Microbiology Reader
Equipment to run microbiology work automatically

Growth Curves of any strain.
Microbiological calculations.

Microbiology Home
Microbioloy Reader
Growth Curves
Photo Album
Microorganisms
Software
Download
Purchasing
Contact Us


Journal of Bacteriology, February 2004, p . 1191-1196, Vol . 186, No . 4

Physical and Enzymological Interaction of Bacillus subtilis Proteins Required for De Novo Pyridoxal 5'-Phosphate Biosynthesis

Boris R . Belitsky*

Department of Molecular Biology and Microbiology, Tufts University School of Medicine, Boston, Massachusetts 02111

Received 31 July 2003/ Accepted 5 October 2003


 

  ABSTRACT

 
Bacillus subtilis synthesizes pyridoxal 5'-phosphate, the active form of vitamin B6, by a poorly characterized pathway involving the yaaD and yaaE genes . The pdxS [yaaD] mutant was confirmedto be a strict B6 auxotroph, but the pdxT [yaaE] mutant turnedout to be a conditional auxotroph depending on the availabilityof ammonium in the growth medium . The PdxS and PdxT proteinscopurified during affinity chromatography and apparently forma complex that has glutaminase activity . PdxS and PdxT appearto encode the synthase and glutaminase subunits, respectively,of a glutamine amidotransferase of as-yet-unknown specificityessential for B6 biosynthesis.


 

  INTRODUCTION

 
Pyridoxal 5'-phosphate [PLP], the biologically active form ofvitamin B6, is an essential cofactor for numerous metabolic enzymes [17] . Two pathways of de novo PLP synthesis are known.The PdxA/PdxJ pathway, comprising six dedicated steps, has beenextensively characterized in Escherichia coli [9, 15] . Genesencoding similar enzymes can be found in the genomes of manyother gram-negative bacteria . A second pathway of PLP synthesis,PDX1/PDX2, has been recently discovered in fungi through identificationof two proteins [PDX1/SNZ/SOR1/PYROA and PDX2/SNO] that arerequired for PLP synthesis [2, 10, 11, 27, 31] . Genes codingfor similar proteins are highly conserved in plants, sponges,plasmodia, archaea, and many bacteria [12, 25, 36, 37].

The adjacent Bacillus subtilis genes, yaaD and yaaE, homologousto PDX1 and PDX2, respectively, have recently been shown tobe required for PLP biosynthesis [33] . We present evidence herethat YaaD [renamed PdxS] and YaaE [renamed PdxT] form a glutamineamidotransferase of as-yet-unknown specificity required forthe pathway of de novo PLP synthesis.


 

  Construction and characterization of the pdxS null mutant .

 
To create a deletion mutation within the pdxS gene, pBB1181 [Fig . 1] was cut with AatII and HindIII and religated after filling in the ends . The actual deletion endpoint in the resulting plasmid, pBB1185 [Fig . 1], as determined by sequencing, turnedout to be beyond the HindIII site; the sequence removed was 606 bp long and did not alter the reading frame of pdxS . pBB1218, a truncated version of pBB1185 [Fig . 1], was used to replacethe wild-type pdxS gene of B . subtilis strain SMY with the {Delta}pdxS allele, resulting in strain BB2253 . Methods for plasmid isolation, agarose and polyacrylamide gel electrophoresis, use of restriction and DNA modification enzymes, DNA ligation, PCR, and electroporation of E . coli JM107 cells were as described by Sambrook et al. [35] . Growth of B . subtilis cells, transformation by plasmidDNA, and procedures for gene replacement were as described previously[4, 5].


 

