|
|
|
Clin Exp Hypertens A, 1982, 4(11-12), 1939 - 63 Biosynthesis of preprorenin . Studies using whole tissue, a cell-free system, and E . coli containing cDNA inserted at the PstI site of plasmid pBR322; Catanzaro DF et al.; The biosynthesis of renin as a higher molecular weight 'prorenin' was demonstrated by in vitro incorporation of {35S} methionine into nascent polypeptides of submandibular gland tissue from adult male mice . Immunoprecipitation with anti-renin and electrophoresis identified a Mr 44,500, pI 6.4 prorenin which normally represented 5% of renin-immunoreactive protein in tissue extracts and which was rapidly converted during in vitro labeling into a Mr 40,000, pI 6.2 species . The latter was subsequently processed slowly to forms of Mr 35,500, pI 5.6 and Mr 34,000, pI 5.4 . The influence of processing enzymes was then eliminated by synthesizing renin in a cell-free translation system containing rabbit reticulocyte lysate and mRNA isolated from submandibular glands . This yielded an even larger species of Mr 46,000 likely to be 'preprorenin' . A clone bank of mouse submandibular gland cDNA was prepared . This consisted of E . coli RRI transformed with plasmid pBR322 in which cDNA had been inserted at the PstI site so that the bacteria could express the encoded polypeptide . Renin-immunoreactive colonies were identified suggesting the expression of renin-like proteins by a prokaryote . The cDNA which was 700-1000 base pairs big was excised for sequencing. J Biol Chem, 1981 Dec 25, 256(24), 13099 - 104 Kinetic and inhibition studies of glutamine synthetase from the cyanobacterium Anabaena 7120; Orr J et al.; A number of biochemical parameters of glutamine synthetase (EC 6.3.1.2) isolated from the cyanobacterium Anabaena 7120 were determined . Apparent Michaelis constants for glutamate and ATP were found to be 2.1 and 0.32 mM, respectively; that for ammonia was found to be below 20 microM, significantly lower than that reported for glutamine synthetases from other species . Serine, alanine, glycine, cysteine, aspartic acid, methionine sulfone, and methionine sulfoximine were found to inhibit the enzyme . The enzyme is controlled neither by adenylylation nor by feedback inhibition by glutamine, mechanisms found in some other prokaryotes . It must therefore be regulated by a different mechanism, possibly a combination of feedback by alanine, serine, and glycine, metabolites which are especially effective in inhibiting Anabaena glutamine synthetase. Nature, 1981 Dec 17, 294(5842), 626 - 31 Two conserved sequence blocks within eukaryotic tRNA genes are major promoter elements; Galli G et al.; The split promoter sequences of a tRNALeuCUG gene of Xenopus laevis have been mapped to nucleotides 13-20 and 51-64 of the tRNALeu coding sequences . The sequences closely coincide with two conserved sequence blocks present in all eukaryotic tRNA genes . The two conserved sequence blocks were found to be exchangeable between tRNA genes as chimaeric tRNAMet--tRNALeu genes proved transcriptionally active . Furthermore, two prokaryotic tRNA genes exhibiting strong homologies with the two blocks yielded specific transcripts when tested in an eukaryotic transcriptional system. J Biol Chem, 1981 Dec 10, 256(23), 12167 - 75 Primary structure of phycocyanin from the unicellular rhodophyte Cyanidium caldarium . I . Complete amino acid sequence of the alpha subunit; Offner GD et al.; The complete amino acid sequence of the alpha subunit of phycocyanin from the unicellular rhodophyte Cyanidium caldarium has been determined by automated sequential degradation of cyanogen bromide peptides, tryptic peptides derived from protein chemically modified with 1,2-cyclohexanedione or citraconic anhydride, and a peptide obtained after cleavage of the protein at the single tryptophan residue . The alpha subunit contains 162 amino acids and methionine and serine are the NH2- and carboxyl-terminal amino acids, respectively . The calculated molecular weight of the protein, based on the amino acid sequence, is 18,303, in good agreement with the value of 17,500 +/- 500, obtained by electrophoresis on calibrated sodium dodecyl sulfate-polyacrylamide gels . One phycocyanobilin chromophore is attached to the alpha subunit at residue 84 by a cysteinyl thioether linkage . A second cysteine (residue 98) is present but is not linked to phycocyanobilin . The amino acid sequence of the alpha subunit of phycocyanin from C . caldarium is the first complete amino acid sequence of a phycobiliprotein from a eukaryotic alga . Extensive homology occurs between the alpha subunit of phycocyanin from C . caldarium and from two prokaryotic cyanobacteria, and the significance of this is discussed. Biochemistry, 1981 Dec 8, 20(25), 7301 - 7 Secondary structure of prokaryotic 5S ribosomal ribonucleic acids: a study with ribonucleases; Douthwaite S et al.; The structures of 5S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus were examined by using ribonucleases A, T1, and T2 and a double helix specific cobra venom ribonuclease . By using both 5' and 3'-32P-end labeling methods and selecting for digested but intact 5S RNA molecules, we were able to distinguish between primary and secondary cutting positions and also to establish the relative degree of cutting . The data reveal the predicted similarities of the higher order structure in the two RNAs but also demonstrate a few significant differences . The data also provide direct evidence for three of the helical regions of the Fox and Woese model of 5S RNA {Fox, G . E., & Woese, C . (1975) Nature (London) 256, 505} and support other important structural features which include a nucleotide looped out from a helical region which has been proposed as a recognition site for protein L18. Proc Natl Acad Sci U S A, 1981 Dec, 78(12), 7331 - 5 A "bulged" double helix in a RNA-protein contact site; Peattie DA et al.; The binding of ribosomal protein L18 affects specific nucleotides in Escherichia coli 5S RNA as detected by dimethyl sulfate alkylation and RNase A digestion of the 5S-L18 complex . Most of the affected nucleotides are clustered and localize a site of RNA-protein interaction in and around the defined central helix {Fox, G . E . & Woese, C . (1975) Nature (London) 256, 505-507} of 5S RNA . Chemical carbethoxylation of the native 5S RNA with diethyl pyrocarbonate shows that a striking feature of this region is an unstacked adenosine residue at position 66 . We propose that this residue exists as a singly bulged nucleotide extending the Fox and Woese central helix by two base pairs in the E . coli sequence (to positions 16-23/60-68) as well as in each of 61 (prokaryotic and eukaryotic) aligned 5S RNA sequences . In each case, the single bulged nucleotide is at the relative position of adenosine-66 in the RNA sequences . The presence of this putative bulged nucleotide appears to have been conserved in 5S RNA sequences throughout evolution, and its identity varies with major phylogenetic divisions . This residue is likely involved in specific 5S RNA-protein recognition or interaction in prokaryotic and eukaryotic ribosomes . The uridine-65 to adenosine-66 internucleotide bond is protected from RNase A digestion in the complex, and carbethoxylation of E . coli adenosine-66 prior to L18 binding affects formation of a stable RNA-protein complex . Thus, we identify a region of E . coli 5S RNA protected by the ribosomal protein L18 and propose that it contains a bulged nucleotide residue important in stable formation of this RNA-protein complex . This bulged residue appears to be evolutionarily conserved and phylogenetically defined in 5S RNA sequences in general, and consideration of other known RNA-protein binding sites shows that such a "bulged helix" may be a common feature of RNA-protein contact sites. Proc Natl Acad Sci U S A, 1981 Dec, 78(12), 7609 - 13 DNA methylation and gene expression: endogenous retroviral genome becomes infectious after molecular cloning; Harbers K et al.; The Mov-3 substrain of mice carries Moloney murine leukemia virus as a Mendelian gene in its germ line . All mice segregating the Mov-3 locus activate virus and develop viremia and leukemia . The integrated provirus (i.e., Mov-3 locus) was molecularly cloned from Mov-3 liver DNA as a 16.8 kilobase long EcoRI fragment . Comparison of the cloned and genomic Mov-3 specific EcoRI fragment by restriction enzyme analysis showed no differences in the size of the fragments, indicating that no major sequence rearrangements occurred during cloning . The genomic and cloned Mov-3 DNAs were compared for methylation and infectivity . Analysis with Hha I showed that the genomic proviral and the flanking mouse sequences were methylated at cytosine residues, in contrast to the cloned Mov-3 locus . The cloned Mov-3 locus, however, was highly infectious in a transfection assay (1 x 10(-3) plaque-forming unit per viral genome) in contrast to the genomic Mov-3 DNA (less than 10(-7) per viral genome) . Our results suggest that genes containing 5-methylcytosine are not expressed after transfection into susceptible cells and that removal of the methyl groups by molecular cloning in prokaryotes leads to expression generating infectious proviral DNA . If gene expression of transfected DNA is controlled by mechanisms that are relevant for gene expression in the animal, this suggests that DNA methylation may play a causative role in eukaryotic gene regulation. Gene, 1981 Dec, 16(1-3), 297 - 307 Nucleotide sequences of small ribosomal RNA and adjacent transfer RNA genes in rat mitochondrial DNA; Kobayashi M et al.; The nucleotide sequences of genes for small 12 S ribosomal RNA and two transfer RNAs (tRNAPhe and tRNAVal) and their common upstream region in cloned rat mitochondrial DNA were determined . This DNA sequence of 1709 bp extends between the HindII and HindIII cleavage sites in the EcoRI-A and EcoRI-D fragments, respectively . There is no long reading frame for protein synthesis starting from the HindIII site and extending all the way to the HindII site, or vice versa . The heavy strand was found to be the template for these RNA transcripts . The 5' and 3' ends of the 12 S ribosomal RNA gene are contiguous with the tRNAPhe and tRNAVal genes, respectively . The structural features of the two tRNA genes are significantly different from the standard prokaryotic tRNA pattern . Since similar contiguous natures of these genes in human (Crews and Attardi, Cell 19 (1980) 775; Eperon et al., Nature 286 (1980) 460) and mouse (Van Etten et al., Cell 22 (1980) 157) mitochondrial DNA have been reported, comparative studies on the structures of these genes were performed by computer analysis and the characteristic features are discussed. Nucleic Acids Res, 1981 Nov 25, 9(22), 6199 - 217 Recovery of recombinant bacterial plasmids from E . coli transformed with DNA from microinjected mouse cells; Kretschmer PJ et al.; We have previously described the isolation of thymidine kinase positive (TK+), human beta-globin gene-containing colonies following co-microinjection of mouse TK- L cells with two recombinant pBR322 plasmids, one containing the TK gene of herpes simplex virus type I (plasmid pXl), and the second containing a human genomic DNA fragment within which is the human beta-globin gene (plasmid pRKl) . DNA isolated from one such clone was used in bacterial transformation experiments with a selection for tetracycline-resistant colonies (that is, for cells containing pRKl) . A total of forty-two tetracycline-resistant colonies were isolated, thirty of which contained circular pRK1 molecules identical to those originally injected . The remaining twelve colonies contained unique plasmids that were grouped into five different classes of recombinant molecules . All five of these unique recombinant classes appear to contain a common deletion endpoint occurring at a specific region of the pBR322 segment of pRKl . Four of the unique recombinant classes appear to have arisen from the deletion of a segment of a pRKl trimer or dimer molecule, while the fifth class appears to have resulted from recombination between pRKl and pXl followed by a deletion event within this recombinant . It is uncertain whether these deletions are occurring within the eukaryotic cell or upon subsequent transformation of the bacterial cell . If the latter, then the passage of the plasmid DNA through the eukaryotic cell alters a specific site of the pBR322 DNA in such a way that deletions can occur at a high frequency in this region when the plasmid DNA is introduced back into a bacterial cell . Thus, we have established a prokaryote-eukaryote-prokaryote DNA transfer and recovery system which should be useful in studies on DNA replication and the regulation of gene expression in higher eukaryotes. Proc Natl Acad Sci U S A, 1981 Nov, 78(11), 6771 - 5 Evidence that a high molecular weight replicative DNA polymerase is conserved during evolution; Hubscher U et al.; Using a technique developed recently to detect DNA polymerase activity in situ after NaDodSO4 gel electrophoresis (Spanos, A., Sedgwick, S . G., Yarranton, g . T., Hubscher, U . & Banks, G . R . (1981) Nucleic Acids Res . 