing aerobic denitrifying processes . Paracoccus denitrificans (formerly Thiosphaera pantotropha) (2, 19, 20) is an aerobic denitrifier that has been isolated from activated sludge and it is the best-characterized such organism . This species reduces NO3- even in the presence of a saturating concentration of O2 . More recent surveys of aerobic denitrifiers have revealed some novel species, such as Microvirgula aerodenitrificans (16) and Thaurea mechernichensis (22); the former organism denitrifies as efficiently as P . denitrificans under aerobic conditions (15) . Previously published results show that these denitrifiers remove NO3- quite efficiently from treated water or from culture medium . However, the previous reports did not address the effect of O2 on the reduction of N2O to N2 .

In the present paper we describe a novel method for screening and characterizing natural aerobic denitrifiers that produce N2 gas by reducing NO3- under oxic conditions . The strains described here produce less N2O under aerobic conditions than the previously described aerobic denitrifiers produce, indicating that they potentially could be used to construct an aerobic denitrifying system that emits low levels of N2O .


   MATERIALS AND METHODS

 
Strains and media.
P . denitrificans (T . pantotropha) ATCC 35512 originated from the American Type Culture Collection . Pseudomonas stutzeri ZoBell (= ATCC 14405) was provided by W . G . Zumft . Other strains were isolated in this study . The following media were used: bromothymol blue (BTB) medium (0.1% L-asparagine, 0.1% KNO3, 0.1% KH2PO4, 0.005% FeCl2 · 6H2O, 0.02% CaCl2 · 2H2O, 0.1% MgSO4 · 7H2O, 1 ml of BTB liter-1 [1% in ethanol], 2% agar; pH 7.0 to 7.3), screening medium (SM) [0.284% sodium succinate, 10 mM NaNO3, 0.136% KH2PO4, 0.027% (NH4)2SO4, 0.1% yeast extract (Difco), 0.019% MgSO4 · 7H2O, 1 ml of a trace element solution (14) liter-1; pH 7.2], denitrification medium (DM) (0.472% sodium succinate, 10 mM Na15NO3, 0.15% KH2PO4, 0.042% Na2HPO4, 0.06% NH4Cl, 0.5% Casamino Acids [Difco], 0.1% MgSO4 · 7H2O, 2 ml of a trace element solution [14] liter-1; pH 7.2), artificial wastewater (AWW) (0.085% NaNO3, 0.06% peptone, 0.04% bouillon extract, 0.01% urea, 0.003% NaCl, 0.01% KH2PO4, 0.0014% KCl, 0.002% MgSO4 · 7H2O, 0.00185% CaCl2 · 2H2O), and Luria-Bertani medium (1% tryptone, 0.5% yeast extract, 0.5% NaCl) .

Screening of denitrifiers.
Samples from rice ponds, domestic wastewater, and soil were transferred to 200 ml of SM in 500-ml Erlenmeyer flasks with cotton plugs and incubated at 30°C for 3 days . Fresh SM was inoculated with 5 ml of culture and incubated under the same conditions . These procedures were repeated three times . The resultant bacterial suspension was streaked on BTB medium plates with 8.5 g of sodium succinate liter-1 and incubated at 30°C for 1 to 3 days . Soil samples were sometimes suspended in 0.9% NaCl and plated directly on BTB medium plates . Regardless, soil samples were incubated in DM or AWW instead of SM . Resulting blue colonies were isolated and screened as follows (second screening) . The bacteria were transferred to 200 ml of Luria-Bertani medium with 10 mM NaNO3 in a 500-ml Erlenmeyer flask . The flask was sealed with a butyl rubber stopper and rotary shaken at 120 rpm at 30°C (preculture) . The atmospheric air in the headspace was not replaced, so the initial conditions were aerobic . A portion (50 ml) of the preculture was collected by centrifugation, washed twice with 0.9% NaCl, transferred to 100 ml of DM containing 15N (Na15NO3) in a 500-ml Erlenmeyer flask, and incubated as described above . Aerobic denitrification by the bacteria was measured by determining time-dependent production of 15N2 and the amount of residual O2 in the headspace gas .

Batch culture.
Batch cultures in flasks were incubated essentially under the conditions described above for the second screening . To investigate their effects on denitrification, various carbon sources were added to DM instead of succinate at a C/N ratio of 24 .