 FIG . 1 . Genetic map of the pdxST [yaaDE] region and plasmids carrying different parts of this region . The restriction sites are abbreviated as follows: A, AatII; B, BamHI; E, EcoRI; H, HindIII; N, NcoI; S, SalI; Sh, SphI; Sw, SwaI . The sites shown in parentheses were created by PCR . Deletion mutations are shown with triangles . The 1.4-kb ble cassette is not drawn to scale . His6 notations indicate that six histidine-encoding codons were added at the 3' ends of the corresponding genes . To create pBB1181, a 1.8-kb PCR product containing the pdxS and pdxT genes was synthesized using B . subtilis strain SMY chromosomal DNA as a template and pdxST-specific primers oBB120 [5'-GATTTGGATCCGGAATTTGGGGAAGC] and oBB121 [5'-TTATAGTCGACTATAAGTTTCCACAGC], containing BamHI and SalI sites, respectively [indicated in bold] . The PCR fragment was cloned in an integrative vector, pBB544 [3] . pBB1181 contained a point mutation, shown by an asterisk, in the penultimate codon of the pdxT gene [GGC to AGC with a corresponding Gly-to-Ser change] and was stable only in the pcnB80 zad::Tn10 derivative of E . coli strain JM107 which reduces the plasmid copy number [23] and apparently alleviates the toxicity of the cloned fragment . To create pBB1252, a 1.54-kb DNA fragment coding for the wild-type version of PdxS and a modified version of PdxT containing a His6 tag at its C terminus was synthesized by PCR, using SMY chromosomal DNA as a template, and oligonucleotides oBB138 [5'-ATAACGGATCCTTGATTAGGGGGACC] and oBB144 [5'-TTTCAGTCGACTTAATGGTGATGGTGATGGTGTACAAGTGCCTTTTGCTTAT] as 5' and 3' primers, respectively [the BamHI and SalI sites are indicated in bold, and the histidine codons are underlined] . The PCR fragment was first blunt ended, then cut with SalI, and cloned in the expression vector pBAD18 containing the inducible E . coli araBAD promoter [14] and cut with SmaI and SalI . Two derivatives of pBB1252 expressing either PdxT-His6 only [pBB1256] or unmodified PdxS only [pBB1257] were generated by removing either the 0.37-kb Acc65I [the vector site]-SwaI fragment containing the 5' part of the pdxS gene or the 0.54-kb fragment between the insert and vector SphI sites containing most of the pdxT gene . Plasmid pBB1261 overexpressing the PdxS-His6 protein was constructed by cloning the 0.90-kb NcoI-SphI fragment in the pBAD24 vector containing the E . coli araBAD promoter and an appropriate ribosomal binding site [14] . The pdxS fragment was synthesized by PCR using SMY chromosomal DNA as a template and oligonucleotides oBB151 [5'-CCAAGCCATGGCTCAAACAGGTAC] and oBB152 [5'-TGTTCGCATGCTTAATGGTGATGGTGATGGTGCCAGCCGCGTTCTTGCAT] as 5' and 3' primers, respectively [the NcoI and SphI sites are indicated in bold, and the histidine codons are underlined].

 
Strain BB2253 [pdxS] lost the ability to grow in minimal medium, even if the medium was enriched with amino acids; growth was fully restored by addition of 0.2 µM pyridoxal [PL] . Thisresult is consistent with the phenotype of the pdxS insertionmutant [33] and the documented role in PLP biosynthesis of fungalpdxS homologs [2, 10, 27, 31] . Pyridoxine [PN] was 1,000-foldless effective in restoration of BB2253 growth, indicating thatB . subtilis cells utilize exogenous PN for PLP biosynthesisweakly or not at all [growth in the presence of PN may be dueto PL contamination or to oxidation of PN to PL] . Pyridoxaminewas several times less effective than PL [probably due to thespecificity of the pyridoxal kinase required for phosphorylationof all simple B6 vitamers [45] or the corresponding transportsystem].


 

  Construction and characterization of the pdxT null mutant .

 
A deletion-insertion mutation within the pdxT gene was created by replacing the 135-bp SphI-EcoRI fragment of pBB1213 [Fig. 1] with a 1.4-kb SphI-EcoRI ble cassette determining resistanceto phleomycin, excised from pJPM136 [5] . pBB1217 was introducedinto B . subtilis SMY, and strain BB2256 [{Delta}pdxT::ble] was isolatedas described previously [5].

In contrast to strain BB2253 [pdxS], strain BB2256 [pdxT] behavedin minimal medium as a conditional PL auxotroph depending on ammonium availability . Virtually no growth was observed in glucose-glutamateor glucose-1 mM NH4Cl medium, but growth at almost the wild-typerate was observed in the presence of 60 to 120 mM NH4Cl [Fig.2]; intermediate growth was observed in glucose-0.2% [37.4 mM]NH4Cl medium . Growth of strain BB2256 was restored to the wild-typerate by addition of PL . Similarly, less severe effects of fungalPDX2 gene defects on PLP synthesis, compared with what is seenwith PDX1 defects, have been described previously [11, 31, 40].In fact, the B6 dependency of the Aspergillus nidulans PYROB[similar to PDX2; GenBank accession number AAK50016] mutantwas also rescued by a high concentration of ammonium [1] . Thepartial B6 auxotrophy of pdxT mutants and the poor capacityof B . subtilis cells to utilize PN explain the ability of 50µM PN to relieve the growth defect of the pdxT mutantbut not that of the pdxS mutant [33].


 

 FIG . 2 . Growth of the yaaE [pdxT] mutant with different ammonium concentrations . Cells of strain BB2256 were grown overnight in TSS-glucose minimal medium with 30 mM NH4Cl and diluted 100-fold into fresh medium with the indicated NH4Cl concentrations . OD600, optical density at 600 nm.

 
A Bacillus circulans mutant defective in the yaaE [pdxT] genehas been described recently . Though the function of the gene was not determined, a conditional growth defect dependent on ammonium availability was also observed for this mutant [41]. The authors of this earlier study tried to relieve the growth defect by adding PN but failed in accord with the very poorability of B . subtilis cells to utilize PN.