9, 1825-1839), we present evidence that a high Mr (greater than or equal to 125,000) polypeptide is responsible for chromosomal DNA replication in prokaryotes, lower eukaryotes and high eukaryotes . Not only extracts from Escherichia coli, Ustilago maydis, Drosophila melanogaster, rat neurones, calf thymus, human fibroblast, and HeLa cells possess such high Mr activities, but also highly purified E . coli DNA polymerase III core enzyme, U . maydis DNA polymerase, and D . melanogaster embryo and calf thymus DNA alpha polymerases . The evidence that these activities are responsible for chromosomal DNA replication is genetical (E . coli, U . maydis, and D . melanogaster); also, the high Mr activity disappears from rat neurones during differentiation from an actively dividing precursor cell to a postmitotically mature neurone . Furthermore, when limited proteolysis is allowed to occur, a defined and remarkably similar pattern of intermediate Mr activities is generated in lower eukaryotic and high eukaryotic extracts and, to some extent, in prokaryotic extracts . In higher eukaryotic extracts, a low Mr activity of approximately 35,000 is also generated . Protease inhibitors can retard formation of these catalytically active proteolytic fragments . We propose that the replicative DNA polymerase complex of both prokaryotes and eukaryotes contains a high Mr polypeptide responsible for chain elongation which might be conserved during evolution and which is extremely sensitive to proteolytic cleavage. Eur J Biochem, 1981 Nov, 120(1), 69 - 77 The conservation of DNA sequences over very long periods of evolutionary time . Evidence against intergeneric chromosomal transfer as an explanation for the presence of Escherichia coli tuf gene sequences in taxonomically-unrelated prokaryotes; Filer D et al.; In the present study we tried to determine whether the presence of DNA sequences homologous to the Escherichia coli tuf gene (encodes peptide chain elongation factor Tu) in many taxonomically-unrelated prokaryotes is due to selective pressure for these sequences or due to the transfer of chromosomal material subsequent to the divergence of the genera from their progenitors . We found that the degree of sequence homology to the DNA immediately adjacent to the E . coli tuf A gene is either nonexistent or much less than that found for the tuf gene . Furthermore, the tuf-homologous sequences present in one prokaryote were found to be in large part the same as or a subset of those present in others . That is, various prokaryotes share a common subset of tuf-homologous sequences . These findings suggest that strong selective pressure and not recent intergeneric chromosomal transfer is responsible for the ubiquitous presence of certain tuf-homologous sequences . Because the genetic code is degenerate, DNA sequence need not be conserved to conserve protein sequence . Therefore, if the only function of these sequences is to encode protein, their persistence must mean that in some instances codon sequence is selected for. Proc Natl Acad Sci U S A, 1981 Nov, 78(11), 6734 - 8 Deoxynucleoside {1-thio}triphosphates prevent proofreading during in vitro DNA synthesis; Kunkel TA et al.; The contribution of proofreading to the fidelity of catalysis by DNA polymerases has been determined with deoxyribonucleoside {1-thio}triphosphate substrates . These analogues, which contain a sulfur in place of an oxygen on the alpha phosphorus, are incorporated into DNA by DNA polymerases at rates similar to those of the corresponding unmodified deoxynucleoside triphosphates . The fidelity of DNA synthesis was measured with phi X174 am3 DNA; reversion to wild type occurs most frequently by a single base substitution, a C for a T at position 587 . By using avian myeloblastosis virus DNA polymerase and DNA polymerase beta (enzymes without a proofreading 3' leads to 5' exonucleolytic activity), substitution of deoxycytidine thiotriphosphate in the reaction mixture did not alter fidelity . In contrast, with DNA polymerases from E . coli (DNA polymerase I) and bacteriophage T4 (enzymes containing a proofreading activity), fidelity was markedly reduced with deoxycytidine {1-thio}triphosphate . DNA containing phosphorothioate nucleotides is insensitive to hydrolysis by the exonuclease associated with these prokaryotic DNA polymerases . These combined results indicate that the deoxynucleoside {1-thio}triphosphates have normal base-pairing properties; however, once misinserted by a polymerase, they are not excised by proofreading . Proofreading of a C:A mismatch at position 587 is thereby found to contribute 20-fold to the fidelity of E . coli DNA polymerase I and a greater amount to the fidelity of bacteriophage T4 DNA polymerase. Gene, 1981 Nov, 15(2-3), 127 - 37 Expression of a cloned Saccharomyces cerevisiae gene (URA1) is controlled by a bacterial promoter in E . coli and by a yeast promoter in S . cerevisiae; Loison G et al.; The expression of a cloned yeast URA1 gene in Escherichia coli and in Saccharomyces cerevisiae was studied . In E . coli, only one orientation of the cloned yeast DNA segment inserted into the bacterial vector (pBR322) allows URA1 expression . Moreover, the permissive orientation changes with the cloning site . The absence of URA1 expression in E . coli can be corrected by the spontaneous integration into the cloned yeast DNA of a 0.9-kb bacterial DNA . Several copies of such a bacterial IS element have been detected in the host E . coli genome . The results strongly suggest that, in E . coli, transcription of the yeast URA1 needs a prokaryotic promoter for its initiation . In S . cerevisiae, the expression of non-chromosomally cloned URA1 does not depend on the orientation of the cloned fragment . Furthermore, it remains under the control of a nuclear regulatory gene (pprX-1) which constitutively enhances the expression of URA1 as well as URA3 at the transcriptional level . Therefore, in S . cerevisiae, transcription of non-chromosomally cloned URA1 involves a physiological yeast promoter cloned along with the structural part of the gene. Can J Biochem, 1981 Nov-Dec, 59(11-12), 921 - 32 The nucleotide sequence of phenylalanine tRNA and 5S RNA from Rhodospirillum rubrum; Newhouse N et al.; The complete nucleotide sequence of tRNAPhe and 5S RNA from the photosynthetic bacterium Rhodospirillum rubrum has been elucidated . A combination of in vitro and in vivo labelling techniques was used . The tRNAPhe sequence is 76 nucleotides long, 7 of which are modified . The primary structure is typically prokaryotic and is most similar to the tRNAPhe of Escherichia coli and Anacystis nidulans (14 differences of 76 positions) . The 5S ribosomal RNA sequence is 120 nucleotides long and again typical of other prokaryotic 5S RNAs . The invariable GAAC sequence is found starting at position 45 . When aligned with other prokaryotic 5S RNA sequences, a surprising amount of nucleotide substitution is noted in the prokaryotic loop region of the R . rubrum 5S RNA . However, nucleotide complementarity is maintained reinforcing the hypothesis that this loop is an important aspect of prokaryotic 5S RNA secondary structure . The 5S and tRNAPhe are the first complete RNA sequences available from the photosynthetic bacteria. Science, 1981 Oct 23, 214(4519), 445 - 50 Complete nucleotide sequence and organization of the Moloney murine sarcoma virus genome; Reddy EP et al.; The complete nucleotide sequence of a mammalian transforming retrovirus . Moloney murine sarcoma virus, has been determined . MSV, recombinant virus derived of helper viral and cellular sequences, possesses termini resembling prokaryotic transposable elements . The viral genome has the coding capacity for the Moloney murine leukemia virus gag gene product and contains large deletions in pol and env genes . A large open reading frame encompassing its cell-derived sequences codes for its putative transforming protein . The nature of some of the important domains in the viral genome has been established, and their structure is discussed in relation to their function. Biochemistry, 1981 Oct 13, 20(21), 6092 - 6 Specificity of the bacteriophage PBS2 induced inhibitor of uracil-DNA glycosylase; Karran P et al.; The purified PBS2 phage-coded inhibitor of uracil-DNA glycosylase (Ura-DNA glycosylase) from Bacillus subtilis has been tested for its ability to inhibit this enzyme isolated from other prokaryotic and from eukaryotic sources . In addition, the inhibitor has been assayed for its effect on DNA glycosylases specific for other base residues in DNA . The data indicate that Ura-DNA glycosylases from a variety of sources are equally sensitive to inhibition by the inhibitor . DNA glycosylases specific for base residues in DNA other than uracil are not inhibited by the PBS2-coded inhibitor. Environ Health Perspect, 1981 Oct, 41, 189 - 93 Mutagenicity studies of vinyl chloride; Fabricant JD et al.; Mutagenicity studies in both man and in test organisms clearly demonstrate positive mutagenic activity of vinyl chloride . In terms of the mutagenicity studies using a variety of in vitro procedures covering both eukaryotes and prokaryotes, positive effects were found . Cytogenetic in vivo studies in animals and in humans indicate not only somatic mutations, but also germinal effects with this chemical. Gene, 1981 Oct, 15(1), 43 - 51 Nucleotide sequence of the promoter and NH2-terminal signal peptide region of the alpha-amylase gene from Bacillus amyloliquefaciens; Palva I et al.; We have isolated and partially sequenced the gene coding for alpha-amylase (EC 3.2.1.1) from Bacillus amyloliquefaciens by molecular cloning in the plasmid pUB110 using Bacillus subtilis as a host . The nucleotide sequence of the NH2-terminal region of the cloned gene was determined and found to contain a 31-residue-long stretch of amino acids preceding the NH2-terminal sequence of the extracellular alpha-amylase . Within this sequence there is a 15-residue-long stretch of uncharged amino acids similar to that found at the NH2 terminus of other precursors to exported proteins . This "signal sequence" is probably removed in conjunction with the translocation of alpha-amylase through the cytoplasmic membrane . In vitro labeling of alpha-amylase with radioactive amino acids in a coupled transcription-translation system followed by partial sequencing established the exact location of the NH2 terminus of the alpha-amylase gene . The nucleotide sequence preceding the NH2 terminus has properties resembling the RNA-polymerase- and ribosome-binding sites found at the 5' terminus of many prokaryotic genes. Biochemistry, 1981 Sep 29, 20(20), 5855 - 9 Chloroplast leucyl-tRNA synthetase from Euglena gracilis . Purification, kinetic analysis, and structural characterization; Imbault P et al.; Euglena gracilis chloroplast leucyl-tRNA synthetase was purified to homogeneity by a series of steps including ammonium sulfate precipitation and chromatography on hydroxylapatite, DEAE-cellulose, Sepharose 6B, phosphocellulose, and Blue Dextran-Sepharose . The purified enzyme exhibits a specific activity of 1233 units/mg of protein, which is one of the highest specific activities obtained for an aminoacyl-tRNA synthetase prepared from plant cells . The enzyme has an apparent Km value of 8 x 10(-6) M for L-leucine, 1.3 x 10(-4) M for ATP, and 1.3 x 10(-6) M for tRNALeu . Chloroplast leucyl-tRNA synthetase appears to be a monomeric enzyme with a molecular weight of 100 000 . The amino acid composition of chloroplast leucyl-tRNA synthetase has been determined . It is the first reported for a chloroplast aminoacyl-tRNA synthetase, and it reveals a relatively large proportion of apolar residues, as in the case of prokaryotic aminoacyl-tRNA synthetases. Proc Natl Acad Sci U S A, 1981 Sep, 78(9), 5685 - 9 Induction of gene mutation in and cell transformation of mammalian cells by modified purines: 2-aminopurine and 6-N-hydroxylaminopurine; Barrett JC; 2-Aminopurine, a classical mutagen in prokaryotic systems, is inactive as a carcinogen in two animal species . To determine the basis for this discrepancy in the correlation between carcinogenesis and mutagenesis, the ability of 2-aminopurine to induce somatic mutation and neoplastic transformation concomitantly in the same cellular system was examined . 6-N-hydroxylaminopurine, a related modified purine that is a mutagen and a carcinogen, was also studied . 2-Aminopurine was a mutagen in Syrian hamster embryo cells, but its activity was very weak . The maximum induced mutation frequency with either of two mutational markers was only 7 X 10(-6) mutants per surviving cell . 2-Aminopurine also induced morphological transformation of the cells under the same conditions, but the frequency was only approximately 0.04% per surviving colony . Neoplastic transformation of the cells after 2-aminopurine treatment was not observed in these experiments . These results indicate that 2-aminopurine is, at best, a weak transforming agent . The lack of carcinogenic activity in vivo with 2-aminopurine is consistent with these observations . In contrast to the results with 2-aminopurine, 6-N-hydroxylaminopurine was a very effective mutagen in these cells (up to 10(-3) mutants per survivor) and induced morphological transformation of the cells in a dose-dependent manner . Furthermore, neoplastic transformation was induced by this nucleic acid base analog . The correlation of mutagenic activity with transforming ability of these two modified purines supports a relationship between mutagenesis and carcinogenesis . However, relative to other carcinogens, there is a quantitative difference in the ability of 6-N-hydroxylaminopurine to induce cell transformation and mutation . For example, in benzo{a}pyrene-treated cultures, the ratio of the frequency of induced morphological transformation to that of somatic mutation was approximately 100, whereas for 6-N-hydroxylaminopurine-treated cultures, the ratio of transformation to mutation was only 3-12.5 . This indicates that 6-N-hydroxylaminopurine is less potent than benzo{a}pyrene in inducing transformation when compared at equal mutagenic potency . This is consistent with our hypothesis that cell transformation, and possibly cancer, occurs predominantly as the result of a mutation at the chromosome level rather than a gene mutation. Proc Natl Acad Sci U S A, 1981 Sep, 78(9), 5543 - 8 Construction of a general vector for efficient expression of mammalian proteins in bacteria: use of a synthetic ribosome binding site; Jay G et al.; With the premise that mRNAs transcribed in Escherichia coli from cloned eukaryotic DNA inserts do not possess the necessary regulatory signals for recognition by prokaryotic ribosomes, we have constructed a general plasmid vector carrying a chemically synthesized prokaryotic ribosome binding site that will ensure the efficient expression of eukaryotic proteins in E . coli . In addition to the regulatory signals necessary for ribosome recognition, the synthetic segment contains, at one end, a Pst I cleavage site which will direct its insertion to pBR322 DNA and, at the other end, a HindIII site to facilitate attachment of the passenger eukaryotic gene . Using simian virus 40 (SV40) tumor (t) antigen as a model system, we have ligated the SV40 DNA fragment containing the entire t antigen gene in tandem with the synthetic ribosome binding site to pBR322 DNA at the Pst I site, which lies within the coding sequence of the beta-lactamase gene . Initiation of transcription at the beta-lactamase promoter would produce a chimeric mRNA with the synthetic ribosome binding signals and the SV40 sequence flanked by beta-lactamase coding sequences . Utilization of the synthetic regulatory signals for initiation of translation is demonstrated by the efficient synthesis, in bacterial transformants, of authentic SV40 t antigen . Excision of the entire SV40 insert by HindIII from those clones that have retained intact HindIII sites at the junction between the ribosome binding site and the SV40 sequence would allow insertion of other heterologous DNAs by using HindIII linkers . The efficient expression of any DNA insert would require that the entire coding sequence be contiguous and that its termini be randomized by treatment with exonuclease III and nuclease S1 to vary the distance between the translational initiation codon and the synthetic ribosome binding site. Eur J Biochem, 1981 Sep, 119(1), 107 - 13 Antibodies to the F1-ATPase of Rhodospirillum rubrum and its purified native beta-subunit: inhibition of ATP-linked activities in R . rubrum and in lettuce; Philosoph S et al.; 1 . Antibodies prepared against the Rhodospirillum rubrum F1-ATPase (RrF1) and its purified, native-beta-subunit, exhibited cross-reactivity with the following soluble preparations of R . rubrum ATPase: RrF0 . F1, RrF1 and the beta-subunit . Anti-RrF1, but not anti-beta antibodies, also formed precipitin lines with soluble beta-less Rrf1, indicating that antigenic determinants of both the beta-subunit and the other four RrF1-subunits are expressed in the whole RrF1 molecule . Both antibodies agglutinated the R . rubrum chromatophores, suggesting that the beta-subunit is located on the external part of RrF1 . 