|
|
|
Mol Biochem Parasitol, 1993 Apr, 58(2), 333 - 44 Cloning and characterization of a vacuolar ATPase A subunit homologue from Plasmodium falciparum; Karcz SR et al.; The distribution of the antimalarial drug chloroquine is determined to a significant extent by a transvacuolar pH gradient in Plasmodium falciparum . A proton pump similar to the vacuolar ATPase found in many cell types has been suggested to maintain a pH gradient across the membranes of acidic compartments in the parasite . In order to understand and define the components involved in the mechanism of acidification of parasite vesicles, we have cloned and characterized a gene, designated VAP-A, encoding a P . falciparum homologue of the catalytic A subunit of the vacuolar ATPase . The VAP-A gene encodes a polypeptide of 611 amino acids which shows between 56 to 61% amino acid identity over its entire length with the sequences of vacuolar ATPase A subunits from several species . The VAP-A gene exists as a single copy gene on P . falciparum chromosome 13 and gives rise to a transcript of 3.7 kb . Antibodies raised against a VAP-A gene segment expressed in Escherichia coli react specifically with a 67-kDa polypeptide, consistent with the size predicted from the sequence and with the size of the corresponding polypeptide in other organisms . The 67-kDa protein is present throughout the asexual erythrocytic cycle and is expressed at similar levels in 5 P . falciparum isolates of differing chloroquine sensitivity . Sequence analysis of the coding region of the VAP-A gene from 2 chloroquine-sensitive and 3 chloroquine-resistant isolates has shown no changes that are linked to chloroquine resistance . Therefore, a proposed chloroquine resistance-linked vacuolar acidification defect does not involve mutations in the VAP-A gene in the isolates we have studied. Mol Gen Genet, 1993 Apr, 238(1-2), 38 - 42 Amplification and loss of repeat units of the human minisatellite MS1 integrated in chromosome III of a haploid yeast strain; Cederberg H et al.; Minisatellites comprise arrays of tandemly repeated short DNA sequences which show extensive variation in repeat unit number . The mechanisms that underlie this length variation are not understood . In order to study processes influencing length changes of minisatellites, we integrated the human minisatellite MS1 into a haploid strain of the yeast Saccharomyces cerevisiae . Frequent spontaneous generation of MS1 alleles with new lengths were observed in this yeast strain . Hence it is concluded that recombination between members of a pair of homologous chromosomes is not a prerequisite for the generation of length changes in MS1 in yeast. Mol Gen Genet, 1993 Apr, 238(1-2), 304 - 7 The A mating-type genes of the mushroom Coprinus cinereus are not differentially transcribed in monokaryons and dikaryons; Richardson WV et al.; The A mating type factor of Coprinus cinereus regulates part of a developmental sequence that leads to the conversion of the asexual monokaryon into the fertile dikaryon . The A42 factor is a complex of seven genes, at least four of which are involved in determining the specificity of mating interactions . In this report we show that the A42 genes are constitutively expressed in both monokaryons and dikaryons . This has important implications with respect to intracellular recognition of a compatible mating, which requires an interaction between proteins already present within the cells of the mating partners, and for the subsequent maintenance of dikaryotic growth. Mol Gen Genet, 1993 Apr, 238(1-2), 252 - 60 A technique for targeted mutagenesis of the EF-Tu chromosomal gene by M13-mediated gene replacement; Zeef LA et al.; A generally applicable system for targeted mutagenesis of a chromosomal sequence is described . The Escherichia coli tufA gene was mutated using a recombinant M13mp9 phage vector carrying a tuf gene . Integration via crossing over with the chromosomal tufA target gene produced an M13 lysogen . These lysogens were screened for resistance to kirromycin . The M13 phage carrying tufA mutations were efficiently retrieved by a genetic procedure . Genetic mapping was performed with the M13 vectors . The same recombinant M13 phage was used for mutagenesis, lysogen formation, gene replacement, retrieval, mapping and sequencing of kirromycin mutants . Three different mutations yielding resistance to kirromycin were found: two of these have previously been found and characterised, while the third mutation, Gly316-->Asp, is a new mutant . We also report the identification of a fourth kirromycin-resistant mutant, Gln124-->Lys. Mol Gen Genet, 1993 Apr, 238(1-2), 218 - 24 Nonsense suppression in thymine-requiring strains of Escherichia coli is a consequence of altered folate metabolism; Basso J et al.; Thymine-requiring strains of Escherichia coli suppress nonsense and frameshift mutants of T4 phage . We proposed that these mutants make errors during translation because of an imbalance in folate metabolism . A thymine-requiring strain grown under suppressing conditions has elevated levels of reduced folates . We tested the effect of either mutational blocks or the inhibition of various steps in folate biosynthesis on suppression . Conditions which prevent the accumulation of 5-methyl tetrahydrofolate inhibit suppression, suggesting that elevated levels of this folate are required for suppression . Furthermore, conditions that result in an accumulation in dihydrofolate inhibit suppression. Mol Gen Genet, 1993 Apr, 238(1-2), 169 - 76 Isolation of temperature-sensitive aminoacyl-tRNA synthetase mutants from an Escherichia coli strain harboring the pemK plasmid; Masuda Y et al.; The pem locus, which is responsible for the stable maintenance of the low copy number plasmid R100, contains the pemK gene, whose product has been shown to be a growth inhibitor . Here, we attempted to isolate mutants which became tolerant to transient induction of the PemK protein . We obtained 20 mutants (here called pkt for PemK tolerance), of which 9 were temperature sensitive for growth . We analyzed the nine mutants genetically and found that they could be classified into three complementation groups, pktA, pktB and pktC, which corresponded to three genes, ileS, gltX and asnS, encoding isoleucyl-, glutamyl- and asparaginyl-tRNA synthetases, respectively . Since these amino-acyl-tRNA synthetase mutants did not produce the PemK protein upon induction at the restrictive temperature, these mutants could be isolated because they behaved as if they were tolerant to the PemK protein . The procedure is therefore useful for isolating temperature-sensitive mutants of aminoacyl-tRNA synthetases. Mol Gen Genet, 1993 Apr, 238(1-2), 161 - 8 Differential expression of the psbA genes in the cyanobacterium Synechocystis 6803; Mohamed A et al.; The 5' region and transcription initiation sites of the psbA-2 and psbA-3 genes of Synechocystis 6803 were determined . The otherwise highly homologous genes were shown to diverge significantly in the 5' noncoding regions . The transcription start site for the psbA-2 gene was mapped to position -49 upstream of the coding region and for the psbA-3 gene to position -88, i.e . 38 bp upstream of the psbA-2 transcription start point . Both genes exhibit promoter elements, which conform in sequence and position to Escherichia coli consensus motifs . The two genes share identical -35 sequences but differ in their -10 sequences . Primer extension analysis demonstrated that the psbA-2 and psbA-3 genes are differentially expressed, with > 90% of the total psbA transcripts being produced by the psbA-2 gene and the rest by the psbA-3 gene . Inactivation of the psbA-2 gene resulted in an eightfold up-regulation of the psbA-3 gene . The strikingly higher stability of the psbA transcripts in darkness compared to light, and the accumulation of a specific decay intermediate under dark conditions was reported previously . We show here that this dark-stability applies to both the psbA-2 and psbA-3 transcripts . The psbA-3 transcript did not appear to produce the processed intermediate, arguing for the involvement of the 5' non-coding region as a determinant in psbA transcript degradation. Hepatology, 1993 Apr, 17(4), 615 - 20 Augmented glucose use and pentose cycle activity in hepatic endothelial cells after in vivo endotoxemia; Spolarics Z et al.; Glucose use and pentose cycle activity were determined in freshly isolated rat hepatic endothelial cells 3 hr after an intravenous injection of Escherichia coli lipopolysaccharide (0.1 mg/kg body weight), by use of {1-14C}glucose, {6-14C}glucose and {2-3H}glucose . Lipopolysaccharide treatment in vivo increased glucose use fivefold, whereas glucose oxidation in the pentose cycle was elevated from 0.2 to 1.5 nmol/hr/10(7) cells . In vitro incubation of endothelial cells from saline- and lipopolysaccharide-treated animals in the presence of phorbol 12-myristate 13-acetate (10(-6) mol/L) increased pentose cycle activity twofold and eightfold, respectively . Phorbol 12-myristate 13-acetate caused only a 40% to 60% increase in glycolysis in both groups . Addition of t-butyl hydroperoxide (0.5 mmol/L), a substrate for glutathione peroxidase, caused a 24-fold and 16-fold increase in the glucose flux through the pentose cycle in cells from saline- and lipopolysaccharide-treated rats, respectively . Oxidation of glucose through the Krebs cycle was also increased several-fold after t-butyl hydroperoxide administration . Depletion of cellular glutathione by N-ethylmaleimide (0.1 mmol/L) inhibited the phorbol 12-myristate 13-acetate-induced or t-butyl hydroperoxide-induced increase in the pentose cycle activity with no marked effects on glycolysis . Diphenyleneiodonium (0.1 mmol/L), an inhibitor of superoxide and nitric oxide synthesis inhibited the phorbol 12-myristate 13-acetate-induced increased pentose cycle activity with no effects on the t-butyl hydroperoxide-induced response.(ABSTRACT TRUNCATED AT 250 WORDS) Eur J Biochem, 1993 Apr 1, 213(1), 613 - 24 Responses of metabolic systems to large changes in enzyme activities and effectors . 1 . The linear treatment of unbranched chains; Small JR et al.; This first paper in a series investigates the problem of predicting and analysing the effects of large changes in enzyme activities or external nutrients/effectors on metabolic fluxes . We introduce the concept of a deviation index, D, which gives a measure of the relative change in a metabolic variable (e.g . flux) due to a large (non-infinitesimal) relative change in a parameter (e.g . enzyme) . Using simplifying kinetic assumptions we have found, for an unbranched metabolic chain, a direct relationship between deviation indices and flux control coefficients . This relationship provides a method to estimate flux control coefficients using a single large change in enzyme activity . We also provide a method of predicting the effects of, for example, DNA manipulation or other techniques for enzyme activity/concentration changes on metabolic fluxes . Up-modulations of single enzymes rarely produce significant changes in fluxes . We show that combined changes of activity of a group of enzymes will produce a more than 'additive' response . We provide a method of predicting the effects of these combined changes, given either the flux control coefficients of the group of enzymes or the effects on the flux of changing the enzymes individually . A similar analysis is carried out for large changes in external nutrients or effectors . These amplification factors, f, give experimentally accessible estimates of the expected changes in metabolic variables . We provide three 'case studies' to illustrate our results. Eur J Biochem, 1993 Apr 1, 213(1), 329 - 38 Overproduction, purification and characterization of the bacterioferritin of Escherichia coli and a C-terminally extended variant; Andrews SC et al.; The bacterioferritin (BFR) of Escherichia coli is an iron-sequestering haemoprotein composed of 24 identical polypeptide chains forming an approximately spherical protein shell with a central iron-storage cavity . BFR and BFR-lambda, a variant with a 14-residue C-terminal extension, have been amplified (120-fold and 50-fold, respectively), purified by a new procedure and characterized . The overproduced BFR exhibited properties similar to those of natural BFR, but the iron content (25-75 non-haem Fe atoms/molecule) was 13-39-fold lower . Two major assembly states of BFR were detected, a 24-subunit protein (tetracosamer) and a novel haem-containing subunit dimer . BFR-lambda subunits assembled into tetracosamers having the same external-surface properties as BFR, presumably because their C-terminal extensions project into and occupy about 60% of the central cavity . As a result, BFR-lambda failed totake up iron under conditions that allowed incorporation into BFR in vitro . The haem content of BFR-lambda (1-2 haems/tetracosamer) was lower than that of BFR (3.5-10.5 haems/tetracosamer) and this, together with a difference in the visible spectra of the two haemoproteins, suggested that the C-terminal extensions in BFR-lambda perturb the haem-binding pockets . A subunit dimer form of BFR-lambda was not detected . A combination of Mossbauer spectroscopy and electron diffraction showed that the BFR loaded with iron in vitro has a ferrihydrite-like iron core, whereas the in-vivo loaded protein has an amorphous core. Eur J Biochem, 1993 Apr 1, 213(1), 233 - 41 Molecular cloning, developmental pattern and tissue expression of 3-hydroxy-3-methylglutaryl coenzyme A reductase of the cockroach Blattella germanica; Martinez-Gonzalez J et al.; In insects, 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMG-CoA) synthesizes mevalonate for the production of nonsterol isoprenoids, which are essential for growth and differentiation . To understand the regulation and developmental role of HMG-CoA reductase, we have cloned a full-length HMG-CoA reductase cDNA from the cockroach Blattella germanica . This cDNA clone was isolated using as a probe a partial cDNA of B . germanica HMG-CoA reductase, amplified using the polymerase chain reaction . The composite 3433-bp cDNA sequence