A strain [BB2254] carrying a deletion of parts of both pdxS and pdxT was constructed as described above by using pBB1190, which lacks the 898-bp fragment of pBB1181 starting at the AatIIsite [Fig . 1] . BB2254 had the same strict PL auxotrophy as a single pdxS null mutant . No pseudorevertants of such mutants have been found . Because both pdxS and pdxST deletions cause a strict requirement for B6 vitamers, we conclude that only one pathway of de novo PLP synthesis, which cannot be easily bypassed due to mutations in other genes, operates in B . subtilis.

B . subtilis mutants requiring PN, PL, or pyridoxamine for growth have been isolated previously [30] but have not been characterizedgenetically . The B6 requirement of most such mutants was partiallyor completely alleviated by isoleucine or isoleucine plus lowconcentrations of PN [30] . In our work, no effect on the growthof the pdxS or pdxT mutants was observed when isoleucine [500µg/ml], with or without a suboptimal amount of PN, wasadded [data not shown], suggesting that our mutants are differentfrom the ones isolated previously.

The fact that PL is utilized preferentially and PN only very poorly correlates well with an apparent lack in B . subtilisof the E . coli pdxH-like gene and the corresponding pyridoxine 5'-phosphate oxidase activity [29, 30] required for conversionof PN to PLP . No genes likely to encode pyridoxine 5'-phosphateoxidase can be found in most bacteria harboring the pdxS- andpdxT-like genes [data not shown] . It is likely that all suchbacteria will prove to depend on PL if their de novo pathwayof PLP synthesis becomes inactivated . In accord with this conclusion,several lactic acid bacteria whose genomes lack pdxH and thegenes for de novo PLP synthesis were shown to use PL preferentially[38].


 

  A mixture of PdxS and PdxT has glutaminase activity.

 
PdxT and other PDX2-like proteins are similar to some glutamine amidotransferases [47], consistent with the observation that in some fungi and bacteria the nitrogen group of PLP originates in glutamine [42] . In E . coli and some other bacteria, the nitrogengroup of PLP comes from glutamate [42] through the SerC-catalyzedtransamination step [21]; in B . subtilis, SerC aminotransferaseis not involved in B6 synthesis [34].

The sequence of pdxT suggests that this gene is unlikely to encode a full glutamine amidotransferase by itself . It is morelikely to encode a glutaminase subunit of a heteromultimericglutamine amidotransferase responsible for hydrolysis of glutamineto glutamate and ammonia and for channeling the latter to thecorresponding synthase subunit . The location of pdxS adjacentto pdxT makes pdxS the most likely candidate to encode the synthase subunit of this glutamine amidotransferase of a novel, as-yet-unknown specificity . The phenotypes of pdxS and pdxT null mutants [strict and conditional requirements for B6 vitamers, respectively] are entirely consistent with this suggestion as [i] most glutamine amidotransferases are able to utilize ammonium, though withlow efficiency, as a substitute for glutamine, [ii] the glutaminase subunit is completely dispensable when ammonium is the substrate,and [iii] inactivation of glutaminase subunits of other glutamine amidotransferases often leads to conditional, ammonium-dependent phenotypes of corresponding mutants [46].

In the absence of precise knowledge of the reaction catalyzedby the putative PdxST complex, we tested a known partial activityof glutamine amidotransferases, the glutaminase reaction which frequently occurs in the absence of other substrates [46] . A His6-tagged version of B . subtilis PdxS [the predicted molecularmass of the unmodified protein is 31.6 kDa] was overproducedin E . coli LMG194 [ara] cells [14] containing pBB1261 [Fig.1] after addition of 0.2% L-arabinose to Luria broth culturesat an A600 of 0.25 to 0.4 and incubation for 4 h . The cellswere pelleted, washed in 50 mM Tris-Cl [pH 8.0]-5% glycerol,and disrupted by sonication in 20 mM Tris-Cl [pH 7.9]-500 mMNaCl-5 mM imidazole-5% glycerol-1 mM phenylmethylsulfonyl fluoride-0.1%Nonidet P-40 . The supernatant was clarified by low-speed centrifugation,and PdxS was purified to virtual homogeneity on a Ni2+ affinitycolumn [His•Bind resin; Novagen] as described by the manufacturer,using 485 mM imidazole for elution [Fig . 3, lane 1] . A His6-tagged version of B . subtilis PdxT [the predicted molecular mass of the unmodified protein is 21.4 kDa] was purified from E . coli [pBB1256] cells in a similar manner using 385 mM imidazole for elution [Fig . 3, lane 3] . The modified proteins, when expressedin B . subtilis cells, were active and could complement nullmutations in the corresponding chromosomal genes [data not shown].


 

 FIG . 3 . Purification of PdxS, PdxT, and the PdxST complex . The proteins were purified by Ni2+ affinity chromatography and subjected to sodium dodecyl sulfate-12% polyacrylamide gel electrophoresis . Lane 1, purified PdxS-His6; lane 2, PdxS-[PdxT-His6] complex; lane 3, purified PdxT-His6.