2 . Both antibodies inhibited ATP synthesis and hydrolysis activities of R . rubrum chromatophores, as well as all the soluble ATPase reactions . Similar concentrations of each antibody were required for 50% inhibition of all these reactions, but anti-RrF1 was always somewhat more effective than anti-beta . These data indicate that the beta-subunit is involved in the catalytic site of the RrF1-enzyme . 3 . The antibodies prepared against R . rubrum F1-ATPase and its beta-subunit could bind the soluble chloroplast F1-ATPase (CF1) and inhibited ATP-linked reactions carried out by chloroplasts and by soluble CF1 . In these reactions, unlike in the R . rubrum ones, anti-beta was a more potent inhibitor than the anti-RrF1 antibody . The cross-reaction obtained between the antibodies raised against R . rubrum F1 and its beta-subunit and the chloroplast CF1 indicates the presence of similar antigenic determinants in the photosynthetic prokaryotic and eukaryotic F1-ATPases, which have been conserved during evolution. Ukr Biokhim Zh, 1981 Sep-Oct, 53(5), 64 - 8 {Vitamin U and RNA metabolism in prokaryotes}; Lebenka AIu et al.; The paper is concerned with a study of the vitamin U effect on the rate of 14C-uridine incorporation into various categories of RNA in E . coli MRE-600 cells . It is found that cells grown with vitamin U (0.06 mg/ml) and incubated with 14C-uridine for 5 min are able to produce a 10-12-fold increase of the label incorporation into 4 S and 5 S RNA and a 14-fold increase into high polymeric RNA in comparison with the control cells . Under longer intervals of incubation (20 min) the intensity of high-polymeric RNA formation was half as high as for 4 S and 5 S RNA formation . MAK column chromatography of high-polymeric RNA in salt and temperature gradients showed the presence of the RNA temperature fraction in bacteria cells . Vitamin U stimulates the formation of various categories of RNA and causes a quantitative increase in the RNA temperature fraction. Recomb DNA Tech Bull, 1981 Sep, 4(3), 98 - 107 Microbial parasitism cross-reactive with host antigen: implications concerning loss of "self" tolerance and development of autoimmune disease; Paterson PY; The implications of inserting eukaryotic genetic material coding for human "self" antigens into prokaryotic microbe vectors that parasitize humans are discussed against the background of contemporary concepts of immunologic tolerance to "self" constituents and the types of host autoreactive immune responses that might occur . The injurious potential of autoreactive immune responses elicited by infecting microbes which share antigenic constituents with host "self" antigens is carefully weighed . The risk of similar cross-reacting microbial vectors arising as a consequence of ongoing recombinant DNA technology and experimentation and posing public health concerns for humans is examined . On balance, the risk would appear to be extraordinarily low. Nucleic Acids Res, 1981 Aug 25, 9(16), 3959 - 78 Selective in vitro transcription by purified yeast RNA polymerase II on cloned 2 micron DNA; Ballario P et al.; The in vitro transcription properties of purified yeast RNA polymerase II have been analyzed on prokaryotic plasmids (pBR322 and pBR313) and chimaeric plasmids bearing yeast 2 micron sequences (BTYP 1, BTYH 2 and BTYH 3) . Conditions for selective transcription of the 2 micron DNA sequences in chimaeric plasmids have been determined . pBR322 and pBR313 are not transcribed by the purified RNA polymerase II when not bearing eukaryotic inserts . We show that the agarose gel electrophoretic analysis of ternary transcription complexes allows the localization of nascent RNA chains . The RNA produced has been visualized by electron microscopy (nascent RNA hybridization loops) and by gel electrophoretic analysis . All the observed properties are shared by RNA polymerase II purified by a conventional method (1) and by a rapid alternative procedure described herein . The peculiar properties of a partially purified form of RNA polymerase II are reported. J Biol Chem, 1981 Aug 25, 256(16), 8458 - 62 Nearest neighbor nucleotide patterns . Structural and biological implications; Nussinov R; Recently, nearest neighbor patterns were observed in prokaryotic and eukaryotic DNA sequences . These are discussed with respect to some of their biological implications . It is suggested that their origins relate to different specific structures of nearest neighbor base pairs . These patterns strongly constrain the DNA sequence . As such, they "explain" to some degree the amino acid codon choice and have direct bearing on questions related to evolution. Biochim Biophys Acta, 1981 Aug 17, 676(2), 199 - 204 Mössbauer spectroscopy of iron-containing dermal granules from Molpadia intermedia; Ofer S et al.; Dermal granules containing hydrous ferric oxide cores from Molpadia intermedia were studied by Mossbauer spectroscopy from 1.5 to 300 K and in magnetic fields up to 80 kOersted at 4.2 K . A magnetic phase transition to an antiferromagnetically ordered state is observed at 10 K . The results are compared with the magnetic behavior of micellar cores of ferritin from eukaryotes and iron-storage materials from prokaryotes. Nucleic Acids Res, 1981 Aug 11, 9(15), 3851 - 61 Determination of base pairing in yeast 5S and 5.8S RNA infrared spectroscopy; Stulz J et al.; Infrared Spectroscopy was used to determine the numbers of base pairs for yeast 5S RNA and 5.8S RNA . The spectra were recorded at 20 degrees C and 50 degrees C, where tertiary interactions are assumed to be of less importance . It may be concluded that the structure of both RNAs is highly ordered and that there are large contributions of tertiary interactions . The results are compared with data derived from structural models that were proposed in the literature as well as with data previously published for prokaryotic 5S RNAs. Nucleic Acids Res, 1981 Aug 11, 9(15), 3835 - 50 Usage of the three termination codons in a single eukaryotic cell, the Xenopus laevis oocyte; Bienz M et al.; Oocytes from Xenopus laevis were injected with purified amber (UAG), ochre (UAA), and opal (UGA) suppressor tRNAs from yeasts . The radioactively labeled proteins translated from the endogenous mRNAs were then separated on two-dimensional gels . All three termination codons are used in a single cell, the Xenopus laevis oocyte . But a surprisingly low number of readthrough polypeptides were observed from the 600 mRNAs studied in comparison to uninjected oocytes . The experimental data are compared with the conclusions obtained from the compilation of all available termination sequences on eukaryotic and prokaryotic mRNAs . This comparison indicates that the apparent resistance of natural termination codons against readthrough, as observed by the microinjection experiments, cannot be explained by tandem or very close second stop codons . Instead it suggests that specific context sequences around the termination codons may play a role in the efficiency of translation termination. Can J Microbiol, 1981 Aug, 27(8), 808 - 14 2-phosphoglycerate phosphatase and serine biosynthesis in Veillonella alcalescens; Pestka JJ et al.; The constituent enzymes for the phosphorylated and nonphosphorylated serine biosynthetic pathways in Veillonella alcalescens were identified and included phosphoserine phosphatase, 3-phosphoglycerate dehydrogenase, glycerate dehydrogenase, phosphoserine aminotransferase, and serine-pyruvate aminotransferase . Cell extracts of the organism were also found to cause the specific dephosphorylation of 2-phosphoglycerate . The phosphatase was purified 39-fold by manganese chloride precipitation, ammonium sulfate precipitation, and DEAE-cellulose chromatography . Sephadex G-200 gel filtration data established an apparent molecular weight of 50000 for the enzyme . The 2-phosphoglycerate phosphatase had a pH optimum of 5.5 and was distinct from phosphoglyceromutase . Assays conducted with the purified enzyme on a number of other phosphorylated intermediates indicated that the phosphatase was most specific for 2-phosphoglycerate . Glucerate, hydroxypyruvate, and serine inhibited the enzyme, whereas succinate stimulated activity . Veillonella 2-phosphoglycerate phosphatase is the first such enzyme to be described in a prokaryote and is probably involved in glycerate generation for the nonphosphorylated serine biosynthetic pathway. J Biol Chem, 1981 Jul 25, 256(14), 7515 - 7 The nucleotide sequence of spinach cytoplasmic 5 S ribosomal RNA; Delihas N et al.; The nucleotide sequence of the cytoplasmic 5 S ribosomal RNA from Spinacia oleracea has been determined . A secondary structural model possessing four base-paired regions can be constructed from the primary structure . This RNA shows 90 to 93% nucleotide sequence homology with other higher plant cytoplasmic 5 S RNAs and 73% homology with that of the lower eukaryote Chlorella . The spinach 5 S RNA has the nucleotide sequence identical with that of Chlorella in two important single-stranded regions, the sequence C10 AUACC and the dodecanucleotide sequence at positions 33 to 44 . A nucleotide sequence similar or identical with C10 AUACC is found in most other eukaryotic 5 S RNAs, including the 5 S RNA from human KB cells . In addition, a single-stranded loop of 12 residues corresponding to positions 33 to 44 in the spinach 5 S RNA sequence may be a general feature of eukaryotic cytoplasmic 5 S RNAs, while prokaryotic 5 S RNAs have a 13-member loop for the corresponding residues . Several other important homologies in primary and secondary structure have also been observed in comparing spinach 5 S RNA to other 5 S RNAs. Biochemistry, 1981 Jul 7, 20(14), 4022 - 9 Primary sequence of wheat mitochondrial 5S ribosomal ribonucleic acid: functional and evolutionary implications; Spencer DF et al.; Using the procedures of Donis-Keller et al . {Donis-Keller, H., Maxam, A . M., & Gilbert, W . (1977) Nucleic Acids Res . 4, 2527--2538 (1977)} and Peattie {Peattie, D . A . (1979) Proc . Natl . Acad . Sci . U.S.A . 76, 1760--1764}, we have determined the nucleotide sequence of wheat mitochondrial 5S ribosomal ribonucleic acid (rRNA) . This sequence {Formula: see text} is the first to be reported for a plant mitochondrial RNA . A highly conserved region (underlined) readily identifies the molecule as a structural homologue of other 5S rRNAs, as do potential base-paired regions which are characteristic of all known (prokaryotic, chloroplast, eukaryotic cytosol) 5S rRNA sequences . However, when assessed in terms of those structural features which distinguish prokaryotic from eukaryotic 5S rRNAs, wheat mitochondrial 5S rRNA cannot be classified readily as one or the other but instead displays characteristics of both types . In addition, the mitochondrial 5S rRNA has several unusual features, including (i) a variable number (two to three) of A residues at both the 5' and 3' ends, (ii) a unique sequence (CGACC, italic) in place of the prokaryotic sequence (CGAAC) which has been postulated to interact with aminoacyl-tRNA during translation, and (iii) a novel sequence, AUAUAUAU, immediately following the highly conserved sequence . In terms of overall primary sequence, wheat mitochondrial and cytosol 5S rRNAs seem to be slightly more divergent from each other than either is from Escherichia coli 5S rRNA, with which they are about equally homologous . From these observations, we propose that wheat mitochondrial 5S rRNA represents a distinct class of 5S rRNA . Our observations raise a number of questions about the evolutionary origin and functional role(s) of plant mitochondrial 5S rRNA. Proc Natl Acad Sci U S A, 1981 Jul, 78(7), 4461 - 5 Deletion mapping a eukaryotic promoter; Struhl K; The phenotypes of 24 mutants that successively delete DNA sequences adjacent to the 5' end of the Saccharomyces cerevisiae (yeast) his3 structural gene are described . Deletions retaining greater than 155 base pairs before the mRNA coding sequences are phenotypically indistinguishable from the wild-type his3 allele . Deletions having end points between 113 and 65 base pairs before the transcription initiation site express his3 at reduced levels . Mutations retaining less than 45 base pairs are indistinguishable from null alleles of the his3 locus . These results indicate (i) that a sequence(s) located 113--155 base pairs upstream