|








| |
Journal of Bacteriology, December 2003, p . 7202-7212, Vol . 185, No . 24
GacA Regulates Symbiotic Colonization Traits of Vibrio fischeri and Facilitates a Beneficial Association with an Animal Host
Cheryl A . Whistler and Edward G . Ruby*
Pacific
Biomedical Research Center, University of Hawaii, Honolulu, Hawaii
96813
Received 3 July 2003/
Accepted 23 September 2003
The
GacS/GacA two-component system regulates the expression of bacterial
traits during host association . Although the importance of GacS/GacA as
a regulator of virulence is well established, its role in benign
associations is not clear, as mutations in either the gacS or
gacA gene have little impact on the success of colonization in
nonpathogenic associations studied thus far . Using as a model the
symbiotic association of the bioluminescent marine bacterium Vibrio
fischeri with its animal host, the Hawaiian bobtail squid,
Euprymna scolopes, we investigated the role of GacA in this
beneficial animal-microbe interaction . When grown in culture,
gacA mutants were defective in several traits important for
symbiosis, including luminescence, growth in defined media, growth
yield, siderophore activity, and motility . However, gacA
mutants were not deficient in production of acylated homoserine lactone
signals or catalase activity . The ability of the
gacA mutants to initiate squid colonization was
impaired but not abolished, and they reached lower-than-wild-type
population densities within the host light organ . In contrast to their
dark phenotype in culture, gacA mutants that reached
population densities above the luminescence detection limit had normal
levels of luminescence per bacterial cell in squid light organs,
indicating that GacA is not required for light production within the
host . The gacA mutants were impaired at competitive
colonization and could only successfully cocolonize squid light organs
when present in the seawater at higher inoculum densities than
wild-type bacteria . Although severely impaired during colonization
initiation, gacA mutants were not displaced by the wild-type
strain in light organs that were colonized with both strains . This
study establishes the role of GacA as a regulator of a beneficial
animal-microbe association and indicates that GacA regulates
utilization of growth substrates as well as other colonization
traits .
During colonization of animal or plant tissue, bacteria must adapt to
the requirements of these environments and prevail over host defenses.
There is great interest in understanding how signaling between
beneficial bacteria and their hosts is initiated and a stable
association is permitted, while at the same time detrimental pathogens
are detected and infection is prevented . Although
long-term, benign bacterial associations with animals are ubiquitous,
studies of these associations are often confounded by the complexity of
consortial populations and our inability to culture obligate symbionts.
Elucidating the mechanisms underlying recognition and persistence by
bacteria in beneficial associations with animal hosts will both add to
our understanding of health and aid in the successful treatment of
disease .
Vibrio fischeri is a bioluminescent marine
bacterium that forms long-term, beneficial associations with certain
fishes and sepiolid squid, such as the Hawaiian bobtail squid,
Euprymna scolopes . In this association, newly hatched squid
acquire V . fischeri from the surrounding seawater in which
they are present at a few hundred CFU per ml
(30) in a total
background of about 106 other marine bacteria per ml . Only
V . fischeri colonizes the nascent light-emitting organs of the
juvenile squid, forming an essentially monospecific culture
(44) . The specificity of
the association suggests that specialized colonization mechanisms in
the bacterial symbiont have coevolved with cognate recognition
mechanisms in the squid host
(53) .
Squid
colonization is both spatially and temporally dynamic . Only motile
V . fischeri cells can migrate specifically through ducts
before they reach the crypt spaces of the light organ
(18) . During
colonization, bacterial symbionts that reach the crypt grow to a
population density of 105 to 106 CFU, using as
growth substrates host-derived nutrients, including small peptides
(20) . The increase in
population size allows the density-dependent induction of luminescence
gene (lux) expression via the accumulation of acylated
homoserine lactone (acyl-HSL) quorum-sensing molecules
(7) . Two different
acyl-HSL signals, N-(3-oxohexanoyl) homoserine lactone
(C6-HSL) and N-octanoyl homoserine
lactone (C8-HSL), work in concert to activate the
lux operon (32),
which contains both the structural genes for luciferase and the
aldehyde synthetase genes
(34) . Although the squid
host expels an estimated 95% of the bacterial contents of its
light organ daily (29),
creating a new level of selective pressure, regrowth of the remaining
bacterial cells results in their persistent association with the host.
Mutants defective or reduced in luminescence effectively initiate
colonization and grow to a normal cell density but are impaired at
longer-term host association during these subsequent regrowth periods
(32,
52) .
Bacteria often
coordinately express multiple traits that are generally important for
host association, including motility, attachment, and stress defense,
together with other traits that are important to their interaction with
specific hosts or host tissues, such as the production and secretion of
effectors, secondary metabolites, or virulence determinants . For
instance, in the genus Pseudomonas, both host association
traits and virulence are globally controlled by a two-component
regulatory system composed of the sensor kinase GacS and the response
regulator GacA (22).
Early studies with plant-pathogenic Pseudomonas spp . revealed
that GacS/GacA controls the production of exoenzymes and is required
for virulence in a number of host-microbe systems
(22) . In the
opportunistic pathogen Pseudomonas aeruginosa, the production
of acyl-HSL signal molecules and factors necessary for virulence on
both plant and animal hosts are GacA controlled
(22) . More recent studies
have also linked the GacA homologs ExpA, SirA, UvrY, VarA, and LetA,
respectively, to (i) the regulation of extracellular enzymes and
acyl-HSL signals in Erwinia carotovora, (ii) motility and
invasion gene expression in Salmonella spp., (iii)
colonization and stress response of Escherichia coli, (iv)
colonization and virulence of Vibrio cholerae, and (v)
motility, transmission, and stress response in Legionella
pneumophila (21,
22,
40,
49) .
The GacS/GacA
system also regulates the expression of traits during benign host
association . For example, in biocontrol Pseudomonas spp., GacA
controls the production of antifungal secondary metabolites that
contribute to the health of their host plants, although the production
of these compounds has little impact on host-microbe association
(22) . Additionally,
GacS/GacA mutants of these biocontrol bacteria have an enhanced
fluorescence typical of overproduction of fluorescent siderophore
compounds that function in iron sequestration and bacterial competition
(9-11,
55) . Thus, GacS/GacA
regulation of host association in these superficial and nonspecific
benign associations appears to function indirectly and predominately
influences microbe-microbe interactions .
We cloned the
gacA gene from V . fischeri and investigated its role
in global regulation of symbiotic colonization of the squid E.
scolopes to establish what role GacA plays in colonization in this
intimate and specific bacterium-host association . Our studies showed
that GacA controlled multiple traits important for successful squid
colonization, including motility, growth-substrate utilization, and
luminescence . However, the effect of gacA on luminescence was
not accomplished through a deficiency in acyl-HSL accumulation but
instead involved depression of luminescence via an undefined mechanism.
Animal studies with the gacA mutant alone, or in competition
with the wild-type strain, revealed that GacA facilitates but is not
required for host colonization . Although GacA was required for
luminescence in culture, gacA strain-colonized squid became
luminous, demonstrating that GacA effects differed in the host and in
culture . The results of this study indicate that GacA is a global
regulator of colonization traits and that mutations result in defects
in symbiotic colonization, most notably during colonization initiation
and growth within the light
organ .
Bacterial strains, plasmids, and
culture conditions.
Bacteria and plasmids are listed in
Table
1 . Chemicals used for culture media preparation were from Sigma (St.
