|








| |
Journal of Bacteriology, December 2003, p . 7140-7144, Vol . 185, No . 24
Transcriptional Regulation and Posttranslational Activity of the Betaine Transporter BetL in Listeria monocytogenes Are Controlled by Environmental Salinity
Roy D . Sleator,1 Janet M . Wood,2 and Colin Hill1*
Department
of Microbiology and Alimentary Pharmabiotic Centre, University College,
Cork, Ireland,1
Department of
Microbiology, University of Guelph, Guelph, Ontario, Canada N1G
2W12
Received 2 July 2003/
Accepted 15 September 2003
While
the genetic elements contributing to the salinity tolerance of
Listeria monocytogenes have been well characterized, the
regulatory signals and responses (genetic and/or biochemical) that
govern these mechanisms have yet to be elucidated . Encoded by
betL, the first genetic element to be linked to listerial
osmotolerance, the secondary betaine uptake system BetL is a member of
the betaine-carnitine-choline transporter family . Preceded by consensus
A- and
B-dependent promoter
sites, betL is constitutively expressed and transcriptionally
up-regulated in response to salt stress . The nisin-controlled
expression system was used to achieve salinity-independent, controlled
betL expression in Listeria . In the absence of
NaCl-activated transcriptional control, BetL activity was found to be a
function of environmental salinity, showing optimal activity in buffer
supplemented with 1 to 2% NaCl (osmolality, 417 to 719
mosmol/kg) . In addition, BetL was activated rapidly (half-life, 2 min)
in response to an osmotic upshift imposed by adding 2% NaCl to
50 mM potassium phosphate
buffer .
The ubiquitous food-borne pathogen Listeria monocytogenes is
highly adapted to life in challenging environments
(10) . The ability of the
organism to survive, and indeed thrive, at elevated osmolarities and
reduced temperatures is attributed mainly to the accumulation of osmo-
and cryoprotective compounds termed osmolytes, or compatible solutes
(13,
27) . Indeed, recent
evidence suggests that osmolyte uptake in L . monocytogenes is
linked not only to the ability of the organism to grow and survive in
foods but also to the ability of the organism to cause infection
(26,
29) . The preferred
compatible solute for the majority of bacteria, and the most effective
osmolyte in L . monocytogenes, is the trimethyl ammonium
compound glycine betaine . Present at relatively high concentrations in
foods of plant origin
(22), betaine has been
shown to stimulate the growth of L . monocytogenes between 0.3
and 0.7 M NaCl, resulting in a 2.1-fold increase in the growth rate at
0.7 M NaCl (1) and a
1.8-fold increase at 4°C
(13) .
Although
betaine was previously believed to be accumulated by a single
transporter (20), recent
genetic analysis revealed that L . monocytogenes takes up
betaine via more than one system
(28) . The principal
transporters include the multicomponent, ATP-dependent GbuABC system
(12) and the
ion-motive-force-dependent secondary transporter BetL
(24) . Each system
exhibits distinct substrate specificities and kinetic parameters and
thus is presumably optimized for maximal effects in diverse ecological
niches (29) .
Since
the osmolyte transport systems of L . monocytogenes have been
cataloged (28), the next
major challenge is to elucidate the individual contribution of each
system to the overall salt stress response . Determining how and when
individual systems are activated, to what extent, and in response to
which signal(s) (internal or external salinity and/or osmolality,
turgor pressure, or related parameters, such as membrane tension) will
ultimately provide a means of predicting when, and how quickly, the
organism reacts . It is envisaged that this information will eventually
facilitate the design of effective control measures for restricting the
spread of the pathogen, both in foods prior to ingestion and
subsequently within the animal host .
Studies of solute
accumulation by other organisms have revealed that osmoprotectant
uptake may be controlled at the levels of both transporter gene
expression and transporter activity
(32) . For example,
transporters BetP and EctP of Corynebacterium glutamicum, both
of which are BetL sequence homologues, can be osmotically activated
(18) . Previously, we
demonstrated that betL is osmoregulated at the transcriptional
level (25) . Using the
nisin-controlled expression (NICE) system for salinity-independent gene
expression (3), we now
demonstrate that BetL is itself activated in response to changes in
salinity . Rapid activation of preexisting BetL protein (half-life
[t1/2], 2 min) in response to relatively
low NaCl concentrations (1 to 2% NaCl) suggests that BetL is one
of the primary respondents to rapid fluxes in medium
salinity .