contains an open reading frame encoding a polypeptide of 856 amino acids (Mr, 93165) . The C-terminal region is more similar to hamster HMG-CoA reductase than is the Drosophila melanogaster enzyme (79% and 69% conserved residues, respectively), and the potential transmembrane domains at the N-terminal region are structurally conservative with both enzymes . The C-terminal region of the B . germanica protein has been expressed as a fusion protein in Escherichia coli and exhibits HMG-CoA reductase activity . Analysis of B . germanica HMG-CoA reductase mRNA levels, reveals a 3.6-kb transcript, that is overexpressed in 4-day-old embryos . Northern-blot analysis of RNA samples from different adult female tissues shows high HMG-CoA reductase mRNA levels in the ovary and lower levels in brain and muscle. Eur J Biochem, 1993 Apr 1, 213(1), 167 - 84 Homonuclear and heteronuclear NMR studies of oxidized Desulfovibrio vulgaris flavodoxin . Sequential assignments and identification of secondary structure elements; Knauf MA et al.; Recombinant Desulfovibrio vulgaris flavodoxin (molecular mass 16.3 kDa) was produced in Escherichia coli . The oxidized protein has been investigated with a combination of homonuclear and heteronuclear two-dimensional and heteronuclear three-dimensional NMR spectroscopy . Sequence-specific assignment of all backbone and most of the side chain 1H and 15N resonances has been obtained . The secondary structure has been inferred from the pattern of sequential, medium-, and long-range NOEs, together with information about slowly exchanging amide hydrogens and HN-H alpha spin-spin coupling constants . In solution, flavodoxin consists of a five-stranded parallel beta-sheet and four alpha-helices . Residues 3-9, 32-36, 52-58, 87-96, and 123-128 are involved in the beta-sheet whereas the a-helical regions comprise residues 13-28, 69-76, 104-114, and 134-148 . Several proton resonances of the bound flavin mononucleotide cofactor have been assigned . NOE contacts between the prosthetic group and the apoprotein have been detected. Biotechniques, 1993 Apr, 14(4), 575 - 8 Post-hybridization recovery of membrane filter-bound DNA for enzymatic DNA amplification; Chong KY et al.; We describe here a simple and rapid method for enzymatic DNA amplification using DNA template recovered from membrane filters previously used in hybridization analysis . This is done by first solubilizing membrane pieces carrying DNA of interest in dimethyl sulfoxide, followed by isopropanol precipitation and polymerase chain reaction amplification . The source of membrane-bound DNA successfully tested includes plasmid and human leukocyte DNA and DNA immobilized on bacterial colony filters and plaque lifts . The sensitivity of the procedure is such that DNA recovered from 0.5 microgram of filter-bound total human DNA was enough for PCR amplification of a 0.3-kb fragment . Our protocol will be useful for recycling of scarce DNA samples for cloning and sequencing purposes. Am J Physiol, 1993 Apr, 264(4 Pt 2), H1161 - 5 TNF-alpha release in endotoxemia contributes to neutrophil-dependent pulmonary edema; Horgan MJ et al.; We examined whether the generation of tumor necrosis factor (TNF-alpha) after lipopolysaccharide (LPS) challenge contributes to increases in lung vascular permeability and water content . Guinea pig lungs perfused at constant flow with Ringer-albumin solution (0.5 g/100 ml) were challenged for 120 min with LPS (Escherichia coli; final concentration 33 ng/ml; n = 5) . Lung effluent samples were assayed for TNF-alpha activity using the modified L-929 fibroblast cytolytic assay . TNF-alpha concentrations increased in a time-dependent manner with a peak value of 100 +/- 20 pg/ml noted 90-120 min after LPS . Human neutrophils {polymorphonuclear leukocytes (PMN; 2 x 10(7)} added to the perfusion solution after endotoxin challenge (n = 5) produced a threefold increase in lung tissue myeloperoxidase (MPO) activity over control values . PMN, added after LPS and activated using phorbol 12-myristate 13-acetate (PMA; 5 x 10(-9) M; n = 6), produced three- to sixfold increases in mean pulmonary arterial pressure (Ppa) and pulmonary capillary pressure (Pcap), wet weight-to-dry weight ratio (W/D), and the pulmonary capillary filtration coefficient (Kf,c) over control values (P < 0.05) . Activation of PMN with PMA in non-LPS-challenged lungs produced only threefold increases in Ppa and Pcap and did not change W/D and Kf,c . Infusion of an anti-TNF-alpha antibody before the LPS challenge reduced by approximately 50% the increases in Ppa, Pcap, MPO content, Kf,c, and lung wet weight gain (P < 0.05) . Therefore, endotoxin-induced TNF-alpha generation in lungs significantly contributes to pulmonary sequestration of PMN . Activation of the sequestered PMN increases pulmonary vascular permeability and tissue water content. Am J Physiol, 1993 Apr, 264(4 Pt 2), H1118 - 23 Arteriolar endothelium-dependent vasodilation occurs during endotoxin shock; Baker CH et al.; Endotoxin shock has been reported to alter endothelial structure as well as function of large arteries from in vitro experiments . Cremaster muscle arteriolar dilator reactivity of pentobarbital-anesthetized rats was determined by videomicroscopy at control and 30, 90, 150, and 210 min after intravenous infusion of Escherichia coli endotoxin (6 mg/kg, 1-h period) . The dilator response was tested by intra-arterial injections of 90 ng acetylcholine (ACh) . At control A1, A2, and A3 arterioles dilated 45, 21, and 34%, respectively . Postendotoxin arterial pressure decreased progressively, the A1 arterioles constricted (P < 0.05), A2 diameters were unchanged and A3 diameters increased . Postendotoxin ACh dilations averaged 28, 23, and 25% . A1 dilation was significantly (P < 0.05) less than at control . Methylene blue (2.5 mg ia) attenuated the ACh response at control, but after endotoxin an intense downstream vasoconstriction resulted in stasis and reduced survival time occurred . Hydroquinone (HQ) partially blocked the responses to ACh postendotoxin . HQ significantly increased the survival time postendotoxin . It is evident postendotoxin that the endothelia of arterioles are functional and able to release nitric oxide (NO) throughout the entire survival period . The microvascular release of NO and the dilation response to ACh were substantially attenuated by methylene blue and HQ . The latter may block the more lethal effects of the inducible NO synthase. J Med Microbiol, 1993 Apr, 38(4), 250 - 5 The role of thymine starvation in the expression of type IV plasmid-encoded trimethoprim-resistant dihydrofolate reductase; Thomson CJ et al.; Hyperproduction of the type IV plasmid-encoded dihydrofolate reductase was studied in Escherichia coli J62-2 (pUK1123) . Hyperproduction of the enzyme was shown to occur not simply as a response to a given concentration of trimethoprim but also to the presence of thymidine in the medium . Before hyperproduction occurred the bacteria began to elongate and die, thus showing the symptoms of thymine starvation . Hyperproduction also required the presence of L-methionine, adenine and glycine, suggesting that the elevated production of the enzyme was a response to the ability of trimethoprim to starve the cell of thymine metabolites. J Clin Invest, 1993 Apr, 91(4), 1822 - 9 Recombinant platelet-derived growth factor B gene expression in porcine arteries induce intimal hyperplasia in vivo; Nabel EG et al.; Platelet-derived growth factor (PDGF) B chain induces cell proliferation in vitro and is associated with arterial lesions that cause cardiovascular disease . However, it has been difficult to document the biological response to PDGF B gene expression in arteries in vivo . To determine the biologic effects of this growth factor in vivo, we have introduced an eukaryotic expression vector plasmid encoding recombinant PDGF B by direct gene transfer into porcine iliofemoral arteries using DNA liposome complexes . The presence of PDGF B plasmid DNA and expression of recombinant mRNA were confirmed by polymerase chain reaction analysis, and recombinant PDGF protein was demonstrated by immunohistochemistry . Intimal thickening was observed in porcine arteries 21 days following transfection with the recombinant PDGF B gene compared with arteries transduced with a control gene, E . coli beta-galactosidase . An eightfold increase in intimal to medial ratio was present in PDGF B gene transfected arteries compared with control transfected arteries (P = 0.001) . This study suggests that expression of a recombinant PDGF B gene in vivo can play a role in the induction of intimal hyperplasia, which can lead to cardiovascular diseases. Comp Biochem Physiol B, 1993 Apr, 104(4), 803 - 10 Molecular cloning and expression of yellowfin porgy (Acanthopagrus latus houttuyn) growth hormone cDNA; Tsai HJ et al.; 1 . The growth hormone cDNA of yellowfin porgy (ypGH cDNA) consisted of 915 base pairs . 2 . The deduced amino acid (aa) sequence showed that the pre-GH comprised 204 residues, of which the first 17 residues formed a signal peptide . 3 . Comparison of aa sequence of ypGH to seabream, tuna, rainbow trout and chum salmon showed that ypGH shared 95.1, 94.1, 65.3 and 62.4% homology with these species, respectively . 4 . By expressing the ypGH cDNA in E . coli, a polypeptide around 23 kilodaltons (kDa) was found which was immunoreactive to GH antibody. Clin Chem, 1993 Apr, 39(4), 605 - 13 Characteristics and clinical application of a radiometric Escherichia coli-based phospholipase A2 assay modified for serum analysis; Aufenanger J et al.; Determination of activities of phospholipase A2 (PLA2) in human sera was based on the hydrolysis of phospholipids from {1-14C}oleic acid-labeled Escherichia coli biomembranes . The E . coli membranes served as substrate specifically for the PLA2 of human serum and were essentially resistant to other lipases in human sera, i.e., lipoprotein lipases, hepatic triacylglycerolipase, or pancreatic lipase in acute pancreatitis . Exchange of phospholipids between the serum and the biomembrane compartment aggravates the determination of PLA2 activity in human serum, which is naturally rich in phospholipids . In our modified E . coli assay, which overcomes these difficulties, the main substrate components phosphatidylethanolamine (70%) and cardiolipin (25%) were > 90% labeled in the sn-2 position . Fatty acids released by PLA2 activity were eluted from an aminopropyl solid-phase column directly into scintillation vials, where the radioactivity was counted . The ratio of {1-14C}oleic acid to released total fatty acids was used to calculate true enzymatic activity . The linear assay range extended from 0 to 3.6 U/L (0-60 nkat/L), with a detection limit of < 0.03 U/L (< 0.5 nkat/L) . Within-assay imprecision (CV) was < 6% and between-assay is < 10% over the whole activity range . The normal range for men was 0-0.44 U/L (0-7.33 nkat/L) and for women 0.044-1.11 U/L (0.73-18.4 nkat/L) . Patients with septicemia, pancreatitis, acute respiratory distress syndrome, or other severe diseases had PLA2 values up to 540 U/L (9000 nkat/L). Carcinogenesis, 1993 Apr, 14(4), 645 - 51 Mutation in Escherichia coli and mammalian cells induced by closely spaced 1-methylpyrene-deoxyadenosine adducts in opposite DNA strands; Kokontis JM et al.; Twenty-eight base complementary oligonucleotides were synthesized with deoxyadenosine residues modified at the N6 position with 1-methylpyrene (MP) specifically positioned 3 bp apart in opposite DNA strands . Doubly modified constructs as well as non-modified and singly modified constructs were ligated into M13mp19 and an SV40-based shuttle vector pSVL-lac for transfection into Escherichia coli and large T-antigen-expressing monkey kidney epithelial cells respectively . Repair of MP adducts was analyzed by direct nucleotide sequencing after selection of clones containing the 28mer construct . In E . coli, double MP adducts induced base substitutions at positions mainly adjacent to modified adenines, while single MP adducts were not mutagenic . Single base insertions were also induced proximal to modified adenines . The frequency of mutation induced by double MP adducts in E . coli was approximately 4% (eight mutations out of 196 analyzed) . In monkey kidney cells, double MP adducts induced one and three base deletions and single base insertions . Base substitution was observed in constructs containing non-modified and singly modified adenine residues, indicative of a significant spontaneous mutation rate . The frequency of mutation induced by double MP adducts in monkey kidney cells was approximately 9% (six mutations out of 66 clones analyzed) . Modification of adenine residues by MP caused termination of DNA replication by E . coli DNA polymerase I (Klenow fragment) in vitro at the position opposite the MP adduct and at the preceding base . The repair of closely spaced polycyclic aromatic hydrocarbon adducts in opposite DNA strands is discussed as it relates to mutagenesis and carcinogenesis in mammalian cells. Protein Expr Purif, 1993 Apr, 4(2), 164 - 75 Characterization of a truncated form of recombinant porcine growth hormone generated in vitro during solubilization of inclusion bodies; Puri NK et al.; During the development of a novel solubilization procedure (1) for bacterial inclusion bodies (IB's) using the cationic surfactant cetyltrimethylammonium chloride (CTAC; (CH3)3-N(+)-C16H33Cl) significant proportions of an apparently truncated, lower molecular weight (MW) variant form of recombinant pig growth hormone (rPGH) were observed on sodium dodecyl sulfate-polyacrylamide gel electrophoresis relative to pig pituitary derived GH . The formation of this rPGH-like species, designated P-band, was found to occur in vitro during solubilization of IB's by CTAC and was dependent on pH and temperature of solubilization, but was not due directly to the use of CTAC, as purified soluble rPGH of the correct MW could not be converted to P-band by exposure to CTAC alone . The bacterial proteolysis suspected as being responsible for the in vitro formation of P-band could not be inhibited by the use of a "cocktail" of defined