Louis, Mo.) unless otherwise noted . Wild-type V . fischeri
strain ES114, isolated from an adult specimen of E . scolopes
(6), and its derivatives
were routinely grown at 28°C in either liquid seawater-tryptone
broth (SWT) (6) with
shaking at 200 rpm or on nutrient agar medium with added salt (LBS)
(18) . V.
fischeri was also grown on minimal agar plates supplemented with
either 24 mM ribose (20),
50 mM fumarate, or 0.5% Casamino Acids (CA; Difco) as a carbon
source . E . coli strains were routinely grown in Luria-Bertani
(LB) broth (45) or in
brain heart infusion medium (Difco) . When required, media were
supplemented with antibiotics at the following concentrations: for
V . fischeri, kanamycin at 50 µg/ml, chloramphenicol
(Ch) at 5 µg/ml for multiple copies of the resistance gene in
plasmids and at 2.5 µg/ml for a single copy on the chromosome,
and erythromycin at 5 µg/ml; for E . coli, kanamycin at
50 µg/ml, Ch at 25 µg/ml, ampicillin at 100
µg/ml, and erythromycin at 150 µg/ml . Plates were
supplemented with 40 mg of
5-bromo-4-chloro-3-indolyl-ß-galactopyranosidase/ml for
visualization of ß-galactosidase activity . Where appropriate,
C6-HSL and C8-HSL (Aurora
Biosciences, San Diego, Calif.) were added to media at 120 nM before
inoculation with bacteria as previously described
(32) . Conditioned broth
was prepared by combining fresh broth with spent broth at a ratio of
1:1 . Spent broth was prepared by growing bacterial cultures to a final
optical density at 600 nm (OD600) of 1.8, pelleting cells by
centrifugation at 12,000 x g, and filter sterilizing
the cleared broth by passage through a 0.2-µm-pore-sized
filter .
| TABLE 1 . Bacterial
strains and plasmids used in this study
| |
Recombinant DNA
techniques.
Standard
molecular methods were used for transformations, restriction enzyme
digestions, gel electrophoresis, Southern analysis, and PCR
(45) . Restriction enzymes
were from New England BioLabs (Beverly, Mass.) . Gel purification of
restriction enzyme-digested DNA was performed using the QiaQuick gel
extraction kit (Qiagen, Valencia, Calif.) . Plasmids for laboratory
procedures were purified using the Qiaprep Spin Miniprep kit (Qiagen).
Plasmid DNA for sequence analysis was prepared using the Perfect Prep
plasmid mini kit (Eppendorf Scientific Inc., Westbury, N.Y.) . Ligations
were performed by the thermal cycling method
(31) . Genomic DNA was
isolated by a cetyltrimethylammonium bromide method
(3).
Digoxigenin-11-dUTP-labeled probes for Southern blotting were generated
by PCR using materials and protocols supplied by the manufacturer
(Boehringer Mannheim Corporation, Indianapolis, Ind.) . Oligonucleotide
primers were synthesized by Integrated DNA Technologies (Coralville,
Iowa) .
Cloning and sequence analysis of
gacA.
Alignments
of the predicted amino acid sequence from various GacA homologs were
used to identify conserved regions to which degenerate primers were
designed . The forward
(5'-GARGCNGAYWSNGGNGARGA-3') and
reverse (5'-NARYTTYTCNGTRTCNARDATNCC-3')
primers were generated and used to amplify a 550-bp fragment
from the genome of V . fischeri strain ES114 by PCR . After
confirmation that the sequence identity was similar to that of the GacA
homolog VarA from V . cholerae
(56) by directly
sequencing the PCR product, gene-specific primers (forward primer
Vgac2, ATGAGTTAATTCAACGTCTCAC; reverse primer
Vgac3, TTATGGATATGAACATGCCTGG) were designed.
These primers were used to amplify an internal fragment of GacA (525 bp
in length) which served as a gene-specific probe to identify and
isolate a genomic clone containing the intact gene . Southern analysis
of genomic fragments from V . fischeri generated by digestion
with various restriction enzymes revealed that the gene was contained
on a 4.0-kb HindIII fragment . A genomic sublibrary of 4.0-kb
HindIII-digested fragments of ES114 was generated by gel
purification of the restriction fragments and subsequent ligation of
ES114 DNA to HindIII-digested pEVS79 plasmid DNA . The library
DNA was transformed into E . coli cells which were plated on LB
with Ch and 5-bromo-4-chloro-3-indoyl-ß-galactopyranosidase.
White colonies containing plasmids with inserted DNA were directly
screened by PCR using the Vgac2 and Vgac3 primers . From a single clone,
pVCW1A7, we amplified the predicted 525-bp fragment . Sequencing of the
entire gacA gene was performed at the Biotechnology Molecular
Biology Instrumentation Facility, University of Hawaii, using primers
designed to the sequence obtained from the PCR-amplified fragment.
Comparisons of the cloned DNA with sequences in GenBank were performed
using the BLAST software package
(2) .
Generation
of mutants.
Plasmid pVCW1A7
that contained the wild-type gacA region was mutagenized using
the EZ::TN<KAN-2> insertion kit
following protocols supplied by the manufacturer (Epicentre, Madison,
Wis.) . Insertions in gacA were identified by PCR amplification
and confirmed to be in the gacA open reading frame (ORF) by
sequence analysis of the clones . One random
EZ::TN<KAN-2> insertion was
identified within the sequence encoding amino acid residue P58 of GacA.
The mutagenized gene was recombined with the chromosomal copy of
gacA by marker exchange mutagenesis as described previously
(47) . A single colony,
designated strain VCW2A1, was confirmed to have the
gacA::EZ::TN<KAN-2>
mutation by Southern analysis . A random
EZ::TN<KAN-2> insertion in the
uvrC gene was generated by a similar approach, creating strain
VCW2E1 .
To make an in-frame deletion of gacA, we created
an AatII restriction site within the gacA ORF . A
single nucleotide conversion from T to C at position 600 in the
nucleotide sequence was generated using the QuikChange site-directed
mutagenesis kit and protocols supplied by the manufacturer (Stratagene,
La Jolla, Calif.) . Two overlapping primers, VGA-AATF
(3'-AAGTGGAGACGTCGAATTAACTCATCTAGCTATTCGTC-5')
and VGA-AATR
(5'-ATCACGAATAGCTAGATGAGTTAATTCGACGTCTCCAC-3'),
were used for mutagenesis . An in-frame deletion of
89% of the gacA ORF was generated within the predicted
protein sequence from amino acid residue I27 to G194 by digesting the
resulting plasmid, pVCW2A5, with AatII and self-ligating it,
creating plasmid pVCW2D5 . The mutation was exchanged with the wild-type
gacA gene by marker-exchange mutagenesis, creating strain
VCW2F5, and gene replacement was confirmed by Southern
analysis .
A LuxI mutation in strain ES114 constructed for these
studies was generated similarly to that mutation in V.
fischeri strain ESR1
(52) and was described in
a previous publication
(32) .
Luminescence
detection.
A 1-ml aliquot
of V . fischeri cells grown in broth culture was removed at
regular intervals to determine the luminescence and optical density
(OD600) . Luminescence levels were measured with a Turner
20/20 luminometer (Turner Designs, Sunnyvale, Calif.) calibrated with a
light standard . Where appropriate, decanal suspended in 95%
ethyl alcohol was added at a final concentration of 0.01% to an
aliquot of culture immediately prior to measurement of luminescence
(32) .
Luminescence
of V . fischeri within colonized squid was routinely measured
at 24, 48, and 72 h postinoculation . The luminescence
detection limit was determined on squid monitored continuously between
7 and 9 h postinoculation with the wild-type strain ES114.
Squid with a luminescence level between 1 and 5 luminescence units (LU)
were immediately frozen, and the number of bacteria contributing to
luminescence was quantified subsequently by homogenization of the squid
in seawater (SW) that was formerly sterilized by autoclaving, plating
the contents onto LBS agar plates, and enumerating the colonies of
V . fischeri that grew following overnight incubation . The
experiment was done twice with similar results, and the data from both
experiments were combined and reported as the mean
CFU .
Quantification of
acyl-HSLs.