 
Glutaminase activity was detected in a coupled reaction withbovine glutamate dehydrogenase as the increase in optical densityat 363 nm due to reduction of 3-acetylpyridine adenine dinucleotide[APAD], which accompanies conversion of glutamine-derived glutamateto 2-ketoglutarate . Samples were assayed at room temperaturein 1 ml of 50 mM Tris-Cl [pH 8.2]-10 mM glutamine-0.6 mM APADcontaining 1 U of bovine glutamate dehydrogenase [Sigma] . Theuse of APAD, an analog of NAD, shifts the unfavorable equilibriumof the glutamate dehydrogenase reaction [44] . The data were corrected for very low reduction of APAD in reactions lackingPdx proteins . Protein concentration was determined using a Bio-Rad protein assay with bovine serum albumin as a standard.

Neither PdxT [Fig . 4, curve 1] nor PdxS [data not shown] alonehad glutaminase activity when glutamine was provided as the only substrate . When PdxS and PdxT were both present, significant glutaminase activity was observed . Higher glutaminase activity was obtained when the ratio of PdxS to PdxT was increased [Fig. 4, curves 2 and 3].


 

 FIG . 4 . Glutaminase activity of the PdxT protein and PdxST complex . Purified PdxT-His6 and PdxS-His6 were assayed for glutaminase activity singly or in combination after 15 min of preincubation at room temperature . Curve 1, 40 µM PdxT; curve 2, 5 µM PdxT plus 2.5 µM PdxS; curve 3, 5 µM PdxT plus 5 µM PdxS . OD363, optical density at 363 nm.

 
Glutaminase subunits of some other glutamine amidotransferasesare also activated by the presence of the corresponding synthasesubunits [18, 46] . This result strongly confirms our hypothesisthat PdxS and PdxT are components of the same enzyme . Additionally,we conclude that the conditional growth phenotype of the pdxT-likemutants reflects the ammonium-dependent activity of PdxS inthe absence of its cognate glutaminase subunit.


 

  PdxS and PdxT interact physically .

 
An E . coli strain containing pBB1252 [Fig . 1] and overproducingthe wild-type version of the B . subtilis PdxS protein and aHis6-tagged version of PdxT was used for purification of thePdxT-His6 protein by Ni2+ affinity chromatography . Wild-typePdxS, which by itself had no affinity for the Ni2+ affinitycolumn, copurified with PdxT-His6 [though not in the stoichiometricamount], indicating that the two proteins form a complex thatdoes not completely dissociate even under the high salt conditions[0.5 M NaCl, 0.4 M imidazole] used for purification [Fig . 3, lane 2] . This result is consistent with the postulated interaction of yeast PDX1 and PDX2 homologs, as deduced from experiments with two-hybrid systems [28] . No protein copurified with PdxT-His6if part of the pdxS gene was deleted from pBB1252, as in pBB1256[Fig . 1 and 3, lane 3].


 

  Analysis of the PdxST pathway .

 
All gram-positive bacteria have either the PdxST pathway orno PLP synthetic pathway; most other bacteria have the PdxA/PdxJpathway [data not shown; published genome sequence data weresearched by using the National Center for Biotechnology InformationBlast server available at http://www.ncbi.nlm.nih.gov/BLAST;preliminary sequence data were searched at http://www.ncbi.nlm.nih.gov/sutils/genom_table.cgiand http://www.sanger.ac.uk/DataSearch] . Some lactic acid bacteriaand Clostridium spp . are known to be B6 auxotrophs [6, 19, 26,38], consistent with the absence of the genes of de novo PLPsynthesis in their genomes . No single bacterial genome has genescoding for all components of both pathways . Some bacteria withthe PdxST pathway have a PdxA homolog; it is likely that theseorphan PdxA-like proteins, as well as additional PdxA paralogsin some gram-negative bacteria [data not shown], have a dehydrogenaseactivity unrelated to PLP synthesis . The pdxS- and pdxT-likegenes are linked in all bacterial genomes except that of Mycobacteriumleprae [8].

In Saccharomyces cerevisiae, a glucose-derived five-carbon-containing compound and a triose are utilized for PLP synthesis [13, 48].No other components of the PDX1/PDX2 pathway, other than glutamine,are known, and it is unclear whether all steps of the PDX1/PDX2pathway are common in different organisms . In our work, we demonstratedthat the PdxST complex is likely to catalyze the correspondingglutamine amidotransferase reaction though neither the additionalsubstrate[s] nor the products of the reaction have been identified.PdxS may have a phosphate-binding site [12], implicating a phosphorylatedcompound as a substrate; another possible role for this siteis binding of flavin mononucleotide [FMN; the IPR003009 motifavailable at www.ebi.ac.uk/interpro].The latter designationmay be misleading, however . Many enzymes containing the IPR003009motif are not known to bind FMN; instead, they have pent[ul]ose5-phosphate derivatives as their substrates . Since FMN containsa ribityl-5-phosphate group, we suggest that the IPR003009 motifreflects binding of a five-carbon unit phosphorylated at position5 . In that case, one of the PdxST substrates, in addition to glutamine, is a phosphorylated five-carbon carbohydrate derivative, as has been suggested by tracer experiments for yeast [13]. Guanylylation of a protein that turned out to be PdxS by extracts of B . subtilis cells has been reported [24] . The physiologicalrole of this modification remains unknown.

