|








| |
Journal of Bacteriology, February 2004, p . 1191-1196, Vol .
186, No . 4
Physical and Enzymological Interaction of Bacillus subtilis Proteins
Required for De Novo Pyridoxal 5'-Phosphate Biosynthesis
Boris R . Belitsky*
Department of Molecular Biology and Microbiology, Tufts University School of
Medicine, Boston, Massachusetts 02111
Received 31 July 2003/ Accepted 5 October 2003
Bacillus subtilis synthesizes pyridoxal 5'-phosphate, the active
form of vitamin B6, by a poorly characterized pathway involving
the yaaD and yaaE genes . The pdxS [yaaD]
mutant was confirmedto be a strict B6 auxotroph, but the
pdxT [yaaE] mutant turnedout to be a conditional
auxotroph depending on the availabilityof ammonium in the growth
medium . The PdxS and PdxT proteinscopurified during affinity
chromatography and apparently forma complex that has glutaminase
activity . PdxS and PdxT appearto encode the synthase and glutaminase
subunits, respectively,of a glutamine amidotransferase of
as-yet-unknown specificityessential for B6 biosynthesis.
Pyridoxal 5'-phosphate [PLP], the biologically active form ofvitamin
B6, is an essential cofactor for numerous metabolic
enzymes [17] . Two pathways of de novo PLP synthesis are
known.The PdxA/PdxJ pathway, comprising six dedicated steps, has
beenextensively characterized in Escherichia coli [9,
15] . Genesencoding similar enzymes can be found
in the genomes of manyother gram-negative bacteria . A second pathway
of PLP synthesis,PDX1/PDX2, has been recently discovered in fungi
through identificationof two proteins [PDX1/SNZ/SOR1/PYROA and
PDX2/SNO] that arerequired for PLP synthesis [2,
10, 11, 27,
31] . Genes codingfor similar proteins are highly
conserved in plants, sponges,plasmodia, archaea, and many bacteria [12,
25, 36, 37].
The adjacent Bacillus subtilis genes, yaaD and yaaE,
homologousto PDX1 and PDX2, respectively, have
recently been shown tobe required for PLP biosynthesis [33] .
We present evidence herethat YaaD [renamed PdxS] and YaaE [renamed
PdxT] form a glutamineamidotransferase of as-yet-unknown specificity
required forthe pathway of de novo PLP synthesis.
|
|
Construction and characterization of the pdxS null
mutant . |
To create a deletion mutation within the pdxS gene, pBB1181
[Fig . 1] was cut with AatII and HindIII and religated after
filling in the ends . The actual deletion endpoint in the resulting
plasmid, pBB1185 [Fig . 1], as determined by sequencing,
turnedout to be beyond the HindIII site; the sequence removed was
606 bp long and did not alter the reading frame of pdxS . pBB1218,
a truncated version of pBB1185 [Fig . 1], was used to
replacethe wild-type pdxS gene of B . subtilis strain
SMY with the
pdxS
allele, resulting in strain BB2253 . Methods for plasmid isolation,
agarose and polyacrylamide gel electrophoresis, use of restriction
and DNA modification enzymes, DNA ligation, PCR, and electroporation
of E . coli JM107 cells were as described by Sambrook et al.
[35] . Growth of B . subtilis cells,
transformation by plasmidDNA, and procedures for gene replacement
were as described previously[4, 5].
|
FIG . 1 . Genetic map of the pdxST [yaaDE] region and
plasmids carrying different parts of this region . The restriction sites
are abbreviated as follows: A, AatII; B, BamHI; E, EcoRI; H, HindIII; N,
NcoI; S, SalI; Sh, SphI; Sw, SwaI . The sites shown in parentheses were
created by PCR . Deletion mutations are shown with triangles . The 1.4-kb
ble cassette is not drawn to scale . His6 notations
indicate that six histidine-encoding codons were added at the 3' ends of
the corresponding genes . To create pBB1181, a 1.8-kb PCR product
containing the pdxS and pdxT genes was synthesized using
B . subtilis strain SMY chromosomal DNA as a template and pdxST-specific
primers oBB120 [5'-GATTTGGATCCGGAATTTGGGGAAGC] and oBB121
[5'-TTATAGTCGACTATAAGTTTCCACAGC], containing BamHI and SalI
sites, respectively [indicated in bold] . The PCR fragment was cloned in
an integrative vector, pBB544 [3] . pBB1181 contained a
point mutation, shown by an asterisk, in the penultimate codon of the
pdxT gene [GGC to AGC with a corresponding Gly-to-Ser change] and
was stable only in the pcnB80 zad::Tn10 derivative of
E . coli strain JM107 which reduces the plasmid copy number [23]
and apparently alleviates the toxicity of the cloned fragment . To create
pBB1252, a 1.54-kb DNA fragment coding for the wild-type version of PdxS
and a modified version of PdxT containing a His6 tag at its C
terminus was synthesized by PCR, using SMY chromosomal DNA as a
template, and oligonucleotides oBB138 [5'-ATAACGGATCCTTGATTAGGGGGACC]
and oBB144 [5'-TTTCAGTCGACTTAATGGTGATGGTGATGGTGTACAAGTGCCTTTTGCTTAT]
as 5' and 3' primers, respectively [the BamHI and SalI sites are
indicated in bold, and the histidine codons are underlined] . The PCR
fragment was first blunt ended, then cut with SalI, and cloned in the
expression vector pBAD18 containing the inducible E . coli araBAD
promoter [14] and cut with SmaI and SalI . Two
derivatives of pBB1252 expressing either PdxT-His6 only
[pBB1256] or unmodified PdxS only [pBB1257] were generated by removing
either the 0.37-kb Acc65I [the vector site]-SwaI fragment containing the
5' part of the pdxS gene or the 0.54-kb fragment between the
insert and vector SphI sites containing most of the pdxT gene .