Published
methods for the purification and quantification of
C6-HSL and C8-HSL were used
(46) . Briefly, acyl-HSLs
were extracted twice with an equal volume of acidified ethyl acetate
from cell-free supernatants of ES114 and derivative cultures grown in
SWT broth to a final OD600 of 1.6 . The samples were
concentrated by evaporation before analysis . Because
C8-HSL is produced at a higher level (micromolar)
than C6-HSL (nanomolar) in strain ES114 (A . Schaefer,
personal communication), C6-HSL cross-reaction
with the biological reporter strain for C8-HSL
does not interfere with quantification of C8-HSL;
therefore, C8-HSL was directly quantified from
extracts of 15-ml cultures . However, C8-HSL cross-reaction
with the biological reporter strains for C6-HSL
could interfere with its quantification . Therefore, we first purified
C6-HSL from 500-ml cultures using a C18
reverse-phase high-performance liquid chromatography column and a
linear, 10-to-100% (vol/vol) methanol-water gradient at
0.5 ml/min . The elution profile of synthetic
C6-HSL was determined to identify which fractions
contained activity, and these and flanking 1-ml fractions from extracts
were assayed for activity . C6-HSL was quantified
using the reporter strain E . coli VJS533 harboring plasmid
pHV200I-, which does not produce its own acyl-HSL
but which responds to C6-HSL by producing
luminescence (39).
C8-HSL was quantified using the reporter strain
Ralstonia solanacearum AW1-AI8 harboring plasmid p395B, which
expresses lacZ in response to exogenous
C8-HSL
(16) . LacZ activity was
measured by a standard assay
(35) . The amounts of
C6-HSL and C8-HSL were
determined by comparing the activity measured from a dilution series of
the extracted and purified samples to the linear range of each standard
curve .
Siderophore and catalase
activities.
The ability of
mutant strains to produce siderophores was assessed qualitatively with
chrom-azurol S indicator (CAS) agar plates and compared to that of
ES114, which produces an orange halo around bacterial colonies
indicative of sequestration of the iron from CAS, and two strains
defective in siderophore production, KV495 and SP301, which produce no
halo indicative of the absence of siderophore secretion or activity, as
negative controls . The CAS was added to artificial seawater medium
(6) supplemented with
0.3% CA and buffered with
piperazine-N,N'-bis(ethanesulfonic acid) (pH 6.8) as
previously described (19,
28) to make CAS agar
plates .
Published methods for quantification of catalase activity
were used without modifications, using a strain that is defective in
catalase production, KV433, as a control
(4,
54) . Protein
concentrations were determined using the Bio-Rad DC protein assay kit
with protocols supplied by the manufacturer (Bio-Rad, Hercules,
Calif.) . The experiment was repeated with similar
results .
Motility, flagellation, and
chemotaxis.
Motility of
exponentially growing (OD600 of 0.2 to 0.4) cells of V.
fischeri in liquid cultures was assessed by light microscopy.
Flagella were examined and the number of flagella per cell was
determined from a total of 75 cells per treatment from three separate
experiments by transmission electron microscopy
(36) . The data were
combined and reported as the mean number of flagella ± the
standard error (SE) .
Swimming motility in soft agar was
determined using SWT containing concentrations between 0.3 and
0.7% of Bacto Agar (Difco, Detroit, Mich.) . At these agar
concentrations, the polarly flagellated V . fischeri ES114 is
presumed to swim, as the pattern of movement is not typical of the
swarming motility seen for peritrichously flagellated Vibrio
spp . (48) . Three
microliters of an exponentially growing culture (OD600 of
0.4) was spotted on the surface of duplicate agar plates, and the
movement of the cells in the agar as a concentric circle away from the
spotted culture was periodically measured at the leading edge . The
ability of strains to move toward attractants was assessed by spotting
10 µl of an exponentially growing culture (OD600 of
0.4) on soft agar plates made with 0.25% Bacto Agar in
70% artificial seawater, 1% tryptone (Difco) with or
without the addition of 0.5% CA or 1.6 mM serine and observing
the bands of cells migrating up a concentration gradient created by the
degradation of each band's attractant
(13) . The experiments
were repeated with similar results, and the data from one
representative experiment are
reported .
Animal colonization.
The ability of V . fischeri
strains to colonize juvenile E . scolopes squid was determined
as previously described
(36,
44) with the following
modifications . Exponentially growing bacteria (OD600 between
0.2 and 0.4) from cultures grown with shaking at 200 rpm were suspended
in a volume of between 50 and 250 ml of filtered-sterilized seawater
(FSW) at a final concentration of between 110 and 20,000 CFU/ml . Squid
were placed collectively into bowls in a volume that allowed a minimum
of 2 ml of SW/squid for either 3 h or overnight and then
transferred to fresh FSW before being placed in individual vials
containing 4 ml of FSW . Each morning, squid were aseptically
transferred to fresh vials containing 4 ml of FSW . Colonization of
squid light organs based on bacterial cell counts recovered from squid
was routinely assessed at 24, 48, and 72 h postinoculation by
rinsing squid in FSW and then freezing animals at -70°C
before homogenizing, serially diluting, and plating the homogenate on
LBS agar plates to determine the number of CFU of V.
fischeri/light organ . Aposymbiotic animals placed in SW without
bacteria and otherwise treated identically were also plated to confirm
the absence of contaminating V . fischeri bacteria . These
experiments were repeated a minimum of two times with both strains
VCW2A1 and VCW2F5, which were comparable to each other, and one
representative experiment with VCW2F5 was reported .
The ability
of bacteria expelled from luminous squid to colonize previously
uncolonized squid was also determined . Previously uncolonized juveniles
were placed in vials containing serial dilutions of FSW that contained
bacteria expelled from luminous VCW2F5- or ES114-colonized animals . The
number of V . fischeri cells in the SW could not be determined
by direct plating due to a high background of other bacteria . After
3 h, squid were placed in fresh vials and luminescence and
colonization were determined at 30 h
postcolonization .
Cocolonization experiments were performed by
placing squid overnight in FSW containing both VCW2F5 and a wild-type
ES114 derivative, JRM200
(33), containing a Ch
resistance gene inserted in the genome in single copy, at various
concentrations . In cocolonization experiments, the identity of the
light organ symbionts plated on LBS agar was assessed by replica
plating colonies onto LBS agar containing antibiotic (Ch) selection and
by visual assessment of colony morphology .
The ability to
complement the colonization defects of VCW2F5 was tested with the
gacA-containing plasmid, pVCW3C3, or with a vector control,
pVO8 . Squid inoculated with bacteria at 3,000 CFU/ml of SW were
subsequently maintained in FSW containing Ch (2 µg/ml) to
select for the plasmids . At 24 h postinoculation,
luminescence and colonization levels were
determined .
Nucleotide sequence
accession number.
The
nucleotide sequence of the gacA gene from V . fischeri
along with flanking DNA has been submitted to the GenBank databases
under accession number AY377390 .
Cloning,
characterization, and mutagenesis of the gacA gene in V.
fischeri.
Amplification
of ES114 (wild-type) genomic DNA using fully degenerate primers to
various gacA homologs (see Materials and Methods) generated a
PCR product with high sequence similarity to the genes encoding GacA
homologs . Subsequently, a genomic clone containing the intact
gacA gene was isolated and sequenced . Sequence analysis of the
clone revealed an ORF that was 642 bp in length, encoding a predicted
protein of 214 amino acids with the alternative start codon GTG . The
predicted sequence of the protein was 85% identical to VarA from
V . cholerae
(56) . Within the
amino-terminal receiver domain, between amino acids 1 and 123, we
identified the putative phosphate-accepting aspartate residue (D54)
involved in phosphorelay and, located in the carboxy-terminal region of
the protein, between amino acids 146 and 203, was a conserved
helix-turn-helix domain . A partial ORF 276 bp downstream of the
gacA ORF, also beginning with GTG, was homologous to UvrC . The
uvrC gene is also located downstream of the gacA
genes in several other bacterial species .
Three mutants were
generated to study the role of GacA in V . fischeri (Table
1) . Two gacA
mutants included a marked-insertion mutant strain, VCW2A1
(gacA::EZ::TN<KAN-2>),
and an unmarked, in-frame deletion mutant strain, VCW2F5
( gacA) . In other bacterial species, gacA and
the downstream gene uvrC are cotranscribed; thus, insertions
can cause polar loss of UvrC . To control for potential polar effects of
the insertion on UvrC, a third mutant harboring an insertion in the
uvrC gene was generated in strain VCW2E1 (uvrC) . When
grown on LBS agar plates, the two gacA mutants had colonies
that were smaller, less yellow, and had a translucent morphology when
compared to the wild-type strain; however, the uvrC mutant
strain colony morphology was indistinguishable from that of the wild
type, suggesting colony morphology was affected by GacA and not polar
loss of UvrC .