In yeast grown anaerobically, glutamine does not serve as B6 precursor [16] . It is possible that under these conditions theyeast PdxS-like SNZ protein uses ammonium as its substrate.Interestingly, the genomes of several bacteria, such as Fusobacteriumnucleatum, Corynebacterium efficiens, Clostridium botulinum,and Treponema denticola, include pdxS-like genes but no pdxT-likegene [data not shown] . PdxS proteins of these organisms mayoperate as ammonium-dependent synthases of the PLP pathway,may use other types of glutaminase subunits, or may not synthesizePLP in vivo . The tight B6 requirement of the pdxT null mutantin the absence of ammonium indicates that no other B . subtilisglutaminase can substitute for PdxT.

1-Deoxy-D-xylulose-5-phosphate, whose formation is catalyzedby the dxs gene product [22, 39], is required for PLP synthesisin E . coli [7, 20] . Most bacteria that have pdxS- and pdxT-likegenes have dxs orthologs, but no orthologs of dxs can be foundin the genomes of archaea, Staphylococcus aureus, or Streptococcuspneumoniae, all of which apparently utilize the PdxST pathway[data not shown] . Moreover, the B . subtilis conditional dxsmutant was not impaired in B6 synthesis [32] . Additionally, the five-carbon-containing compound utilized for PLP synthesis in yeast is derived from glucose as an intact unit [13]; in contrast, 1-deoxy-D-xylulose-5-phosphate originates from condensationof pyruvate and glyceraldehyde 3-phosphate [9, 15] . Therefore,Dxs-produced 1-deoxy-D-xylulose-5-phosphate is an unlikely intermediatein the PdxST-dependent pathway of PLP synthesis . Though an alternativeroute of 1-deoxy-D-xylulose-5-phosphate synthesis was describedin E . coli, its physiological role is unknown [43].

Exogenous 2'-hydroxypyridoxine can be converted to PLP in yeast[49] . It is possible that 2'-hydroxypyridoxine 5'-phosphateis an immediate precursor of PLP in B . subtilis . If so, theputative five-carbon intermediate of the PdxST pathway shouldhave a hydroxyl group at its 1 position.


 

  ADDENDUM IN PROOF

 
The crystal structure of the B . subtilis PdxT [YaaE] protein was determined recently [J . A . Bauer, E . M . Bennett, T . P . Begley, and S . E . Ealick, J . Biol . Chem., in press].

 


 

  ACKNOWLEDGMENTS

 
I am grateful to A . L . Sonenshein and J . Smith for many helpful discussions and for careful reading of the manuscript.

This work was supported by a grant from the National Science Foundation [MCB-0110651] to B.R.B.


 

  FOOTNOTES

 
* Mailing address: Department of Molecular Biology and Microbiology, Tufts University School of Medicine, 136 Harrison Ave., Boston, MA 02111 . Phone: [617] 636-3618 . Fax: [617] 636-0337 . E-mail: bbelit02@granite.tufts.edu.

 


 

  REFERENCES

 