Continuous culture.
Precultures (100 ml) were transferred to 1-liter fermentation jars (BMJ-01; Able, Tokyo, Japan) containing 500 ml of DM or AWW with formate in which Na15NO3 was substituted for Na14NO3 . Each culture was magnetically stirred at 300 rpm and 30°C (pH 7.4) . Initially, 20% O2 balanced with argon was added to the cultures at a constant flow rate of 20 ml/min . Exhaust gas that flowed into gas sampling tubes was collected after passing through a vapor condenser . The culture broth was aseptically withdrawn through sampling tubes, and then NO3-, NO2-, and biomass were analyzed . A continuous nutrient flow was started when cultures reached the logarithmic growth phase and was continued at a dilution rate of 0.14 h-1 . After 48 h, exhaust gas was analyzed in duplicate to confirm the steady state . The O2 supply conditions were manipulated by changing the feed gas composition and/or the stirring speed . The cultures were constantly supplied with nutrients for over 48 h, which was equivalent to 6.7 replacements of the working volume to ensure a steady state .

Determination of the 16S rRNA gene sequences.
Total bacterial DNA was purified as described previously (14) . The genes encoding 16S rRNA were amplified by PCR by using total DNA (0.1 µg) as the template and primers AGAGTTTGATCCTGGCTCAG and GGTTACCTTGTTACGACTT (26) . Genes were amplified by 30 cycles of 94°C for 20 s, 50°C for 1 min, and 72°C for 1.5 min, followed by extension at 72°C for 10 min .

Analytical methods.
We analyzed gaseous O2 and N2O by gas chromatography (GC) (23) . Isotope-labeled N2 gas was measured by isotope mass spectroscopy (Delta plus, Finnigan MAT) as described previously (24), and NO3- and NO2- were measured colorimetrically (12) .

Enzyme assays.
Nitrate reductase (Nar) activity was assayed as described previously (7) by using methylviologen-dithionite as the electron donor . Nitrite reductase (Nir) activity was assayed by using NADH-phenazine methosulfate as the electron donor by determining the amount of NO produced by the P450nor-trap method (7) . Nitric oxide reductase (Nor) activity was determined by determining NADH-dependent N2O formation by GC as described previously (11) . Nitrous oxide reductase activity was assayed as described by Kshirsagar et al . (9) .

Nucleotide sequence accession numbers.
The nucleotide sequence data have been deposited in the DDBJ/EMBL/GenBank nucleotide sequence databases under accession numbers AB096261 (strain TR2) and AB096260 (strain K50) .


   RESULTS

 
Isolation of novel aerobic denitrifiers.
We developed plate assays to isolate bacterial strains that denitrify under aerobic conditions, . The method is based on the changes in the pH of a medium due to NO3- depletion by denitrification . The plates contained KNO3 and the pH indicator BTB . The pH of the medium was initially adjusted to between 7.0 and 7.3 . Plates inoculated with a bacterial suspension were incubated for several days at the appropriate temperature, and then bacterial NO3- consumption was monitored by examining blue colonies and/or halos due to the increasing pH of the medium . Positive strains obtained from this initial screening analysis were screened further by culturing them in flasks containing DM under initially aerobic conditions . Denitrification was periodically monitored by measuring N2O and 15N2 in the gas phase by GC and GC-mass spectrometry, respectively . Most strains completely consumed O2 before they produced N2 . However, some strains produced significant amounts of N2 even in the presence of 3% O2 in the gas phase of the flasks . Among these, strains that produced the least N2O (aerobic denitrifiers emitting low N2O levels) were selected .

In a typical experiment we screened 97 bacterial colonies, and we found 29 strains which were positive in BTB plate assays and 9 strains that produced N2 even in the presence of 3% O2 . Six of the nine strains evolved less than 1 µmol of N2O flask-1 under the same culture conditions . The most prominent aerobic (O2-tolerant) N2 producers (strains TR2 and K50) from several screening analyses were analyzed as follows .