The gacA mutants
have a growth yield defect that is relieved by the addition of Casamino
Acids.
The small colony size
of gacA mutants led us to evaluate whether growth was
influenced by GacA . The exponential growth rates of V.
fischeri mutant and wild-type strains in SWT broth did not differ
(Fig.
1) . However, the gacA mutants had a growth yield defect (Fig.
1) and reached a lower
final cell density (OD600 of 1.8) compared to the wild type
(OD600 of >5.0) . No growth yield defect was observed
in the uvrC mutant, which reached a final cell density similar
to the wild type . When cultured on minimal agar plates with either
ribose or fumarate as the sole carbon source, the
gacA mutant did not grow, although the wild type grew
on these media, indicating that the
gacA mutant was
unable to adapt to the metabolic requirements of prototrophic growth on
these sole carbon compounds . The addition of 0.5% CA, which can
serve as a source of nitrogen, carbon, and vitamins, improved but did
not restore the growth of the mutant to the level seen for the wild
type, indicating that an amino acid auxotrophy alone could not account
for the growth defect .
To assess whether the growth yield defect
of the
gacA mutant was caused by either insufficient
nutrients or accumulation of repressive compounds in the supernatant,
we measured the growth rate and final growth yield of the wild type and
the
gacA mutant in complex media of different
composition . The media included (i) SWT diluted to different extents
with 70% SW, (ii) SWT supplemented with CA, or (iii) SWT
conditioned with an equal volume of cell-free supernatants from either
the wild-type or
gacA strain or both strains grown to
a final OD600 of 1.8 (Fig.
2) . In all media tested, the
gacA mutant attained the
same exponential growth rate as the wild type (data not shown), but it
reached a lower cell density than the wild type (Fig.
2) . Although the addition
of 0.5% CA (the same amount that improved but did not restore
growth of the mutant in minimal medium) to SWT did not substantially
improve the growth of either strain, the addition of 2.5% CA to
SWT increased the yield of both strains . Additionally, the
gacA mutant reached the same final cell density in
0.5x SWT as it did in SWT conditioned with
gacA broth . This cell density was lower than the
final cell density that the mutant reached in broth conditioned with
either a mixture of both wild type and
gacA
supernatants at a 1:1 ratio or wild type alone . In contrast, the wild
type reached the same cell density in all conditioned broths . These
data support the hypothesis that the growth yield defect of the mutant
was caused by a limitation of growth substrates rather than the
generation of growth-restrictive compounds by the
gacA mutant . The growth yield of the mutant was fully
restored by carrying the gacA gene in trans on
pVCW3C3 (data not shown) .
The
gacA mutants have a luminescence defect that is not
complemented by the addition of acyl-HSLs or aldehyde.
Luminescence was not detected from
broth cultures either of the
gacA::EZ::TN<KAN-2>
mutant (data not shown) or of the
gacA mutant (Fig.
3) unless the gacA gene was restored in trans on pVCW3C3
(data not shown) . In contrast, luminescence was detected from both the
uvrC mutant (data not shown) and the luxI mutant
(Fig . 3), which harbors a
mutation in the C6-HSL synthetase and therefore is
defective in the production of one of the two activating signals of the
lux biosynthetic operon . Although the luxI mutant
produces less luminescence than the wild type, the luxI mutant
was significantly more luminous than the
gacA mutant.
This finding implies that GacA did not simply affect LuxI activity, but
instead influenced luminescence by another mechanism . One hypothesis is
that the gacA mutation affected C8-HSL
production, as mutants in its synthetase, AinS, produce no luminescence
in culture (32) .
To
determine whether the
gacA mutant was defective in
the synthesis of C8-HSL, which is produced at a
relatively high level in culture by the wild type
(32), we tested the
ability of excess amounts of either acyl-HSL or decanal, a substrate of
the luciferase reaction that is limiting in culture, to complement the
mutant's luminescence defect . Exponentially growing culture of the
wild type or the luxI or
gacA mutant that
produced no detectable light became luminous after the addition of
decanal or either of the acyl HSLs (Table
2) . The wild type and the luxI mutant were similar in their
luminescence response to all three substances (Table
2) . However, with the
addition of C6-HSL or decanal, the
gacA mutant produced only about 20% of the
luminescence of either the wild type or the luxI mutant . With
C8-HSL, the
gacA mutant produced
only 2% of the luminescence of the other two strains (Table
2) . The inability of
exogenous acyl-HSL to complement its luminescence defect suggests that
repression of luminescence in the gacA mutants is not caused
solely by an acyl-HSL or decanal deficiency but is effected by another
mechanism .
| TABLE 2 . Luminescence
response to acyl-HSL and decanal
| |
Since the
gacA mutant was minimally
responsive to addition of excess acyl-HSLs, it was still unclear
whether the strain produced these compounds . Quantification of
acyl-HSLs revealed the
gacA mutant produced both
C6-HSL (0.07 nM) and C8-HSL
(1.2 µM) at the same molarity as the wild type (0.15 nM and 1.3
µM, respectively) . The luxI mutant also produced
C8-HSL at a similar concentration (1.7
µM); however, as expected, no C6-HSL was
detectable (<0.005 nM) .
Additional
colonization traits are affected by the GacA mutations in
culture.
Previous studies
have identified additional traits of V . fischeri important
during host colonization . These include the production of catalase
(32,
54) and siderophore
(19), as well as motility
(18,
36), all of which have
been shown to be regulated by GacA in other bacterial species
(22) . Therefore, we
determined whether GacA from V . fischeri globally controls
these colonization phenotypes in culture .
The
gacA::EZ::TN<KAN-2>
mutant was not defective in catalase activity, as culture extracts were
comparable to the wild type in the degradation of hydrogen peroxide.
However, both the gacA mutants, but not the uvrC
mutant, were defective at siderophore-mediated iron sequestration on
CAS agar plates . CAS agar, which is a defined, low-iron medium
containing 0.3% CA, did sustain growth of the gacA
mutants, although they grew more slowly than other mutants that are
also defective in siderophore activity (see Materials and Methods),
indicating that iron limitation alone did not cause the gacA
growth defect observed on minimal agar plates . An intact gacA
gene supplied in trans on pVCW3C3 restored siderophore
production to the gacA mutants .
GacA also regulates
motility behavior in V . fischeri, but its impact was complex.
Exponentially growing gacA mutants of V . fischeri
from liquid cultures were motile; however, their ability to swim
through various concentrations of soft agar was altered . Although other
Vibrio spp . exhibit swarming behavior on higher concentrations
of agar due to a lateral flagellar gene system distinct from the polar
flagella used for swimming
(48), V.
fischeri ES114 swims on agar concentrations between 0.25 and
0.7% and has not been reported or observed to be peritrichously
flagellated or to exhibit swarming motility . At a relatively low
viscosity (0.3% agar), both gacA mutants swam faster
than the wild type and were similar to a hyperswimmer strain of V.
fischeri, DM66 (Fig.
4) . However, at a higher viscosity (0.7% agar), the gacA
mutants swam more slowly than the wild type, which swam more slowly
than DM66 (Fig . 4) . The
motility of the gacA mutants when grown at an intermediate
viscosity (0.5% agar) (Fig.
4) and at all agar
concentrations tested when gacA was supplied in trans
on pVCW3C3 (data not shown) was indistinguishable from that of the wild
type . The uvrC mutation had no detectable effect on motility
(data not shown) . Examination by transmission electron microscopy of
the
gacA mutant grown in broth cultures revealed no
apparent differences in flagellum length, width, or appearance;
however, it was slightly hyperflagellated (5.2 ± 0.3 flagella
per cell) compared to the wild type (3.1 ± 0.2 flagella per
cell) .
| FIG . 4 . Effect
of medium viscosity on the motility of wild-type V . fischeri
and derivatives . The extent of movement of duplicate samples of
wild-type (gray bars),
gacA (black bars),
gacA::EZ::TN<KAN>
(white bars), and hyperswimmer strain DM66 (hatched bars) cells was
measured over time . Average values (± 1 standard deviation)
were normalized to the wild-type rates at each viscosity . The absence
of error bars indicates no variability within
treatment.
| |
Differences in chemotaxis between gacA mutants
and the wild type were also observed . At the leading edge of the
migrating front, both the wild type (data not shown) and the
hyperswimmer strain DM66 (Fig.