  1. Arst, H . N., Jr., A . G . Brownlee, and S . A . Cousen. 1982 . Nitrogen metabolite repression in Aspergillus nidulans: a farewell to tamA? Curr . Genet . 6:245-257.
  2. Bean, L . E., W . H . Dvorachek, Jr., E . L . Braun, A . Errett, G . S . Saenz, M . D . Giles, M . Werner-Washburne, M . A . Nelson, and D . O . Natvig. 2001 . Analysis of the pdx-1 [snz-1/sno-1] region of the Neurospora crassa genome: correlation of pyridoxine-requiring phenotypes with mutations in two structural genes . Genetics 157:1067-1075 .
  3. Belitsky, B . R., M . C . Gustafsson, A . L . Sonenshein, and C . Von Wachenfeldt. 1997 . An lrp-like gene of Bacillus subtilis involved in branched-chain amino acid transport . J . Bacteriol . 179:5448-5457.
  4. Belitsky, B . R., and A . L . Sonenshein. 2002 . GabR, a member of a novel protein family, regulates utilization of {gamma}-aminobutyrate in Bacillus subtilis . Mol . Microbiol . 45:569-583.
  5. Belitsky, B . R., and A . L . Sonenshein. 1998 . Role and regulation of Bacillus subtilis glutamate dehydrogenase genes . J . Bacteriol . 180:6298-6305 .
  6. Boyd, J . M., M . A . Logan, and A . A . Tytell. 1948 . The growth requirements of Clostridium perfringens [welchii] BP6K . J . Biol . Chem . 174:1013-1025.
  7. Cane, D . E., S . Du, J . K . Robinson, Y . Hsiung, and I . D . Spenser. 1999 . Biosynthesis of vitamin B6: enzymatic conversion of 1-deoxy-D-xylulose-5-phosphate to pyridoxol phosphate . J . Am . Chem . Soc . 121:7222-7223.
  8. Cole, S . T., K . Eiglmeier, J . Parkhill, K . D . James, N . R . Thomson, P . R . Wheeler, N . Honore, T . Garnier, C . Churcher, D . Harris, K . Mungall, D . Basham, D . Brown, T . Chillingworth, R . Connor, R . M . Davies, K . Devlin, S . Duthoy, T . Feltwell, A . Fraser, N . Hamlin, S . Holroyd, T . Hornsby, K . Jagels, C . Lacroix, J . Maclean, S . Moule, L . Murphy, K . Oliver, M . A . Quail, M . A . Rajandream, K . M . Rutherford, S . Rutter, K . Seeger, S . Simon, M . Simmonds, J . Skelton, R . Squares, S . Squares, K . Stevens, K . Taylor, S . Whitehead, J . R . Woodward, and B . G . Barrell. 2001 . Massive gene decay in the leprosy bacillus . Nature 409:1007-1011.
  9. Drewke, C., and E . Leistner. 2001 . Biosynthesis of vitamin B6 and structurally related derivatives . Vitam . Horm . 61:121-155.
  10. Ehrenshaft, M., P . Bilski, M . Y . Li, C . F . Chignell, and M . E . Daub. 1999 . A highly conserved sequence is a novel gene involved in de novo vitamin B6 biosynthesis . Proc . Natl . Acad . Sci . USA 96:9374-9378 .
  11. Ehrenshaft, M., and M . E . Daub. 2001 . Isolation of PDX2, a second novel gene in the pyridoxine biosynthesis pathway of eukaryotes, archaebacteria, and a subset of eubacteria . J . Bacteriol . 183:3383-3390 .
  12. Galperin, M . Y., and E . V . Koonin. 1997 . Sequence analysis of an exceptionally conserved operon suggests enzymes for a new link between histidine and purine biosynthesis . Mol . Microbiol . 24:443-445.
  13. Gupta, R . N., T . Hemscheidt, B . G . Sayer, and I . D . Spenser. 2001 . Biosynthesis of vitamin B6 in yeast: incorporation pattern of glucose . J . Am . Chem . Soc . 123:11353-11359.
  14. Guzman, L . M., D . Belin, M . J . Carson, and J . Beckwith. 1995 . Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter . J . Bacteriol . 177:4121-4130.
  15. Hill, R . E., and I . D . Spenser. 1996 . Biosynthesis of vitamin B6, p . 695-703 . In F . C . Neidhardt, R . I . Curtiss, J . L . Ingraham, E . C . C . Lin, K . B . Low, B . Magasanik, W . S . Reznikoff, M . Riley, M . Schaechter, and H . E . Umbarger [ed.], Escherichia coli and Salmonella typhimurium: cellular and molecular biology . American Society for Microbiology, Washington, D.C.
  16. Ishida, S., and K . Yamada. 2002 . Biosynthesis of pyridoxine in Saccharomyces cerevisiae—origin of the pyridoxine nitrogen atom differs under anaerobic and aerobic conditions . J . Nutr . Sci . Vitaminol . 48:448-452.
  17. John, R . A. 1995 . Pyridoxal phosphate-dependent enzymes . Biochim . Biophys . Acta 1248:81-96.
  18. Klem, T . J., and V . J . Davisson. 1993 . Imidazole glycerol phosphate synthase: the glutamine amidotransferase in histidine biosynthesis . Biochemistry 32:5177-5186.
  19. Koser, S . A. 1968 . Vitamin requirements of bacteria and yeasts . Charles C . Thomas Publisher, Springfield, Ill.
  20. Laber, B., W . Maurer, S . Scharf, K . Stepusin, and F . S . Schmidt. 1999 . Vitamin B6 biosynthesis: formation of pyridoxine 5'-phosphate from 4-[phosphohydroxy]-L-threonine and 1-deoxy-D-xylulose-5-phosphate by PdxA and PdxJ protein . FEBS Lett . 449:45-48.
  21. Lam, H . M., and M . E . Winkler. 1990 . Metabolic relationships between pyridoxine [vitamin B6] and serine biosynthesis in Escherichia coli K-12 . J . Bacteriol . 172:6518-6528.
  22. Lois, L . M., N . Campos, S . R . Putra, K . Danielsen, M . Rohmer, and A . Boronat. 1998 . Cloning and characterization of a gene from Escherichia coli encoding a transketolase-like enzyme that catalyzes the synthesis of D-1-deoxyxylulose 5-phosphate, a common precursor for isoprenoid, thiamin, and pyridoxol biosynthesis . Proc . Natl . Acad . Sci . USA 95:2105-2110 .
  23. Lopilato, J., S . Bortner, and J . Beckwith. 1986 . Mutations in a new chromosomal gene of Escherichia coli K-12, pcnB, reduce plasmid copy number of pBR322 and its derivatives . Mol . Gen . Genet . 205:285-290.