Media, chemicals, and growth
conditions.
Bacterial
strains and plasmids used in this study are listed in Table
1 . L . monocytogenes strains were grown in brain heart infusion
(BHI) broth (Oxoid, Unipath Ltd., Basingstoke, United Kingdom) . Nisin
(Sigma Chemical Co., St . Louis, Mo.) was prepared in 0.05%
acetic acid (100 mg/ml) and diluted 1:10 in dimethyl sulfoxide.
1-14C-radiolabeled N,N,N-trimethylglycine (55
mCi/mmol) was purchased from American Radiolabeled Chemicals Inc . (St.
Louis, Mo.) . Antibiotics were prepared as concentrated stocks as
described by Maniatis et al.
(15) and added to media
at the required levels . When necessary, the medium salinity was
adjusted by adding NaCl and osmolality was measured with a vapor
pressure osmometer (Wescor, Logan,
Utah) .
| TABLE 1 . Bacterial
strains and plasmids
| |
DNA manipulations and sequence
analysis.
Restriction
enzymes, RNase, and T4 DNA ligase were obtained from Boehringer GmbH
(Mannheim, Germany) . Plasmid DNA was isolated with the QIAprep spin
miniprep kit (QIAGEN, Hilden, Germany) . Escherichia coli was
transformed by standard methods
(15), while
electrotransformation of L . monocytogenes was achieved by the
protocol outlined by Park and Stewart
(19) . PCR reagents
(Taq DNA polymerase and deoxynucleoside triphosphates) were
purchased from Boehringer and used according to the manufacturer's
instructions with a PCR express system (Hybaid, Middlesex, United
Kingdom) . Unless otherwise stated, PCR was carried out following lysis
of cells with Igepal CA-630 (Sigma) . Oligonucleotide primers used for
PCR and sequence purposes were synthesized on an Oligo 1000M DNA
synthesizer (Beckman Instruments, Inc., Fullerton, Calif.) . Nucleotide
sequence determination was performed with an ABI 373A automated
sequencer by using a dye terminator sequencing kit (Applied Biosystems,
Warrington, United
Kingdom) .
Incorporating betL
into the NICE expression system.
PCR primers betLFnis
(5' GCTACCATGGGGAAATACATACAGAGA
3') and betLRnis (5'
CGCAAGCTTTCTTTCGAAAAAAATATCCTAAAC
3') with incorporated NcoI and
HindIII cut sites (underlined) were used to amplify a
promoterless copy of the betL gene (47 bp upstream of the TTG
initiation codon and 126 bp downstream of the TAA termination codon;
encompassing the coding region and native ribosomal binding site but
not the upstream promoter regions) from the chromosome of L.
monocytogenes LO28 . The resultant PCR product was digested with
NcoI and HindIII and subsequently cloned into
similarly digested pNZ8048, creating a transcriptional fusion between
the nisin-inducible nisA promoter on pNZ8048 and the
promoterless betL gene . The resultant plasmid construct,
designated pCPL17 and confirmed by sequence analysis, was then cloned
into LO28n BG . Harboring the facilitator plasmid pNZ9530, this
strain lacks the principal betaine uptake systems BetL and Gbu and thus
exhibits no detectable betaine uptake . Control strains included
LO28n BG(pNZ8048), which contains both pNZ9530 and pNZ8048 and
is devoid of betaine uptake, and LO28 G, which possesses a
chromosomal copy of betL that is transcribed from its own
native promoters .
Transcriptional
analysis.
RNA isolation and
reverse transcription-PCR (RT-PCR) were carried out as previously
described (25) . RNA was
isolated from overnight cultures following nisin induction or
imposition of a salt stress . For studies of the transcriptional
response to added NaCl, overnight cultures of L . monocytogenes
grown at 37°C in BHI were used to inoculate fresh media at a
level of 1% . When the optical density at 600 nm
(OD600) of the culture reached 0.5, salt stress (4%
NaCl) was applied for 30 min . For induction with nisin, cultures were
grown to an OD600 of 0.2 and either induced with a
0.1% concentration of the supernatant from an
overnight culture of the nisin-producing strain Lactococcus
lactis NZ9700 or preinduced with 4.5 µg of nisin powder/ml
for 1 h and then induced with 45 µg of nisin
powder/ml (a concentration high enough to induce transcription, yet low
enough to ensure no difference in the nisin sensitivities of the two
strains [data not shown]) for 30 min before RNA was isolated.