Plasmid pBB1261 overexpressing the PdxS-His6 protein was
constructed by cloning the 0.90-kb NcoI-SphI fragment in the pBAD24
vector containing the E . coli araBAD promoter and an appropriate
ribosomal binding site [14] . The pdxS fragment
was synthesized by PCR using SMY chromosomal DNA as a template and
oligonucleotides oBB151 [5'-CCAAGCCATGGCTCAAACAGGTAC] and oBB152
[5'-TGTTCGCATGCTTAATGGTGATGGTGATGGTGCCAGCCGCGTTCTTGCAT] as
5' and 3' primers, respectively [the NcoI and SphI sites are indicated
in bold, and the histidine codons are underlined].
|
|
Strain BB2253 [pdxS] lost the ability to grow in minimal medium,
even if the medium was enriched with amino acids; growth was
fully restored by addition of 0.2 µM pyridoxal [PL] . Thisresult is
consistent with the phenotype of the pdxS insertionmutant [33]
and the documented role in PLP biosynthesis of fungalpdxS
homologs [2, 10, 27,
31] . Pyridoxine [PN] was 1,000-foldless effective
in restoration of BB2253 growth, indicating thatB . subtilis
cells utilize exogenous PN for PLP biosynthesisweakly or not at all
[growth in the presence of PN may be dueto PL contamination or to
oxidation of PN to PL] . Pyridoxaminewas several times less effective
than PL [probably due to thespecificity of the pyridoxal kinase
required for phosphorylationof all simple B6 vitamers [45]
or the corresponding transportsystem].
|
|
Construction and characterization of the pdxT null
mutant . |
A deletion-insertion mutation within the pdxT gene was created
by replacing the 135-bp SphI-EcoRI fragment of pBB1213 [Fig.
1] with a 1.4-kb SphI-EcoRI ble cassette determining
resistanceto phleomycin, excised from pJPM136 [5] .
pBB1217 was introducedinto B . subtilis SMY, and strain BB2256
[ pdxT::ble]
was isolatedas described previously [5].
In contrast to strain BB2253 [pdxS], strain BB2256 [pdxT]
behavedin minimal medium as a conditional PL auxotroph depending on
ammonium availability . Virtually no growth was observed in
glucose-glutamateor glucose-1 mM NH4Cl medium, but growth
at almost the wild-typerate was observed in the presence of 60 to
120 mM NH4Cl [Fig.2]; intermediate
growth was observed in glucose-0.2% [37.4 mM]NH4Cl
medium . Growth of strain BB2256 was restored to the wild-typerate by
addition of PL . Similarly, less severe effects of fungalPDX2
gene defects on PLP synthesis, compared with what is seenwith
PDX1 defects, have been described previously [11,
31, 40].In fact, the B6
dependency of the Aspergillus nidulans PYROB[similar to
PDX2; GenBank accession number
AAK50016] mutantwas also rescued by a high concentration of
ammonium [1] . Thepartial B6 auxotrophy
of pdxT mutants and the poor capacityof B . subtilis
cells to utilize PN explain the ability of 50µM PN to relieve the
growth defect of the pdxT mutantbut not that of the pdxS
mutant [33].
|
FIG . 2 . Growth of the yaaE [pdxT] mutant with different
ammonium concentrations . Cells of strain BB2256 were grown overnight in
TSS-glucose minimal medium with 30 mM NH4Cl and diluted
100-fold into fresh medium with the indicated NH4Cl
concentrations . OD600, optical density at 600 nm.
|
|
A Bacillus circulans mutant defective in the yaaE [pdxT]
genehas been described recently . Though the function of the gene
was not determined, a conditional growth defect dependent on
ammonium availability was also observed for this mutant [41].