5A) created two distinct concentric bands, representing chemotaxis up a
gradient created by degradation of each of two attractants, nucleosides
and serine (13) . In
contrast, the concentric bands of the
gacA mutant
migrated more closely to each other (Fig.
5B) and often appeared as
one diffuse band . With the addition of either 0.5% CA (data not
shown) or 1.6 mM serine to the medium, which slows the migration of the
inner band of both wild-type (data not shown) and DM66 (Fig.
5C) cells, the two bands
generated by migration of the gacA mutant became distinctly
separated (Fig . 5D) . This
observation is consistent with the hypothesis that the gacA
mutant depleted serine from the medium more rapidly than the wild type
did .
| FIG . 5 . Patterns
of chemotaxis in soft agar by hyperswimmer derivatives of V.
fischeri . The relative migration rates towards serine (inner ring)
or nucleosides (outer ring) are indicated by the ring diameters . Shown
are the patterns of strain DM66 (A and C), which is the same as the
wild-type pattern, and the
gacA mutant (B and D) in
medium without (A and B) or with (C and D) the addition of 1.6 mM
serine.
| |
Symbiotic gacA mutants are
impaired in host colonization and growth, but not in
luminescence.
Because
gacA influenced traits in culture that could affect (i)
colonization initiation, e.g., motility
(18), (ii) growth within
the light organ, e.g., substrate utilization
(20), and (iii)
persistent association, e.g., luminescence
(52) and siderophore
production (19), we
tested the ability of the
gacA mutant to colonize,
grow within, and maintain an association with juvenile squid . When
newly hatched juvenile squid were placed for 3 h in SW
containing 2 x 103 wild-type cells/ml, 100%
of the animals became colonized; however, only 51% of animals
exposed to the same concentration of
gacA cells were
successfully colonized . A colonization efficiency of 100% was
achieved by gacA mutants only after a 14- to 18-h inoculation
with
104 CFU/ml, a level that is at least 50-fold
higher than that required by the wild type .
Although most
gacA mutant-colonized squid produced no detectable
luminescence, a subset was luminous (Table
3) . These data contrast with what we observed with the gacA mutant
grown in culture, which never produced detectable luminescence without
the addition of acyl-HSL or decanal (Fig.
3 and Table
2) . We confirmed that
bacteria isolated from these luminous squid were
gacA
based on both their colony morphology on LBS and CAS agar and their
luminescence and growth yield phenotypes in culture (data not shown);
however, the possibility remained that a mutation had occurred that
suppressed squid phenotypes or that the strains had adapted in some
other way to the light organ environment . We confirmed that
gacA mutants from luminous animals had not acquired a
mutation that suppressed gacA colonization phenotypes, because
such squid isolates retained a comparably low efficiency of
colonization and a low proportion of luminescence (10%)
characteristic of the original
gacA mutant inoculum.
Similarly, bacteria directly expelled from luminous gacA
mutant-colonized squid and not cultured in medium prior to a subsequent
exposure to squid were characteristically impaired at colonizing
juveniles, whereas expelled, wild-type bacteria were not impaired, even
when diluted 100-fold (data not shown) . Thus, there was no evidence
that
gacA symbionts in luminous animals had adapted
to the host, improving their ability to reinfect
squid .
| TABLE 3 . Luminescence
characteristics of colonized squid
| |
Enumeration of bacteria from the light organs of colonized
squid provided insight into why there were differences in luminescence
levels between various
gacA mutant-colonized squid.
Wild-type bacterial populations averaged 1.2 x 105
CFU/squid, whereas
gacA populations averaged only 1.5
x 103 CFU/squid, and this density was maintained
over several days (Fig.
6), whereas previously characterized derivatives of V . fischeri in
which luminescence has been either abolished or reduced do not maintain
their initial population levels and their population diminishes by
48 h postinoculation
(32) . Squid colonized by
the wild type became detectably luminous between 7 and 9 h
postinoculation, when their populations reached an average of 8
x 103 CFU/squid (Fig.
6) . On
average,
gacA mutant-colonized animals that were dark
contained populations of only 4 x 102 cells and,
thus, were below this minimum level of luminescence detection . The
gacA mutant-colonized animals that were detectably
luminous had larger symbiont populations (Table
3) and were above the
detection limit (Fig . 6).
Therefore, the inability of the
gacA mutant to reach
a normal colonization level in the light organ most likely prevented
the induction of detectable levels of luminescence in these animals.
Because a percentage of
gacA mutant-colonized animals
was detectably luminous and their symbionts did not differ from the
wild type in their luminescence per bacterial cell (Table
3), we inferred that GacA
was not required to achieve light emission in the squid . Normal
(100%) colonization efficiency (data not shown), colonization
level, and luminescence of the mutant were fully restored by carrying
the gacA gene in trans on pVCW3C3 (Table
4) .
TABLE 4 . Complementation
of
gacA symbiotic defects by gacA
| |
gacA mutants are severely
impaired at competitively initiating colonization but are not displaced
by the wild type in cocolonized light organs.
Determining the relative effectiveness
of mutant and wild-type bacteria during coinoculation experiments can
help elucidate interactions between the strains as they initiate
association with the host, because a direct competition can accentuate
defects and reveal otherwise subtle differences between strains . Thus,
we used such competition experiments to determine (i) whether the wild
type either complemented or exacerbated the association defects of the
mutant and, conversely, (ii) whether the mutant interfered with
colonization by the wild type .
When squid were coinoculated for
3 h with both the
gacA mutant and the wild
type, each at 6 x 103 CFU/ml, less than 0.05%
of the cells present in the symbiotic population at either 24 or
48 h were
gacA (Fig.
7A) . This result indicated that the
gacA mutant was at a
competitive disadvantage in colonization in the presence of wild-type
cells . Since at an inoculum of 6 x 103 CFU/ml the
wild type by itself colonized 100% of the squid, whereas the
gacA mutant by itself colonized only 65% of
the squid (Fig . 7A), we
hypothesized that the mutant's defect was expressed during the
initiation of the colonization rather than during competitive growth
within the light organ . To test this hypothesis, we adjusted the
inoculum so that it would give the two strains an equal chance at
initiating symbiosis . To equalize the strains' colonization
efficiencies, we combined
gacA cells at a
concentration of 2.5 x 103 CFU/ml, which by itself
resulted in colonization of 55% of the squid, with wild-type
cells at a concentration of only 1.1 x 102 CFU/ml,
which by itself resulted in colonization of 65% of the squid
(Fig . 7B) . With this 23:1
advantage, the
gacA mutant initiated the
cocolonization process with the efficiency expected and successfully
cocolonized squid with the wild type (Fig.
7B) . In the mixed
symbiotic populations that resulted, the mutant and the wild type
attained essentially the same levels as they did when they colonized in
the absence of the other strain (Fig.
7C) . Thus, it appears that
the
gacA competition defect is important primarily
during initiation . Even after initiation, wild-type cells neither
complemented the growth defect of the
gacA mutant
nor, surprisingly, displaced the
gacA population
after 48 h postinoculation . Similarly, there was no
indication that the presence of the
gacA mutant
affected the ability of the wild type to attain and maintain its normal
level of colonization .
| FIG . 7 . Colonization
of squid by wild-type V . fischeri and its
gacA derivative in mixed bacterial inoculations . (A
and B) The proportion of wild-type-colonized (light gray),
gacA mutant-colonized (black), cocolonized (dark
gray), or uncolonized (white) squid after inoculation with either 6,000
CFU of each strain by itself or 12,000 CFU of both strains combined at
a 1:1 ratio (wild type/ gacA mutant) (n
= 20 for each treatment) (A), or with a total of 110 CFU of the
wild type by itself (n = 20), 2,500 CFU of the
gacA mutant by itself (n = 20), or
2,600 CFU of both strains combined at a 1:23 ratio (wild
type/ gacA) (n = 70) (B).