Following RT, primers XbaIKO and EcoRIKO, described
previously (25), were
used to amplify the resulting cDNA . In all cases, control PCR primers
were used to confirm the complete removal of DNA from
non-reverse-transcribed RNA preparations and subsequently following the
RT reaction to ensure that levels of cDNA for samples that were to be
compared were equal .
Transport
assays.
Radiolabeled
betaine uptake studies were carried out as described by Culham et al.
(5), with some minor
modifications . Essentially, log-phase cells grown in BHI were harvested
by centrifugation, washed twice, and resuspended in 50 mM potassium
phosphate buffer (pH 6.8) to an OD600 of 1.0 . Glucose was
added to a final concentration of 5 mM to energize the cells, and where
indicated below, NaCl was added to subject the cells to salt shock.
After 3 min of incubation at 25°C, assays were initiated by the
addition of [14C]glycine betaine (at a final
concentration of 40 µM and a specific radioactivity of 5
Ci/mol) . Cells were collected on 0.45-µm-pore-size cellulose
nitrate filters (Schleicher & Schuell, GmbH, Dassell, Germany, and
Millipore Canada Ltd.) under vacuum . Filters were then washed with 5 ml
of buffer (of the same osmolality as the assay buffer), and the
radioactivity trapped in the cells was measured by liquid scintillation
counting .
To determine the kinetics of activation of
BetL, bacteria were prepared for transport as described above, uptake
was initiated with betaine after preincubation in the standard assay
mixture supplemented with 2% NaCl (incubations ranged from
10 s to 20 min), and initial uptake rates were determined.
Nonlinear regression was used to fit the resulting data to the
following relationship: vt =
vf(1 - e-Kt)
+ v0e-Kt, where
vt is the initial rate of betaine uptake at time
t, vf is the initial rate of betaine
uptake at an infinite time after activation, v0 is
the initial rate of betaine uptake observed when uptake was initiated
as salt was added, K is the activation rate constant, and
t1/2 for transporter activation is equal to ln
2/K (17).
Protein concentrations were determined by the bicinchoninic acid assay
(30) by using the BCA kit
from Pierce (Rockford, Ill.) with bovine serum albumin as the
standard .
Controlled expression of
betL.
The NICE
system (3) was used to
overcome salt-induced transcriptional control of the betL gene
and to determine whether BetL is regulated at the biochemical level in
response to increasing salinity . Originally developed in lactic acid
bacteria (11) and
subsequently demonstrated to function in a variety of gram-positive
bacteria (7), the system
consists of two compatible replicons: the regulatory plasmid pNZ9530,
carrying the nisRK regulatory genes, and the expression vector
pNZ8048, harboring the nisA promoter (PnisA) . In the
presence of nisin and, to a lesser extent, galactose and lactose
(4), transcription is
induced from PnisA in a dose-dependent manner . In the case of
nisin, induction is via the two-component regulatory system NisRK,
provided in trans by pNZ9530 . Here we exploit the
dose-dependent inducible nature of the NICE system to control gene
expression such that the transcription of betL is independent
of salt-induced transcriptional control . This processallows us for the first time to directly determine the effects of
increasing salinity on BetL activation, independently of the regulation
of betL transcription .
The host strains used in this
study were L . monocytogenes LO28 G, in which the
chromosomally encoded wild-type BetL (regulated by salinity at the
transcriptional level) is the only remaining functional betaine
transporter, and LO28 BG, which is completely devoid of betaine
uptake (31) . To remove
the betL gene from salt-induced transcriptional control, a
promoterless copy of betL was cloned downstream of the
PnisA promoter between the NcoI and HindIII
cut sites on pNZ8048 . To avoid changing the initiation codon from TTG
to ATG and thus possibly affecting the translational control of the
resulting gene construct
(28), the
betLFnis primer was designed to incorporate the native
betL ribosomome-binding site and a termination codon to
prevent read-through from the ATG start codon at the NcoI
site . The resulting construct, designated pCPL17, was subsequently
transformed into LO28n BG (harboring pNZ9530) to form
LO28n BG(pCPL17) . Plasmid pNZ8048 lacking an insert was also
introduced into LO28n BG for use as a negative control in
subsequent experiments . Interestingly, it was observed that in the
absence of added nisin, the transcript level for betL
nis (the betL construct encoded by pCPL17)
was comparable to that of the wild type following growth in BHI under
nonstress conditions (Fig.