The authors of this earlier study tried to relieve the growth
defect by adding PN but failed in accord with the very poorability
of B . subtilis cells to utilize PN.
A strain [BB2254] carrying a deletion of parts of both pdxS
and pdxT was constructed as described above by using pBB1190,
which lacks the 898-bp fragment of pBB1181 starting at the AatIIsite
[Fig . 1] . BB2254 had the same strict PL auxotrophy as a
single pdxS null mutant . No pseudorevertants of such mutants
have been found . Because both pdxS and pdxST deletions cause
a strict requirement for B6 vitamers, we conclude that only
one pathway of de novo PLP synthesis, which cannot be easily
bypassed due to mutations in other genes, operates in B . subtilis.
B . subtilis mutants requiring PN, PL, or pyridoxamine for growth
have been isolated previously [30] but have not been
characterizedgenetically . The B6 requirement of most such
mutants was partiallyor completely alleviated by isoleucine or
isoleucine plus lowconcentrations of PN [30] . In
our work, no effect on the growthof the pdxS or pdxT
mutants was observed when isoleucine [500µg/ml], with or without a
suboptimal amount of PN, wasadded [data not shown], suggesting that
our mutants are differentfrom the ones isolated previously.
The fact that PL is utilized preferentially and PN only very
poorly correlates well with an apparent lack in B . subtilisof
the E . coli pdxH-like gene and the corresponding pyridoxine
5'-phosphate oxidase activity [29, 30]
required for conversionof PN to PLP . No genes likely to encode
pyridoxine 5'-phosphateoxidase can be found in most bacteria
harboring the pdxS- andpdxT-like genes [data not
shown] . It is likely that all suchbacteria will prove to depend on
PL if their de novo pathwayof PLP synthesis becomes inactivated . In
accord with this conclusion,several lactic acid bacteria whose
genomes lack pdxH and thegenes for de novo PLP synthesis were
shown to use PL preferentially[38].
|
|
A mixture of PdxS and PdxT has glutaminase activity.
|
PdxT and other PDX2-like proteins are similar to some glutamine
amidotransferases [47], consistent with the observation that
in some fungi and bacteria the nitrogen group of PLP originates
in glutamine [42] . In E . coli and some other bacteria,
the nitrogengroup of PLP comes from glutamate [42]
through the SerC-catalyzedtransamination step [21];
in B . subtilis, SerC aminotransferaseis not involved in B6
synthesis [34].
The sequence of pdxT suggests that this gene is unlikely to
encode a full glutamine amidotransferase by itself . It is morelikely
to encode a glutaminase subunit of a heteromultimericglutamine
amidotransferase responsible for hydrolysis of glutamineto glutamate
and ammonia and for channeling the latter to thecorresponding
synthase subunit . The location of pdxS adjacentto pdxT
makes pdxS the most likely candidate to encode the synthase
subunit of this glutamine amidotransferase of a novel, as-yet-unknown
specificity . The phenotypes of pdxS and pdxT null mutants [strict
and conditional requirements for B6 vitamers, respectively]
are entirely consistent with this suggestion as [i] most glutamine
amidotransferases are able to utilize ammonium, though withlow
efficiency, as a substitute for glutamine, [ii] the glutaminase
subunit is completely dispensable when ammonium is the substrate,and
[iii] inactivation of glutaminase subunits of other glutamine
amidotransferases often leads to conditional, ammonium-dependent
phenotypes of corresponding mutants [46].
In the absence of precise knowledge of the reaction catalyzedby
the putative PdxST complex, we tested a known partial activityof
glutamine amidotransferases, the glutaminase reaction which
frequently occurs in the absence of other substrates [46] . A
His6-tagged version of B . subtilis PdxS [the predicted
molecularmass of the unmodified protein is 31.6 kDa] was
overproducedin E . coli LMG194 [ara] cells [14]
containing pBB1261 [Fig.1] after addition of 0.2%
L-arabinose to Luria broth culturesat an A600
of 0.25 to 0.4 and incubation for 4 h . The cellswere pelleted,
washed in 50 mM Tris-Cl [pH 8.0]-5% glycerol,and disrupted by
sonication in 20 mM Tris-Cl [pH 7.9]-500 mMNaCl-5 mM imidazole-5%
glycerol-1 mM phenylmethylsulfonyl fluoride-0.1%Nonidet P-40 . The
supernatant was clarified by low-speed centrifugation,and PdxS was
purified to virtual homogeneity on a Ni2+ affinitycolumn
[His•Bind resin; Novagen] as described by the manufacturer,using 485
mM imidazole for elution [Fig . 3, lane 1] . A His6-tagged
version of B . subtilis PdxT [the predicted molecular mass of
the unmodified protein is 21.4 kDa] was purified from E . coli
[pBB1256] cells in a similar manner using 385 mM imidazole for
elution [Fig . 3, lane 3] . The modified proteins, when
expressedin B . subtilis cells, were active and could
complement nullmutations in the corresponding chromosomal genes
[data not shown].