Properties of denitrifiers in batch culture.
The time-dependent denitrification by strain TR2 or K50 was compared with that of the typical denitrifiers P . stutzeri ZoBell and P . denitrificans ATCC 35512 during batch culture in flasks with a headspace that was initially filled with air to create aerobic conditions . After the incubation was started, the O2 concentration in the gas phase was gradually decreased, and N2 evolved (Fig . 1) . The rates of N2 production were significantly different for the different cultures . Initiation of N2 production by P . stutzeri ZoBell required a lag period of 2.5 h, whereas the other three strains evolved N2 without a lag phase, indicating that N2 production by P . stutzeri ZoBell is more sensitive to O2 than N2 production by the other strains is (Fig . 1A) . The aerobic denitrifier P . denitrificans produced N2 without a lag but concomitantly produced a considerable amount of N2O (Fig . 1B) . Strains TR2 and K50 produced N2 without a lag period, and little N2O was detected during the entire incubation period . These results demonstrated that strains TR2 and K50 should be aerobic denitrifiers that produce low levels of N2O even under aerobic conditions . The NO3- initially added (1 mmol) was completely consumed by these cultures (data not shown) . The amount of consumed N atoms recovered in N2 was greatest with strain K50, in which the 0.27 mmol of N2 obtained corresponded to 54% recovery (Fig . 1C) . The final level of recovery with strain TR2 was 28% (Fig . 1D) .


 FIG . 1 . Denitrification by new isolates and control denitrifiers in initially aerobic batch cultures . The strains were cultured in flasks containing DM, and the gas phase was monitored periodically as described in Materials and Methods . (A) P . stutzeri ZoBell; (B) P . denitrificans ATCC 35512; (C) strain K50; (D) strain TR2 . Symbols: •, N2; {blacktriangleup}, N2O; {blacksquare}, O2 . Typical results from more than three independent experiments are shown.

 
Denitrification in continuous culture.
We further investigated the effects of aeration on N2 and N2O production by the isolated bacteria . Table 1 shows the steady-state characteristics observed with continuous cultures of the strains isolated and of the typical denitrifiers . Changing the composition of the aerating gas and agitation speed allowed us to establish anoxic (dissolved oxygen [DO] concentration, 0 µmol liter-1), hypoxic (DO concentration, 5.3 to 9.4 µmol liter-1), and oxic (DO concentration, 28 to 39 µmol liter-1) aeration conditions . Most of the cultures produced N2 under anoxic and hypoxic conditions; the only exception was a P . denitrificans culture in which there was too little growth to detect N2 produced under anoxic conditions . All of the strains produced N2 at a higher rate under hypoxic conditions than under anoxic conditions (data not shown) . However, under anoxic conditions the rate of N2 production was higher than that under hypoxic conditions, as for other bacterial denitrifiers (2, 4), when the rates were expressed on the basis of cell mass (optical density at 540 nm [OD540]) . This is because the cell mass was significantly larger under hypoxic conditions than under anoxic conditions . The value per cell for strain TR2 (2.8 µmol of N2 min-1 unit of OD540-1) was double that for P . denitrificans (1.4 µmol of N2 min-1 unit of OD540-1) under hypoxic conditions . When challenged with oxic conditions, P . stutzeri ZoBell and P . denitrificans produced no N2 and considerable amounts of N2O, indicating that O2 inhibited the reduction of N2O to N2 under these conditions . By contrast, strains TR2 and K50 could still produce N2 under oxic conditions (Table 1) . The activity of strain TR2 (0.9 µmol of N2 min-1 unit of OD540-1) was as much as 32% of the activity under hypoxic conditions . Both TR2 and K50 produced less N2O than the other strains produced under the corresponding aeration conditions . TR2 produced less N2O than K50 produced, indicating that strain TR2 reduces N2O to N2 more efficiently than K50 reduces N2O to N2 . Our results showed that P . denitrificans, a typical aerobic denitrifier, produced N2O at a much higher rate than the other strains produced N2O, indicating that this organism produces N2O instead of N2 under oxic conditions . These findings indicate that the strains isolated in the present study are aerobic denitrifiers that produce low levels of N2O .