1) . We suggest that this "leaky" transcription is most
likely a consequence of nisin-independent induction of PnisA
by lactose and galactose, which are present in the growth medium
(4) . Proof that the NICE
system is indeed functional and that native-salt-induced
transcriptional control has been replaced by salinity-insensitive
PnisA induction was obtained by RT-PCR
transcriptional analysis of LO28 G and
LO28n BG(pCPL17) (Fig.
1) . Exposure of
LO28 G to salt stress resulted in an increase in transcript
levels similar to that observed previously
(25) . However, no
transcriptional up-regulation was observed for
LO28n BG(pCPL17), proving that salt-induced transcriptional
up-regulation had been removed . In contrast, while the addition of
nisin had no effect on betL transcription in LO28 G,
transcription was significantly induced in LO28n BG(pCPL17).
Densitometric analysis revealed a ca . eightfold increase in the
betL transcript level following exposure to 45 µg of
nisin/ml . This increase compares with the 10- to 11-fold induction
observed previously for Bacillus subtilis
(7) .
| FIG . 1 . RT-PCRs
showing that salt-induced transcriptional control of the betL
gene has been replaced with nisin-controlled gene expression in
LO28n BG(pCPL17) . Each lane represents the levels
of betL wild-type (A) and betL nis (B)
transcript resulting from 30 PCR cycles with primers
XbaIKO and EcoRIKO on cDNA generated from total RNA
isolated from cells after 30 min of exposure to nonstress conditions in
BHI broth (control) (first lane of each panel); 4% added NaCl
(second lane of each panel); 0.1% cell-free supernatant from the
nisin-producing strain Lactococcus lactis NZ9700 (third lane
of each panel); and preinduction with 4.5 µg of nisin powder/ml
for 1 h, followed by induction with 45 µg of nisin
powder/ml (fourth lane of each panel) . Bent arrows, promoters;
lollipops,
terminators.
| |
BetL
activity is determined by environmental salinity.
As expected, the transporter-deficient
strain LO28 BG had no detectable betaine uptake in potassium
phosphate buffer (50 mM) in the presence or absence of added NaCl
(3%) (Table
2) . Thus, at least under the conditions tested (NaCl added at 0 to
6%) (Fig.
2), this strain is devoid of betaine uptake activity and provides an
ideal background for the study of BetL activity in vivo . Strain
LO28 G (betL+) did not take up
betaine in the absence of a salt stress, but the addition of 3%
NaCl resulted in a significant increase in the betaine uptake rate.
Since a comparable result was obtained with strain
LO28n BG(pCPL17), in which betL expression is
salinity independent, BetL is itself activated by salt stress (Table
2) . Previously, Gerhardt
et al . (9), employing an
in vitro-based approach, also identified a betaine-specific permease
that is activated by salt and can function in membrane vesicles . We
suggest that this transporter (later named betaine porter I) and BetL
are in fact one and the same . In further support of this proposal is
the observation that no porter I activity can be detected against a
betL null background
(2,
31) .
| TABLE 2 . BetL
activity is regulated by medium salinity
| |
To determine
the salt concentration at which BetL activity is maximal, the initial
rate of betaine uptake was determined over a range of NaCl
concentrations (Fig . 2).