|
FIG . 3 . Purification of PdxS, PdxT, and the PdxST complex . The proteins
were purified by Ni2+ affinity chromatography and subjected
to sodium dodecyl sulfate-12% polyacrylamide gel electrophoresis . Lane
1, purified PdxS-His6; lane 2, PdxS-[PdxT-His6]
complex; lane 3, purified PdxT-His6.
|
|
Glutaminase activity was detected in a coupled reaction withbovine
glutamate dehydrogenase as the increase in optical densityat 363 nm
due to reduction of 3-acetylpyridine adenine dinucleotide[APAD],
which accompanies conversion of glutamine-derived glutamateto
2-ketoglutarate . Samples were assayed at room temperaturein 1 ml of
50 mM Tris-Cl [pH 8.2]-10 mM glutamine-0.6 mM APADcontaining 1 U of
bovine glutamate dehydrogenase [Sigma] . Theuse of APAD, an analog of
NAD, shifts the unfavorable equilibriumof the glutamate
dehydrogenase reaction [44] . The data were
corrected for very low reduction of APAD in reactions lackingPdx
proteins . Protein concentration was determined using a Bio-Rad
protein assay with bovine serum albumin as a standard.
Neither PdxT [Fig . 4, curve 1] nor PdxS [data not shown]
alonehad glutaminase activity when glutamine was provided as the
only substrate . When PdxS and PdxT were both present, significant
glutaminase activity was observed . Higher glutaminase activity
was obtained when the ratio of PdxS to PdxT was increased [Fig.
4, curves 2 and 3].
|
FIG . 4 . Glutaminase activity of the PdxT protein and PdxST complex .
Purified PdxT-His6 and PdxS-His6 were assayed for
glutaminase activity singly or in combination after 15 min of
preincubation at room temperature . Curve 1, 40 µM PdxT; curve 2, 5 µM
PdxT plus 2.5 µM PdxS; curve 3, 5 µM PdxT plus 5 µM PdxS . OD363,
optical density at 363 nm.
|
|
Glutaminase subunits of some other glutamine amidotransferasesare
also activated by the presence of the corresponding synthasesubunits
[18, 46] . This result strongly confirms
our hypothesisthat PdxS and PdxT are components of the same enzyme .
Additionally,we conclude that the conditional growth phenotype of
the pdxT-likemutants reflects the ammonium-dependent activity
of PdxS inthe absence of its cognate glutaminase subunit.
|
|
PdxS and PdxT interact physically .
|
An E . coli strain containing pBB1252 [Fig . 1] and
overproducingthe wild-type version of the B . subtilis PdxS
protein and aHis6-tagged version of PdxT was used for
purification of thePdxT-His6 protein by Ni2+
affinity chromatography . Wild-typePdxS, which by itself had no
affinity for the Ni2+ affinitycolumn, copurified with
PdxT-His6 [though not in the stoichiometricamount],
indicating that the two proteins form a complex thatdoes not
completely dissociate even under the high salt conditions[0.5 M
NaCl, 0.4 M imidazole] used for purification [Fig . 3,
lane 2] . This result is consistent with the postulated interaction
of yeast PDX1 and PDX2 homologs, as deduced from experiments
with two-hybrid systems [28] . No protein copurified with
PdxT-His6if part of the pdxS gene was deleted from
pBB1252, as in pBB1256[Fig . 1 and 3,
lane 3].
|
|
Analysis of the PdxST pathway .
|
All gram-positive bacteria have either the PdxST pathway orno PLP
synthetic pathway; most other bacteria have the PdxA/PdxJpathway
[data not shown; published genome sequence data weresearched by
using the National Center for Biotechnology InformationBlast server
available at
http://www.ncbi.nlm.nih.gov/BLAST;preliminary sequence data were
searched at
http://www.ncbi.nlm.nih.gov/sutils/genom_table.cgiand http://www.sanger.ac.uk/DataSearch] .