antiproteolytic agents but was inhibited by pH and temperature, and by solubilization of IB's in 5% SDS, 6 M gnHCl or 7.5 M urea . Detailed characterization of the structure of P-band by N-terminal amino acid sequencing, electrospray mass spectrometry, radioreceptor binding assay, peptide mapping, and C-terminal peptide sequencing confirmed that P-band was approximately 950 mass units smaller than normal rPGH and lacked eight C-terminal amino acids . A significant finding was that P-band is unable to bind to the pig liver-membrane GH receptor in a competitive radioreceptor assay . Analysis of the relative secondary and tertiary structure of P-band by circular dichroism spectra, intrinsic tryptophan-dependent fluorescence, and average surface hydrophobicity (2) suggested small but measurable changes to the overall structure of P-band relative to normal rPGH . Consequently, our results also suggest that the C-terminal portion of rPGH, including in particular the last eight amino acids, is of major importance in the binding of rPGH to the pig liver membrane GH receptor. Mol Reprod Dev, 1993 Apr, 34(4), 349 - 56 Gene introduction into mouse blastocysts via "pricking"; Sato M et al.; It is a well-known phenomenon that cultured mammalian cells that have been pricked in the presence of foreign DNA can be transformed . This micromanipulation 'pricking' technique was applied to mouse blastocysts to determine whether uptake of exogenous DNA would occur in the embryos . The middle region of the inner cell mass (ICM) was pricked three times in each blastocyst in a medium containing a linearized plasmid DNA . When the 60 treated blastocysts were transferred to the uterine horns of pseudopregnant females, 30 developing fetuses (50%) at the mid-gestation stage were obtained . Twenty-two of the 30 fetuses (73%) had less than 1 copy of the foreign DNA per diploid cell, as revealed by polymerase chain reaction (PCR)-Southern analysis, a sensitive technique combined with Southern blot processing of the PCR products . The 8 other fetuses were negative for the foreign DNA . When blastocysts were pricked in the presence of vector DNA coupling E . coli beta-galactosidase (beta-gal) gene to a mouse metallothionein-I (MT-I) promoter and assessed for beta-gal activity histochemically after 1 and 5 days of culture in the presence of 1 microM CdCl2, at least 65% of the embryos exhibited beta-gal activity mainly in the ICM region . These results indicate that mouse blastocysts can be transfected with a relatively high efficiency after pricking, and that the introduced gene expression occurs . This approach provides a means of mapping the regulatory elements of genes that are active in the mouse blastocyst ICM, and may be useful in investigating the fate of the ICM cells in an intact blastocyst by labeling them via pricking technique. Biochem J, 1993 Apr 1, 291 ( Pt 1), 15 - 7 Large changes of transition-state structure during experimental evolution of an enzyme; Srinivasan K et al.; The question of whether, during the evolution of an enzyme, the transition state of the catalysed reaction is largely unchanged, or whether transition state and protein change together, was examined using the egb beta-galactosidases of Escherichia coli . Charge development at the first chemical state was assumed {Konstantinidis and Sinnott (1991) Biochem . J . 279, 587-593} to be proportional to delta delta G++, the ratio of second-order rate constants for the hydrolysis of beta-D-galactopyranosyl fluoride and 1-fluoro-D-galactopyranosyl fluoride, expressed as a free-energy difference . delta delta G++ (kJ.mol-1) falls from 10.4 for wild-type enzyme to 6.8 and 7.2 as a consequence of two different single amino-acid changes (which arise from single evolutionary events), to 6.3 as a consequence of the two amino-acid changes together, and then increases slightly to 7.3 as a consequence of a third single evolutionary change involving three further amino-acid changes. Biochem J, 1993 Apr 1, 291 ( Pt 1), 123 - 9 Importance of the evolutionarily conserved glycine residue in the N-terminal region of human cystatin C (Gly-11) for cysteine endopeptidase inhibition; Hall A et al.; Human cystatin C variants in which the evolutionarily conserved Gly-11 residue has been replaced by residues with positively charged (Arg), negatively charged (Glu), bulky hydrophobic (Trp), or small (Ser or Ala) side-chains have been produced by site-directed mutagenesis and expression in Escherichia coli . The five variants were isolated and structurally verified . Their inhibitory properties were compared with those of wild-type recombinant cystatin C by determination of the equilibrium constants for dissociation (Ki) of their complexes with the cysteine endopeptidases papain and human cathepsin B and with the cysteine exopeptidase dipeptidyl peptidase I . The Ser-11 and Ala-11 cystatin C variants displayed Ki values for the two endopeptidases that were approx . 20-fold higher than those of wild-type cystatin C, while the corresponding values for the Trp-11 . Arg-11 and Glu-11 variants were increased by a factor of about 2000 . In contrast, the Ki values for the interactions of all five variants with the exopeptidase differed from that of wild-type cystatin C by a factor of less than 10 . Wild-type cystatin C and the Ser-11, Ala-11 and Glu-11 variants were incubated with neutrophil elastase, which in all cases resulted in the rapid hydrolysis of a single peptide bond, between amino acid residues 10 and 11 . The Ki values for the interactions with papain of these three N-terminal-decapeptide-lacking cystatin C variants were 20-50 nM, just one order of magnitude higher than the value for N-terminally truncated wild-type cystatin C, which in turn was similar to the corresponding values for the full-length Glu-11, Arg-11 and Trp-11 variants . These data indicate that the crucial feature of the conserved Gly residue in position 11 of wild-type cystatin C is that this residue, devoid of a side-chain, will allow the N-terminal segment of cystatin C to adopt a conformation suitable for interaction with the substrate-binding pockets of cysteine endopeptidases, resulting in high-affinity binding and efficient inhibition . The functional properties of the remaining part of the proteinase contact area, which is built from more C-terminal inhibitor segments, are not significantly affected even when amino acids with bulky or charged side-chains replace the Gly-11 residue of the N-terminal segment. Arch Biochem Biophys, 1993 Apr, 302(1), 72 - 7 Inhibition of NAD(P)H:quinone acceptor oxidoreductase by flavones: a structure-activity study; Chen S et al.; A structure-activity study was carried out to determine the important regions of baicalein and oroxylin A, two flavones isolated from the Chinese herb Scutellariae radix, in inhibiting NAD(P)H:quinone acceptor oxidoreductase (EC 1.6.99.2; DT-diaphorase) . This quinone reductase is a vitamin K reductase . It is a target for and has been used as a model enzyme to investigate the mode of action of oral anticoagulants . The two flavones were found to inhibit this quinone reductase in nanomolar ranges . The 5-hydroxyl, 7-hydroxyl, 8-hydroxyl, and 2-phenyl groups of these flavones were found to be important for their inhibition of the enzyme . The inhibition profiles of the flavones on the NADH-menadione reductase activity, the NADH-potassium ferricyanide reductase activity, and the NADH-methyl red reductase activity of this enzyme were different . Therefore, even though the flavones were found to be competitive inhibitors with respect to NADH, they probably did not inhibit the enzyme by binding to the nicotinamide nucleotide binding site . Inhibition kinetic studies which indicated that these compounds bound to different sites than those for dicoumarol and phenindone were performed . These results indicate that these flavones are a new type of inhibitor of NAD(P)H:quinone acceptor oxidoreductase and potentially useful as anticoagulant drugs. Arch Biochem Biophys, 1993 Apr, 302(1), 128 - 33 Identification of the hydrophobic ligand-binding region in recombinant glutathione S-transferase P and its binding effect on the conformational state of the enzyme; Nishihira J et al.; Recombinant glutathione S-transferase P (GST-P) was purified in a homogeneous state . Fatty acid analysis of the enzyme revealed that the final enzyme preparation endogenously bound fatty acids, mostly palmitic acid or stearic acid, which were difficult to dissociate from the complex . Temperature-dependent analysis by 1H NMR indicated that the molecular motion of fatty acids was strongly restrained under physiological conditions, which was significantly different from that of serum albumin . On the other hand, there existed another hydrophobic ligand-binding region in GST-P, to which 1-amino-8-naphthalenesulfonic acid and bilirubin would bind with relatively lower affinity than the endogenously bound fatty acid . The hydrophobic ligand-binding region was determined to be around 141-156 residues from the N-terminus by procedures including association of the enzyme to fatty acid-linked Sepharose and affinity labeling with fluorescent fatty acid . Furthermore, circular dichroism analysis showed that the binding of hydrophobic ligand to GST-P produced a remarkable conformational change of the enzyme, which led to states devoid of transferase activity . In addition, the hydrophobic ligand binding caused a significant fluorescence quenching of tryptophan 38, which was assumed to be located at the active center of GST-P . It could be the result of a conformational change of the active center of the enzyme. J Gen Virol, 1993 Apr, 74 ( Pt 4), 623 - 30 Molecular cloning and expression in Escherichia coli of the glycoprotein gene of VHS virus, and immunization of rainbow trout with the recombinant protein; Lorenzen N et al.; The gene encoding the envelope glycoprotein of a recent Danish isolate of a salmonid rhabdovirus, viral haemorrhagic septicaemia virus (VHSV) has been cloned and sequenced at the cDNA level . When compared with the deduced sequence of a French isolate of VHSV, it was noted that there were 13 amino acid substitutions in the Danish virus . Amino acid homologies with the glycoprotein of a North American salmonid rhabdovirus (infectious haematopoietic necrosis virus) indicate a high degree of structural similarity between the two fish rhabdovirus glycoproteins . Results from partial enzymatic deglycosylation of the viral protein indicate that all four NXT/S sites found in the sequence are N-glycosylated in the virus . The glycoprotein, without the N-terminal leader sequence and C-terminal hydrophobic anchor segment, was expressed in Escherichia coli as a factor Xa protease-cleavable fusion protein . The purified and renatured viral part of the recombinant protein was able to elicit VHSV-specific antibodies and neutralizing antibody activity in serum when injected into rainbow trout. J Bacteriol, 1993 Apr, 175(8), 2455 - 7 The Ada protein is a class I transcription factor of Escherichia coli; Sakumi K et al.; The methylated Ada protein of Escherichia coli, a regulatory protein for the adaptive response, binds to a target DNA from positions -62 to -31 upstream of the ada gene and facilitates the binding of RNA polymerase to the promoter . Mutant RNA polymerases consisting of C-terminal-deleted alpha subunits are virtually inactive in response to activation by the Ada protein . Thus, we conclude that the Ada protein is a class I transcription factor which requires the C-terminal region of the RNA polymerase alpha subunit for transcription activation. J Bacteriol, 1993 Apr, 175(8), 2448 - 50 Expression of gonococcal transferrin-binding protein 1 causes Escherichia coli to bind human transferrin; Cornelissen CN et al.; The gene for gonococcal transferrin-binding protein 1 (TBP1) was cloned behind an inducible promoter in Escherichia coli . The resultant strain was capable of binding human transferrin with the same specificity as that of the gonococcus . E . coli expressing TBP1 did not internalize transferrin-bound iron or grow on transferrin as a sole iron source. J Bacteriol, 1993 Apr, 175(8), 2423 - 35 Structure, function, and regulation of the kilB locus of promiscuous plasmid RK2; Thomson VJ et al.; The kil-kor regulon of the self-transmissible, broad-host-range plasmid RK2 is a unique network with eight coregulated operons . Among the genes encoded by the kil-kor regulon are trfA, which encodes the replication initiator, and several kil loci (kilA, kilB, kilC, and kilE), each of which is lethal to the host cell in the absence of appropriate negative regulatory elements encoded by the korA, korB, korC, and korE determinants . We have proposed that the functions of the kil loci are related to RK2 maintenance or host range . Here, we report the nucleotide sequence of a 2.44-kb region that includes the lethal kilB determinant . We identified the first three genes of the kilB operon (designated klbA, klbB, and klbC), and we determined by deletion analysis that the host-lethal phenotype requires klbB . The predicted amino acid sequence of the 34,995-Da klbA product reveals a potential ATP-binding fold . The klbB product is predicted to be a membrane protein with a molecular mass of 15,012 Da with homology to the RK2 KlaC membrane protein encoded by the kilA operon . The amino acid sequence of the 12,085-Da klbC product contains a perfect match to the leucine zipper motif common to eukaryotic regulatory proteins . Primer extension analysis revealed unambiguously that transcription of the kilB operon begins 46 nucleotides upstream of klbA . No transcription was initiated from the sequence previously presumed by other investigators to be the kilB promoter . The abundance of kilB transcripts is reduced in the presence of KorB, consistent with the prediction that KorB acts at the level of transcription . A degenerate KorB-binding site that contains a perfect half-palindrome overlaps the kilB promoter, but this site is insufficient for regulation by KorB . The region containing a KorB-binding site located 183 bp upstream of the transcriptional start is required for regulation