The uptake rate was optimal between 1 and 2% NaCl . The coupling
ion for betaine uptake via BetL is likely to be Na+,
as it is for other members of the betaine-carnitine-choline transporter
family, including the BetL functional homologue BetP of C.
glutamicum (21,
23) . The
Km of BetP for Na+ is 4 mM
(21) . The increasing
betaine uptake activities via BetL observed as the NaCl concentration
rose to 1% (0.17 M) may in part reflect limiting concentrations
of Na+ as the counterion for betaine symport, but
they are also likely to indicate osmotic activation of BetL in that
range . The decreased activity of BetL at NaCl concentrations greater
than 2% (0.33 M) may result from the impact of high salinity on
the maintenance of the sodium motive force generated through
respiration . In any case, the salt concentration for which BetL is
maximally active (1 to 2%) is significantly lower than
4%, the salt concentration at which maximum betaine uptake was
previously reported for Listeria
(13) . This observation is
strengthened by the fact that the salinity and osmolality of the base
medium used in the present study (50 mM potassium phosphate buffer)
were significantly lower than those of the modified Pine's medium
used by Ko et al . (13)
(70 mmol/kg as opposed to 210 mmol/kg) . Taken together with the finding
of Mendum and Smith (16)
that inactivating Gbu significantly affects betaine uptake only at NaCl
concentrations greater than 4%, this result suggests that while
the multicomponent Gbu system most likely plays the dominant role at
high NaCl concentrations, it is the BetL system which appears to be
most important at lower
salinities .
Kinetics of activation for
BetL.
Having determined the
salt concentration at which BetL activity was optimal, our next step
was to establish the rate of activation, i.e., how quickly the protein
reacted to an imposed increase in salinity (Fig.
3) . The kinetics of BetL activation could be described by the formula
vt = vf(1 -
e-Kt) +
v0e-Kt . BetL activity
increased from 1.5 nmol/min/mg of protein to approach a maximum rate of
approximately 3 nmol/min/mg of protein with a t1/2
of 2 min . The t1/2 for the activation of ProP in
E . coli following a hyperosmotic shift imposed with NaCl is
similar (17) . This rapid
activation of BetL is consistent with the finding of Mendum and Smith
(16) that even in a
gbu mutant, the rate of betaine uptake immediately following
an increase in salinity was indistinguishable from that in the wild
type . Taken together, these results suggest that activation of
preexisting BetL protein represents the most immediate response to
increased salinity . A recent report by Fraser et al.
(8) showed that following
exposure to 3% (0.5 M) NaCl, betL and gbu were
induced to approximately the same extent . Thus, it is unlikely that the
dominance of BetL activity immediately following an increase in
salinity arose from differences in expression
levels .
| FIG . 3 . Time
course of activation of BetL . Betaine uptake by L.
monocytogenes strain LO28n BG(pCPL17) was measured as a
function of time after bacteria suspended in 50 mM potassium phosphate
were introduced into the same medium supplemented with NaCl
(2%) . Initial rates of betaine uptake are plotted as the means
± standard errors from four replicate experiments . Primary data
were analyzed by nonlinear regression analysis as described in
Materials and Methods, with v0 being fixed at the
measured value of 1.3 nmol/min/mg of protein . The values of the
resulting parameters were 2.96 ± 0.05 (vf)
and 0.35 ± 0.04
(K).
| |
Conclusions.
The immediate response of preexisting
BetL protein to relatively low salt concentrations (1 to 2%
NaCl) suggests that this secondary betaine uptake system represents one
of the primary respondents to rapid changes in medium salinity, whereas
during prolonged exposure, it is the Gbu system that is most important.
Thus, in addition to being tailored for optimal effects in diverse
environmental niches
(29), each system appears
to prevail in a distinct time frame and salinity range within the
overall salt stress response .
Since we have demonstrated that
BetL is activated at the biochemical level independently of
transcriptional control, the next step is to determine whether BetL
functions as a sensor as well as a modulator of osmotic activity and
indeed whether the protein reacts to other osmotic stressors, such as
glucose and sucrose, in a similar manner . Given that the NICE system is
controllable in a dynamic range of >1,000-fold, with induced
protein levels reaching 60% of the total intracellular protein
(11), an obvious
advantage of the system is that it provides a convenient method for
overproducing BetL . The isolated protein can subsequently be purified,
reconstituted in proteoliposomes, and used for future in vitro
analysis . It is envisaged that the data obtained from this in vitro
approach will ultimately reveal whether BetL functions as an osmosensor
and, if so, what osmotic signal(s) is sensed .
We thank Anh Ly (University
of Guelph) and Gary Smith (University of California, Davis) for
invaluable assistance during the course of this work .
We
acknowledge the financial assistance of the Irish Government under the
National Development Plan 2000-2006 and Natural Sciences and
Engineering Research Council of Canada . R.D.S . is funded by an IRCSET
postdoctoral
fellowship .