Some lactic acid bacteriaand Clostridium spp . are known to be
B6 auxotrophs [6, 19,
26,38], consistent with the
absence of the genes of de novo PLPsynthesis in their genomes . No
single bacterial genome has genescoding for all components of both
pathways . Some bacteria withthe PdxST pathway have a PdxA homolog;
it is likely that theseorphan PdxA-like proteins, as well as
additional PdxA paralogsin some gram-negative bacteria [data not
shown], have a dehydrogenaseactivity unrelated to PLP synthesis . The
pdxS- and pdxT-likegenes are linked in all bacterial
genomes except that of Mycobacteriumleprae [8].
In Saccharomyces cerevisiae, a glucose-derived five-carbon-containing
compound and a triose are utilized for PLP synthesis [13,
48].No other components of the PDX1/PDX2 pathway,
other than glutamine,are known, and it is unclear whether all steps
of the PDX1/PDX2pathway are common in different organisms . In our
work, we demonstratedthat the PdxST complex is likely to catalyze
the correspondingglutamine amidotransferase reaction though neither
the additionalsubstrate[s] nor the products of the reaction have
been identified.PdxS may have a phosphate-binding site [12],
implicating a phosphorylatedcompound as a substrate; another
possible role for this siteis binding of flavin mononucleotide [FMN;
the IPR003009 motifavailable at www.ebi.ac.uk/interpro].The latter
designationmay be misleading, however . Many enzymes containing the
IPR003009motif are not known to bind FMN; instead, they have
pent[ul]ose5-phosphate derivatives as their substrates . Since FMN
containsa ribityl-5-phosphate group, we suggest that the IPR003009
motifreflects binding of a five-carbon unit phosphorylated at
position5 . In that case, one of the PdxST substrates, in addition to
glutamine, is a phosphorylated five-carbon carbohydrate derivative,
as has been suggested by tracer experiments for yeast [13].
Guanylylation of a protein that turned out to be PdxS by extracts
of B . subtilis cells has been reported [24] . The
physiologicalrole of this modification remains unknown.
In yeast grown anaerobically, glutamine does not serve as B6
precursor [16] . It is possible that under these
conditions theyeast PdxS-like SNZ protein uses ammonium as its
substrate.Interestingly, the genomes of several bacteria, such as
Fusobacteriumnucleatum, Corynebacterium efficiens,
Clostridium botulinum,and Treponema denticola, include
pdxS-like genes but no pdxT-likegene [data not shown] .
PdxS proteins of these organisms mayoperate as ammonium-dependent
synthases of the PLP pathway,may use other types of glutaminase
subunits, or may not synthesizePLP in vivo . The tight B6
requirement of the pdxT null mutantin the absence of ammonium
indicates that no other B . subtilisglutaminase can substitute
for PdxT.
1-Deoxy-D-xylulose-5-phosphate, whose formation is
catalyzedby the dxs gene product [22,
39], is required for PLP synthesisin E . coli
[7, 20] . Most bacteria that have pdxS-
and pdxT-likegenes have dxs orthologs, but no
orthologs of dxs can be foundin the genomes of archaea,
Staphylococcus aureus, or Streptococcuspneumoniae, all of
which apparently utilize the PdxST pathway[data not shown] .
Moreover, the B . subtilis conditional dxsmutant was
not impaired in B6 synthesis [32] . Additionally,
the five-carbon-containing compound utilized for PLP synthesis
in yeast is derived from glucose as an intact unit [13]; in
contrast, 1-deoxy-D-xylulose-5-phosphate originates
from condensationof pyruvate and glyceraldehyde 3-phosphate [9,
15] . Therefore,Dxs-produced 1-deoxy-D-xylulose-5-phosphate
is an unlikely intermediatein the PdxST-dependent pathway of PLP
synthesis . Though an alternativeroute of 1-deoxy-D-xylulose-5-phosphate
synthesis was describedin E . coli, its physiological role is
unknown [43].
Exogenous 2'-hydroxypyridoxine can be converted to PLP in yeast[49] .
It is possible that 2'-hydroxypyridoxine 5'-phosphateis an immediate
precursor of PLP in B . subtilis . If so, theputative
five-carbon intermediate of the PdxST pathway shouldhave a hydroxyl
group at its 1 position.
The crystal structure of the B . subtilis PdxT [YaaE] protein
was determined recently [J . A . Bauer, E . M . Bennett, T . P . Begley,
and S . E . Ealick, J . Biol . Chem., in press].
I am grateful to A . L . Sonenshein and J . Smith for many helpful
discussions and for careful reading of the manuscript.
This work was supported by a grant from the National Science
Foundation [MCB-0110651] to B.R.B.
* Mailing address: Department of Molecular Biology and
Microbiology, Tufts University School of Medicine, 136 Harrison Ave., Boston, MA
02111 . Phone: [617] 636-3618 . Fax: [617] 636-0337 . E-mail: bbelit02@granite.tufts.edu.