(C) The mean number (± SE) of wild-type (light gray)
and
gacA (black) CFU per light organ at 48
h postinoculation is shown from the three subgroups that resulted from
the combined treatment presented in panel B (n = 46).
For wild-type-colonized or cocolonized squid a minimum of 200 colonies
were identified, but for
gacA mutant-colonized squid
frequently fewer than 100 bacterial colonies were available for
assessment due to this mutant's lower colonization
level.
| |
We
show here that in V . fischeri GacA globally controls multiple
phenotypes, several of which are generally important to bacteria during
host colonization, and at least one of which, luminescence, plays a
specific role in this symbiotic association
(52) . This study also
establishes that growth substrate utilization is coregulated by GacA
along with other colonization traits . The contribution of each
phenotype to the observed colonization defects remains speculative.
However, this study confirms the conservation of GacA as a bacterial
colonization regulator and indicates that GacA regulates not only
pathogenic associations but also a specific, beneficial animal
association .
Substrate utilization and
growth.
Although GacS/GacA
has long been associated with the regulation of secondary metabolism
(22), until recently the
implication that GacA is an important regulator of growth had been
largely overlooked . In several bacterial species, including
Pseudomonas fluorescens
(55), Azotobacter
vinelandii (8), and
E . coli (37),
GacA controls the production of RpoS, an alternative sigma factor
associated with the transition from rapid growth rates to slow or
nongrowing states . Consistent with reductions in RpoS, spontaneous
gacS and gacA mutants in P . fluorescens are
frequently isolated from and can overtake stationary-phase cultures
(14), as altered RpoS
function can confer a growth advantage in stationary-phase (GASP)
phenotype (57,
58) . Recent work has
confirmed the role of GacS/GacA in growth and substrate utilization, as
mutants in the GacS/GacA homologs of E . coli are similar to
CsrA mutants and show preference for growth on gluconeogenic
substrates, such as amino acids, but not glycolytic growth substrates
(41) . Enhanced ability to
catabolize amino acids can also confer a GASP phenotype
(59) . In several
bacterial species, including P . fluorescens
(1,
5,
23), E.
carotovora (12,
25), and E . coli
(49), GacA antagonizes
the repressive activity of CsrA homologs via positive regulation of
small regulatory RNA paralogs of csrB . These examples
demonstrate that there is a strong link between GacA and
growth .
Several phenotypes of the gacA mutants of V.
fischeri substantiate the role of gacA in primary
metabolism, including (i) their inability to grow on a minimal medium
with simple sugars as a carbon source, (ii) their low growth yield in
rich medium (Fig . 1), and
(iii) a growth yield defect in squid light organs (Table
3; Fig.
6) . Further results
suggest that as with the homologous mutant of E . coli
(41), the gacA
mutant of V . fischeri preferentially utilized amino acids as
growth substrates . These include (i) growth on minimal medium with CA
as a sole carbon source, (ii) improved growth yield in rich medium when
supplemented with CA (Fig.
2), and (iii) enhanced
chemotaxis toward serine consistent with a more rapid utilization and
depletion of this amino acid (Fig.
5) . Interestingly, the
wild type did not preferentially deplete the substrates that are growth
limiting for the gacA mutant; in fact, the gacA
mutant reached a higher cell density in wild-type-conditioned medium
than in gacA-conditioned medium, whereas the wild type reached
the same cell density in both conditioned media (Fig.
2) . Such differences
between the wild type and the gacA mutant in growth substrate
utilization could allow the strains to occupy different nutritional
niches during early stages of growth in cocolonized light organs,
allowing the gacA mutant to maintain its minority population
despite the abundance of competitors (Fig.
7C) . Although the extent
of the metabolic defects of the gacA mutant of V.
fischeri remains unknown, the inability of the mutant to grow on
the gluconeogenic substrate fumarate implies that regulation by GacA in
V . fischeri may be more complex than a defect in switching
between gluconeogenesis and glycolysis, as has been observed with
E . coli
(41) .
The growth
defects described both in culture and during symbiotic association
imply that the gacA mutation interfered with the ability of
V . fischeri to sense and adapt to the nutrient conditions of
the light organ . For instance, the limited availability of amino acids
in the light organ could underlie the restricted growth of the
gacA mutant much as it does for amino acid auxotrophs
(20) . Recently, it has
been reported that pathogenic Salmonella enterica serovar
Typhimurium recognizes its location within the enteric tract by sensing
the presence of intestinal short-chain fatty acids and, in response,
induces invasion genes through a process mediated by the GacS/GacA
homologs SirA/BarA (27).
A similar inability to respond appropriately to a light organ signal
could impair the gacA mutant not only during growth in the
light organ (Table 3; Fig.
6) but also during
initiation (Fig . 7A and
B) . Further characterization of the gacA mutant may elucidate
which nutrient resources serve as host-specific signals during
symbiotic association .
Luminescence
regulation.
One of the most
striking phenotypes of the GacA mutants in culture was their inability
to produce luminescence, a trait that is specifically important for the
squid-V . fischeri association
(52) . Due to the
dependence of squid luminescence on acyl-HSL signal accumulation
(32,
52) and the linkage of
GacS/GacA to acyl-HSL expression in other host-associated bacteria
(9,
15,
43), we suspected that
the dark phenotype of the GacA mutant of V . fischeri resulted
from a deficiency in acyl-HSL synthesis or accumulation . However, the
GacA mutant produced typical levels of both C6-HSL and
C8-HSL in culture and responded only partially to the
addition of excess acyl-HSLs (Table
2), suggesting that
luminescence expression could be blocked in the absence of GacA.
Surprisingly, whereas GacA was required for luminescence in culture, it
was not required for characteristic induced levels of luminescence per
bacterial cell in the host light organ (Table
3) . In contrast
luxI mutants, which are luminous in culture (Fig.
3), are not luminous in
the light organ even though they initially reach populations similar to
the wild-type strain (32,
52) . Although other
factors may play a role, these results demonstrate that
C6-HSL-mediated induction of luminescence and not GacA is
the dominant activating pathway in the squid
host .
Other symbiosis-related
phenotypes.
The appropriate
expression of motility behavior, which is regulated by GacA in other
bacteria (17,
26,
56), is critical during
early stages of squid-host association
(18,
36) . Although the
hyperflagellation of gacA mutants may explain their
hyperswimmer phenotype in low-viscosity medium, it is unclear why they
appear less motile than the wild type in high-viscosity medium, since
other hyperflagellated strains swim faster than the wild type at all
medium viscosities (Fig.
4)
(36) . Furthermore,
because V . fischeri ES114 does not exhibit the swarming
motility that other Vibrio spp . exhibit
(48), such differences
cannot be explained as a defect in lateral flagella . Since nonmotile
V . fischeri strains cannot initiate colonization
(18), this study implies
that the gacA mutants were motile during squid association;
however, their hyperflagellation phenotype could lead to a delay in
colonization
(36) .
We
investigated two additional colonization traits that are often present
in GacA regulons . Catalase production was identified as an important
bacterial factor during growth in the squid light organ
(54) and indicated that
the oxidative environment of the light organ may restrict the growth of
certain bacteria . Although bacterial defenses to oxidative damage are
controlled by GacA in other bacteria
(37,
55), V . fischeri
did not require GacA for normal catalase activity in culture . In
contrast, GacA was required for the production of another colonization
factor, siderophore . The production of siderophores by pathogenic
bacteria can contribute to virulence by mediating iron acquisition from
host sources, but they can also contribute to protection from oxidative
damage by preventing the Fe2+-catalyzed generation
of free radicals (42) . A
recent study determined that the siderophore biosynthetic gene,
iucA, is induced by V . fischeri cells within squid
light organs (50),
supporting the importance of iron sequestration during persistent host
association
(19) .
GacA
and symbiont specificity.
This study demonstrated that
gacA mutants were not only defective in reaching normal
colonization levels but also were severely impaired during initiation
and early colonization phases of symbiosis, suggesting that GacA may
coregulate defense and communication activities along with nutrient
acquisition . During host association, it is postulated that a selective
winnowing occurs that eventually allows colonization only by V.
fischeri (53).