* Corresponding
author . Mailing address: Department of Microbiology, University
College, Cork, Ireland . Phone: 353-21-4901374 . Fax: 353-21-4903101.
E-mail:
c.hill{at}ucc.ie .
- Amezaga,
M . R. 1996 . The adaptation of Listeria
monocytogenes to osmotic stress . Ph.D . thesis . University of
Aberdeen, Aberdeen,
Scotland.
- Angelidis,
A . S., and G . M . Smith. 2003.
Three transporters mediate uptake of glycine betaine and carnitine by
Listeria monocytogenes in response to hyperosmotic stress.Appl . Environ . Microbiol.
69:1013-1022.
- Bryan,
E . M., T . Bae, M . Kleerebezem, and G . M . Dunny.2000 . Improved vectors for nisin-controlled expression in
gram-positive bacteria . Plasmid
44:183-190.
- Chandrapati,
S., and D . J . O'Sullivan. 1999 . Nisin
independent induction of the nisA promoter in Lactococcus
lactis during growth in lactose or galactose . FEMS
Microbiol . Lett.
170:191-198.
- Culham,
D . E., J . Henderson, R . A . Crane, and
J . M . Wood. 2003 . Osmosensor ProP of
Escherichia coli responds to the concentration, chemistry and
molecular size of osmolytes in the proteoliposome lumen.Biochemistry
42:410-420.
- de
Ruyter, P . G . G . A., O . P.
Kuipers, and W . M . de Vos. 1996 . Controlled
gene expression systems for Lactococcus lactis with the
food-grade inducer nisin . Appl . Environ . Microbiol.
62:3662-3667.
- Eichenbaum,
Z., M . J . Federle, D . Marra, W . M . de Vos,
O . P . Kuipers, M . Kleerebezem, and J . R . Scott.1998 . Use of the lactococcal nisA promoter to
regulate gene expression in gram-positive bacteria: comparison of
induction level and promoter strength . Appl . Environ.
Microbiol.
64:2763-2769.
- Fraser,
K . R., D . Sue, M . Wiedmann, K . Boor, and C . P.
O'Byrne. 2003 . Role of
B in
regulating the compatible solute uptake systems of Listeria
monocytogenes: osmotic induction of opuC is
B dependent . Appl . Environ.
Microbiol.
69:2015-2022.
- Gerhardt,
P . N . M., L . T . Smith, and G.
M . Smith. 1996 . Sodium-driven, osmotically activated
glycine betaine transport in Listeria monocytogenes membrane
vesicles . J . Bacteriol.
178:6105-6109.
- Hill,
C., P . D . Cotter, R . D . Sleator, and C.
G . M . Gahan. 2002 . Bacterial stress response
in Listeria monocytogenes: jumping the hurdles imposed by
minimal processing . Int . Dairy J.
12:273-283.
- Kleerebezem,
M., M . M . Beerthuyzen, E . E . Vaughan, W.
M . de Vos, and O . P . Kuipers. 1997.
Controlled gene expression systems for lactic acid bacteria:
transferable nisin-inducible expression cassettes for
Lactococcus, Leuconostoc, and Lactobacillus
spp . Appl . Environ . Microbiol.
63:4581-4584.
- Ko,
R., and L . T . Smith. 1999 . Identification of
an ATP-driven, osmoregulated glycine betaine transport system in
Listeria monocytogenes. Appl . Environ.
Microbiol.
65:4040-4048.
- Ko,
R., L . T . Smith, and G . M . Smith.1994 . Glycine betaine confers enhanced osmotolerance and
cryotolerance on Listeria monocytogenes. J.
Bacteriol.
176:426-431.
- Kuipers,
O . P., M . M . Beerthuizen, R . J . Siezen,
and W . M . de Vos. 1993 . Characterization of
the nisin gene cluster nisABTCIPR of Lactococcus
lactis requirement of expression of nisA and
nisI genes for development of immunity . Eur.
J . Biochem.
216:281-291.
- Maniatis,
T., E . F . Fritsch, and J . Sambrook. 1982.
Molecular cloning: a laboratory manual . Cold Spring Harbor Laboratory,
Cold Spring Harbor,
N.Y.