- Arst, H . N., Jr., A . G . Brownlee, and S . A . Cousen. 1982 .
Nitrogen metabolite repression in Aspergillus nidulans: a farewell to
tamA? Curr . Genet . 6:245-257.
- Bean, L . E., W . H . Dvorachek, Jr., E . L . Braun, A . Errett, G .
S . Saenz, M . D . Giles, M . Werner-Washburne, M . A . Nelson, and D . O . Natvig.
2001 . Analysis of the pdx-1 [snz-1/sno-1] region of the Neurospora
crassa genome: correlation of pyridoxine-requiring phenotypes with
mutations in two structural genes . Genetics 157:1067-1075 .
- Belitsky, B . R., M . C . Gustafsson, A . L . Sonenshein, and C .
Von Wachenfeldt. 1997 . An lrp-like gene of Bacillus subtilis
involved in branched-chain amino acid transport . J . Bacteriol . 179:5448-5457.
- Belitsky, B . R., and A . L . Sonenshein. 2002 . GabR, a
member of a novel protein family, regulates utilization of
-aminobutyrate
in Bacillus subtilis . Mol . Microbiol . 45:569-583.
- Belitsky, B . R., and A . L . Sonenshein. 1998 . Role and
regulation of Bacillus subtilis glutamate dehydrogenase genes . J .
Bacteriol . 180:6298-6305 .
- Boyd, J . M., M . A . Logan, and A . A . Tytell. 1948 . The
growth requirements of Clostridium perfringens [welchii] BP6K .
J . Biol . Chem . 174:1013-1025.
- Cane, D . E., S . Du, J . K . Robinson, Y . Hsiung, and I . D .
Spenser. 1999 . Biosynthesis of vitamin B6: enzymatic conversion
of 1-deoxy-D-xylulose-5-phosphate to pyridoxol
phosphate . J . Am . Chem . Soc . 121:7222-7223.
- Cole, S . T., K . Eiglmeier, J . Parkhill, K . D . James, N . R .
Thomson, P . R . Wheeler, N . Honore, T . Garnier, C . Churcher, D . Harris, K .
Mungall, D . Basham, D . Brown, T . Chillingworth, R . Connor, R . M . Davies, K .
Devlin, S . Duthoy, T . Feltwell, A . Fraser, N . Hamlin, S . Holroyd, T . Hornsby,
K . Jagels, C . Lacroix, J . Maclean, S . Moule, L . Murphy, K . Oliver, M . A .
Quail, M . A . Rajandream, K . M . Rutherford, S . Rutter, K . Seeger, S . Simon, M .
Simmonds, J . Skelton, R . Squares, S . Squares, K . Stevens, K . Taylor, S .
Whitehead, J . R . Woodward, and B . G . Barrell. 2001 . Massive gene decay in
the leprosy bacillus . Nature 409:1007-1011.
- Drewke, C., and E . Leistner. 2001 . Biosynthesis of
vitamin B6 and structurally related derivatives . Vitam . Horm . 61:121-155.
- Ehrenshaft, M., P . Bilski, M . Y . Li, C . F . Chignell, and M .
E . Daub. 1999 . A highly conserved sequence is a novel gene involved in de
novo vitamin B6 biosynthesis . Proc . Natl . Acad . Sci . USA 96:9374-9378 .
- Ehrenshaft, M., and M . E . Daub. 2001 . Isolation of PDX2,
a second novel gene in the pyridoxine biosynthesis pathway of eukaryotes,
archaebacteria, and a subset of eubacteria . J . Bacteriol . 183:3383-3390 .
- Galperin, M . Y., and E . V . Koonin. 1997 . Sequence
analysis of an exceptionally conserved operon suggests enzymes for a new link
between histidine and purine biosynthesis . Mol . Microbiol . 24:443-445.
- Gupta, R . N., T . Hemscheidt, B . G . Sayer, and I . D . Spenser.
2001 . Biosynthesis of vitamin B6 in yeast: incorporation pattern of
glucose . J . Am . Chem . Soc . 123:11353-11359.
- Guzman, L . M., D . Belin, M . J . Carson, and J . Beckwith.
1995 . Tight regulation, modulation, and high-level expression by vectors
containing the arabinose PBAD promoter . J . Bacteriol . 177:4121-4130.
- Hill, R . E., and I . D . Spenser. 1996 . Biosynthesis of
vitamin B6, p . 695-703 . In F . C . Neidhardt, R . I . Curtiss,
J . L . Ingraham, E . C . C . Lin, K . B . Low, B . Magasanik, W . S . Reznikoff, M .