TABLE 1 . Steady-state characteristics of continuous cultures of bacterial strainsa

 
Electron donor specificity.
We investigated the electron donor specificity of denitrification by strains TR2 and K50 in flask cultures under initially aerobic conditions (Fig . 1) . Table 2 shows that both strains consumed O2 and produced N2 and/or N2O with all carbon sources tested, indicating that they can use a variety of carbon sources as electron donors for O2 respiration and denitrification . Of the carbon sources tested, succinate supported O2 respiration and denitrification most efficiently in TR2 . Strain K50 utilized O2 efficiently in the presence of ethanol and acetate in addition to succinate . Although the N2 production rates were lower and more N2O evolved than the N2O that evolved with the other carbon sources, C1 compounds, such as methanol and formate, could support denitrification by both bacteria . Strain K50 evolved little N2O irrespective of the electron donor .


TABLE 2 . Carbon source utilization of strains TR2 and K50a

 
Identification of the strains.
Strains TR2 and K50 were both gram-negative rods with catalase and oxidase activities . They also metabolized glucose to organic acid, indicating that they are pseudomonads . The nucleotide sequences of their 16S rRNA genes and a phylogenetic analysis revealed that these strains are members of the genus Pseudomonas in the ß subclass the class Proteobacteria . The levels of identity of the sequences of strains TR2 and K50 were greatest with the sequences of P . stutzeri (99%) and Pseudomonas mendocina NCIB 10541 (99%), respectively . The phenotype of strain TR2 was characteristic of P . stutzeri; namely, there were no fluorescent pigments, organic growth factors were not required, and the organism was gelatinase negative and amylase positive . The ability to grow at 41°C is also a phenotypic criterion that distinguishes P . stutzeri strains from other Pseudomonas spp . Thus, we identified strain TR2 as P . stutzeri and designated it P . stutzeri TR2 . Strain K50 accumulated poly ß-hydroxybutyric acid, which P . mendocina does not do . Therefore, we could not identify this strain and designated it Pseudomonas sp . strain K50 .

Performance in AWW system.
We estimated the denitrification by continuous cultures of P . stutzeri TR2 in organic wastewater . We added formate to conventional wastewater as an additional electron donor assuming that it should provide selective pressure for survival that should allow P . stutzeri TR2 to become the dominant species in the culture . Table 3 shows that neither P . stutzeri TR2 nor the control strain P . stutzeri ZoBell evolved N2O at any DO level . TR2 more efficiently reduced NO3- and produced more N2 than P . stutzeri ZoBell . When the DO concentration was increased to 113 µmol liter-1, P . stutzeri ZoBell produced neither N2 nor N2O . This is in contrast to P . stutzeri TR2, which produced a significant amount of N2 even under highly aerobic conditions (DO concentration, 141 µmol liter-1) . The level of recovery of N atoms in N2 in an aerobic culture of P . stutzeri TR2 was 14% of the consumed NO3- . Other N atoms of the consumed NO3- should have been incorporated into the biomass . These results indicate that the denitrifying system of P . stutzeri TR2 is more resistant to O2 than the denitrifying system of P . stutzeri ZoBell is and that the TR2 strain produced N2 under aerobic conditions in AWW .


TABLE 3 . Steady-state characteristics of strains in AWW supplemented with formatea

 
Enzyme activities.
The activities of respiratory NO3 reductase, NO2- reductase, NO reductase, and N2O reductase in crude extracts prepared from denitrifying cells of P . stutzeri TR2 were determined, and the results obtained with 3-day cultures are shown in Fig . 1 . The specific activities of these enzymes were 4,400, 63, 6.8, and 64 nmol of product min-1 mg of protein-1, respectively, indicating that the activity observed should have been responsible for denitrification by P . stutzeri TR2 .


   DISCUSSION

 
Although N2O production by denitrifying bacteria under insufficient anaerobic conditions is an established phenomenon that causes serious global warming, in most studies of aerobic denitrifiers the workers have described only NO3- and NO2- consumption under aerobic conditions, and studies in which the workers focused on denitrified gas (N2O and N2) have been limited . This is probably due to difficulties in detecting denitrified N2 under aerobic conditions; under such conditions contamination with atmospheric N2 interferes with precise quantitation of denitrified N2 . Here, we used heavy-isotope-labeled NO3- (15NO3-) and highly sensitive mass spectrometry to screen and isolate denitrifying bacteria emitting low levels of N2O under aerobic conditions . To our knowledge, we are the first researchers to isolate and characterize denitrifiers that produce less N2O than other bacteria produce . Our screening method should be applicable to isolation of aerobic denitrifying bacteria that exhibit such properties .