- Mendum,
M . L., and L . T . Smith. 2002.
Characterization of glycine betaine porter I from Listeria
monocytogenes and its roles in salt and chill tolerance.Appl . Environ . Microbiol.
68:813-819.
- Milner,
J . L., S . Grothe, and J . M . Wood.1988 . Proline porter II is activated by a hyperosmotic
shift in both whole cells and membrane vesicles of Escherichia
coli K12 . J . Biol . Chem.
263:14900-14905.
- Morbach,
S., and R . Krämer. 2002 . Body shaping under
water stress: osmosensing and osmoregulation of solute transport in
bacteria . ChemBioChem
3:384-397.
- Park,
F . P., and G . S . A . B.
Stewart. 1990 . High-efficiency transformation of
Listeria monocytogenes by electroporation of penicillin
treated cells . Gene
94:129-132.
- Patchett,
R . A., A . F . Kelly, and R . G . Kroll.1994 . Transport of glycine betaine by Listeria
monocytogenes. Arch . Microbiol.
162:205-210.
- Peter,
H., A . Burkovski, and R . Krämer. 1996.
Isolation, characterization, and expression of the Corynebacterium
glutamicum betP gene, encoding the transport system for the
compatible solute glycine betaine . J . Bacteriol.
178:5229-5234.
- Rhodes,
D., and A . D . Hanson. 1993 . Quaternary
ammonium and tertiary sulfonium compounds in higher plant . Annu.
Rev . Plant Physiol.
44:357-384.
- Ruebenhagen,
R., H . Roensch, H . Jung, R . Kraemer, and S . Morbach.2000 . Osmosensor and osmoregulator properties of the
betaine carrier BetP from Corynebacterium glutamicum in
proteoliposomes . J . Biol . Chem.
275:735-741.
- Sleator,
R . D., C . G . M . Gahan, T . Abee, and C.
Hill. 1999 . Identification and disruption of BetL, a
secondary glycine betaine transport system linked to the salt tolerance
of Listeria monocytogenes LO28 . Appl . Environ.
Microbiol.
65:2078-2083.
- Sleator,
R . D., C . G . M . Gahan, B.
O'Driscoll, and C . Hill. 2000 . Analysis of the
role of betL in contributing to the growth and survival of
Listeria monocytogenes LO28 . Int . J . Food
Microbiol.
60:261-268.
- Sleator,
R . D., J . Wouters, C . G . M . Gahan, T.
Abee, and C . Hill. 2001 . Analysis of the role of OpuC,
an osmolyte transport system, in salt tolerance and virulence potential
of Listeria monocytogenes. Appl . Environ.
Microbiol.
67:2692-2698.
- Sleator,
R . D., and C . Hill. 2002 . Bacterial
osmoadaptation: the role of osmolytes in bacterial stress and
virulence . FEMS Microbiol . Rev.
26:49-71.
- Sleator,
R . D., C . G . M . Gahan, and C . Hill.2003 . A postgenomic appraisal of osmotolerance in
Listeria monocytogenes. Appl . Environ.
Microbiol.
69:1-9.
- Sleator,
R . D., G . A . Francis, D . O'Beirne,
C . G . M . Gahan, and C . Hill.
2003 . Betaine and carnitine uptake systems in
Listeria monocytogenes affect growth and survival in foods and
during infection . J . Appl . Microbiol.
95:839-846.
- Smith, P . K.,
R . I . Krohn, G . T . Hermanson, A . K.
Mallia, F . H . Gartner, M . D . Provenzano,
E . K . Fujimoto, N . M . Goeke, B . J . Olson,
and D . C . Klenk. 1985 . Measurement of
protein using bicinchoninic acid . Anal . Biochem.
150:76-85.
- Wemekamp-Kamphuis,
H . H., J . A . Wouters, R . D . Sleator,
C . G . M . Gahan, C . Hill, and T . Abee.2002 . Multiple deletions of the osmolyte transporters
BetL, Gbu, and OpuC of Listeria monocytogenes affect virulence
and growth at high osmolarity . Appl . Environ . Microbiol.
68:4710-4716.
- Wood,
J . M. 1999 . Osmosensing by bacteria: signals
and membrane-based sensors . Microbiol . Mol . Biol . Rev.
63:230-262.
Free Online Full-text Article
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
|