Indeed, while other bacterium species can participate in the initial
stages of association, even at these early stages V . fischeri
exhibits dominance (38).
Such a selection process is likely to involve not only symbiont defense
traits but also reciprocal bacterium-host signaling and recognition.
Analysis of the GacA regulon in V . fischeri is ultimately
aimed at discovering such traits that may elucidate how bacteria
colonize and maintain beneficial associations with
animals .
We thank C . DeLoney-Marino,
K . Visick, and J . Graf for protocols and helpful suggestions and A.
Schaefer for assistance with acyl-HSL purification and quantification.
We further thank A . Schaefer, D . Millikan, C . Lupp, J . McCann, J.
Graber and L . Sycuro for technical assistance, helpful conversations,
and comments on earlier versions of the manuscript and D . K.
Willis for guidance in the initiation of these studies .
This work
was supported in part by a postdoctoral fellowship in microbial biology
from the National Science Foundation to C.A.W., by National Institutes
of Health grant RR12294 to E.G.R . and M . McFall-Ngai, by National
Science Foundation grant IBN0211673 to M . McFall-Ngai and E.G.R., and
by a W . M . Keck Foundation grant to E.G.R . and
others .
* Corresponding
author . Mailing address: Pacific Biomedical Research Center, University
of Hawaii, 41 Ahui St., Honolulu, HI 96813 . Phone: (808) 539-7309 . Fax:
(808) 599-4817 . E-mail:
eruby{at}hawaii.edu .
- Aarons,
S., A . Abbas, C . Adams, A . Fenton, and F . O'Gara.2000 . A regulatory RNA (prrB RNA) modulates expression of
secondary metabolite genes in Pseudomonas fluorescens F113.J . Bacteriol.
182:3913-3919.
- Altschul,
S., T . Madden, A . Schaffer, J . Zhang, Z . Zhang, W . Miller, and D.
Lipman. 1997 . Gapped BLAST and PSI-BLAST: a new
generation of protein database search programs . Nucleic Acids
Res.
25:3389-3402.
- Ausubel,
F., R . Brent, R . E . Kingston, D . D . Moore,
J . G . Seidman, J . A . Smith, and K . Struhl.1990 . Current protocols in molecular biology . Wiley and
Sons, Inc., New York,
N.Y.
- Beers,
R . F., Jr., and I . W . Sizer. 1952.
A spectrophotometric method for measuring the breakdown of hydrogen
peroxide by catalase . J . Biol . Chem.
195:133-140.
- Blumer,
C., S . Heeb, B . Pessi, and D . Haas. 1999 . Global
GacA-steered control of cyanide and exoprotease production in
Pseudomonas fluorescens involves specific ribosome binding
sites . Proc . Natl . Acad . Sci . USA
96:14073-14078.
- Boettcher,
K . J., and E . G . Ruby. 1990.
Depressed light emission by symbiotic Vibrio fischeri of the
sepiolid squid Euprymna scolopes. J . Bacteriol.
172:1053-1058.
- Boettcher,
K . J., and E . G . Ruby. 1995.
Detection and quantification of Vibrio fischeri autoinducer
from symbiotic squid light organs . J . Bacteriol.
177:1053-1058.
- Castaneda,
M., J . Sanchez, S . Moreno, C . Nunez, and G . Espin.2001 . The global regulators GacA and sigma S form part of
a cascade that controls alginate production in Azotobacter
vinelandii. J . Bacteriol.
183:6787-6793.
- Chancey,
S . T., D . W . Wood, and L . S . Pierson
III. 1999 . Two-component transcriptional regulation of
N-acyl-homoserine lactone production in Pseudomonas
aureofaciens. Appl . Environ . Microbiol.
65:2294-2299.
- Chancey,
S . T., D . W . Wood, E . A . Pierson, and
L . S . Pierson III. 2002 . Survival of
GacS/GacA mutants of the biological control bacterium Pseudomonas
aureofaciens 30-84 in the wheat rhizosphere . Appl.
Environ . Microbiol.
68:3308-3314.
- Corbell,
N . A., and J . E . Loper. 1995 . A
global regulator of secondary metabolite production in Pseudomonas
fluorescens Pf-5 . J . Bacteriol.
177:6230-6236.
- Cui,
Y., A . Chatterjee, and A . K . Chatterjee.2001 . Effects of the two-component system comprising GacA
and GacS of Erwinia carotovora subsp . carotovora on
the production of global regulatory rsmB RNA, extracellular enzymes,
and HarpinEcc . Mol . Plant Microbe Interact.
14:516-526.
- DeLoney-Marino,
C . R., C . R . Wolfe, and K . L . Visick.
Chemoattraction of Vibrio fischeri to serine, nucleosides, and
N-acetylneuraminic acid, a component of squid light-organ
mucus . Appl . Environ . Microbiol., in
press.
- Duffy,
V . K., and G . Defago. 2000 . Controlling
instability in gacS-gacA regulatory genes during
inoculate production of Pseudomonas fluorescens biocontrol
strains . Mol . Plant Microbe Interact.
66:3142-3150.
- Eriksson,
A . R . B., R . A . Andersson, M . Pirhonen,
and E . T . Palva. 1998 . Two-component
regulators involved in the global control of virulence in Erwinia
carotovora subsp . carotovora. Mol . Plant Microbe
Interact.
8:743-752.
- Flavier,
A . B., L . M . Ganova-Raeva, M . A . Schell,
and T . P . Denny. 1997 . Hierarchical
autoinduction in Ralstonia solanacearum: control of
acyl-homoserine lactone production by a novel autoregulatory system
responsive to 3-hydroxypalmitic acid methyl ester . J.
Bacteriol.
179:7089-7097.
- Goodier,
R . I., and B . M . M . Ahmer.2001 . SirA orthologs affect both motility and virulence.J . Bacteriol.
183:2249-2258.
- Graf,
J., P . V . Dunlap, and E . G . Ruby.1994 . Effect of transposon-induced motility mutations on
colonization of the host light organ by Vibrio fischeri.J . Bacteriol.
176:6986-6991.
- Graf,
J., and E . G . Ruby. 2000 . Novel effects of a
transposon insertion in the Vibrio fischeri glnD gene: defects
in iron uptake and symbiotic persistence in addition to nitrogen
utilization . Mol . Microbiol.
37:168-179.
- Graf,
J., and E . G . Ruby. 1998 . Host-derived amino
acids support the proliferation of symbiotic bacteria . Proc.
Natl . Acad . Sci . USA
95:1818-1822.
- Hammer,
B . K., E . S . Tateda, and M . S.
Swanson. 2002 . A two-component regulator induces the
transmission phenotype of stationary-phase Legionella
pneumophila. Mol . Microbiol.
44:107-118.
- Heeb,
S., and D . Haas. 2001 . Regulatory roles of the
GacS/GacA two-component system in plant-associated and other
gram-negative bacteria . Mol . Plant Microbe Interact.
14:1351-1363.
- Heeb,
S., C . Blumer, and D . Haas. 2002 . Regulatory RNA as
mediator in GacA/RsmA-dependent global control of exoproduct formation
in Pseudomonas fluorescens CHA0 . J . Bacteriol.
184:1046-1056.
- Herrero,
M., V . de Lorenzo, and K . N . Timmis. 1990.
Transposon vectors containing non-antibiotic resistance selection
markers for cloning and stable chromosomal insertion of foreign genes
in gram-negative bacteria . J . Bacteriol.
172:6557-6567.
- Hyytiainen,
H., M . Montesano, and E . T . Palva. 2001.
Global regulators ExpA (GacA) and KdgR modulate extracellular enzyme
gene expression through the RsmA-RsmB system in Erwinia
carotovora subsp . carotovora . Mol . Plant Microbe
Interact.
14:931-938.
- Kinscherf,
T . G., and D . K . Willis. 1999.
Swarming by Pseudomonas syringea B728a requires gacS
(lemA) and gacA but not the acyl-homoserine lactone
biosynthetic gene ahlI. J . Bacteriol.
181:4133-4136.