Riley, M . Schaechter, and H . E . Umbarger [ed.], Escherichia coli and
Salmonella typhimurium: cellular and molecular biology . American Society
for Microbiology, Washington, D.C.
- Ishida, S., and K . Yamada. 2002 . Biosynthesis of
pyridoxine in Saccharomyces cerevisiae—origin of the pyridoxine
nitrogen atom differs under anaerobic and aerobic conditions . J . Nutr . Sci .
Vitaminol . 48:448-452.
- John, R . A. 1995 . Pyridoxal phosphate-dependent enzymes .
Biochim . Biophys . Acta 1248:81-96.
- Klem, T . J., and V . J . Davisson. 1993 . Imidazole
glycerol phosphate synthase: the glutamine amidotransferase in histidine
biosynthesis . Biochemistry 32:5177-5186.
- Koser, S . A. 1968 . Vitamin requirements of bacteria and
yeasts . Charles C . Thomas Publisher, Springfield, Ill.
- Laber, B., W . Maurer, S . Scharf, K . Stepusin, and F . S .
Schmidt. 1999 . Vitamin B6 biosynthesis: formation of pyridoxine
5'-phosphate from 4-[phosphohydroxy]-L-threonine and
1-deoxy-D-xylulose-5-phosphate by PdxA and PdxJ
protein . FEBS Lett . 449:45-48.
- Lam, H . M., and M . E . Winkler. 1990 . Metabolic
relationships between pyridoxine [vitamin B6] and serine biosynthesis in
Escherichia coli K-12 . J . Bacteriol . 172:6518-6528.
- Lois, L . M., N . Campos, S . R . Putra, K . Danielsen, M .
Rohmer, and A . Boronat. 1998 . Cloning and characterization of a gene from
Escherichia coli encoding a transketolase-like enzyme that catalyzes
the synthesis of D-1-deoxyxylulose 5-phosphate, a
common precursor for isoprenoid, thiamin, and pyridoxol biosynthesis . Proc .
Natl . Acad . Sci . USA 95:2105-2110 .
- Lopilato, J., S . Bortner, and J . Beckwith. 1986 .
Mutations in a new chromosomal gene of Escherichia coli K-12, pcnB,
reduce plasmid copy number of pBR322 and its derivatives . Mol . Gen . Genet .
205:285-290.
- Mitchell, C., P . W . Morris, and J . C . Vary. 1992 . Amino
acid sequences of several Bacillus subtilis proteins modified by
apparent guanylylation . Mol . Microbiol . 6:1579-1581.
- Mittenhuber, G. 2001 . Phylogenetic analyses and
comparative genomics of vitamin B6 [pyridoxine] and pyridoxal phosphate
biosynthesis pathways . J . Mol . Microbiol . Biotechnol . 3:1-20.
- Mulligan, J . H., and E . E . Snell. 1977 . Transport and
metabolism of vitamin B6 in lactic acid bacteria . J . Biol . Chem . 252:835-839.
- Osmani, A . H., G . S . May, and S . A . Osmani. 1999 . The
extremely conserved pyroA gene of Aspergillus nidulans is
required for pyridoxine synthesis and is required indirectly for resistance to
photosensitizers . J . Biol . Chem . 274:23565-23569 .
- Padilla, P . A., E . K . Fuge, M . E . Crawford, A . Errett, and
M . Werner-Washburne. 1998 . The highly conserved, coregulated SNO and SNZ
gene families in Saccharomyces cerevisiae respond to nutrient
limitation . J . Bacteriol . 180:5718-5726 .
- Pflug, W., and F . Lingens. 1983 . Occurrence of
pyridoxamine-phosphate oxidase and pyridoxal kinase in gram-negative and
gram-positive bacteria . Hoppe-Seyler's Z . Physiol . Chem . 364:1627-1630.
- Pflug, W., and F . Lingens. 1978 . Vitamin-B6-biosynthesis
in Bacillus subtilis . Hoppe-Seyler's Z . Physiol . Chem . 359:559-570.
- Rodriguez-Navarro, S., B . Llorente, M . T .
Rodriguez-Manzaneque, A . Ramne, G . Uber, D . Marchesan, B . Dujon, E . Herrero,
P . Sunnerhagen, and J . E . Perez-Ortin. 2002 . Functional analysis of yeast
gene families involved in metabolism of vitamins B1 and B6 .
Yeast 19:1261-1276.
- Sakai, A., N . Kinoshita, M . Kita, T . Katsuragi, and Y . Tani.
2003 . Investigation of 1-deoxy-D-xylulose 5-phosphate
synthase and transketolase of Bacillus subtilis in relation to vitamin
B-6 biosynthesis . J . Nutr . Sci . Vitaminol . 49:73-75.