from the transcribed region is necessary for wild-type expression and (ii) that the T-A-T-A box (a sequence in front of most eukaryotic genes) is not sufficient for wild-type promoter function . Thus, the yeast his3 promoter region appears large when compared with prokaryotic promoters, suggesting that it may be more complex than a simple site of interaction between RNA polymerase and DNA. Mol Biol (Mosk), 1981 Jul-Aug, 15(4), 725 - 52 {Recognition of messenger RNAs upon initiation of translation in prokaryotes}; Gren EIa; Structural aspects of ribosomal recognition of initiation sites on messenger RNA in procaryotes are considered . Location of initiation sites on mRNA, their length, typical nucleotide sequences that build up the initiation signal, and also the influence of the macrostructure of mRNA on protein synthesis are discussed . Determined nucleotide sequences of mRNA and DNA flanking the origin of different phage and bacterial genes are given. Nucleic Acids Res, 1981 Jun 25, 9(12), 2801 - 5 The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach; Delihas N et al.; Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with {32P} and the complete nucleotide sequence was determined . The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH . This sequence can be fitted to the secondary structural model proposed for prokaryotic 5S ribosomal RNAs by Fox and Woese (1) . However, the lengths of several single- and double-stranded regions differ from those common to prokaryotes . The spinach chloroplast 5S ribosomal RNA is homologous to the 5S ribosomal RNA of Lemna chloroplasts with the exception that the spinach RNA is longer by one nucleotide at the 3' end and has a purine base substitution at position 119 . The sequence of spinach chloroplast 5S RNA is identical to the chloroplast 5S ribosomal RNA gene of tobacco . Thus the structures of the chloroplast 5S ribosomal RNAs from some of the higher plants appear to be almost totally conserved . This does not appear to be the case for the higher plant cytoplasmic 5S ribosomal RNAs. Nucleic Acids Res, 1981 Jun 25, 9(12), 2913 - 32 Sequence homologies between eukaryotic 5.8S rRNA and the 5' end of prokaryotic 23S rRNa: evidences for a common evolutionary origin; Jacq B; The question of the evolutionary origin of eukaryotic 5.8S rRNA was re-examined after the recent publication of the E . coli 23S rRNA sequence (26,40) . A region of the 23S RNA located at its 5' end was found to be approximately 50% homologous to four different eukaryotic 5.8S rRNAs . A computer comparison analysis indicates that no other region of the E . coli ribosomal transcription unit (greater than 5 000 nucleotides in length) shares a comparable homology with 5.8S rRNA . Homology between the 5' end of e . coli 23S and four different eukaryotic 5.8S rRNAs falls within the same range as that between E . coli 5S RNA from the same four eukaryotic species . All these data strongly suggest that the 5' end of prokaryotic 23S rRNA and eukaryotic 5.8S RNA have a common evolutionary origin . Secondary structure models are proposed for the 5' region of E . coli 23S RNA. Nucleic Acids Res, 1981 Jun 11, 9(11), 2543 - 7 Nucleotide sequence of a spinach chloroplast valine tRNA; Sprouse HM et al.; The nucleotide sequence of a spinach chloroplast valine tRNA (sp . chl . tRNA Val) has been determined . This tRNA shows essentially equal homology to prokaryotic valine tRNAs (58-65% homology) and to the mitochondrial valine tRNAs of lower eukaryotes (yeast and N . crassa, 61-62% homology) . Sp . chl . tRNA Val shows distinctly lower homology to mouse mitochondrial valine tRNA (53% homology) and to eukaryotic cytoplasmic valine tRNAs (47-53% homology) . Sp . chl . tRNA Val, like all other chloroplast tRNAs sequenced, contains a methylated GG sequence in the dihydrouridine loop and lacks unusual structural features which have been found in several mitochondrial tRNAs. Mutat Res, 1981 Jun, 89(2), 95 - 136 DNA-cell-binding (DCB) assay for suspected carcinogens and mutagens; Kubinski H et al.; This report describes a novel technique for screening potential carcinogens and mutagens . The DNA-cell-binding (DCB) assay is based on earlier observations which indicated that DNA and other nucleic acids exposed to active carcinogens strongly react with other macromolecules, producing nucleic acid--nucleic acid and nucleic acid--protein adducts . The latter group of adducts included complexes with proteins present in both prokaryotic and eukaryotic cell membranes . Increased attachment of DNA to the intact bacterial and animal cells was seen in the presence of active carcinogens or carcinogens activated by extracts from mouse and rat livers . We have conducted a survey of almost 280 chemicals including 130 with known carcinogenic potential (i.e., either known carcinogens or known non-carcinogens) . The DCB test and animal assays agreed in abut 96% of cases . Thus, as a predictor of potential carcinogenicity, this assay compares favorably with other rapid methods currently in use . In this respect, the DCB assay is also superior to other techniques which measure the formation of macromolecular complexes, such as velocity centrifugation through sucrose gradients, gel electrophoresis, filtration through nitrocellulose filters, chromatography on methyl-esterified albumin, equilibrium density gradient centrifugation, etc . In the few cases for which the data were available, combining the results of DCB assays with the results of experiments in which the induction of DNA--protein adducts in living human cells in tissue culture has been measured by cold phenol extraction, the predictability was increased to 100% . We suggest that DCB assay should be used either alone or in combination with other rapid methods of carcinogen detection for screening industrial, environmental and other chemicals and chemical mixtures for their carcinogenic potential . Ways of further improving and simplifying the DCB tests are considered. Pediatr Res, 1981 Jun, 15(6), 956 - 8 Photodynamic reaction of riboflavin and deoxyguanosine; Ennever JF et al.; Previous studies have demonstrated that phototherapy depresses serum riboflavin in jaundiced infants . The potential long-term hazards of this in vivo reaction may be significant in view of the in vitro reaction of riboflavin which modifies intracellular DNA in eukaryotic and prokaryotic cells . Previous investigations have suggested that the DNA-modifying activity of riboflavin results from the generation of singlet oxygen and photooxidation of the guanine moieties of the DNA . In the present study, we demonstrate that singlet oxygen is not involved in the photodynamic reaction of riboflavin and deoxyguanosine. Pediatr Res, 1981 Jun, 15(6), 952 - 5 Induction of gentamicin resistance by visible light; Harris MC et al.; Recent studies have demonstrated the ability of visible light or phototherapy to modify the intracellular DNA of prokaryotic and eukaryotic cells . The present study was undertaken to determine the effect of light used in phototherapy on antibiotic resistance in prokaryotic cells using tester strains of gentamicin-sensitive Escherichia coli and Staphylococcus aureus . A growing population of the tester microorganisms was inoculated on plates containing nutrient medium and gentamicin . Experiments were performed to determine the effect of blue light on the induction of gentamicin-resistant mutants . The plates were divided into two populations, one of which was illuminated, while the other was kept in the dark to serve as a control . During photoirradiation, the plates were protected from direct sunlight and air coded to maintain a temperature of 27 degrees C . The sample distance from the light source was adjusted to maintain a fluence rate (450 nm) of 141 uW/cm2 . Control experiments were performed to investigate the effect of photoirradiation on the media and gentamicin . An increased frequency of mutation to gentamicin resistance was seen in the irradiated population of bacteria . The mutagenic effect was observed over a wide range of gentamicin concentrations and correlated in a linear fashion with increasing duration of photoirradiation . There was an inverse correlation between the size of the bacterial inoculum and the recovery of mutant bacteria. Biosci Rep, 1981 Jun, 1(6), 497 - 507 Malate dehydrogenase: isolation from E . coli and comparison with the eukaryotic mitochondrial and cytoplasmic forms; Fernley RT et al.; Escherichia coli malate dehydrogenase has been isolated in homogeneous form by a procedure employing chromatography on DEAE-cellulose, 5-'AMP-Sepharose, and Sephacryl-200 . It is composed of two identical polypeptide chains each of Mr = 32 500 . Like porcine mitochondrial malate dehydrogenase, it is devoid of tryptophan, but otherwise it is not particularly more similar in composition to one of the eukaryotic isozymes than to the other . However, amino-terminal sequence analysis of the first 36 residues shows remarkable similarity of the bacterial and mitochondrial enzymes (69% identical residues) in contrast to the cytoplasmic form (27%) . The two porcine heart enzymes are identical in 24% of the positions compared . These results clearly establish that all three forms of malate dehydrogenase have evolved from a common precursor and that the prokaryotic and mitochondrial forms have retained sequences that are much closer to the ancestral one than the cytoplasmic enzyme . These findings appear to further substantiate the endosymbiotic hypothesis for the origin of the mitochondrion. Cell Biol Int Rep, 1981 Jun, 5(6), 539 - 49 The central dogma of cell biology; Cooper S; The Continuum Model proposes that preparations for DNA synthesis occur continuously during all phases of the division cycle . Various stimuli activate cell proliferation by changing the rate of initiator (protein) synthesis . Cell division does not initiate any process regulating cell proliferation . Cell division is the end of a process and the beginning of nothing . The alternative model which has cell proliferation regulated in the G1 phase of the division cycle is reexamined and the two types of evidence for this model, G1-variability and G1-arrest are shown to be compatible with the Continuum Model . Here, the Continuum Model is generalized to produce a new look at the logic of the division cycle in prokaryotes and eukaryotes . This new view, the Central Dogma of Cell Biology, is presented and two predictions are made . I propose that (i) cell division does not have any regulatory function, and (ii) that DNA synthesis may, indeed, have some affect on the synthesis of initiator. Gene, 1981 Jun-Jul, 14(1-2), 91 - 101 Sequence organization of the origins of DNA replication in lambdoid coliphages; Moore DD et al.; We have determined the sequences of the ori region DNA of several phage lambda mutants and hybrids, which shed light on the mechanism of DNA replication in the lambdoid phages . These include the heterologous substitution hybrids lambda rep82:lambda and lambda rep80:lambda, a pseudorevertant of the ori-r93 mutant lambda r93hot5, and the insertion mutant lambda pk35 . The ori regions of the three lambdoid phages, lambda, phi 80 and 82, all have repeated sequences, termed iterons, and A . T-rich zones . We note that a similar arrangement of DNA is also found in several other prokaryotic origins of replication . lambda and phi 80 have four iterons, and 82 has five . The origin of lambda r93hot5 is unusual in that contains only three iterons, yet the phage grows normally . Analysis of this mutant indicates that the spacing of iterons is crucial to ori function, whereas their number is not . This argues against the cloverleaf model for lambda ori structure (Hobom et al., 1979) . In lambda pk35 the drug resistance element Tn903 is inserted into the "inceptor" (ice) site, proposed to be crucial for lambda replication initiation (Hobom et al., 1979); yet this phage grows normally. Eur J Biochem, 1981 May 15, 116(2), 419 - 22 On the hydrophobic nature of signal sequences; von Heijne G; A number of signal sequences, prokaryotic as well as eukaryotic, have been analyzed in terms of gross amino acid composition and hydrophobicity . It is shown that the amino acid composition of the hydrophobic core can be well reproduced in a computer simulation of signal sequence 'evolution' with selection operating on the mean hydrophobicity of the sequence and the non-occurrence of charged residues . The calculated hydrophobicities are interpreted in terms of a model in which the hydrophobic part of the signal sequence partitions directly into the membrane interior, thereby making further translocation of the growing nascent chain possible. Biosci Rep, 1981 May, 1(5), 387 - 98 Preferential utilization of bromodeoxyuridine and iododeoxyuridine triphosphates by DNA polymerase gamma in vitro; Schwartz SA; Thymidine triphosphate (TTP) and its halogenated analog bromodeoxyuridine triphosphate (BrdUTP) were compared in vitro as substrates for several prokaryotic and eukaryotic DNA polymerases to determine a possible enzymatic preference which might account for the reported finding of nonrandom patterns of incorporation of the analog in eukaryotic cellular DNA as well as help clarify the mechanism for drug-induced activation of latent retroviruses from animal cells . Following nucleotide competition reactions, no discriminatory utilization was detected from a mixture containing equimolar {3H}TTP and {alpha 32P}TTP for any of the polymerases . In contrast, when {3H}BrdUTP was mixed with an equal concentration of {alpha 32P}TTP, it was apparent that eukaryotic DNA polymerase gamma utilized more of the brominated analog triphosphate in preference to the unsubstituted compound . This increased affinity was confirmed by the differences in Km values . Furthermore, the selectivity of polymerase gamma was even more pronounced with the iodinated thymidine analog iododeoxyuridine triphosphate . On the other hand, polymerase gamma failed to discriminate as readily between equal concentrations of alpha 32P-labeled deoxycytidine triphosphate and 125I-labeled iododeoxycytidine triphosphate. J Antibiot (Tokyo), 1981 May, 34(5), 583 - 9 Cystathionine gamma-lyase activity in the cephamycin C producer Streptomyces lactamdurans; Kern BA et al.; Extracts of the cephamycin C producer S . lactamdurans were found to possess cystathionine gamma-lyase activity (E.C . 