by KorB, indicating that KorB acts at a distance to regulate transcription of kilB . Our studies with the mutant plasmid pRP101, a transfer-defective derivative of the RK2-like plasmid RP4, demonstrated that the kilB operon includes the conjugal transfer and surface exclusion genes of the Tra2 region . Nucleotide sequence analysis revealed that the transposon Tn7 insertion in pRP101 is located in the klbC gene, and complementation analysis showed that this mutation has a strong polar effect on the expression of genes for conjugal transfer and surface exclusion located several kilobases downstream . A klbA mutant was constructed and found to be both transfer defective and complementable, thus, demonstrating a requirement was constructed and found to be both transfer defective and complementable, thus demonstrating a requirement for klbA product in plasmid transmissibility . These results have demonstrated a role for the kilB operon in conjugal transfer . The kil-kor regulon of RK2 is the only known example of plasmid-mediated coregulation of replication and transfer. J Bacteriol, 1993 Apr, 175(8), 2407 - 13 The Rhodobacter capsulatus chlorin reductase-encoding locus, bchA, consists of three genes, bchX, bchY, and bchZ; Burke DH et al.; The bchA locus of Rhodobacter capsulatus codes for the chlorin reductase enzyme in the bacteriochlorophyll synthesis pathway . Previous work has suggested that this locus might encompass a single gene . We have sequenced the bchA locus and found it to contain three coding segments, which we designate bchX, bchY, and bchZ . Each coding segment contains its own translational initiation sequence and follows codon utilization patterns consistent with those of previously published R . capsulatus genes . When various regions of the bchA locus and flanking sequences were subcloned into an expression vector and expressed in Escherichia coli, the three coding segments were all expressed as separate peptides . Finally, conservation of amino acid sequences between bchX and a subunit of the protochlorophyllide reductase (bchL, 34% identity) and the nitrogenase Fe protein (nifH, 30 to 37% identity) suggests structural and mechanistic commonalities among all three proteins. J Bacteriol, 1993 Apr, 175(8), 2363 - 9 Genetic evidence that promoter P2 is the physiologically significant promoter for the pyrBI operon of Escherichia coli K-12; Liu C et al.; The pyrBI operon of Escherichia coli K-12 encodes the two nonidentical subunits of the pyrimidine biosynthetic enzyme aspartate transcarbamylase (ATCase) . Expression of this operon is negatively regulated by pyrimidine availability primarily through UTP-sensitive transcriptional attenuation and, to a lesser extent, at the level of transcriptional initiation . Previous studies indicated that the pyrBI operon was transcribed from tandem sigma 70 promoters designated P1 and P2, with the large majority of transcription initiated at the more downstream promoter P2 . To more clearly define the roles of these promoters, mutations that severely impair or inactivate individual promoters were constructed in the chromosomal pyrBI operon, and their effects on ATCase synthesis were measured . In cells grown under conditions of either pyrimidine excess or pyrimidine limitation, more than 99% of all ATCase synthesis was directed by transcripts initiated at promoter P2, indicating that it is the only physiologically significant pyrBI promoter . However, mutations that effectively inactivate promoter P1 caused a 15% reduction in ATCase levels, apparently by inhibiting transcription from promoter P2 by an unknown mechanism . Support for this explanation was provided by the demonstration that little, if any, transcriptional initiation occurred at promoter P1 in a transcriptional fusion vector whereas a high level of transcription was initiated at promoter P2 in an equivalent construction . Our results also provide evidence for pyrimidine-mediated regulation of transcriptional initiation at promoter P2 over a severalfold range and show that cells can grow reasonably well with very low levels of ATCase, apparently because of changes in the concentration of allosteric effectors that increase the specific activity of the enzyme. J Bacteriol, 1993 Apr, 175(8), 2321 - 6 AppppA-binding protein E89 is the Escherichia coli heat shock protein ClpB; Fuge EK et al.; Dinucleotide AppppA (5',5'''-P1,P4-diadenosine tetraphosphate) is rapidly synthesized in Escherichia coli cells during heat shock . apaH mutants lack AppppN hydrolase activity and, therefore, contain constitutively levels of AppppA, which affect several cellular processes . However, the precise role of AppppA remains undetermined . Photo-crosslinking experiments with radioactively labelled azido-AppppA have shown that a number of proteins, including heat shock proteins DnaK and GroEL, specifically bind to AppppA . Several other unidentified proteins (C40, C45, and E89) also bind strongly to AppppA . In this work, we have identified the AppppA-binding protein E89 as heat shock protein ClpB . In addition, since ClpB belongs to a family of proteins implicated in proteolysis, we have examined the effects of apaH mutants on protein degradation . Constitutively elevated levels of AppppA stimulate lon-independent proteolysis only in heat-shocked cells . We also show that overproduction of ClpB from a plasmid rescues apaH mutants from sensitivity to killing by heat. J Bacteriol, 1993 Apr, 175(8), 2255 - 62 A mutation of Escherichia coli SecA protein that partially compensates for the absence of SecB; McFarland L et al.; The Escherichia coli SecB protein is a cytosolic chaperone protein that is required for rapid export of a subset of exported proteins . To aid in elucidation of the activities of SecB that contribute to rapid export kinetics, mutations that partially suppressed the export defect caused by the absence of SecB were selected . One of these mutations improves protein export in the absence of SecB and is the result of a duplication of SecA coding sequences, leading to the synthesis of a large, in-frame fusion protein . Unexpectedly, this mutation conferred a second phenotype . The secA mutation exacerbated the defective protein export caused by point mutations in the signal sequence of pre-maltose-binding protein . One explanation for these results is that the mutant SecA protein has sustained a duplication of its binding site(s) for exported protein precursors so that the mutant SecA is altered in its interaction with precursor molecules. J Bacteriol, 1993 Apr, 175(8), 2241 - 7 Plasmolysis bays in Escherichia coli: are they related to development and positioning of division sites? Mulder E, Woldringh CL. Plasmolysis bays, induced in Escherichia coli by hypertonic treatment, are flanked by zones of adhesion between the plasma membrane and the cell wall . To test the proposition of Cook et al . (W . R . Cook, F . Joseleau-Petit, T . J . MacAlister, and L . I . Rothfield, Proc . Natl . Acad . Sci . USA 84:7144-7148, 1987) that these zones, called periseptal annuli, play a role in determining the division site, we analyzed the positions of these zones by phase-contrast and electron microscopy . In situ treatment of cells grown in agar showed that the youngest cell pole was the most susceptible to plasmolysis, whereas the constriction site was resistant . Lateral bays occurred only at some distance from a polar bay or a resistant constriction site . Orienting cells with their most prominently plasmolyzed polar bay in one direction showed that the lateral bays were always displaced away from the polar bay at about half the distance to the other cell pole . If no poles were plasmolyzed, lateral bays occurred either in the centers of nonconstricting cells or at the 1/4 or 3/4 position of cell length in constricting cells . The asymmetric positions of lateral plasmolysis bays, caused by their abrupt displacement in the presence of polar bays or constriction sites, does not confirm the periseptal annulus model (Cook et al.), which predicts a gradual and symmetric change in the position of lateral bays with increasing cell length . Our analysis indicates that plasmolysis bays have no relation to the development and positioning of the future division site. J Bacteriol, 1993 Apr, 175(8), 2221 - 8 Characterization of the Escherichia coli F factor traY gene product and its binding sites; Nelson WC et al.; The traY gene product (TraYp) from the Escherichia coli F factor has previously been purified and shown to bind a DNA fragment containing the F plasmid oriT region (E . E . Lahue and S . W . Matson, J . Bacteriol . 172:1385-1391, 1990) . To determine the precise nucleotide sequence bound by TraYp, DNase I footprinting was performed . The TraYp-binding site is near, but not coincident with, the site that is nicked to initiate conjugative DNA transfer . In addition, a second TraYp binding site, which is coincident with the mRNA start site at the traYI promoter, is described . The Kd for each binding site was determined by a gel mobility shift assay . TraYp exhibits a fivefold higher affinity for the oriT binding site compared with the traYI promoter binding site . Hydrodynamic studies were performed to show that TraYp is a monomer in solution under the conditions used in DNA binding assays . Early genetic experiments implicated the traY gene product in the site- and strand-specific endonuclease activity that nicks at oriT (R . Everett and N . Willetts, J . Mol . Biol . 136:129-150, 1980; S . McIntire and N . Willetts, Mol . Gen . Genet . 178:165-172, 1980) . As this activity has recently been ascribed to helicase I, it was of interest to see whether TraYp had any effect on this reaction . Addition of TraYp to nicking reactions catalyzed by helicase I showed no effect on the rate or efficiency of oriT nicking . Roles for TraYp in conjugative DNA transfer and a possible mode of binding to DNA are discussed. J Bacteriol, 1993 Apr, 175(8), 2184 - 8 Highly selective binding of nascent polypeptides by an Escherichia coli chaperone protein in vivo; Kumamoto CA et al.; Chaperone proteins bind to newly synthesized polypeptides and assist in various assembly reactions . The Escherichia coli chaperone protein SecB binds precursors of exported proteins and assists in export . In vitro, SecB can bind to many unfolded proteins . In this report, we demonstrate that SecB binding in vivo is highly selective; the major polypeptides that are bound by SecB are nascent precursors of the exported proteins maltose-binding protein (MBP), LamB, OmpF, and OmpA . These results support the hypothesis that the primary physiological function of SecB is to stimulate protein export . By interacting with nascent polypeptides, SecB probably stimulates their cotranslational association with the membrane-bound protein translocation apparatus. Int J Biochem, 1993 Apr, 25(4), 575 - 9 PLA2 activity in rat liver nuclei; van der Klis FR et al.; 1 . Subcellular fractions of rat liver were assayed for PLA2 activity . 2 . The PLA2 assay measures the release of {3H}oleic acid from phospholipids, using labeled E . coli as substrate . 3 . Nuclear fractions contained PLA2 activity, which was Ca2+ dependent and could not be explained from mitochondria, microsomal or plasma membrane contamination . 4 . The Vmax value of nuclear PLA2 is 0.30 +/- 0.04 pmol oleic acid/min/mg protein; its Km value is 0.86 +/- 0.12 microM, similar to that of mitochondrial PLA2 . 5 . We conclude that rat liver nuclei contain PLA2 activity. EMBO J, 1993 Apr, 12(4), 1311 - 9 Structure of the HMG box motif in the B-domain of HMG1; Weir HM et al.; The conserved, abundant chromosomal protein HMG1 consists of two highly homologous, folded, basic DNA-binding domains, each of approximately 80 amino acid residues, and an acidic C-terminal tail . Each folded domain represents an 'HMG box', a sequence motif recently recognized in certain sequence-specific DNA-binding proteins and which also occurs in abundant HMG1-like proteins that bind to DNA without sequence specificity . The HMG box is defined by a set of highly conserved residues (most distinctively aromatic and basic) and appears to define a novel DNA-binding structural motif . We have expressed the HMG box region of the B-domain of rat HMG1 (residues 88-164 of the intact protein) in Escherichia coli and we describe here the determination of its structure by 2D 1H-NMR spectroscopy . There are three alpha-helices (residues 13-29, 34-48 and 50-74), which together account for approximately 75% of the total residues and contain many of the conserved basic and aromatic residues . Strikingly, the molecule is L-shaped, the angle of approximately 80 degrees between the two arms being defined by a cluster of conserved, predominantly aromatic, residues . The distinctive shape of the HMG box motif, which is distinct from hitherto characterized DNA-binding motifs, may be significant in relation to its recognition of four-way DNA junctions. EMBO J, 1993 Apr, 12(4), 1277 - 82 Excess capacity of H(+)-ATPase and inverse respiratory control in Escherichia coli; Jensen PR et al.; With succinate as free-energy source, Escherichia coli generating virtually all ATP by oxidative phosphorylation might be expected heavily to tax its ATP generating capacity . To examine this the H(+)-ATPase (ATP synthase) was modulated over a 30-fold range . Decreasing the amount of H(+)-ATPase reduced the growth rate much less than proportionally; the H(+)-ATPase controlled growth rate by < 10% . This lack of control reflected excess capacity: the rate of ATP synthesis per H(+)-ATPase (the turnover number) increased by 60% when the number of enzymes was decreased by 40% . At 15% H(+)-ATPase, the enzyme became limiting and its turnover was increased even further, due to an increased driving force caused by a reduction in the total flux through the enzymes . At smaller reductions of {H(+)-ATPase} the total flux was not reduced, revealing a second cause for increased turnover number through increased membrane potential: respiration was increased, showing that in E.coli, respiration and ATP synthesis are, in part, inversely coupled . Indeed, growth yield per O2 