  24. Mitchell, C., P . W . Morris, and J . C . Vary. 1992 . Amino acid sequences of several Bacillus subtilis proteins modified by apparent guanylylation . Mol . Microbiol . 6:1579-1581.
  25. Mittenhuber, G. 2001 . Phylogenetic analyses and comparative genomics of vitamin B6 [pyridoxine] and pyridoxal phosphate biosynthesis pathways . J . Mol . Microbiol . Biotechnol . 3:1-20.
  26. Mulligan, J . H., and E . E . Snell. 1977 . Transport and metabolism of vitamin B6 in lactic acid bacteria . J . Biol . Chem . 252:835-839.
  27. Osmani, A . H., G . S . May, and S . A . Osmani. 1999 . The extremely conserved pyroA gene of Aspergillus nidulans is required for pyridoxine synthesis and is required indirectly for resistance to photosensitizers . J . Biol . Chem . 274:23565-23569 .
  28. Padilla, P . A., E . K . Fuge, M . E . Crawford, A . Errett, and M . Werner-Washburne. 1998 . The highly conserved, coregulated SNO and SNZ gene families in Saccharomyces cerevisiae respond to nutrient limitation . J . Bacteriol . 180:5718-5726 .
  29. Pflug, W., and F . Lingens. 1983 . Occurrence of pyridoxamine-phosphate oxidase and pyridoxal kinase in gram-negative and gram-positive bacteria . Hoppe-Seyler's Z . Physiol . Chem . 364:1627-1630.
  30. Pflug, W., and F . Lingens. 1978 . Vitamin-B6-biosynthesis in Bacillus subtilis . Hoppe-Seyler's Z . Physiol . Chem . 359:559-570.
  31. Rodriguez-Navarro, S., B . Llorente, M . T . Rodriguez-Manzaneque, A . Ramne, G . Uber, D . Marchesan, B . Dujon, E . Herrero, P . Sunnerhagen, and J . E . Perez-Ortin. 2002 . Functional analysis of yeast gene families involved in metabolism of vitamins B1 and B6 . Yeast 19:1261-1276.
  32. Sakai, A., N . Kinoshita, M . Kita, T . Katsuragi, and Y . Tani. 2003 . Investigation of 1-deoxy-D-xylulose 5-phosphate synthase and transketolase of Bacillus subtilis in relation to vitamin B-6 biosynthesis . J . Nutr . Sci . Vitaminol . 49:73-75.
  33. Sakai, A., M . Kita, T . Katsuragi, N . Ogasawara, and Y . Tani. 2002 . yaaD and yaaE are involved in vitamin B6 biosynthesis in Bacillus subtilis . J . Biosci . Bioeng . 93:309-312.
  34. Sakai, A., M . Kita, T . Katsuragi, and Y . Tani. 2002 . serC is involved in vitamin B-6 biosynthesis in Escherichia coli but not in Bacillus subtilis . J . Biosci . Bioeng . 93:334-337.
  35. Sambrook, J., E . F . Fritsch, and T . J . Maniatis. 1989 . Molecular cloning: a laboratory manual, 2nd ed . Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
  36. Seack, J., S . Perovic, V . Gamulin, H . C . Schroder, P . Beutelmann, I . M . Muller, and W . E . Muller. 2001 . Identification of highly conserved genes: SNZ and SNO in the marine sponge Suberites domuncula: their gene structure and promoter activity in mammalian cells . Biochim . Biophys . Acta 1520:21-34.
  37. Sivasubramaniam, S., V . M . Vanniasingham, C . T . Tan, and N . H . Chua. 1995 . Characterisation of HEVER, a novel stress-induced gene from Hevea brasiliensis . Plant Mol . Biol . 29:173-178.
  38. Snell, E . E. 1989 . Nutrition research with lactic acid bacteria: a retrospective view . Annu . Rev . Nutr . 9:1-19.
  39. Sprenger, G . A., U . Schorken, T . Wiegert, S . Grolle, A . A . de Graaf, S . V . Taylor, T . P . Begley, S . Bringer-Meyer, and H . Sahm. 1997 . Identification of a thiamin-dependent synthase in Escherichia coli required for the formation of the 1-deoxy-D-xylulose 5-phosphate precursor to isoprenoids, thiamin, and pyridoxol . Proc . Natl . Acad . Sci . USA 94:12857-12862 .
  40. Stolz, J., and M . Vielreicher. 2003 . Tpn1p, the plasma membrane vitamin B6 transporter of Saccharomyces cerevisiae . J . Biol . Chem . 278:18990-18996 .
  41. Tamegai, H., E . Nango, A . Koike-Takeshita, F . Kudo, and K . Kakinuma. 2002 . Significance of the 20-kDa subunit of heterodimeric 2-deoxy-scyllo-inosose synthase for the biosynthesis of butirosin antibiotics in Bacillus circulans . Biosci . Biotechnol . Biochem . 66:1538-1545.
  42. Tanaka, K., K . Tazuya, K . Yamada, and H . Kumaoka. 2000 . Biosynthesis of pyridoxine: origin of the nitrogen atom of pyridoxine in microorganisms . J . Nutr . Sci . Vitaminol . 46:55-57.
  43. Wungsintaweekul, J., S . Herz, S . Hecht, W . Eisenreich, R . Feicht, F . Rohdich, A . Bacher, and M . H . Zenk. 2001 . Phosphorylation of 1-deoxy-D-xylulose by D-xylulokinase of Escherichia coli . Eur . J . Biochem . 268:310-316 .
  44. Wyngaarden, J . B., and D . M . Ashton. 1959 . The regulation of activity of phosphoribosylpyrophosphate amidotransferase by purine ribonucleotides: a potential feedback control of purine biosynthesis . J . Biol . Chem . 234:1492-1496.
  45. Yang, Y., H . C . Tsui, T . K . Man, and M . E . Winkler. 1998 . Identification and function of the pdxY gene, which encodes a novel pyridoxal kinase involved in the salvage pathway of pyridoxal 5'-phosphate biosynthesis in Escherichia coli K-12 . J . Bacteriol . 180:1814-1821 .
  46. Zalkin, H. 1993 . The amidotransferases . Adv . Enzymol . Relat . Areas Mol . Biol . 66:203-309.
  47. Zalkin, H., and J . L . Smith. 1998 . Enzymes utilizing glutamine as an amide donor . Adv . Enzymol . Relat . Areas Mol . Biol . 72:87-144.
  48. Zeidler, J., R . N . Gupta, B . G . Sayer, and I . D . Spenser. 2003 . Biosynthesis of vitamin B6 in yeast . Incorporation pattern of trioses . J . Org . Chem . 68:3486-3493.
  49. Zeidler, J., N . Ullah, R . N . Gupta, R . M . Pauloski, B . G . Sayer, and I . D . Spenser. 2002 . 2'-Hydroxypyridoxol, a biosynthetic precursor of vitamins B6 and B1 in yeast . J . Am . Chem . Soc . 124:4542-4543.