4.4.1.1) . This represents the first demonstration of this enzyme of the reverse transsulfuration pathway in a prokaryotic organism . A likely involvement of reverse transsulfuration in antibiotic synthesis is indicated by the fact that propargylglycine, a mechanism-based inhibitor of the gamma-lyase, is a strong inhibitor of cephamycin C production. J Antibiot (Tokyo), 1981 May, 34(5), 489 - 95 Ansamitocin analogs from a mutant strain of Nocardia . I . Isolation of the mutant, fermentation and antimicrobial properties; Tanida S et al.; A mutant having a high ability to produce ansamitocins was derived from a dnacin-producing strain, Nocardia sp . No . C-14482 (N-1001), by treatment with ethidium bromide . Mutant N-1231 produced ansamitocins P-3 and P-4 as major components, but was deficient in its ability to produce dnacins . Strain N-1231 also produced fifteen novel ansamitocin analogs as minor components . These analogs showed no activity against prokaryotic micro-organisms . The results of determining the activity inhibiting cilia regeneration of deciliated Tetrahymena pyriformis suggest that hydroxylation of C15, C26 and the acyl moiety at C3 of ansamitocins may cause marked reduction of their antitubulinic activities whereas demethylation of -NCH3 at C18 slightly affected their activities. Mol Biol (Mosk), 1981 May-Jun, 15(3), 485 - 516 {Mechanisms of translation termination}; Ter-Avanesian MD et al.; The review considers the results of both genetical and biochemical studies of translation termination in pro- and eukaryotes . The available information on the components of the protein synthesis machinery, participating in the termination process is summarized . Special attention is paid to the problem of nonsense codon recognition . The possibility of modulation of the process of termination in vivo and in vitro is discussed . All the data considered allow us to propose the hypothesis about the role of the small ribosomal subunit RNA (SrRNA) in translation of natural messengers . Deficiency of AGG and related codone in prokaryotes suggests the possibility of scanning of mRNA's in the coding frame by the 3'-terminus of SrRNA . The context of natural terminators in mRNA's in pro-and eukaryotes reveals that the sequences between 6th and 20th positions both up- and down stream from the nonsense codons are complementary to the 3'-end of SrRNA . Interaction between 3'-terminus of SrRNA and the sequences under consideration is postulated to be important for high efficiency termination of translation. Proc Natl Acad Sci U S A, 1981 May, 78(5), 2722 - 6 Specific binding of a prokaryotic ribosomal protein to a eukaryotic ribosomal RNA: implications for evolution and autoregulation; Gourse RL et al.; Ribosomal protein L1 from the prokaryote Escherichia coli has been shown to form a specific complex with 26S ribosomal RNA from the eukaryote Dictyostelium discoideum . The segment of Dictyostelium rRNA protected from ribonuclease digestion by L1 and the corresponding region in Dictyostelium rDNA were investigated by nucleotide sequence analysis, and an analogous section in rDNA from Xenopus laevis was identified . When the L1-specific segments from eukaryotic rRNA were compared with those from prokaryotic rRNA, striking similarities in both primary and secondary structure were apparent . These conserved features suggest a common structural basis for protein recognition and indicate that such regions became fixed at a very early stage in rRNA evolution . In addition, certain structural elements of the L1 binding sites in rRNA are also found in the initial segment of the polycistronic L11-L1 mRNA, providing support for the hypothesis that L1 participates in the regulation of ribosomal protein synthesis by specific interaction with its own mRNA. Nucleic Acids Res, 1981 Apr 24, 9(8), 1963 - 71 Periodicity in DNA primary structure is defined by secondary structure of the coded protein; Zhurkin VB; A 10.5-base periodicity found earlier is inherent in both eu- and prokaryotic coding nucleotide sequences . In the case of noncoding eukaryotic sequences no periodicity is found, so the 10.5-base oscillation seemingly does not correlate with the nucleosomal organization of DNA . It is shown that the DNA fragments, coding the alpha-helical protein segments, manifest the pronounced 10.5-base periodicity, while those regions of DNA which code the beta-structure have a 6-base oscillation . The repeating pattern of nucleotide sequences can be used for comparison of the DNA segments with low degree of homology. Nucleic Acids Res, 1981 Apr 24, 9(8), 1885 - 904 A unique secondary folding pattern for 5S RNA corresponds to the lowest energy homologous secondary structure in 17 different prokaryotes; Studnicka GM et al.; A general secondary structure is proposed for the 5S RNA of prokaryotic ribosomes, based on helical energy filtering calculations . We have considered all secondary structures that are common to 17 different prokaryotic 5S RNAs and for each 5S sequence calculated the (global) minimum energy secondary structure (300,000 common structures are possible for each sequence) . The 17 different minimum energy secondary structures all correspond, with minor differences, to a single, secondary structure model . This is strong evidence that this general 5S folding pattern corresponds to the secondary structure of the functional 5S rRNA . The general 5S secondary structure is forked and in analogy with the cloverleaf of tRNA is named the "wishbone" model . It constant 8 double helical regions; one in the stem, four in the first, or constant arm, and three in the second arm . Four of these double helical regions are present in a model earlier proposed (1) and four additional regions not proposed by them are presented here . In the minimum energy general structure, the four helices in the constant arm are exactly 15 nucleotide pairs long . These helices are stacked in the sequences from gram-positive bacteria and probably stacked in gram-negative sequences as well . In sequences from gram-positive bacteria the length of the constant arm is maintained at 15 stacked pairs by an unusual minimum energy interaction involving a C26-G57 base pair intercalated between two adjacent helical regions. Proc Natl Acad Sci U S A, 1981 Apr, 78(4), 2447 - 51 Mutator phenotypes in mammalian cell mutants with distinct biochemical defects and abnormal deoxyribonucleoside triphosphate pools; Weinberg G et al.; Recent studies of in vitro DNA synthesis have shown that fidelity of replication is influenced by the relative concentrations of deoxyribonucleoside triphosphates (dNTPs) . Several investigators have used reconstituted prokaryotic replication systems to copy defined natural templates and have shown that specific incorporation errors can be induced by an appropriate bias of the precursor pools . The recent demonstration of mutator phenotypes among mutant Chinese hamster ovary cell lines with altered intracellular dNTP pools has allowed extension of the in vitro observations to eukaryotic replication and repair mechanisms . We describe here three mutant murine T-lymphosarcoma cell lines with altered dNTP pools and increased rates of spontaneous mutation to dexamethasone resistance and 6-thioguanine resistance . Unlike previously described mammalian cells with mutator phenotypes, these three lines have demonstrable defects in known structural gene products . Two of these cell lines are heterozygous for mutations affecting the M1 subunit of ribonucleoside diphosphate reductase; the other mutant is deficient in deoxycytidylate deaminase . In each cell line these mutations result in deranged endogenous dNTP pools and increased rates of spontaneous mutation, which are shown to be characteristic of the cell line and independent of the two genetic markers examined . Furthermore, normalization of the dNTP pools of the deaminase-deficient cells suppresses its mutator phenotype . Thus, abnormal dNTP pools seem to cause enhanced mutagenesis in mammalian cells. Nucleic Acids Res, 1981 Mar 25, 9(6), 1383 - 93 Specific interaction of histone H1 with eukaryotic DNA; Diez-Caballero T et al.; The interaction of calf thymus histone H1 with homologous and heterologous DNA has been studied at different ionic strengths . It has been found that about 0.5 M NaCl histone H1, and its fragments N-H1 (residues 1-72) and C-H1 (residues 73-C terminal), precipitate selectively a small fraction of calf thymus DNA . This selective precipitation is preserved up to very high values (less than 2.0) of the input histone H1/DNA ratio . The percentage of DNA insolubilized by histone H1 under these ionic conditions is dependent upon the molecular weight of the nucleic acid, diminishing from 18% fro a Mw equals 1.0 x 10(7) daltons to 5% for a Mw equals 8.0 x 10(4) daltons . The base composition of the precipitated DNA is similar to that of the bulk DNA . Calf thymus histone H1 also selectively precipitates a fraction of DNA from other eukaryotes (herring, trout), but not from some prokaryotes (E . coli, phage gamma . On the other hand, at 0.5 M NaCl, the whole calf thymus DNA (but not E . coli DNA) presents a limited number of binding sites for histone H1, the saturation ratio histone H1 bound/total DNA being similar to that found in chromatin . A similar behavior is observed from the histone H1 fragments, N-H1 and C-H1, which bind to DNA in complementary saturation ratios . It is suggested that in eukaryotic organisms histone H1 molecules maintain specific interactions with certain DNA sequences . A fraction of such specific complexes could act as nucleation points for the high-order levels of chromatin organization. Proc Natl Acad Sci U S A, 1981 Mar, 78(3), 1596 - 600 Method to determine the reading frame of a protein from the purine/pyrimidine genome sequence and its possible evolutionary justification; Shepherd JC; The periodic variations obtained by correlating the relative positions of purines and pyrimidines (and of the four bases thymine, cytosine, adenine, and guanine) in a wide variety of genomes of wholly or partly known sequence suggest that there may be enough of an earlier comma-free coding system (i.e., only readable in one frame) still present to permit determination of the reading frame and approximate extent of the present protein coding stretches . The characteristics of these variations support the hypothesis that these primitive messages were formed of coding triplets having the form RNY (R = purine; Y = pyrimidine; and N = purine or pyrimidine) . The base sequences and reading frames that have a minimal deviation from such a message are still good predictors of actual coding regions and reading frames in spite of the many mutations that have occurred since such a genetic code was last in use . In fact, the right frame for almost all the proteins in a number of viruses and various prokaryotes and eukaryotes is deduced purely from purine/pyrimidine information and not by using the normal start and stop signals. Proc Natl Acad Sci U S A, 1981 Mar, 78(3), 1527 - 31 Transformation of mouse fibroblasts to methotrexate resistance by a recombinant plasmid expressing a prokaryotic dihydrofolate reductase; O'Hare K et al.; A recombinant plasmid has been constructed for the expression of inserted DNA sequences coding for polypeptide chains using the simian virus 40 early promoter and splicing and polyadenylylation signals from the rabbit beta-globin gene . The coding regions for two prokaryotic methotrexate-resistant dihydrofolate reductases were introduced into the expression vector . When mouse fibroblasts were exposed to these recombinant plasmids, it was possible to select methotrexate-resistant clones that had integrated the plasmids and produced a chimeric RNA coding for the prokaryotic enzyme. Hoppe Seylers Z Physiol Chem, 1981 Mar, 362(3), 353 - 6 {Biochemical evidence for integration of prokaryotic DNA into mammalian cells (author's transl)}; Weckler C et al.; Experiments were undertaken to test for the stable integration of defined prokaryotic genes in mammalian cells . Thus lambda dvgal 88 plasmid DNA were transferred together with the herpes simplex virus type 1 thymidine kinase (TK) gene as a selectable marker to TK- mouse cells . DNA restriction and hybridization analysis of TK+ mouse cell clone DNA revealed (i) the presence of prokaryotic lambda dvgal 88 sequences in the mouse DNA; (ii) the stable integration of the prokaryotic DNA in mouse cell DNA under selective conditions; and (iii) the presence of lambda dvgal fragments in several copies per cell and their integration at different loci within the cell DNA. Z Naturforsch {C}, 1981 Mar-Apr, 36(3-4), 246 - 54 Molecular characterization of glutamine synthetase from the nitrogen-fixing phototrophic bacterium Rhodopseudomonas palustris; Alef K et al.; The phototrophic bacterium Rhodopseudomonas palustris assimilated ammonium via glutamine synthetase and glutamate synthase . Diazotrophic and ammonium-grown cells had high levels of both enzymes, whereas enzymes of alternative assimilatory pathways were absent or had only low activities . Glutamine synthetase was purified to electrophoretic homogeneity within three steps by dye-ligand and ion exchange chromatography . Electron microscopy revealed a dodecameric molecular entity which was in accordance with parameters derived from electrophoretic techniques . The molecular weight of the enzyme monomer was 558000; that of the dodecamer 670000 . The amino acid composition of R . palustris glutamine synthetase was determined and compared by a statistical method with other known enzyme compositions from prokaryotic and eukaryotic origins. Nucleic Acids Res, 1981 Feb 25, 9(4), 983 - 91 UGA suppression by normal tRNA Trp in Escherichia coli: codon context effects; Engelberg-Kulka H; The nucleotide sequences at the 3' side of in-phase UGA termination codons in mRNAs of various prokaryotic genes were re-examined . An adenine (A) residue is found to be adjacent to the 3' side of UGA in mRNAs which code for readthrough proteins by the suppression of UGA by normal Escherichia coli