decreased, suggesting significant leakage or slip at the high respiration rates and membrane potential found at low H(+)-ATPase concentrations, and explaining that growth yield may be increased by activating the H(+)-ATPase. DNA Cell Biol, 1993 Apr, 12(3), 209 - 15 5' structure and expression of human glucose-6-phosphate dehydrogenase mRNA; Kanno H et al.; The human glucose-6-phosphate (G6PD) cDNAs cloned from normal and carcinoma cells can encode 545-amino-acid residues starting from the first in-frame chain initiation codon . However, it was reported that the G6PD mRNAs of carcinoma cell lines were shorter and could encode only 515-amino-acid residues (Martini et al., 1986) . We demonstrated the existence of two major G6PD mRNAs in normal reticulocytes, lymphoblasts, and hepatocytes by the primer extension analysis . The longer mRNA has a cap site at approx . nucleotide -166 and can encode 545-amino-acid residues, whereas the shorter mRNA has a cap site at approx . nucleotide -66, and encodes 515-amino-acid residues . These two naturally existing mRNAs (cDNAs) and an artificially truncated mRNA, which can encode the carboxy-terminal 479-amino-acid residues of the subunit, were expressed in the in vitro reticulocyte and wheat germ systems and in the in vivo E . coli system . All three species of mRNA (cDNA) were efficiently translated and produced proteins with the expected molecular sizes . The peptide with 515 residues formed the catalytically active enzyme, but the 545-residue protein and the 479-residue protein were catalytically inactive . The larger 545-residue protein may correspond to the larger G6PD precursor observed in the rat . The extended amino-terminal region encoded by the larger mRNA contains the -Arg-Gly-Gly-Arg-Arg-Arg-Arg-sequence, which is conserved in the nucleotide-binding protamine family. Proc Natl Acad Sci U S A, 1993 Apr 1, 90(7), 3088 - 92 Soluble antigen profoundly reduces memory B-cell numbers even when given after challenge immunization; Nossal GJ et al.; The splenic B-cell repertoire of unimmunized C57BL/6 mice can be examined for anti-(4-hydroxy-3-nitrophenyl)acetyl (NP) B cells of relatively high affinity by using a dual strategy . First, limiting numbers of splenocytes are polyclonally activated by Escherichia coli lipopolysaccharide and a mixture of interleukins 2, 4, and 5 in the presence of 3T3 filler cells, thus ensuring that many B-cell clones switch to IgG1 antibody production . Second, an enzyme-linked immunosorbent assay is geared to register only higher-affinity antibody by (i) detecting only bivalent IgG1 antibody and ignoring IgM and (ii) using a lowly substituted NP-conjugated protein as the capture layer . Naive spleens contain very few higher-affinity anti-NP B cells thus defined, but thymus (T)-dependent immunization causes the appearance of approximately 10(5) per spleen within 2 weeks . The development of these clonable anti-NP antibody-forming cell precursors can be virtually eliminated by a single injection of 1 mg of soluble, freshly deaggregated NP2-human serum albumin (HSA) . This toleragen works not only if injected prior to challenge immunization, but even if given up to 6 days later . Soluble HSA works partially but not nearly as well as NP2-HSA, suggesting the possibility that the toleragen must act on T and B cells . NP conjugated to irrelevant carriers achieved partial tolerance in only one of four experiments . The studies demonstrate the need for continuing T-cell help throughout the process of memory B-cell generation . They also show that those recently activated T cells involved in this process can be silenced in vivo by soluble toleragen. Proc Natl Acad Sci U S A, 1993 Apr 1, 90(7), 3058 - 62 Molecular cloning and expression of cDNA for mammalian translation initiation factor 5; Das K et al.; Eukaryotic translation initiation factor 5 (eIF-5) catalyzes the hydrolysis of GTP bound to the 40S ribosomal initiation complex (40S.AUG.Met-tRNAf-eIF-2.GTP) with the subsequent joining of a 60S ribosomal subunit resulting in the formation of a functional 80S initiation complex . A rat cDNA that encodes eIF-5 has been isolated and expressed in Escherichia coli to yield a catalytically active eIF-5 protein . The 3.55-kb cDNA encodes a protein of 429 amino acids (calculated M(r) 48,926) with properties that are similar to eIF-5 isolated from rabbit reticulocyte lysates . The deduced amino acid sequence of eIF-5 contains sequence motifs characteristic of proteins of the GTPase superfamily. Proc Natl Acad Sci U S A, 1993 Apr 1, 90(7), 2754 - 8 Cysteine desulfurase activity indicates a role for NIFS in metallocluster biosynthesis; Zheng L et al.; Biological nitrogen fixation is catalyzed by nitrogenase, a complex metalloenzyme composed of two separately purifiable component proteins encoded by the structural genes nifH, nifD, and nifK . Deletion of the Azotobacter vinelandii nifS gene lowers the activities of both nitrogenase component proteins . Because both nitrogenase component proteins have metallocluster prosthetic groups that are composed of iron- and sulfur-containing cores, this result indicated that the nifS gene product could be involved in the mobilization of the iron or sulfur required for metallocluster formation . In the present work, it is shown that NIFS is a pyridoxal phosphate-containing homodimer that catalyzes the formation of L-alanine and elemental sulfur by using L-cysteine as substrate . NIFS activity is extremely sensitive to thiol-specific alkylating reagents, which indicates the participation of a cysteinyl thiolate at the active site . Based on these results we propose that an enzyme-bound cysteinyl persulfide that requires the release of the sulfur from the substrate L-cysteine for its formation ultimately provides the inorganic sulfide required for nitrogenase metallocluster formation . The recent discovery of nifS-like genes in non-nitrogen-fixing organisms also raises the possibility that the reaction catalyzed by NIFS represents a universal mechanism that involves pyridoxal phosphate chemistry, in the mobilization of the sulfur required for metallocluster formation. Proc Natl Acad Sci U S A, 1993 Apr 1, 90(7), 2715 - 8 Cocatalytic zinc motifs in enzyme catalysis; Vallee BL et al.; Cocatalytic zinc binding sites are characteristic of enzyme molecules which contain two or more zinc and/or other metal atoms . In each site an aspartate, glutamate, or histidine residue simultaneously binds to two zinc atoms or a zinc and a different metal atom . In the resultant amino acid bridge, two of the cocatalytic metal atoms bind to the same amino acid . Consequently the participating metal atoms are in close proximity and function as a catalytic unit, typical of this motif . In these functional units aspartate seems to be preferred over glutamate . Serine, threonine, tryptophan, and lysine residues are encountered as zinc ligands, although they have not so far been identified as ligands in monozinc enzymes or DNA-binding zinc proteins . The resultant coordination spheres and their mechanistic implications raise interesting questions for further study. Proc Natl Acad Sci U S A, 1993 Apr 1, 90(7), 2651 - 5 Expression of truncated forms of liver microsomal P450 cytochromes 2B4 and 2E1 in Escherichia coli: influence of NH2-terminal region on localization in cytosol and membranes; Pernecky SJ et al.; The currently accepted model for the membrane topology of microsomal cytochrome P450 is that of a largely cytoplasmic domain bound by only one or two transmembrane segments at the NH2 terminus . However, as we have reported previously, P450 2E1 lacking the hydrophobic NH2-terminal signal peptide, like the full-length protein, is located in the inner cell membrane when expressed in Escherichia coli and is active with typical substrates . In the present study, additional variants of alcohol-inducible P450 2E1 as well as truncated forms of phenobarbital-inducible P450 2B4 were similarly expressed to determine the influence of the NH2-terminal region on the membrane-binding properties . After deletion of S1 (the NH2-terminal hydrophobic segment), or both S1 and L1 (the following hydrophilic region, expected to be lumenal or cytosolic), one-third of the resulting P450 2B4 (delta 2-20) and 2B4 (delta 2-27) remained membrane bound . Furthermore, the idea that the first two hydrophobic segments are required for attachment by a hairpin loop is not supported by the finding that after deletion of the S1, L1, and S2 segments about half of the P450 2E1 (delta 3-48) remained membrane bound . Since Na2CO3 treatment of the membrane fraction had no significant effect, the findings are apparently not attributable to a loose attachment or occlusion of the truncated proteins . The replacement of neutral amino acids by positively charged residues in positions 3 and 8 of P450 2E1 (delta 3-29) changed the amount in the cytosol from 35% to 50%, and the deletion of residues 2-20 or 2-27 from P450 2B4, which resulted in positive charges occurring in the NH2-terminal region, changed the amount in the cytosol from 27% to 67% . We conclude that alterations in the NH2-terminal region can change the location of the cytochrome from largely membranous to largely cytosolic and that the first two hydrophobic segments are not uniquely involved in membrane attachment. Magn Reson Med, 1993 Apr, 29(4), 441 - 5 Nuclear magnetic resonance Hahn spin-echo decay (T2) in live rats with endotoxin lung injury; Shioya S et al.; To determine the possibility of using nuclear magnetic resonance imaging to study experimentally induced lung injury, we measured in the lungs of spontaneously breathing living rats the time course of both the Hahn spin-echo decay (T2) and the proton density after endotoxin injury . In order to minimize artifacts arising from motions of the nearby chest wall and heart, we used a motion-insensitive technique (the interleaved line scan) . A typical Hahn T2 measurement was obtained over a region of interest from a series of images each with a different echo time, which ranged from 16 to 110 ms . Lung water content was determined by integrating the proton density over the region of interest . The Hahn T2 and proton density were measured before and at 1, 3, 6, and 9 h after intravenous injection of endotoxin . The effects of the treatment administered before and after endotoxin injection were also evaluated . Endotoxin treatment caused lengthening of both fast (T2f) and slow (T2s) Hahn T2 components but had no significant effect on the proton density, consistent with the notion that endotoxin causes lung injury without significant lung water accumulation in rats . However, the methylprednisolone treatment prevented the lengthening of T2s but did not seem to have a significant effect on T2f . Our results suggest that NMR imaging can be used to detect and monitor experimental lung injury in intact living animals, even in the absence of variations of lung water content. J Neurosci, 1993 Apr, 13(4), 1730 - 50 Neurons, astrocytes, and oligodendrocytes of the rat cerebral cortex originate from separate progenitor cells: an ultrastructural analysis of clonally related cells; Luskin MB et al.; The diverse array of neurons and glia in the mammalian cerebral cortex arises from proliferating cells of the ventricular zone that surrounds the lateral ventricles of the developing brain . A fundamental but unresolved question is whether the individual cells of the ventricular zone are committed to producing progeny of only one particular phenotype or whether they generate progeny of more than one phenotype . We have begun to address this question by asking if individual cells of the ventricular zone generate exclusively neurons or glia at the onset of cortical neurogenesis in the rat . To assess the phenotypes of cells derived from a common progenitor cell, retroviral-mediated gene transfer was used to introduce the reporter gene, Escherichia coli beta-galactosidase, into ventricular zone cells at embryonic day 15 or 16 . We used histochemistry to reveal beta-galactosidase-expressing cells in the mature rat cerebral cortex . Isolated clusters of beta-galactosidase-expressing cells, presumably clones, were identified in serial sections . Since the histochemical reaction product is electron dense, each cell could be examined at the ultrastructural level and assigned definitively to one of the major classes of cells in the cerebral cortex on the basis of well-established morphological criteria . This approach overcomes the problems of cell type identification encountered with light microscopy, where it is not always possible to distinguish between different cell phenotypes . We found that virtually all clones contained cells of exclusively one type: either all astrocytes, all oligodendrocytes, or all neurons . Furthermore, each particular cell type exhibited a different pattern and intensity of staining . The neuronal clones, with one exception, were composed of either all pyramidal cells (projection neurons), or all nonpyramidal cells (interneurons) . The size and composition of neuronal clones did not seem related to their position in the cerebral cortex . Collectively, our observations indicate that separate progenitor cells exist for pyramidal neurons, nonpyramidal neurons, astrocytes, and oligodendrocytes . The striking phenotypic homogeneity in the clones arising from individual progenitor cells suggests that by the onset of cortical neurogenesis, at least some lineage restrictions have already occurred among the precursor cell population . Thus, our results suggest that lineage may play a pivotal role in determining some of the functionally important phenotypic attributes of cells in the cerebral cortex. J Neurosci, 1993 Apr, 13(4), 1533 - 42 Nerve growth factor is a potent inducer of proliferation and neuronal differentiation for adult rat chromaffin cells in vitro; Tischler AS et al.; Adult rat chromaffin cells in vitro show a large proliferative response to NGF, followed by neuronal differentiation . Infection of replicating chromaffin cells with a retrovirus carrying the Escherichia coli beta-galactosidase (beta-gal) gene demonstrates beta-gal expression in cells that