Our results indicated that both of the denitrifiers isolated, P . stutzeri TR2 and Pseudomonas sp . strain K50, produced N2 even under oxic conditions (DO concentration, 38 to 39 µmol liter-1) (Table 1), conditions under which other typical aerobic denitrifiers could not produce N2, indicating that the novel strains are O2 resistant, aerobic denitrifiers . Physiologically, O2 is the best electron acceptor for supporting growth, and it receives electrons through the respiratory chain . Most denitrifying microorganisms perform O2 respiration and repress the denitrification mechanism when O2 is available . Therefore, the physiological significance of denitrification under oxic conditions (aerobic denitrification) is quite intriguing . Aerobic denitrification has also been identified in P . denitrificans (19, 20), as well as in the novel species M . aerodenitrificans (15) and T . mechernichensis (22) . The strains identified here, together with these organisms, should be useful for future investigations of the mechanisms of aerobic denitrification by bacteria and the role of aerobic denitrification in the ecosystem .

We found that all of the bacteria tested emitted considerably more N2O under continuously aerobic conditions than under anaerobic conditions (Table 1) . This is consistent with the observation that in most denitrifiers, the activity of N2O reductase is inactivated by O2, which also represses expression of the encoding gene and N2 production (4, 8) . We also found that both P . stutzeri TR2 and Pseudomonas sp . strain K50 produced less N2O and more N2 under our conditions than the other denitrifiers produced (Fig . 1 and Table 1) . Furthermore, our results demonstrated that the N2- and N2O- producing activities of the strains were dependent on the culture . For example, carbon sources seemed to affect denitrification to various degrees depending on the strain (Table 2) . Factors other than carbon sources can also affect aerobic denitrification . In the presence of formate as an electron donor, P . stutzeri TR2 produced N2O in batch culture (Table 2), whereas little N2O was detected in continuous culture (Table 3) . This may have been due to differences in conditions between the batch and continuous cultures or to the compositions of the media . The mechanism with which the isolates suppressed N2O production remains to be studied . However, the results suggest that aerobic denitrification that produces less N2O should be a complicated system that is regulated by various factors, including the O2 supply and the composition of the medium . It is interesting that P . stutzeri TR2 and ZoBell have different denitrifying properties, especially for N2O production under oxic conditions (Table 1) and for N2 production in response to sudden exposure to O2 (Fig . 1), despite their close phylogenetic relationship . A comparison of the genes of these strains should reveal the critical gene(s) required for aerobic denitrification and for N2O suppression .

The novel bacteria isolated in the present study denitrified under conditions that mimicked those in wastewater treatment plants (Table 3) . This finding suggests that the isolates could be maintained in the mixed population of microorganisms found in sludge as is observed with P . denitrificans, which reduces NO3- more efficiently than a control reactor without the strain when it is mixed with activated sludge (9) . Sometimes, a C1 carbon source, such as methanol or formate, has been used to manipulate the dominant bacterial species in sludge (5, 21) . Our novel strains should be useful for constructing new aerobic denitrification processes that do not produce N2O, since these strains could be selected as the dominant organisms by using C1 compounds as the electron donors .

 


   ACKNOWLEDGMENTS

 
We thank Kota Hatayama (University of Tsukuba) for determining the nucleotide sequence of the 16S rRNA gene . We also thank Norma Foster for critical reading of the manuscript .

This study was supported by PROBRAIN (Program for Promotion of Basic Research Activities for Innovative Biosciences) and by a grant-in-aid for scientific research from the Ministry of Education, Science, Culture and Sports of Japan .


   FOOTNOTES

 
* Corresponding author . Mailing address: Department of Biotechnology, Graduate School of Agricultural and Life Sciences, University of Tokyo, Bunkyo-Ku, Tokyo 113-8657, Japan . Phone and fax: 81-35841-5148 . E-mail: ahshoun{at}mail.ecc.u-tokyo.ac.jp .