- Sakai, A., M . Kita, T . Katsuragi, N . Ogasawara, and Y . Tani.
2002 . yaaD and yaaE are involved in vitamin B6
biosynthesis in Bacillus subtilis . J . Biosci . Bioeng . 93:309-312.
- Sakai, A., M . Kita, T . Katsuragi, and Y . Tani. 2002 .
serC is involved in vitamin B-6 biosynthesis in Escherichia coli
but not in Bacillus subtilis . J . Biosci . Bioeng . 93:334-337.
- Sambrook, J., E . F . Fritsch, and T . J . Maniatis. 1989 .
Molecular cloning: a laboratory manual, 2nd ed . Cold Spring Harbor Laboratory,
Cold Spring Harbor, N.Y.
- Seack, J., S . Perovic, V . Gamulin, H . C . Schroder, P .
Beutelmann, I . M . Muller, and W . E . Muller. 2001 . Identification of highly
conserved genes: SNZ and SNO in the marine sponge Suberites domuncula:
their gene structure and promoter activity in mammalian cells . Biochim .
Biophys . Acta 1520:21-34.
- Sivasubramaniam, S., V . M . Vanniasingham, C . T . Tan, and N .
H . Chua. 1995 . Characterisation of HEVER, a novel stress-induced gene from
Hevea brasiliensis . Plant Mol . Biol . 29:173-178.
- Snell, E . E. 1989 . Nutrition research with lactic acid
bacteria: a retrospective view . Annu . Rev . Nutr . 9:1-19.
- Sprenger, G . A., U . Schorken, T . Wiegert, S . Grolle, A . A .
de Graaf, S . V . Taylor, T . P . Begley, S . Bringer-Meyer, and H . Sahm. 1997 .
Identification of a thiamin-dependent synthase in Escherichia coli
required for the formation of the 1-deoxy-D-xylulose
5-phosphate precursor to isoprenoids, thiamin, and pyridoxol . Proc . Natl .
Acad . Sci . USA 94:12857-12862 .
- Stolz, J., and M . Vielreicher. 2003 . Tpn1p, the plasma
membrane vitamin B6 transporter of Saccharomyces cerevisiae .
J . Biol . Chem . 278:18990-18996 .
- Tamegai, H., E . Nango, A . Koike-Takeshita, F . Kudo, and K .
Kakinuma. 2002 . Significance of the 20-kDa subunit of heterodimeric
2-deoxy-scyllo-inosose synthase for the biosynthesis of butirosin antibiotics
in Bacillus circulans . Biosci . Biotechnol . Biochem . 66:1538-1545.
- Tanaka, K., K . Tazuya, K . Yamada, and H . Kumaoka. 2000 .
Biosynthesis of pyridoxine: origin of the nitrogen atom of pyridoxine in
microorganisms . J . Nutr . Sci . Vitaminol . 46:55-57.
- Wungsintaweekul, J., S . Herz, S . Hecht, W . Eisenreich, R .
Feicht, F . Rohdich, A . Bacher, and M . H . Zenk. 2001 . Phosphorylation of
1-deoxy-D-xylulose by D-xylulokinase
of Escherichia coli . Eur . J . Biochem . 268:310-316 .
- Wyngaarden, J . B., and D . M . Ashton. 1959 . The
regulation of activity of phosphoribosylpyrophosphate amidotransferase by
purine ribonucleotides: a potential feedback control of purine biosynthesis .
J . Biol . Chem . 234:1492-1496.
- Yang, Y., H . C . Tsui, T . K . Man, and M . E . Winkler.
1998 . Identification and function of the pdxY gene, which encodes a
novel pyridoxal kinase involved in the salvage pathway of pyridoxal
5'-phosphate biosynthesis in Escherichia coli K-12 . J . Bacteriol .
180:1814-1821 .
- Zalkin, H. 1993 . The amidotransferases . Adv . Enzymol .
Relat . Areas Mol . Biol . 66:203-309.
- Zalkin, H., and J . L . Smith. 1998 . Enzymes utilizing
glutamine as an amide donor . Adv . Enzymol . Relat . Areas Mol . Biol . 72:87-144.
- Zeidler, J., R . N . Gupta, B . G . Sayer, and I . D . Spenser.
2003 . Biosynthesis of vitamin B6 in yeast . Incorporation pattern of
trioses . J . Org . Chem . 68:3486-3493.
- Zeidler, J., N . Ullah, R . N . Gupta, R . M . Pauloski, B . G .
Sayer, and I . D . Spenser. 2002 . 2'-Hydroxypyridoxol, a biosynthetic
precursor of vitamins B6 and B1 in yeast . J . Am . Chem .
Soc . 124:4542-4543.
Free Online Full-text Article
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
|