continue to multiply, that differentiate into neurons, and that become static . The effects of NGF on proliferation and differentiation are abolished by the protein kinase inhibitors K252a and staurosporine, and by cholera toxin, an activator of adenylate cyclase . They are diminished, but not abolished, by high concentrations of dexamethasone . Both cholera toxin alone and phorbol myristate acetate (PMA), an activator of protein kinase C, elicit small and inconsistent mitogenic responses . The responses to PMA cannot be shown to be additive with the effects of NGF . NGF is a known mitogen and neuritogen for chromaffin cells from neonatal rats, but has not previously been believed to affect similarly chromaffin cells from adults . The present findings suggest that portions of NGF signaling pathways might continue to be involved in regulating proliferation of adult rat chromaffin cells in vivo, and might be constitutively activated in PC12 cells and other adrenal medullary tumors . They further suggest that rat chromaffin cells might be propagated in vitro to obtain large numbers of sympathetic neurons expressing normal or exogenous genes. J Clin Microbiol, 1993 Apr, 31(4), 851 - 6 Characterization of enterotoxigenic Escherichia coli isolated from U.S . troops deployed to the Middle East; Wolf MK et al.; Enterotoxigenic Escherichia coli (ETEC) was a common cause of traveler's diarrhea in U.S . soldiers in the Middle East in 1989 and 1990 . To determine which bacterial components would be useful in a vaccine, potential protective antigens (toxin, colonization factor antigen {CFA}, and serotype) from 189 ETEC isolates were examined . Nearly half of the isolates expressed both ETEC toxins, 39% had only heat-stable enterotoxin (ST), and 17% had heat-labile enterotoxin (LT) . CFA/I was the least common colonization factor antigen (11%), CFA/II was common (34%), as was CFA/IV (31%), and 24% expressed none of these CFAs . Fifty-seven O:H serotypes were found . Serotype O6:H16 was the most common, occurring in 29% of the ETEC isolates, usually with LT-ST and CFA/II . Generally, CFA/II was associated with expression of both toxins, CFA/IV was associated with expression of ST, and none of the CFAs was routinely found with LT . We conclude that ETEC from soldiers in the Middle East expressed a variety of antigens and that an effective vaccine will require multiple protective antigens. Genetics, 1993 Apr, 133(4), 763 - 73 The Cs sec mutants of Escherichia coli reflect the cold sensitivity of protein export itself; Pogliano KJ et al.; We have found that temperature can have a striking effect upon protein export in Escherichia coli, suggesting that there is a cold-sensitive step in the protein export pathway . Cs mutations comprise the largest class of mutations affecting the membrane-localized Sec proteins SecD, SecE, SecF and SecY . Although some of these mutations could encode cold-labile proteins, this is unlikely to account for the Cs phenotype of most export mutants, as mutations which simply produce lower amounts of SecE protein have the same phenotype . Certain signal sequence mutations affecting maltose binding protein are also cold sensitive for export . These effects appear to arise by a specific interaction of cold with certain export defects . We believe that the Cs sec mutations are representative of a large class of conditional lethal mutations, whose conditional phenotype reflects an underlying thermal sensitivity of the process in which they are involved. Blood, 1993 Apr 1, 81(7), 1833 - 40 Mechanism of the chromosomal translocation t(14;18) in lymphoma: detection of a 45-Kd breakpoint binding protein; Jaeger U et al.; The translocation t(14;18) between the BCL-2 oncogene and the Ig heavy chain (IgH) gene provides the molecular basis for the development of follicular lymphomas . The illegitimate recombination occurs in early B cells . While V(D)J-recombinase is most likely involved on the chromosome 14 part, little is known about the mechanism of breakage on chromosome 18 . We investigated the BCL-2 breakpoint regions for their structural vulnerability and protein binding capacity . We found that the major breakpoint region (mbr) contains an S1 nuclease-sensitive site and is the target of an endogenous nuclease present in early B cells . A 45 Kd nuclear protein (bp45) from early B cell extracts binds to a homopurine-homopyrimidine stretch (GGGAGGACGGGAGGAAGGCG) in the mbr, which is homologous to a recombinatorial element in Escherichia coli (CHI) . The protein also binds to homologous sequences in the minor breakpoint cluster region (mcr) and in the IgH locus . The localization of the binding sites on both chromosomes as well as the tissue distribution of bp45 suggest that this protein-DNA interaction is involved in the translocation t(14;18) . The DNA binding motif is also present at other translocation breakpoints indicating a more general role for this mechanism. Virology, 1993 Apr, 193(2), 924 - 31 A unique conformation at the carboxyl terminus of the small hepatitis delta antigen revealed by a specific monoclonal antibody; Hwang SB et al.; Two forms of the hepatitis delta antigen (HDAg), a small (24 kDa) and a large (27 kDa) one, have different functions in the hepatitis delta virus (HDV) replication cycle . The small HDAg trans-activates RNA replication, while the large one inhibits RNA replication . The lack of the trans-acting activity in the large HDAg, even though it contains the complete sequence of small HDAg, suggests that the large HDAg lacks a certain functional conformation . To test such a possibility, monoclonal antibodies (MAbs) were generated from mice immunized with recombinant baculovirus-expressed small HDAg . As expected, most of the MAbs recognized both small and large HDAg . In addition, one MAb (9E4) was obtained which recognized only the small HDAg, but not the large one, in Western blot and immunoprecipitation analysis, suggesting that it recognized an epitope unique to small HDAg . However, MAb 9E4 detected both forms of HDAg in virus-infected cells by immunofluorescence and reacted with TrpE-large HDAg fusion proteins expressed in Escherichia coli, suggesting that this MAb recognizes a conformation-dependent epitope which is not present in the native large HDAg molecule but is detectable in LHDAg when its conformation is altered . The 9E4 epitope was mapped within a region of 32 amino acids at the carboxyl-terminus of small HDAg, indicating that this region contains a unique conformation not present in the native molecule of large HDAg . Since this is the only structure identified that is unique to small HDAg, the C-terminal region may contain the domain associated with the biological activities unique to the small HDAg. Virology, 1993 Apr, 193(2), 868 - 76 Phylogenetic analysis of the N8 neuraminidase gene of influenza A viruses; Saito T et al.; Phylogenetic analysis of the N8 neuraminidase (NA) genes from 18 influenza A viruses, representing equine and avian hosts in different geographic locations, revealed three major lineages: (i) currently circulating equine 2 viruses; (ii) avian viruses isolated in the Eurasian region, including A/Equine/Jilin/1/89, a recent avian-like N8 isolate found in horses in China; and (iii) avian viruses isolated in North America . Comparison of mutation rates indicated that avian N8 genes have evolved more slowly than their equine counterparts . That is, in both avian lineages, 72% of the nucleotide changes were silent in the terminal branches of the phylogenetic tree, whereas in equine 2 viruses, 59% of the nucleotide changes were silent . This suggests greater selective pressure on the NA gene from the mammalian immune system, leading to progressive evolution . Alternatively, the slower mutation rate for avian N8 genes could reflect a selective advantage gained from a longer, continuous span of evolution . The shape of the phylogenetic tree, the evolutionary rate, and the calculated date of origin for the N8 equine 2 virus lineage were comparable to findings for the equine 2 virus hemagglutinin (HA) gene (Bean et al., J . Virol . 66, 1129-1138, 1992) . This suggests that both viral membrane glycoproteins of equine 2 viruses have evolved together and have been subjected to similar levels of selective pressure . Several amino acid residues were found to differ among the three host-specific lineages, but they may not be involved in host restriction of the NA, as they are shared by EQ/Jilin/1/89 and viruses of avian origin . The present findings complement detailed structural information on the N2 and N9 subtypes and should prove valuable in understanding future X-ray diffraction studies of N8 crystals. Virology, 1993 Apr, 193(2), 812 - 24 Replication of minute virus of mice minigenomes: novel replication elements required for MVM DNA replication; Tam P et al.; In this report, we describe the replication of minigenomes of minute virus of mice (MVM) . We show that the cis-acting sequences required for MVM DNA replication reside in the terminal 140 and 660 nucleotides of the left and right termini, respectively . Minigenomes containing either two right (RR) or two left (LL) termini are replication competent genomes, demonstrating that both termini contain the genetic information necessary for the excision and initiation of DNA replication . Since the efficiency of replication of the RR genome is greater than that of the LL genome, it suggests that the individual terminal sequences are not equivalent in function . In addition to the terminal palindromic sequences required for replication, we show that specific elements found inboard of the right hairpin between nucleotides 4489-4636 (element A) and 4636-4695 (element B) are necessary for the efficient replication of MVM minigenomes . These elements have heretofore not been identified as replication sequences. Virology, 1993 Apr, 193(2), 753 - 61 Characterization of vaccinia surface antigen expressed by recombinant baculovirus; Morikawa S et al.; The gene encoding the vaccinia surface antigen (S antigen) was inserted into a baculovirus transfer vector and a recombinant virus was isolated . The S antigen was expressed on the surface of Spodoptera frugiperda cells (Sf cells) infected with the recombinant baculovirus . Recombinant proteins were detected in immunoblotting with anti-vaccinia serum and have the apparent molecular weight of 40 and 50-kDa . The 50-kDa polypeptide was tunicamycin sensitive and was thus glycosylated . The glycosylated 50-kDa polypeptide was also secreted into culture supernatants . Antiserum directed against the expressed S antigen specifically reacted to the authentic S antigen that is located on the mammalian cells infected with vaccinia virus, but did not affect the production of infectious progeny virus . Antisera against both the terminal regions of the S antigen were prepared by immunizing rabbits with the recombinant fusion proteins produced in the bacterial expression vector . The S antigen on the cell surface reacted by immunofluorescence with anti-C-terminus serum but not or very weakly with anti N-terminus serum, indicating that the hydrophobic N-terminus functions both as a signal and a membrane anchor sequence . Interleukin (IL)-1 alpha failed to bind to the S antigen expressed on insect and mammalian cells, although the homology between IL-1 receptor and the S antigen has been reported by computer analysis of amino acid sequence. Virology, 1993 Apr, 193(2), 1033 - 6 Lambda kil-mediated lysis requires the phage context; Reisinger GR et al.; The lambda kil gene has been shown to be responsible for premature lysis effected by addition of chloramphenicol between 15 and 20 min after thermal induction of a lambda prophage . Here, we localized the kil reading frame . The kil gene, represented by lambda orf47, overlaps genes cIII and gam . Expression of the plasmid-borne kil gene resulted in growth arrest, a reduction of colony-forming units and filament formation . However, kil-mediated cell lysis could not be triggered by chloramphenicol when the plasmid borne kil gene was expressed, suggesting that kil-induced cell lysis requires the phage context. J Bacteriol, 1993 Apr, 175(7), 2154 - 6 The Escherichia coli visA gene encodes ferrochelatase, the final enzyme of the heme biosynthetic pathway; Frustaci JM et al.; An Escherichia coli mutant with a disrupted visA gene was defective in ferrochelatase activity but expressed wild-type levels of protoporphyrinogen oxidase activity . The visA coding region was placed under the transcriptional control of T7 RNA polymerase in an E . coli expression system, and the product was expressed as a 38-kDa protein . The overexpressed protein was purified to near homogeneity and was found to contain ferrochelatase activity . The data show that the visA gene encodes ferrochelatase, and we propose that it be renamed hemH to reflect that conclusion. J Bacteriol, 1993 Apr, 175(7), 2150 - 3 KatF (sigma S) synthesis in Escherichia coli is subject to posttranscriptional regulation; Loewen PC et al.; A transcriptional fusion of katF to the lacZ gene was expressed at increasingly higher levels throughout the exponential phase, but a translational fusion was expressed at low levels during exponential-phase growth and was induced 160-fold during the transition to stationary phase, implicating a posttranscriptional mechanism in the regulation of KatF synthesis . Mutational analyses suggested that the initiation codon of katF is the second ATG in the previously identified open reading frame. J Bacteriol, 1993 Apr, 175(7), 2143 - 9 The putative sigma factor KatF is regulated posttranscriptionally during carbon starvation; McCann MP et al.; Transcriptional and translational 'lacZ reporter fusions were constructed to the katF gene, which encodes a putative sigma factor centrally involved in starvation-mediated general resistance in Escherichia coli . Transcription of katF was found to increase ca . twofold after carbon starvation in minimal medium . The protein fusion containing the longest fragment of katF induced ca . eightfold under the same conditions, whereas fusions to shorter segments showed only a twofold increase in