tRNA Trp . It is suggested that the nature of the nucleotide following a UGA codon determines whether the UGA signals inefficiently or efficiently the termination of polypeptide chain synthesis: an A residue at this position permits the UGA readthrough process. J Biol Chem, 1981 Feb 25, 256(4), 1539 - 43 The evolution of multi-isoacceptor tRNA families . Sequence of tRNA Leu CAA and tRNA Leu CAG from Anacystis nidulans; LaRue B et al.; Two leucine tRNAs from the cyanophyte Anacystis nidulans have been isolated, and their complete nucleotide sequences have been determined by combining data from oligonucleotide fingerprints and sequencing gels . The two sequences are 87 nucleotides long, have the anticodons CAA and CAG, and differ from each other at a total of 28 positions . They have been compared to other known tRNA Leu sequences and incorporated into a phylogenetic tree comprising prokaryotic and chloroplastic tRNA Leu sequences . Mutations inferred from the tree show that some parts of the tRNA molecule are highly variable (the extra arm and the acceptor stem) while others are much more conserved (the D and T arms) . The topology of the tree supports the idea that blue-green algae and chloroplasts share a common prokaryotic ancestor and show a basic divergence between XAA and XAG anticodon-containing tRNAs, suggesting that these two subfamilies result from an ancient gene duplication . Finally, comparison of this phylogenetic tree with those of other multi-isoacceptor tRNA families shows no common scheme, which may be due to independent refinement of codon-reading patterns in different tRNA families. Nucleic Acids Res, 1981 Feb 11, 9(3), 697 - 710 Characterization of a R plasmid-associated, trimethoprim-resistant dihydrofolate reductase and determination of the nucleotide sequence of the reductase gene; Zolg JW et al.; The trimethoprim-resistant dihydrofolate reductase associated with the R plasmid R388 was isolated from strains that over-produce the enzyme . It was purified to apparent homogeneity by affinity chromatography and two consecutive gel filtration steps under native and denaturing conditions . The purified enzyme is composed of four identical subunits with molecular weights of 8300 . A 1100 bp long DNA segment which confers resistance to trimethoprim was sequenced . The structural gene was identified on the plasmid DNA by comparing the amino acid composition of the deduced proteins with that of the purified enzyme . The gene is 234 bp long and codes for 78 amino acids . No homology can be found between the deduced amino acid sequence of the R388 dihydrofolate reductase and those of other prokaryotic or eukaryotic dihydrofolate reductases . However, it differs in only 17 positions from the enzyme associated with the trimethoprim-resistance plasmid R67. J Biol Chem, 1981 Feb 10, 256(3), 1115 - 21 The terminal redundancy of the retrovirus genome facilitates chain elongation by reverse transcriptase; Swanstrom R et al.; Transcription of DNA from the RNA genome of retroviruses by reverse transcriptase involves an unusual translocation of the growing chain from the 5' end to the 3' end of the RNA template . In order to elucidate the mechanism by which this translocation occurs, we have used chain termination to analyze nascent viral DNA synthesized in vitro by avian sarcoma virus, and we have determined the nucleotide sequence of appropriate regions of viral DNA isolated from infected cells and cloned into prokaryotic vectors . Our results provide direct experimental evidence for a previously proposed model in which a short terminal redundancy in viral RNA, and a DNA copy of the redundant sequence, are used to allow the growing DNA chain to move from the 5' to the 3' end of the template . Transcription of avian sarcoma virus RNA with purified reverse transcriptase also generates an anomalous product, a hairpin DNA that arises when the initial DNA transcript folds back on itself to continue synthesis . The foldback is mediated by an inverted repeat of 5 nucleotides in the sequence of nascent DNA . Anomalous hairpin DNA is not produced by detergent-activated virions . Thus, constituents of the virions or the configuration of encapsidated viral RNA must facilitate correct transcription. Mutat Res, 1981 Feb, 88(2), 125 - 33 Bisulfite (sulfur dioxide) is a comutagen in E . coli and in Chinese hamster cells; Mallon RG et al.; The mutagenic and comutagenic effects of bisulfite were investigated . Under moderate exposure conditions (high survival) it was found that bisulfite is not mutagenic to either eukaryotic cells (Chinese hamster V79), or prokaryotic cells (Escherichia coli) . However, bisulfite does act as a comutagen with UV irradiation . Bisulfite approximately doubles the mutation frequency in UV-irradiated Chinese hamster V79 cells, and it causes a greater than 8-fold increase in Trp+ revertants in UV-irradiated E . coli . The comutagenic effect occurs whether cells are exposed to bisulfite during or immediately after UV irradiation . Kinetic studies of the comutagenic effect in E . coli shows that it decays in a biphasic manner, with an apparent half-life of 15 min and a persistence of the comutagenic effect for up to 120 min after UV irradiation . Experiments with several strains of E . coli of varying DNA-repair capacities indicate that excision repair is necessary for a comutagenic effect by bisulfite . It is thought that bisulfite acts to inhibit excision repair, perhaps by effects on DNA polymerase I, or DNA ligase. Eur J Biochem, 1981 Feb, 114(2), 451 - 6 On the role of ribosylthymine in prokaryotic tRNA function; Kersten H et al.; tRNAPhe and tRNALys were isolated from an Escherichia coli K12 mutant deficient in ribosylthymine (rT) and from the wild-type strain . The sequence G-rT-psi-C which is common to loop IV of practically all tRNAs used in the elongation cycle of protein synthesis reads G-U-psi-C in the tRNAs of the mutant strain . The purified tRNAs were compared in various steps of protein biosynthesis . The poly(U)-dependent poly(Phe) synthesis performed with purified Phe-tRNAPhe and purified elongation factors showed no dependence on the presence or absence of ribosylthymine in the respective tRNAs . In contrast, the corresponding poly(A)-dependent poly(Lys) synthesis was markedly increased when Lys-tRNALys lacking rT was used . The analysis of individual functional steps of the poly(A)-dependent elongation cycle demonstrated that the absence of rT reduced the binding to the A-site and improved the translocation reaction, whereas the formation of the ternary complex EF-Tu . GTP . aa-tRNA as well as both tRNA binding to the P-site and the peptidyltransferase reaction remained unaffected . The presence of U in place of rT in tRNA increases the misincorporation of leucine in an optimized poly(U)/poly(Phe) system from about 3 in 10 000 to 3 in 1000 . Our results are in agreement with the view that rT is involved in tRNA binding to the A-site in contrast to the P-site, and suggested that the presence of rT in tRNA improves the fidelity of the decoding process at the A-site of the ribosome. Eur J Biochem, 1981 Feb, 114(2), 221 - 7 Binding of ribosomes to linear and circular forms of the 5'-terminal leader fragment of tobacco-mosaic-virus RNA; Konarska M et al.; The sequence of the 5'-terminal leader fragment preceding the AUG codon in the RNA of tobacco mosaic virus (TMV), tomato strain, SPS isolate, has been determined . This RNA, similarly to the RNAs of the U1 and Dahlemense strains of TMV {Kukla et al . (1979) Eur . J . Biochem . 98, 61--66} has the 7-methylguanosine(5')triphospho(5')guanosine cap separated from the initiation codon by a long stretch of nucleotides devoid of guanosine residues . The RNase-T1-resistant 73-nucleotide-long leader fragment of TMV RNA from the SPS isolate was assayed for its ability to interact with eukaryotic and prokaryotic ribosomes . The linear fragment, labelled either at its 5' or 3' end, efficiently formed disome initiation complexes when incubated with wheat-germ protein-synthesis extract . In contrast to its linear counterpart, the circular covalently closed RNA leader fragment, obtained in a reaction catalysed by T4 RNA ligase, was unable to interact with wheat germ ribosomes . Both kinds of leader fragment bound equally well to Escherichia coli 70-S ribosomes . The results offer further support to the notion that in eukaryotic initiation the free 5' end (either capped or uncapped) is required for mRNA interaction with ribosomes . Furthermore, they suggest that both ribosomes found in disome initiation complexes with the TMV RNA leader fragment enter the mRNA sequentially via the free 5' terminus. Nature, 1981 Jan 22, 289(5795), 306 - 8 cis-Interacting genes in the S region of the murine major histocompatibility complex; Michaelson J et al.; Insight into the control of gene expression may be gained by analysing genetic systems marked by both regulatory and structural variants . In such systems one can determine whether a regulatory element controls structural genes on both chromosomes or only on the chromosome to which it is linked . The latter may be detected in individuals heterozygous at both the regulatory and structural loci, in which case the effect of each regulatory allele is seen to be exerted only on the cis-located structural allele . In prokaryotic organisms, the identification of cis interaction of this sort has allowed elucidation of many features of genetic regulation, first for the lac operon and subsequently for a variety of other systems . In higher organisms, however, there have been few opportunities to observe cis-interacting genes . The most thoroughly characterized mammalian system in this regard is the murine beta-glucuronidase locus described by Paigen and his colleagues, in which cis interaction has been shown to occur between two closely linked genetic elements-the beta-glucuronidase structural gene itself and an androgen-activated regulatory gene which controls the quantity of beta-glucuronidase expressed . We report here that cis-interacting genetic elements are also found in the S region of the mouse major histocompatibility complex H-2. Biochemistry, 1981 Jan 20, 20(2), 265 - 72 Hydrogen-1 and phosphorus-31 nuclear magnetic resonance study of the solution structure of Bacillus licheniformis 5S ribonucleic acid; Salemink PJ et al.; The conformation of Bacillus licheniformis 5S RNA in solution has been studied by using 360-MHz 1H NMR and 40.5-MHz 31P NMR spectroscopy . The 1H NMR spectra, which are well resolved, have been compared with theoretical spectra derived by ring-current shift calculations for various models proposed in the literature for the secondary structure of 5S RNA . The total amount of base pairs is estimated to be around 36 . NMR melting experiments indicate that both the molecular stalk and the prokaryotic loop {Fox, G . E., & Woese, C . R . (1975) Nature (London) 256, 505} are present in the solution structure . On this basis, some models proposed for the secondary structure of 5S RNA not containing these structural features can be rejected . Several resonances are observed around 10.7 ppm that can be ascribed to protons involved in non-Watson-Crick base pairing most likely present in tertiary interactions in the 5S RNA molecule or to ring N protons of nonpaired bases which as a result of the molecular folding are shielded from the solvent . Under our solution conditions, these structural features disappear at physiological temperature, the process being uncoupled from the collapse of the secondary structure . Using 31P NMR, we demonstrate that the number of phosphate conformations in the sugar phosphate backbone of 5S RNA, deviating from the g-,g- conformation normally found in double helices, is far les than in tRNA. Nature, 1981 Jan 15, 289(5794), 181 - 4 Selective inhibition of T suppressor-cell function by a monosaccharide; Koszinowski UH et al.; Interactions between regulatory T lymphocytes and other cells are assumed to occur at the level of the cell surface . T cells which suppress the generation of specifically effector cells have been described as having antigenic, idiotypic, allotypic and I-region specificity . Other T suppressor cells generated by in vitro cultivation with or without mitogenic stimulation have suppressive activity for T and B cells but no specificity can be assigned to them . These T suppressor cells (Ts) inhibit various lymphoid functions-this either reflects their polyclonal origin or indicates that the structures recognized by the Ts receptors must be common for many cell types . Carbohydrates on cell membrane-inserted glycoproteins or glycolipids might function as specific ligands for recognition by cellular receptors or soluble factors . Almost all cell-surface proteins of mammalian cells are glycosylated . There is evidence for lectin-like carbohydrate binding proteins not only in plants but also in toxins, viruses, prokaryotic cells and even mammalian cells, including T cells . A functional role for these lectin-like proteins has been described for slime moulds and suggested for the selective association of embryonic cells . We report here that addition of a monosaccharide can counteract the effect of T suppressor cells during the generation of alloreactive cytotoxic T cells (CTLs) in vitro. Rev Elev Med Vet Pays Trop, 1981, 34(4), 391 - 6 {A new rickettsiale (Ehrlichiae) in leukocytes of the blood of Gambia rats (Cricetomys gambianus) in Senegal : Cytoecetes kamtchoulii n . sp.}; Gretillat S et al.; Among 20 hemograms (peripheric blood smears) carried out upon some adults male and female Giant Rats, (Cricetomys gambianus) captured in the Dakar region, two (10 p . 