   REFERENCES

 

  1. Banin, A., J . G . Lawless, and R . C . Whitten. 1984 . Global N2O cycles—terrestrial emissions, atmospheric accumulation and biospheric effects . Adv . Space Res . 4:207-216.
  2. Baumann, B., M . Snozzi, A . J . B . Zehnder, and J . R . van der Meer. 1996 . Dynamics of denitrification activity of Paracoccus denitrificans in continuous culture during aerobic-anaerobic changes . J . Bacteriol . 178:4367-4374.
  3. Bremner, J . M., and A . M . Blackmer. 1978 . Nitrous oxide: emission from soils during nitrification of fertilizer nitrogen . Science 199:295-296.
  4. Ferguson, S . J. 1994 . Denitrification and its control . Antonie Leeuwenhoek 66:89-110.
  5. Fesefeldt, A., N . C . Holm, and C . G . Gliesche. 1998 . Genetic diversity and population dynamics of Hyphomicrobium spp . in a sewage treatment plant and its receiving lake . Water Sci . Technol . 37:113-116.
  6. Firestone, M . K., R . B . Firestone, and J . M . Tiedje. 1980 . Nitrous oxide from soil denitrification: factors controlling its biological production . Science 208:749-751.
  7. Kobayashi, M., Y . Matsuo, A . Takimoto, S . Suzuki, F . Maruo, and H . Shoun. 1996 . Denitrification, a novel type of respiratory metabolism in fungal mitochondrion . J . Biol . Chem . 271:16263-16267.
  8. Korner, H., and W . G . Zumft. 1989 . Expression of denitrification enzymes in response to the dissolved oxygen level and respiratory substrate in continuous culture of Pseudomonas stutzeri . Appl . Environ . Microbiol . 55:1670-1676.
  9. Kshirsagar, M., A . B . Gupta, and S . K . Gupta. 1995 . Aerobic denitrification studies on activated sludge mixed with Thiosphaera pantotropha. Environ . Technol . 16:35-43.
  10. Kumon, Y., Y . Sasaki, I . Kato, N . Takaya, H . Shoun, and T . Beppu. 2002 . Codenitrification and denitrification are dual metabolic pathways through which dinitrogen evolves from nitrate in Streptomyces antibioticus . J . Bacteriol . 184:2963-2968.
  11. Nakahara, K., T . Tanimoto, K . Hatano, K . Usuda, and H . Shoun. 1993 . Cytochrome P-450 55A1 (P-450dNIR) acts as nitric oxide reductase employing NADH as the direct electron donor . J . Biol . Chem . 268:8350-8355.
  12. Nicholas, D . J . D., and A . Nason. 1951 . Determination of nitrate and nitrite . Methods Enzymol . 3:983-984.
  13. Otte, S., N . G . Grobben, L . A . Robertson, M . S . M . Jetten, and J . G . Kuenen. 1996 . Nitrous oxide production by Alcaligenes faecalis under transient and dynamic aerobic and anaerobic conditions . Appl . Environ . Microbiol . 62:2421-2426.
  14. Ozeki, S., I . Baba, N . Takaya, and H . Shoun. 2001 . A novel C1-utilizing aerobic denitrifier Alcaligenes sp . STC1 and its genes for copper-containing nitrite reductase and azurin . Biosci . Biotechnol . Biochem . 65:1206-1210.
  15. Patureau, D., N . Bernet, and R . Moletta. 1995 . Effect of oxygen on denitrification in continuous chemostat culture with Comamonas sp . strain SGLY2 . J . Ind . Microbiol . 16:124-128.
  16. Patureau, D., J.-J . Godon, P . Dabert, T . Bouchez, N . Bernet, J . P . Delgenes, and R . Moletta. 1998 . Microvirgula aerodenitrificans gen . nov., sp . nov., a new gram-negative bacterium exhibiting co-respiration of oxygen and nitrogen oxides up to oxygen saturated conditions . Int . J . Sys . Bacteriol . 48:775-782.
  17. Robertson, G . P., E . A . Paul, and R . R . Harwood. 2000 . Greenhouse gases in intensive agriculture: contributions of individual gases to the radiative forcing of the atmosphere . Science 289:1922-1925.
  18. Robertson, G . P., and J . M . Tiedje. 1987 . Nitrous oxide sources in aerobic soils: nitrification, denitrification and other biological processes . Soil Biol . Biochem . 19:187-193.
  19. Robertson, L . A., T . Dalsgaar, N . P . Revsbech, and J . G . Kuenen. 1995 . Confirmation of 'aerobic denitrification' in batch cultures, using gas chromatography and 15N mass spectrometry . FEMS Microbiol . Ecol . 18:113-120.
  20. Robertson, L . A., E . W . J . van Niel, R . A . M . Torresmans, and J . G . Kuenen. 1988 . Simultaneous nitrification and denitrification in aerobic chemostat cultures of Thiosphaera pantotropha . Appl . Environ . Microbiol . 54:2812-2818.
  21. Sakairi, M . A . B., P . C . Wang, and M . Matsumura. 1997 . High-rate seawater denitrification utilizing a macro-porous cellulose carrier . J . Ferment . Bioeng . 83:102-108.
  22. Scholten, E., T . Lukow, G . Auling, R . M . Kroppenstedt, F . A . Rainey, and H . Dielmann. 1999 . Thaurea mecharnichensis sp . nov., an aerobic denitrifier from a leachate treatment plant . Int . J . Sys . Bacteriol . 49:1045-1051.
  23. Shoun, H., and T . Tanimoto. 1991 . Denitrification by the fungus Fusarium oxysporum and involvement of cytochrome P-450 in the respiratory nitrite reduction . J . Biol . Chem . 266:11078-11082.
  24. Tsuruta, S., N . Takaya, L . Zhang, and H . Shoun. 1998 . Denitrification by yeasts and occurrence of cytochrome P450nor in Trichosporon cutaneum. FEMS Microbiol . Lett . 168:105-110.
  25. van Bochove, E., B . Theriault, P . Rochette, H . G . Jones, and J . W . Pomeroy. 2001 . Thick ice layers in snow and frozen soil affecting gas emission from agricultural soils during winter . J . Geophys . Res . 106:23061-23071.
  26. Weisburg, W . G., S . M . Barns, D . A . Pelletier, and D . J . Lane. 1991 . 16S ribosomal DNA amplification for phylogenetic study . J . Bacteriol . 173:697-703.