 

 

Free Online Full-text Article

 

What Is Biofilm?, What Is Cell Biology?, What Is Botulism?, What is Food Microbiology?, What Is Listeria Monocytogenes?, n, Microbe, e, Bacteriology, e, Bacterium, c, Microbiology, n, Microbes, e, Micrococci, o, Escherichia coli, a, Escherichia coli, a, Culture medium, r, Escherichia coli, o, Microorganisms, i, S. cerevisiae, o, Staphylococcus aureus, a, Lactococci, i, Fermentations, a, Ps. putida, s, Antimicrobial, i, Cryptococci, i, Culture medium, a, Botulin, o, Haemophilus, i, Yeasts, a, Pseudomonas aeruginosa, n, Bacteroides, s, Microorganisms, r, Candida albicans




 

   Scientific Publications - Work Done by Microbiology Reader Bioscreen C

Agricultural Microbiology
Anaerobic Microbiology
Antimicrobial Susceptibility
Artificial Atmosphere
Bioassay of Antibiotics
Biofilm Microbiology
Bioreactor Technology
Biotechnology
Cell Biology
Clinical Microbiology
Environmental Microbiology
Experiments with Yeast
Fermentation
Food Microbiology
Functional Genomics
Gene Technology
Growth Media Development
Growth Rate and Lag Time
Industrial Microbiology
Medical/Pharmaceutical Field
Microbiological Assay
Microbiological Research
Microbiology of Cosmetics

go to a specific theme...

Military Microbiology
Molecular Microbiology
Mutagenicity and Genotoxicity
Oral Microbiology
Patents
Postantibiotic Studies
Soil Microbiology
Spore Microbiology
Veterinary Microbiology
Waste/Wastewater Treatment
Water Microbiology
Wine Microbiology

 


 

© 2005 Transgalactic Ltd (manufacturer of Bioscreen C software) | Privacy Statement | P.O. Box 1393, 00101 Helsinki, Finland, phone: +358 9 85172920, fax: +358 9 8749481, e-mail: microbiology@bionewsonline.com
 

 

 

Last modified: May 25, 2005