100) are infected by one Rickettsiale of the Ehrlichiae tribe and of the Cytoecetes genus Tyzzer, 1938 . Polymorphonuclear neutrophil leukocytes and monocytes, more or less 1/25, and monocytes, more or less 1/40, of the systemic circulation are infected by "elementary bodies" (diameter : 0.1 to 0.3 mu) included in the cell protoplasma and bundled at one or two poles of the cell . They grow and become "initial bodies" (diameter : 1 to 1.5 mu) . Sometimes dumbbell-shaped forms indicate an early particle division . They are included in a small but visible vacuole . The multiplication and the growth tend to the formation of an intravacuolar "morula" (diameter : 2.5 to 3.5 mu) that can deform the monocyte nucleus . Electron micrographs of thin sections of polynuclear neutrophil leukocytes infected by morula show that each element of the morula is surrounded by two membranes (internal and external) . This prokaryotic element is carmine-coloured by staining technic of May-Grunwald and Giemsa . Hypochromia, anisochromia, anisocytosis, poikylocytosis, leukopenia (especially neutrophils), with hematopoiesis disorders (bone marrow lesions) and hematopedesis are observed . It is the first species of Cytoecetes infecting both monocytes and polynuclear neutrophil leukocytes of systemic circulation . The two Giant Rats, were also infected by some Grahamella and one massively by a spirochete of the genus Borrelia . Polyparasitism is probably the cause of the general and important blood disorders observed . This Cytoecetes is the second Ehrlichiae found in Senegal after Ehrlichia bovis . It is named Cytoecetes kamtchoulii n . sp., "Kamtchoouli" is the name of Cricetomys gambianus in Oualoff language of the Presqu'Ile du Cap Vert region . The ticks (Ixodidae) that live in the burrows of the rodent seem to be the vectors of this rickettsia. Rev Elev Med Vet Pays Trop, 1981, 34(4), 383 - 9 {A new rickettsiale of Gambia rats (Cricetomys gambianus) in Senegal : Grahamella kaniae n . sp . (Bartonellacae)}; Gretillat S et al.; Giant Rat (Cricetomys gambianus Waterh) is a big rodent very common in West Africa . Its burrow is bordering upon huts and lofts in the african villages . Omnivorous, it is more or less a commensal of the man . The blood of 20 adults male and female specimens captured in the Sine Saloum (Fatik) and Presqu'Ille du Cap Vert (Dakar) regions was examined (peripheric blood smears) . In 60 p . 100 (12/20) of hemograms, an intraerythrocytic organism of the genus Grahamella Brumpt 1911 was observed . Rod-shaped and carmine-coloured by staining technic of May-Grunwald and Giemsa, it is an unflagellate element . Slightly narrowed in the median part, it is 1 to 1.5 mu long and 0.25 mu wide . Multiplication by bipartition in the red cell plasma that may be occupied by 30 to 40 Grahamella . In chronic infection without morbid signs . 1/50 to 1/60 hematocyte is only infected . Electron micrograph of thin sections of red cells infected by Grahamella shows an element with a cell wall surrounding cytoplasmic masses which are enclosed in a cytoplasmic membrane . Nuclear region (bundles of moniliform chains = nucleic acids) is not surrounded by a nuclear membrane . Intraerythrocytic position . Bipolar densification of the cell plasma . The prokaryote is directly included in the erythrocyte plasma : no host cell vacuole is visible . Stress, polyinfection, polyparasitism or immuno-depressor effects, determine an intense proliferation of Grahamella by micrococcus elements (diameter : 0.1 to 0.3 mu) invading the systemic circulation . In that cases : septicaemia, anaemia; haematopoiesis with respiratory and nervous disorders; hyperthermia and weakness precede the death . This prokaryote is the first Baratonellacae found in the blood of the Giant Rat . It is namded Grahamella knaiae n . sp ("Kania" is the name of C . gambianus in "serere" language of Fatik region of Senegal) . The fleas seem to be the vectors or this prokaryotic element. Biosystems, 1981, 14(3-4), 423 - 31 Flagellar beat patterns and their possible evolution; Sleigh MA; The roles of flagella and their functioning in unicellular organisms of various groups are described . Water propelled around a cell by the flagellum may cause locomotion of the cell and may bring near to the cell food particles that can be filtered from the water and phagocytosed . For purpose of locomotion alone, a relatively simple flagellar activity is adequate, but the efficient collection of particulate food requires modification of the flagellar activity or of the cell organization or both . The most sophisticated flagellar mechanisms are best explained as having been evolved for the collection of particulate food, although they may occur in groups that are now predominantly or entirely autotrophic . This is consistent with the view that heterotrophic flagellates requiring efficient particle collection for feeding evolved divergent flagellar mechanisms, based upon various structural patterns, and that only later did some of these divergent groups acquire their own particular types of plastid, presumably following phagotrophic uptake of the appropriate type of photosynthetic prokaryote and the establishment of a symbiotic association. Biochem J, 1981 Jan 1, 193(1), 235 - 44 Kinetic and physical properties of the L-malate-NAD+ oxidoreductase from Methanospirillum hungatii and comparison with the enzyme from other sources; Storer AC et al.; The L-malate-NAD+ oxidoreductase of Methanospirillum hungatii was purified to homogeneity by using Blue Sepharose and ADP-Sepharose affinity chromatography . The molecular weight was estimated as 61 700 +/- 1900 by gel filtration and 64 200 +/- 1200 by ultracentrifugation . Sodium dodecyl sulphate/polyacrylamide-gel electrophoresis indicated that the protein is composed of two polypeptide chains, each corresponding to 31 350 +/- 2150 daltons . Inhibition patterns obtained for malate, alpha-oxoglutarate and ADP established that the sequential reaction mechanism was ordered, with NADH serving as the first substrate . Intracellular concentrations of oxaloacetate approximated the Km value of 27 microM, but NADH was present at less than Km values . Comparison of the amino-acid composition of the L-malate-NAD+ oxidoreductase of M . hungatii and 22 others from prokaryotic and eukaryotic cells revealed a significant direct relationship between average hydrophobicity and the frequency of non-polar side chains, as well as a significant indirect relationship between average hydrophobicity and the polarity ratio . Calculations based on amino-acid-composition data indicated significant composition similarity between pairs of mammalian-cytoplasmic or pairs of mitochondrial L-malate-NAD+ oxidoreductases from various sources, but no significant composition similarity between any of the pairs of bacterial species examined. Biosystems, 1981, 14(1), 123 - 47 Evolution of the control of pigment and plastid development in photosynthetic organisms; Schiff JA; How do bioenergetic organelles relate to the cells they are in and how was this relationship established over the course of evolution? Plastids and mitochondria are viewed as prokaryotic residents in eukaryotic cells . These organelles are semiautonomous: they perpetuate themselves by division but regulate and are subject to regulation by the cell in which they are residents . Although these organelles are usually constitutive, their development is arrested in certain organisms when an inducing substrate is absent (light, for example, in the case of the chloroplast) with the formation of precursor organelles such as proplastids . Various trends in the evolution of photo-control systems are discussed including those concerned with photoperception and photomorphogenesis . The photocontrol of chloroplast development by blue and red light is discussed in relation to its possible evolutionary origins in a system for finding the right light for photosynthesis . Models for various types of cellular regulation by light during chloroplast development are discussed . Also considered is the evolution of plastid pigments in response to available light . A parallel evolution of accessory pigments and chlorophylls is suggested which led to chlorophyll reaction centers serving as energy sinks for light absorbed by accessory pigments and, therefore, having their absorptions pushed to the longest possible wavelengths as accessory pigments evolved to fill the middle of the spectrum in response to ecological selection . An endosymbiotic origin of bioenergetic organelles is suggested based on polyphyletic origins of chloroplasts from a number of oxygenic procaryotic precursors . The similarity between proplastids and these oxygenic procaryotes suggests that the original invading organelle may have resembled a modern proplastid rather than a mature chloroplast. J Mol Evol, 1981, 17(6), 334 - 7 An evaluation of the phylogenetic position of the dinoflagellate Crypthecodinium cohnii based on 5S rRNA characterization; Hinnebusch AG et al.; Partial nucleotide sequences for the 5S and 5.8S rRNAs from the dinoflagellate Crypthecodinium cohnii have been determined, using a rapid chemical sequencing method, for the purpose of studying dinoflagellate phylogeny . The 5S RNA sequence shows the most homology (75%) with the 5S sequences of higher animals and the least homology (less than 60%) with prokaryotic sequences . In addition, it lacks certain residues which are highly conserved in prokaryotic molecules but are generally missing in eukaryotes . These findings suggest a distant relationship between dinoflagellates and the prokaryotes . Using two different sequence alignments and several different methods for selecting an optimum phylogenetic tree for selecting an optimum phylogenetic tree for a collection of 5S sequences including higher plants and animals, fungi, and bacteria in addition to the C . cohnii sequence, the dinoflagellate lineage was joined to the tree at the point of the plant-animal divergence well above the branching point of the fungi . This result is of interest because it implies that the well-documented absence in dinoflagellates of histones and the typical nucleosomal subunit structure of eukaryotic chromatin is the result of secondary loss, and not an indication of an extremely primitive state, as was previously suggested . Computer simulations of 5S RNA evolution have been carried out in order to demonstrate that the above-mentioned phylogenetic placement is not likely to be the result of random sequence convergence . We have also constructed a phylogeny for 5.8S RNA sequences in which plants, animals, fungi and the dinoflagellates are again represented . While the order of branching on this tree is the same as in the 5S tree for the organisms represented, because it lacks prokaryotes, the 5.8S tree cannot be considered a strong independent confirmation of the 5S result . Moreover, 5.8S RNA appears to have experienced very different rates of evolution in different lineages indicating that it may not be the best indicator of evolutionary relationships . We have also considered the existing biological data regarding dinoflagellate evolution in relation to our molecular phylogenetic evidence. CRC Crit Rev Biochem, 1981, 11(1), 35 - 104 The evolving tRNA molecule; Cedergren RJ et al.; The study of tRNA molecular evolution is crucial to understanding the origin and establishment of the genetic code as well as the differentiation and refinement of the machinery of protein synthesis in prokaryotes, eukaryotes, organelles, and phage systems . The small size of the molecule and its critical involvement in a multiplicity of roles distinguish its study from classical protein molecular evolution with respect to goals and methods . Here, the authors assess available and missing data, existing and needed methodology, and the impact of tRNA studies on current theories both of genetic code evolution and of the evolution of species . They analyze mutational "hot spots", the role of base modification, synthetase recognition, codon-anticodon interactions and the status of organelle tRNA. Biosystems, 1981, 14(1), 89 - 94 Evolution of photosynthetic reaction centers; Olson JM; The common ancestor of all photosynthetic prokaryotes and organelles contained chlorophyll (Chl) a . All green and purple photosynthetic bacteria descended from a common bacteriochlorophyll (Bchl) a-containing ancestor which diverged from the Chl a line . Separate PS-I and PS-II reaction centers may have evolved before the appearance of Bchl a . When the transition to Bchl a occurred, the resultant organism contained two types of reaction center, "PS-I" and "PS-II." One line of development eliminated "PS-II" and evolved into the green bacteria . The other line eliminated "PS-I" and became the purple bacteria . In the Chl a-containing organisms the evolution of PS-II continued until oxygen evolution was achieved. J Mol Evol, 1981, 17(4), 237 - 44 The universal dinucleotide asymmetry rules in DNA and the amino acid codon choice; Nussinov R; Natural DNA sequences were recently found to contain distinct nearest neighbor patterns . Hetero-dinucleotides were demonstrated to appear consistently more (less) than their mirror-image counterparts . This paper shows that this asymmetric behavior does not stem from the coding requirements of the DNA . It also shows some codon patterns in prokaryotic and eukaryotic genomes which came up in the course of this work. J Neuropathol Exp Neurol, 1981 Jan, 40(1), 1 - 8 Intracellular spiral inclusions in cerebral cell processes in Creutzfeldt-Jakob disease; Reyes JM et al.; Electron microscopic examination of brain biopsy specimens from two patients with Creutzfeldt-Jakob disease revealed the presence of intracellular membranous spiral inclusions in the processes of cortical cells . These inclusions, 375 nm to 660 nm in length and 50 nm to 88 nm in width, resemble similar structures reported in a patient with the same disease by Bastian and, more recently, in a second patient by Gray et al . These inclusions bear close morphologic resemblance to spiroplasma organisms, a wall-free prokaryote known to cause a "slow-virus"-like disorder in mice. Mol Gen Genet, 1981, 182(3), 430 - 9 Usage of the three termination codons: compilation and analysis of the known eukaryotic and prokaryotic translation termination sequences; Kohli J et al.; The published translation termination sequences have been compiled and analysed to aid the interpretation of experiments on termination codon usage in the Xenopus oocyte (Bienz et al . 