expression . The protein fusion was expressed at higher levels in a strain containing a katF::Tn10 mutation, indicating katF autoregulation . The posttranscriptional regulation of katF by starvation did not require a component of the spent minimal medium . katF was also posttranscriptionally regulated during entry into late log phase in complex medium . This induction was coincident with an increase in katE transcription, suggesting that the cellular concentration of KatF directly followed the induction of the katF protein fusion. J Bacteriol, 1993 Apr, 175(7), 2026 - 36 Global regulation of gene expression in Escherichia coli; Chuang SE et al.; Global transcription responses of Escherichia coli to various stimuli or genetic defects were studied by measuring mRNA levels in about 400 segments of the genome . Measuring mRNA levels was done by analyzing hybridization to DNA dot blots made with overlapping lambda clones spanning the genome of E . coli K-12 . Conditions examined included isopropyl-beta-D-thiogalactopyranoside (IPTG) induction, heat shock, osmotic shock, starvation for various nutrients, entrance of cells into the stationary phase of growth, anaerobic growth in a tube, growth in the gnotobiotic mouse gut, and effects of pleiotropic mutations rpoH, himA, topA, and crp . Most mapped genes known to be regulated by a particular situation were successfully detected . In addition, many chromosomal regions containing no previously known regulated genes were discovered that responded to various stimuli . This new method for studying globally regulated genetic systems in E . coli combines detection, cloning, and physical mapping of a battery of coregulated genes in one step. J Bacteriol, 1993 Apr, 175(7), 1956 - 60 Phenotypic revertant mutations of a new OmpR2 mutant (V203Q) of Escherichia coli lie in the envZ gene, which encodes the OmpR kinase; Harlocker SL et al.; The Escherichia coli ompR2 allele ompR472 contains a valine-to-methionine point mutation at position 203, resulting in an OmpF-constitutive OmpC- outer membrane phenotype . In the present study, OmpR residue V-203 was replaced with glutamine (V203Q mutation), resulting in the same outer membrane phenotype . However, unlike the OmpFc OmpC- phenotype conferred by the OmpR(V203M) mutant protein, the OmpFc OmpC- phenotype produced by the OmpR(V203Q) mutation was suppressed by the envZ11(T247R) allele . Additional suppressors of OmpR(V203Q) were isolated by random mutagenesis . All suppressor mutations were found in the envZ gene and conferred an OmpC+ OmpF- phenotype in the presence of the wild-type ompR . These envZ11-like mutations mapped to a region different from those previously reported and were incapable of suppressing the ompR(V203M) allele . Our results indicate that while methionine or glutamine replacements could cause similar effects on OmpF and OmpC expression, they conferred different abilities on the mutant proteins to be suppressed by envZ. Mol Cell Biol, 1993 Apr, 13(4), 2614 - 22 Structure and expression of the nuclear gene coding for the chloroplast ribosomal protein L21: developmental regulation of a housekeeping gene by alternative promoters; Lagrange T et al.; We have cloned and sequenced the nuclear gene of the chloroplast ribosomal protein L21 (rpl21) of Spinacia oleracea . The gene consists of five exons and four introns . All introns are located in the sequence which corresponds to the Escherichia coli-like central core of the protein . L21 mRNA is present in photosynthetic (leaves) and nonphotosynthetic (roots and seeds) plant organs, although large quantitative differences exist . Primer extension and S1 nuclease mapping experiments revealed the existence of two types of transcripts in leaves . The two corresponding start sites were defined as P1 and P2 . In roots and seeds, we found only the shorter of the two transcripts (initiated at P2) . The nucleotide sequence surrounding P2 resembles promoters for housekeeping and vertebrate r-protein genes . Analysis of several promoter constructions by transient expression confirmed that both transcripts originate from transcription initiation . Results are interpreted to mean that the expression of the rpl21 gene is regulated by alternative promoters . One of the promoters (P2) is constitutive, and the other one (P1) is specifically induced in leaves, i.e., its activation should be related to the transformation of amyloplasts or proplastids to chloroplasts . The gene thus represents the first example of a housekeeping gene which is regulated by the organ-specific usage of alternative promoters . Primer extension analysis and S1 nuclease mapping of another nucleus-encoded chloroplast ribosomal protein gene (rps1) give evidence that the same type of regulation by two-promoter usage might be a more general phenomenon of plant chloroplast-related ribosomal protein genes . Preliminary results indicate that presence of conserved sequences within the rpl21 and rps1 promoter regions which compete for the same DNA binding activities. Mol Cell Biol, 1993 Apr, 13(4), 2332 - 41 Autoactivation of catalytic (C alpha) subunit of cyclic AMP-dependent protein kinase by phosphorylation of threonine 197; Steinberg RA et al.; We recently found, using cultured mouse cell systems, that newly synthesized catalytic (C) subunits of cyclic AMP-dependent protein kinase undergo a posttranslational modification that reduces their electrophoretic mobilities in sodium dodecyl sulfate (SDS)-polyacrylamide gels and activates them for binding to a Sepharose-conjugated inhibitor peptide . Using an Escherichia coli expression system, we now show that recombinant murine C alpha subunit undergoes a similar modification and that the modification results in a large increase in protein kinase activity . Threonine phosphorylation appears to be responsible for both the enzymatic activation and the electrophoretic mobility shift . The phosphothreonine-deficient form of C subunit had reduced affinities for the ATP analogs p-fluorosulfonyl-{14C}benzoyl 5'-adenosine and adenosine 5'-O-(3-thiotriphosphate) as well as for the Sepharose-conjugated inhibitor peptide; it also had markedly elevated Kms for both ATP and peptide substrates . Autophosphorylation of C-subunit preparations enriched for this phosphothreonine-deficient form reproduced the changes in enzyme activity and SDS-gel mobility that occur in intact cells . A mutant form of the recombinant C subunit with Ala substituted for Thr-197 (the only C-subunit threonine residue known to be phosphorylated in mammalian cells) was similar in SDS-polyacrylamide gel electrophoresis mobility and activity to the phosphothreonine-deficient form of wild-type C subunit . In contrast to the wild-type subunit, however, the Ala-197 mutant form could not be shifted or activated by incubation with the phosphothreonine-containing wild-type form . We conclude that posttranslational autophosphorylation of Thr-197 is a critical step in intracellular expression of active C subunit. J Immunol, 1993 Apr 1, 150(7), 3091 - 100 Characterization of the mouse autoantigen La (SS-B) . Identification of conserved RNA-binding motifs, a putative ATP binding site and reactivity of recombinant protein with poly(U) and human autoantibodies; Topfer F et al.; To facilitate the study of autoimmunity to the nuclear Ag La (SS-B) we have isolated and characterized cDNA encoding the mouse La (SS-B) protein . Mouse La (SS-B) protein has 76.7% identity to both human and bovine La (SS-B) proteins and the previously recognized RNP-binding motifs were noted to be highly conserved across the three species . Examination of the primary sequence of human and bovine La (SS-B) newly identifies the site of a potential ATP-binding motif G/AXXXXGK which is preserved in mouse La (SS-B) despite a unique 16 amino acid insertion present in this region of the mouse protein . Analysis of mouse genomic DNA suggests a single gene encodes mouse La (SS-B) and no restriction fragment polymorphisms were identified in the three mouse strains investigated . Two alternate 5' untranslated regions were identified in mouse La (SS-B) cDNA and La (SS-B) mRNA was identified in a wide range of murine tissues consistent with its ubiquitous expression . Recombinant mouse La (SS-B) protein purified from Escherichia coli was shown to bind to poly(U) agarose and to react with sera containing anti-La (SS-B) antibodies obtained from patients with Sjogren's syndrome . The ability to produce recombinant mouse La (SS-B) should provide a valuable reagent for the study of the cellular autoimmune response as well as immunologic tolerance to La (SS-B) Ag in mice. J Immunol, 1993 Apr 1, 150(7), 2931 - 44 Characterization of a recombinant T cell and B cell reactive polypeptide of Onchocerca volvulus; Seeber F et al.; To identify potentially protective Ag of the filarial nematode Onchocerca volvulus on the molecular level we screened a cDNA library of O . volvulus with a human serum raised against radiation-attenuated infective larvae of O . volvulus . A cDNA clone of 218 bp (OvL3-1) was selected for further studies . It was expressed in Escherichia coli and affinity purified recombinant polypeptide was tested for its ability to stimulate in vitro PBMC from African onchocerciasis patients and PBMC from chimpanzees experimentally infected with O . volvulus . An enhanced cell proliferation by PBMC was observed in many patients after stimulation with the recombinant OvL3-1 polypeptide . In addition, some patients' PBMC responded to OvL3-1 stimulation with enhanced IL-2 production . Infected chimpanzees also showed an increase in T cell proliferation . Onchocerciasis patients had variable levels of specific antibodies directed to the recombinant polypeptide when sera were tested by ELISA . A mAb directed against the recombinant protein located the native target Ag in the muscles of the adult worm . The molecular mass of native OvL3-1 was found to be 50 kDa on immunoblots . Polymerase chain reaction analysis of RNA from different life stages of the parasite showed that OvL3-1 is transcribed in all parasite stages within the mammalian host . A homologous gene is also present in other filarial parasites . The protein corresponding to OvL3-1, therefore, represents an immunogen present during the whole life-span of the parasite, and because of its B and T cell stimulatory properties, it may be a candidate for a protective Ag in human filariasis. Toxicol Lett, 1993 Apr, 67(1-3), 87 - 103 The possible role of alpha, beta-unsaturated carbonyl compounds in mutagenesis and carcinogenesis; Eder E et al.; alpha, beta-Unsaturated carbonyl compounds are industrially important compounds, ubiquitous in the environment and are formed endogenously . They interact with proteins and enzymes . Genotoxicity was found in eucaryotic cells and some compounds were carcinogenic . Unsaturated carbonyl compounds are considered to play an important role in human cancer . Insufficient and contradictory results were reported on mutagenicity . We demonstrated a clear mutagenic potential for these compounds and have shown interference of their bacterial toxicity with an adequate testing . Structure-mutagenicity relationships were confirmed by the results of the SOS-chromotest . The compounds induce DNA-strand breaks . However, we did not find indications for cross linking . With mutagenic alpha, beta-unsaturated carbonyl compounds we isolated and characterized 1,N2-cyclic deoxyguanosine adducts, 7,8-cyclic and 7-linear guanine adducts as well as 1,N2-7,8-biscyclic adducts and 1,N2-cyclic, 7-linear bisadducts . Reactivity of these compounds towards nucleosides runs in parallel with their mutagenic potential . Mutagenic and carcinogenic activities most probably depend on these reactions with DNA, and DNA adducts can be utilized as indicators for the role of these compounds in human carcinogenicity. Toxicol Lett, 1993 Apr, 67(1-3), 17 - 28 Generation of electronically excited triplet species at the cellular level: a potential source of genotoxicity; Cilento G et al.; Selected enzymatic systems can efficiently produce a product in the electronically excited triplet state . Earlier, only the formation of electronically excited singlet species was known . The formation of triplet species has been demonstrated with both normal substrates/metabolites and with xenobiotics, even at the cellular level . Triplet excited species have intrinsically much longer lifetimes than excited singlets, whereby they can be potentially important agents for normal and/or deleterious processes, including mutagenesis . Enzymically generated triplet species can damage DNA, even when protein coated, as in the case of the lambda-phage of Escherichia coli . Some evidence of damage by triplet species has also been reported for intact cells . Triplet excited species may produce their effects through type I and/or type II dark photosensitization, that is, the events may be started by H abstraction and/or singlet oxygen/superoxide ion production . The induction of lipid peroxidation, with concomitant clastogenic effects, appears to be of special importance. J Infect Dis, 1993 Apr, 167(4), 876 - 81 Protection against lethal endotoxemia by anti-lipid A murine monoclonal antibodies: comparison of efficacy with that of human anti-lipid A monoclonal antibody HA-1A; Cornelissen JJ et al.; The protective capacities of murine anti-lipid A monoclonal antibodies (MAbs) 8-2 and 26-20 were examined and compared with those of the human MAb HA-1A with respect to inhibition of lipopolysaccharide (LPS) priming of human polymorphonuclear leukocytes (PMNL) in vitro and protection against lethal endotoxemia in mice . HA-1A did not prevent the priming effect of either rough or smooth LPS, while MAb 26-20 effectively inhibited LPS priming of human PMNL . Also, both murine MAbs protected mice against an otherwise lethal challenge with rough Re LPS of S . minnesota R595 as well as with smooth LPS of E . coli O111:B4 . HA-1A exerted no protection against the lethal effects of Re LPS in this in vivo model . The enhanced survival in mice by treatment with MAbs 8-2 and 26-20 was associated with decreased levels of LPS-induced tumor necrosis factor . Neutralization of lipid A as a mechanism of protection was strongly suggested by efficacious inhibition of LPS priming of human PMNL by MAbs 8-2 and 26-20 in vitro. Biol Pharm Bull, 1993 Apr, 16(4), 343 - 8 Expression of the ligand-binding domain-containing region of retinoic acid receptors alpha, beta and gamma in Escherichia coli and evaluation of ligand-binding selectivity; Fukasawa H et al.; The complete molecule or the ligand-binding domain-containing region of each of the three subtypes of human retinoic acid receptors (hRAR alpha, hRAR beta and hRAR gamma) was expressed in Escherichia coli . The expressed recombinant RARs (rRARs: rRAR alpha/E, rRAR beta/E and rRAR gamma) showed nearly the same magnitude of binding affinity toward {3H}retinoic acid (RA) as hRARs extracted from human cells (Ka values: 6.0 x 10(9) M-1 for rRAR alpha/E and 2.7 x 10(10) M-1 for both rRAR beta/E and rRAR gamma) . Therefore, the ligand-binding selectivity of the rRARs toward RA and synthetic retinoids (4-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-naphthalenylcarbamoyl )benzoic acid (Am80), (E)-4-{3-(3,5-di-tert-butylphenyl)-3-oxo-1-propenyl}benzoic acid (Ch55)) was examined . Am80 bound rRAR alpha/E preferentially and showed no binding activity toward rRAR gamma, which is consistent with the case of hRAR gamma . Ch55 bound all three subtypes of rRARs, preferentially rRAR beta/E . These results suggest that the intrinsic nature of the binding of each retinoid can be investigated by usage of the rRARs . However, rRARs show quantitatively different ligand-selectivity from that of hRARs: RA showed higher binding affinity toward rRARs than both Am80 and Ch55, but Ch55 binds all three subtypes of hRARs stronger than RA and Am80, which binds hRAR beta stronger than RA. Mol Microbiol, 1993 Apr, 8(2), 269 - 75 Topology of the PhoR protein of Escherichia coli and functional analysis of internal deletion mutants; Scholten M et al.; The PhoR protein of Escherichia coli K-12 belongs to a family of structurally related sensor-kinases that regulate responses to environmental stimuli . These proteins are often located in the inner membrane with two membrane-spanning segments that are separated by a periplasmic domain, which is supposed to sense the environmental stimuli . However, the hydrophobicity plot of PhoR suggests a somewhat different topology in which a large periplasmic domain is lacking and an extended cytoplasmic domain is present besides the kinase domain . In protease-accessibility experiments and by using phoR-phoA gene fusions, the topology of PhoR was investigated and the absence of a large periplasmic domain was confirmed . Furthermore, the function of the extended cytoplasmic domain was studied by creating internal deletions . The mutations in this domain resulted in a constitutive expression of the pho regulon, indicating that the mutant PhoR proteins are locked in their kinase function . We propose that this extended cytoplasmic domain functions by sensing an internal signal that represses the kinase function of the PhoR protein. J Bioenerg Biomembr, 1993 Apr, 25(2), 177 - 88 Coordination dynamics of heme-copper oxidases . The ligand shuttle and the control and coupling of electron transfer and proton translocation; Woodruff WH; Results are presented which, taken with evidence developed by others, suggest a general mechanism for the entry and binding of exogenous ligands (including O2) at the "binuclear site" (CuBFea3) of the heme-copper oxidases . The mechanism includes a "ligand shuttle" wherein the obligatory way station for incoming ligands is CuB and the binding of exogenous ligands at this site triggers the exchange and displacement of endogenous ligands at Fea3 . It is suggested that these ligand shuttle reactions might be functionally important in providing a coupling mechanism for electron transfer and proton translocation . Scenarios as to how this might happen are delineated. Mol Biol Cell, 1993 Apr, 4(4), 363 - 73 Anaerobiosis and plant growth hormones induce two genes encoding 1-aminocyclopropane-1-carboxylate synthase in rice (Oryza sativa L.); Zarembinski TI et al.; The plant hormone ethylene is believed to be responsible for the ability of rice to grow in the deepwater regions of Southeast Asia . Ethylene production is induced by hypoxia, which is caused by flooding, because of enhanced activity of 1-aminocyclopropane-1-carboxylic acid (ACC) synthase, the key enzyme in the ethylene biosynthetic pathway . We have cloned three divergent members, (OS-ACS1, OS-ACS2, and OS-ACS3), of a multigene family encoding ACC synthase in rice . OS-ACS1 resides on chromosome 3 and OS-ACS3 on chromosome 5 in the rice genome . The OS-ACS1 and OS-ACS3 genes are induced by anaerobiosis and indoleacetic acid (IAA) + benzyladenine (BA) + LiCl treatment . The anaerobic induction is differential and tissue specific; OS-ACS1 is induced in the shoots, whereas OS-ACS3 is induced in the roots . These inductions are insensitive to protein synthesis inhibitors, suggesting that they are primary responses to the inducers . All three genes are actually induced when protein synthesis is inhibited, indicating that they may be under negative control or that their mRNAs are unstable . The OS-ACS1 gene was structurally characterized, and the function of its encoded protein (M(r) = 53 112 Da, pI 8.2) was confirmed by expression experiments in Escherichia coli . The protein contains all eleven invariant amino acid residues that are conserved between aminotransferases and ACC synthases cloned from various dicotyledonous plants . The amino acid sequence shares significant identity to other ACC synthases (69-34%) and is more similar to sequences in other plant species (69% with the tomato LE-ACS3) than to other rice ACC synthases (50-44%) . The data suggest that the extraordinary degree of divergence among ACC synthase isoenzymes within each species arose early in plant evolution and before the divergence of monocotyledonous and dicotyledonous plants. Curr Opin Cell Biol, 1993 Apr, 5(2), 219 - 25 Regulatory mechanisms in meiosis; Honigberg SM et al.; Meiosis can be viewed both as a process of cell differentiation and as a modification of the mitotic cell cycle . Here we describe recent progress in defining a variety of regulatory mechanisms that govern the meiotic divisions . Studies in the yeast Saccharomyces cerevisiae and in higher organisms have led to complementary insights into these controls. Electrophoresis, 1993 Apr, 14(4), 259 - 65 Two-dimensional gel selection of protein binding sites on DNA; Boffini A et al.; We have developed a gel electrophoretic approach for visualizing and cloning protein binding sites from complete genomes . This system consists of a simple two-dimensional band shift, in which protein-DNA complexes are retarded in the first dimension, performed at low temperature, and disrupted in the second dimension, performed at high temperature . We present here results obtained with the integration host factor (IHF) and cAMP receptor protein (CRP) proteins of Escherichia coli, and discuss some of the important methodological aspects of the technique. Mol Microbiol, 1993 Apr, 8(1), 179 - 85 Sequence requirements for target activity in site-specific recombination mediated by the Int protein of transposon Tn 1545; Trieu-Cuot P et al.; Excision and integration of Tn1545 occur by reciprocal site-specific recombination between 6 (or 7) bp variable sequences present in the recombining attachment (att) sites and designated overlap regions . We devised an assay for Tn1545 transposition in which derivatives containing the cis-acting transposition sequences (attTn 1545) integrate into a target replicon when complemented in trans by the transposon-encoded integrase Int-Tn . This assay was used to determine the characteristics of the DNA sequence that influence target site selection . Characterization of several integration sites indicated that a 20 bp segment, designated attB, contains the sequences required for target activity . It also appeared that (i) the target activity depends upon the extent of homology between the 7bp segments flanking the overlap regions in attB and attTn 1545, and (ii) the degree of homology between the two recombining overlap regions does not affect the level of target activity and has no influence on integration orientation. Immunology, 1993 Apr, 78(4), 643 - 9 Intranasal immunization against herpes simplex virus infection by using a recombinant glycoprotein D fused with immunomodulating proteins, the B subunit of Escherichia coli heat-labile enterotoxin and interleukin-2; Hazama M et al.; To establish a novel strategy of mucosal immunization against herpes simplex virus type 1 (HSV-1) infection, we studied the immune responses elicited by intranasal immunization with several forms of a recombinant glycoprotein D (gD) of HSV-1 . A truncated gD (t-gD) co-administered with heat-labile enterotoxin B subunit (LTB) from Escherichia coli induced both a mucosal immune response involving secretion of anti-gD IgA and serum IgG production . The levels of these responses are comparable to those in mice which have recovered from intranasal HSV-1 infections . The fusion protein (t-gD-LTB), consisting of t-gD and LTB, induced the responses more efficiently than did co-administration of t-gD and LTB, although GM1 ganglioside binding activity was significantly reduced in t-gD-LTB . We found that another fusion protein, consisting of t-gD and human interleukin-2 (t-gD-IL-2), also elicited antibody responses comparable to those induced by t-gD-LTB . Immunity acquired by intranasal immunization with t-gD-IL-2 protected mice from intraperitoneal HSV-1 infections, whereas t-gD-LTB or t-gD alone failed to provide protection against infection . Even in a mouse strain that responded highly to subcutaneously administered gD, intranasally administered t-gD did not elicit antibody responses . The lack of response to gD was clearly abrogated by co-administration with IL-2, and administration of t-gD-IL-2 induced an excellent level of antibody responses in this strain . These results suggest that the IL-2 fusion strategy yields a new type of mucosal immunization, the mechanism of which differs from that speculated for the mucosal adjuvant activity of LTB. Cell Growth Differ, 1993 Apr, 4(4), 269 - 79 Characterization of the thyroid hormone response element in the skeletal alpha-actin gene: negative regulation of T3 receptor binding by the retinoid X receptor; Muscat GE et al.; We have identified a T3 response element (TRE) in the human skeletal alpha-actin gene between nucleotide positions -273 and -249 (5' GGGCAACTGGGTCGGGTCAGGAGGG 3') that is accommodated by the core receptor binding motif, A/G GG T/A C A/G . This sequence conferred appropriate hormonal regulation in a thyroid hormone receptor (TR alpha) dependent manner to an enhancerless SV40 promoter . Electrophoretic mobility shift assay experiments showed that Escherichia coli expressed and affinity purified TR alpha bound to the skeletal alpha-actin TRE in a sequence specific manner . The alpha-actin TRE bound TR alpha dimers cooperatively . Mutagenesis of the alpha-actin TRE indicated that the core binding motifs and the gap sequences were the most important for efficient binding to TR alpha . The retinoid X receptor alpha (RXR alpha) interacted with the alpha-actin TRE in a sequence specific fashion and formed heterodimeric complexes with TR alpha on the alpha-actin TRE . However, increased levels of RXR alpha decreased the binding of TR alpha to the alpha-actin TRE, in contrast to promoting TR alpha binding to the alpha-myosin heavy chain TRE . Furthermore, the alpha-actin, palindromic, synthetic direct repeat, alpha-myosin heavy chain, and growth hormone TREs interacted with an identical nuclear factor in vitro in muscle cells . In conclusion, our data suggest that the human skeletal alpha-actin TRE is a target for direct cross-talk between two different hormonal signals (T3 and 9-cis-retinoic acid) at the receptor level.(ABSTRACT TRUNCATED AT 250 WORDS) Antimicrob Agents Chemother, 1993 Apr, 37(4), 839 - 45 Mechanism of action of quinolones against Escherichia coli DNA gyrase; Yoshida H et al.; The mechanism of action of quinolones was investigated by use of various DNA gyrases reconstituted from wild-type and mutant GyrA and GyrB proteins of Escherichia coli . The quinolone sensitivities of the DNA supercoiling activity of the gyrases were generally parallel to the quinolone susceptibilities of strains having the corresponding enzymes and depended on gyrase subunits but not on substrate DNA . {3H}Enoxacin did not bind to gyrase alone or DNA alone but bound to gyrase-DNA complexes when measured by a gel filtration method . There appeared to be two enoxacin binding phases, at low and high enoxacin concentrations, for the wild-type gyrase-DNA and type 2 GyrB (Lys-447 to Glu) mutant gyrase-DNA complexes but only one enoxacin binding phase at the concentrations used for the GyrA (Ser-83 to Leu) mutant gyrase-DNA and type 1 GyrB (Asp-426 to Asn) mutant gyrase-DNA complexes . New enoxacin binding sites appeared in the presence of enoxacin, and the enoxacin binding affinities for the sites, especially at low enoxacin concentrations, near the MICs for the strains having the corresponding gyrases, correlated well with the enoxacin sensitivities of the gyrases and the MICs . From the results obtained, we propose a quinolone pocket model as the mechanism of action of quinolones, in which quinolones exert their action through binding to a gyrase-DNA complex and the quinolone binding affinities for the complex are determined by both GyrA and GyrB subunits in concert. Antimicrob Agents Chemother, 1993 Apr, 37(4), 646 - 51 Novel 1-8-bridged chiral quinolones with activity against topoisomerase II: stereospecificity of the eukaryotic enzyme; Froelich-Ammon SJ et al.; A series of novel C-7 quinolyl-substituted enantiomers of ofloxacin were used to determine the stereospecificity of topoisomerase II for the C-11 methyl group in tricyclic quinolones . In all cases, the S isomer was the most active compound against the eukaryotic enzyme . It was approximat |