 

 

 

Free Online Full-text Article

 

 

 

 

What Is Biofilm?, What Is Nitrification?, What Is Listeria Monocytogenes?, What Is Biofilter?, What Is Genetic Engineering?, n, Bacteriology, n, Microbe, e, Bacteria, c, Microorganisms, e, Bacterium, s, Multidrug resistant, i, Candida albicans, n, Yeasts, n, Multidrug resistant, i, Cell cultures, i, Erwinia, o, Staphylococcus aureus, s, Bacteria, n, Escherichia coli, i, Microbiological, a, Petri dish, c, B. anthracis, e, Streptococcal, o, Escherichia coli, e, Antibiotic treatment, c, Bacillus, s, Bactericidal, s, Bacillus, o, Staphylococcus, e, Yeasts, n, Microbiological




 

   Scientific Publications - Work Done by Microbiology Reader Bioscreen C

Agricultural Microbiology
Anaerobic Microbiology
Antimicrobial Susceptibility
Artificial Atmosphere
Bioassay of Antibiotics
Biofilm Microbiology
Bioreactor Technology
Biotechnology
Cell Biology
Clinical Microbiology
Environmental Microbiology
Experiments with Yeast
Fermentation
Food Microbiology
Functional Genomics
Gene Technology
Growth Media Development
Growth Rate and Lag Time
Industrial Microbiology
Medical/Pharmaceutical Field
Microbiological Assay
Microbiological Research
Microbiology of Cosmetics

go to a specific theme...

Military Microbiology
Molecular Microbiology
Mutagenicity and Genotoxicity
Oral Microbiology
Patents
Postantibiotic Studies
Soil Microbiology
Spore Microbiology
Veterinary Microbiology
Waste/Wastewater Treatment
Water Microbiology
Wine Microbiology

 


 

© 2005 Transgalactic Ltd (manufacturer of Bioscreen C software) | Privacy Statement | P.O. Box 1393, 00101 Helsinki, Finland, phone: +358 9 85172920, fax: +358 9 8749481, e-mail: microbiology@bionewsonline.com
 

 

 

Last modified: May 25, 2005