- Lawhon,
S . D., R . Maurer, M . Suyemoto, and C . Altier.2002 . Intestinal short-chain fatty acids alter
Salmonella typhimurium invasion gene expression and virulence
through BarA/SirA . Mol . Microbiol.
46:1451-1464.
- Lee,
K . H., and E . G . Ruby. 1994.
Competition between Vibrio fischeri strains during initiation
and maintenance of a light organ symbiosis . J.
Bacteriol.
176:1985-1991.
- Lee,
K . H., and E . G . Ruby. 1994.
Effect of the squid host on the abundance and distribution of symbiotic
Vibrio fischeri in nature . Appl . Environ.
Microbiol.
60:1565-1571.
- Lee,
K . H., and E . G . Ruby. 1995.
Symbiotic role of the viable but nonculturable state of Vibrio
fischeri in Hawaiian coastal seawater . Appl . Environ.
Microbiol.
61:278-283.
- Lund,
A . H., M . Dutch, and F . S . Pedersen.1996 . Increased cloning efficiency by temperature-cycle
ligation . Nucleic Acids Res.
24:800-801.
- Lupp,
C., M . Urbanowski, E . P . Greenberg, and E . G.
Ruby. 2003 . The Vibrio fischeri
quorum-sensing systems ain and lux sequentially
induce luminescence gene expression and are important for persistence
in the squid host . Mol . Microbiol.
50:319-331.
- McCann,
J., E . V . Stabb, D . S . Millikan, and E.
G . Ruby. 2003 . Population dynamics of Vibrio
fischeri during infection of Euprymna scolopes.Appl . Environ . Microbiol.
69:5928-5934.
- Meighen,
E . A., and P . V . Dunlap. 1993.
Physiological, biochemical and genetic control of bacterial
bioluminescence . Adv . Microb . Physiol.
34:1-67.
- Miller,
J . H. 1972 . Experiments in molecular
genetics . Cold Spring Harbor Laboratory, Cold Spring Harbor,
N.Y.
- Millikan,
D . S., and E . G . Ruby. 2002.
Alterations in Vibrio fischeri motility correlate with a delay
in symbiosis initiation and are associated with additional symbiotic
colonization defects . Appl . Environ . Microbiol.
68:2519-2528.
- Mukhopadhyay,
S., J . P . Audia, R . N . Roy, and H . E.
Schellhorn. 2000 . Transcriptional induction of the
conserved alternative sigma factor RpoS in Escherichia coli is
dependent on BarA, a probable two-component regulator . Mol.
Microbiol.
37:371-381.
- Nyholm,
S . V., B . Deplancke, H . R . Gaskins, M . A.
Apicella, and M . J . McFall-Ngai. 2002 . Roles
of Vibrio fischeri and nonsymbiotic bacteria in the dynamics
of mucus secretion during symbiont colonization of the Euprymna
scolopes light organ . Appl . Environ . Microbiol.
68:5113-5122.
- Pearson,
J . P., K . M . Gray, L . Passador, K . D.
Tucker, A . Eberhard, B . H . Iglewski, and E . P.
Greenberg. 1994 . Structure of the autoinducer required
for expression of Pseudomonas aeruginosa virulence genes.Proc . Natl . Acad . Sci . USA
91:197-201.
- Pernestig,
A . K., S . J . Normark, D . M . Georgellis,
and O . Melefors. 2000 . The role of the AirS
two-component system in uropathogenic Escherichia coli.Adv . Exp . Med . Biol.
485:137-142.
- Pernestig,
A.-K., D . Georgellis, T . Romeo, K . Suzuki, H . Tomenius, S . Normark, and
O . Melefors. 2003 . The Escherichia coli
BarA-UvrY two-component system is needed for efficient switching
between glycolytic and gluconeogenic carbon sources . J.
Bacteriol.
185:843-853.
- Ratledge,
C., and L . G . Dover. 2000 . Iron metabolism
in pathogenic bacteria . Annu . Rev . Microbiol.
54:881-941.
- Reimmann,
C., M . Beyeler, M . Latifi, H . Winteler, M . Foglino, A . Lazdunski, and
D . Hass. 1997 . The global activator GacA of
Pseudomonas aeruginosa PAO positively controls the production
of the autoinducer N-butyryl-homoserine lactone and the
formation of the virulence factors pyocyanin, cyanide, and lipase.Mol . Microbiol.
24:309-319.
- Ruby,
E . G., and L . M . Asato. 1993.
Growth and flagellation of Vibrio fischeri during initiation
of the sepiolid squid light organ symbioses . Arch.
Microbiol.
159:160-167.
- Sambrook,
J., E . F . Fritsch, and T . Maniatis. 1989.
Molecular cloning: a laboratory manual, 2nd ed . Cold Spring Harbor
Laboratory Press, Cold Spring Harbor,
N.Y.
- Schaefer,
A . L., B . L . Hanselka, M . R . Parsek, and
E . P . Greenberg. 2000 . Detection,
purification, and structural elucidation of the acylhomoserine lactone
inducer of Vibrio fischeri luminescence and other related
molecules . Methods Enzymol.
305:288-301.
- Stabb,
E . V., and E . G . Ruby. 2002.
RP4-based plasmids for conjugation between Escherichia coli
and members of the Vibrionaceae . Methods
Enzymol.
358:413-426.
- Stewart,
B . J., and L . L . McCarter. 2003.
Lateral flagellar gene systems of Vibrio parahaemolyticus.J . Bacteriol.
185:4508-4518.
- Suzuki,
K., X . Wang, T . Weilbacher, A.-K . Pernestig, O . Melefors, D.
Georgellis, P . Babitzke, and T . Romeo. 2002.
Regulatory circuitry of the CsrA/CsrB and BarA/UvrY systems of
Escherichia coli. J . Bacteriol.
184:5130-5140.
- Visick,
K . L., and E . G . Ruby. 1997 . New
genetic tools for use in the marine bioluminescent bacterium Vibrio
fischeri, p . 119-122 . In
J . W . Hastings, L . J . Kricka, and P . E.
Stanley (ed.), Bioluminescence and chemiluminescence . John Wiley &
Sons, New York,
N.Y.
- Visick,
K . L., and E . G . Ruby. TnluxAB
insertion mutants of Vibrio fischeri with symbiosis-regulated
phenotypes . Nova Acta Leopold., in
press.
- Visick,
K . L., J . Foster, J . Doino, M . McFall-Ngai, and E.
G . Ruby. 2000 . Vibrio fischeri lux genes play
an important role in colonization and development of the host light
organ . J . Bacteriol.
182:4578-4586.
- Visick,
K . L., and M . J . McFall-Ngai.2000 . An exclusive contract: specificity in the Vibrio
fischeri-Euprymna scolopes partnership . J.
Bacteriol.
182:1779-1787.
- Visick,
K . L., and E . G . Ruby. 1998 . The
periplasmic group III catalase of Vibrio fischeri is required
for normal symbiotic competence and is induced both by oxidative stress
and by approach to stationary phase . J . Bacteriol.
180:2087-2092.
- Whistler,
C . A., N . A . Corbell, A . Sarniguet, W . Ream, and
J . E . Loper. 1998 . The two-component
regulators GacS and GacA influence accumulation of the stationary-phase
sigma factor
s and the stress response in
Pseudomonas fluorescens Pf-5 . J . Bacteriol.
180:6635-6641.
- Wong,
S . M., P . A . Carroll, L . G . Rahme,
F . M . Ausubel, and S . B . Calderwood.1998 . Modulation of expression of the ToxR regulon in
Vibrio cholerae by a member of the two-component family of
response regulators . Infect . Immun.
66:5854-5861.
- Zambrano,
M . M., and R . Kolter. 1996 . GASPing for life
in stationary phase . Cell
86:181-184.
- Zambrano,
M . M., D . A . Siegele, M . Almiron, A . Tormo, and R.
Kolter. 1993 . Microbial competition: Escherichia
coli mutants that take over stationary phase cultures.Science
259:1757-1760.
- Zinser,
E . R., and R . Kolter. 1999 . Mutations
enhancing amino acid catabolism confer a growth advantage in stationary
phase . J . Bacteriol.
181:5800-5807.
Free Online Full-text Article
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
|