1981) . There are significant differences between prokaryotes and eukaryotes concerning the usage of the three termination codons and of tandem stops . In addition viruses show termination strategies that differ from those of their hosts . Preferred context sequences flanking termination codons are described . Contexts vary within the last codon according to the nature of the termination codon, but are uniform within the first triplet following the terminators. Ann N Y Acad Sci, 1981, 361, 154 - 65 Chloroplast evolution--ancient and modern; Whatley JM; The traditional theory of serial endosymbiosis envisages the origin of all chloroplasts from prokaryotic algal symbionts . Of the two membranes that immediately surround plastids, the inner is considered homologous with the plasma membrane of the symbiont and the outer homologous with the vacuolar membrane provided by the host . This theory has been modified to suggest that those chloroplasts that are surrounded by more than two membranes were derived, following a second act of symbiosis, from eukaryotic rather than prokaryotic symbionts; these may have been whole eukaryotic algae or chloroplasts isolated from them . This suggestion is partly based on homologies between the various membranes that surround chloroplasts of different taxonomic groups and those that surround photosynthetic symbionts known today . If chloroplasts did indeed evolve from photosynthetic symbionts, then algal phylogeny must take account not only of the individual characteristics of the host cells and their symbionts but also of modifications of these characteristics arising from interactions between host and symbiont. Scand J Infect Dis Suppl, 1981, 26, 31 - 41 Action of clinically utilized 5-nitroimidazoles on microorganisms; Muller M; Various nitroimidazoles are used as antimicrobial and radiosensitizing agents in human medicine . Of these, 5-nitroimidazoles show high selective toxicity for anaerobic prokaryotes and eukaryotes . This review discusses the effects of 5-nitroimidazoles on microorganisms, i.e . microbicidal action, radiosensitizing action, inhibition of photosynthetic microorganisms, and induction of mutations . All these actions are enhanced by anaerobiosis and inhibited by aerobiosis or by the presence of certain reducible compounds . There is no indication that antimicrobial action could be dissociated from mutagenic properties . Relative resistance to 5-nitroimidazoles has been detected in some isolates of Bacteroides fragilis and Trichomonas vaginalis and was experimentally developed in B . fragilis and various trichomonads . Nitroimidazoles enter the microorganisms by diffusion . Facilitated transport has not been detected . The compound is reduced by low oxidation-reduction potential ferredoxin and similar electron transport components in the cell . In microorganisms highly susceptible to metronidazole, such compounds play a significant metabolic role . The reduction increases the outside-inside concentration gradient and thus drives further uptake . Certain short-lived products of the reduction are responsible for the cytotoxic action . In less susceptible organisms only limited amounts of such products are formed, and thus the cells are not killed but may undergo mutations . A major component of cytotoxicity is damage to DNA but other mechanisms cannot be excluded at present. Arzneimittelforschung, 1981, 31(11), 1869 - 72 Effects of erythromycin on Euglena gracilis as a model for testing the toxicity of antibacterial drugs; Fasulo MP et al.; Based on the main physiological and ultrastructural effects induced in Euglena gracilis by erythromycin, one of the least toxic of the commonly used antibiotics that specifically inhibit protein synthesis on 70S ribosomes of prokaryotic organisms, a symptomatologic picture is outlined which could be useful for the preliminary evaluation of the toxicity of antibacterial agents. Crit Rev Microbiol, 1981, 9(1), 45 - 100 The developmental biology of heterocyst and akinete formation in cyanobacteria; Adams DG et al.; We will be concerned with the two major differentiated cell types of filamentous cyanobacteria--the heterocyst and the akinete . The former is generally accepted to be the site of aerobic nitrogen fixation in heterocystous cyanobacteria . The latter is a spore-like cell capable of withstanding certain environmental extremes and of germination . A short general introduction to cyanobacteria and their cell types will be included . The remainder of the review will fall into four main sections . The first will deal with the metabolism of the heterocyst and akinete, with particular reference to nitrogen fixation in the former . The next will be concerned with a description of the metabolic and ultrastructural changes associated with heterocyst and a kinete development . A third section will describe the special arrangement of the heterocyst and akinete (one of the features which makes this group of prokaryotes unique), the relationship between the cell types, and methods of altering this normal regular spatial pattern . The final section will describe in detail present theories of pattern control in cyanobacteria and the mechanisms by which the process of differentiation itself is regulated. Mol Gen Genet, 1981, 181(4), 525 - 31 Biological assay of prokaryotic genes in mouse cells following DNA mediated transformation; Yoder JI et al.; Genes coding for leucine biosynthesis in Bacillus subtilis were introduced into mouse LTK- cells by co-transformation with thymidine kinase+ (tk) DNA . Genomic DNA from the tk+ transformants was used to transform competent cultures of different B . subtilis leucine auxotrophs . Each auxotroph was transformed to prototrophy at a similar frequency and the number of leucine gene sequences per transformant genome as deduced by the B . subtilis bioassay strongly correlated with the number estimated by hybridization methods . Tk- subclones were obtained by plating the transformants in 5'-bromodeoxyuridine . One subclone still contained the non-selected leucine gene sequences and could transform auxotrophs of B . subtilis . No deletions or rearrangements in the linkage relationships of the leucine genes occurred in the LTK- cells that inhibited transformation of B . subtilis. J Supramol Struct Cell Biochem, 1981, 16(1), 91 - 103 The repair of DNA damage: recent developments and new insights; Friedberg EC et al.; This brief review presents the salient features of new developments in the enzymatic repair of base damage to DNA . DNA glycosylases and apurinic/apyrimidinic (AP) endonucleases are reviewed and evidence is presented that in at least two prokaryote systems incision of UV-irradiated DNA occurs by the sequential action of these two classes of enzymes . In contradistinction, the uvrA, uvrB, and uvrC gene products of E coli appear to function as a multi-protein complex that catalyzes hydrolysis of phosphodiester bonds in damaged DNA directly . The inducible rapid repair of O6-methylguanine in E coli is also reviewed. Biosystems, 1981, 14(1), 113 - 21 The coupling ATPase complex: an evolutionary view; Harris DA; Phospholipid micelles and vesicles, present in the primordial soup, formed both primitive (surface) catalyst and primitive replicative life forms . With the adoption of a common energy source, ATP, integrated biochemical systems within these vesicles became possible - cells . Fermentation within these primitive cells was favoured by the evolution, first of ion channels allowing protons to leak out, and then of an active ATP-driven pump . In the prokaryotic/mitochondria/chloroplast line, the proton channel was such as to be blocked by dicyclohexylcarbodiimide and the adenosine 5' triphosphate phosphohydrolase (ATPase) by 4-chloro 7-nitrobenzofurazan (Nbf-C1) . The ATPase was initially simple (4 subunits) but later, possibly concomitant with its evolution to an ATP synthetase, became more complex (8 subunits) . One of the steps in evolution probably involved gene duplication and divergence of 2 subunits (alpha and beta) from the largest of the ATPase subunits . From this stage, the general form of the ATPase was fixed, although sensitivity to, for example, oligomycin involved later, after divergence of the mitochondrial and chloroplast lines . A regulatory protein, the ATPase inhibitor, is found associated with a wide spectrum of coupling ATPases. Proc Natl Acad Sci U S A, 1981 Jan, 78(1), 124 - 8 Nucleotide sequence of cloned unintegrated avian sarcoma virus DNA: viral DNA contains direct and inverted repeats similar to those in transposable elements; Swanstrom R et al.; We have determined the nucleotide sequence of portions of two circular avian sarcoma virus (ASV) DNA molecules cloned in a prokaryotic host--vector system . The region whose sequence was determined represents the circle junction site--i.e., the site at which the ends of the unintegrated linear DNA are fused to form circular DNA . The sequence from one cloned molecule, SRA-2, shows that the circle junction site is the center of a 330-base-pair (bp) tandem direct repeat, presumably representing the fusion of the long terminal repeat (LTR) units known to be present at the ends of the linear DNA . The circle junction site is also the center of a 15-bp imperfect inverted repeat, which thus appears at the boundaries of the LTR . The structure of ASV DNA--unique coding region flanked by a direct repeat that is, in turn, terminated with a short inverted repeat--is very similar to the structure of certain transposable elements . Several features of the sequence imply that circularization to form the SRA-2 molecule occurred without loss of information from the linear DNA precursor . Circularization of another cloned viral DNA molecule, SRA-1, probably occurred by a different mechanism . The circle junction site of the SRA-1 molecule has a 63-bp deletion, which may have arisen by a mechanism that is analogous to the integration of viral DNA into the host genome . Flanking one side of the tandem direct repeat is the binding site for tRNATrp, the previously described primer for synthesis of the first strand of viral DNA . The other side of the direct repeat is flanked by a polypurine tract, A-G-G-G-A-G-G-G-G-G-A, which may represent the position of the primer for synthesis of the second strand of viral DNA . An A+T-rich region, upstream from the RNA capping site, and the sequence A-A-T-A-A-A are present within the direct repeat sequence . These sequences may serve as a promoter site and poly(A) addition signal, respectively, as proposed for other eukaryotic transcription units. Adv Exp Med Biol, 1981, 136 Pt A, 257 - 74 Metabolism and genotoxicity of styrene; Vainio H et al.; An overview on the metabolism and genotoxicity of styrene is given in this article . The mutagenic potency of styrene has been confirmed in a number of test systems providing the metabolic activation of styrene . Styrene is converted to styrene-7,8-oxide as catalyzed by cytochrome P-450 cored enzyme complex . Styrene-7,8-oxide is mutagenic in prokaryotic and eukaryotic test systems without metabolic activation . It reacts with nucleic acid bases, especially with deoxyguanosine producing 7-alkylguanine and deoxycytidine producing N-3 alkylcytosine . Quite recently, styrene-7,8-oxide has been found to be a potent carcinogen in rats . In human whole blood cultures, styrene is metabolized into styrene-7,8-oxide . Styrene is able to induce both SCEs and chromosomal aberrations in cultured lymphocytes . The clastogenic action of styrene can be explained by the metabolism of styrene into styrene-7,8-oxide in cultured human blood cells . Although also an arene oxide, styrene-3,4-oxide, has been suggested in the biotransformation of styrene, the evidence so far supports the view that the vinyl group oxidation and oxirane formation plays a predominant role in the genotoxicity of styrene. Immun Infekt, 1981, 9(3), 88 - 98 {Antibiotics as inhibitors of the prokaryotic protein biosynthesis: action and resistance mechanisms (author's transl)}; Nierhaus KH; Most of the known antibiotics interfere with the translational apparatus due to the extraordinary complexity of the translational organelle, the ribosome . After a short survey on structure and function of the ribosome the action of some antibiotics is explained and integrated in an extended scheme of ribosomal functions . Furthermore, various resistance strategies of the translational apparatus against the antibiotics are described. Proc Natl Acad Sci U S A, 1981 Jan, 78(1), 110 - 4 Sites of termination of in vitro DNA synthesis on ultraviolet- and N-acetylaminofluorene-treated phi X174 templates by prokaryotic and eukaryotic DNA polymerases; Moore PD et al.; In vitro DNA synthesis on a phi X174 template primed with a restriction fragment and catalyzed by the Escherichia coli DNA polymerase I large (Klenow) fragment (pol I) terminates at the nucleotide preceding a site that has been altered by ultraviolet irradiation or treatment with N-acetylaminofluorene . Termination on ultraviolet-irradiated templates is similar when synthesis is catalyzed by E . coli DNA polymerase III holoenzyme (pol III), phage T4 DNA polymerase, a polymerase alpha from human lymphoma cells, or avian myeloblastosis virus reverse transcriptase . 3' leads to 5' exonuclease activity cannot be detected in the reverse transcriptase and DNA polymerase alpha preparations . On N-acetylaminofluorene templates, pol I, pol III, and T4 polymerase reactions terminate immediately preceding the lesion, whereas reverse transcriptase-catalyzed reactions and, at some positions in the sequence, polymerase alpha-catalyzed reactions terminate at the site of the lesion . Substitution of Mn2+ for Mg2+ changes the pattern of pol I-catalyzed termination sites . The data suggest that termination is a complicated process that does not depend exclusively on the 3' leads to 5' exonuclease activity associated with many polymerases. Biochemistry, 1980 Dec 23, 19(26), 5955 - 9 Raman and 19F(1H) nuclear Overhauser evidence for a rigid solution conformation of Escherichia coli 5-fluorouracil 5S ribonucleic acid; Marshall AG et al.; Escherichia coli cells grown on a medium containing 5-fluorouracil (FU) produce 5S RNA whose uracil residues are approximately 80% replaced by FU . The Raman spectra of native and FU-5S RNA are very similar, confirming similar solution conformations for the two species and a highly base-stacked structure in solution . The 254-MHz 19F NMR spectrum of FU-5S RNA sh |