|








| |
Journal of Bacteriology, July 2004, p . 4142-4151, Vol . 186,
No . 13
HutZ Is
Required for Efficient Heme Utilization in Vibrio cholerae
Elizabeth E . Wyckoff,1* Michael
Schmitt,2 Angela Wilks,3 and Shelley M . Payne1,4
Section of Molecular Genetics and Microbiology,1 Institute of
Cellular and Molecular Biology, The University of Texas at Austin, Austin, Texas
78712,4 Laboratory of Bacterial Toxins, Division of Bacterial,
Parasitic and Allergenic Products, Center for Biologics Evaluation and Research,
Food and Drug Administration, Bethesda, Maryland 20892,2 Department
of Pharmaceutical Sciences, School of Pharmacy, University of Maryland,
Baltimore, Maryland 21201-11803
Received 18 March 2004/ Accepted 23 March 2004
Vibrio cholerae, the causative agent of cholera, requires iron
for growth . One mechanism by which it acquires iron is the uptake of
heme, and several heme utilization genes have been identified in
V . cholerae . These include three distinct outer membrane
receptors, two TonB systems, and an apparent ABC transporter to
transfer heme across the inner membrane . However, little is known
about the fate of the heme after it enters the cell . In this report
we show that a novel heme utilization protein, HutZ, is required for
optimal heme utilization . hutZ (open reading frame [ORF]
VCA0907) is encoded with two other genes, hutW (ORF VCA0909)
and hutX (ORF VCA0908), in an operon divergently transcribed
from the tonB1 operon . A hutZ mutant grew poorly when heme was
provided as the sole source of iron, and the poor growth was
likely due to the failure to use heme efficiently as a source of
iron, rather than to heme toxicity . Heme oxygenase mutants of both
Corynebacterium diphtheriae and C . ulcerans fail to use
heme as an iron source . When the hutWXZ genes were expressed
in the heme oxygenase mutants, growth on heme was restored, and
hutZ was required for this effect . Biochemical characterization
indicated that HutZ binds heme with high efficiency; however, no heme
oxygenase activity was detected for this protein . HutZ may act as a
heme storage protein, and it may also function as a shuttle protein
that increases the efficiency of heme trafficking from the membrane
to heme-containing proteins .
Vibrio cholerae is the causative agent of the severe diarrheal
disease cholera . V . cholerae has the ability to survive in a
variety of environments, including fresh and marine waters, as well
as in the human host . Cholera is transmitted to humans from
contaminated water and food . Following ingestion, V . cholerae
colonizes the lower small intestine, where it secretes cholera toxin .
The toxin is responsible for the severe diarrhea characteristic of
cholera .
This pathogen has an absolute requirement for iron and must
acquire iron in each of the environments in which it grows .
Accordingly, it has evolved several mechanisms for iron acquisition,
including the production and secretion of the catechol siderophore
vibriobactin (9) . This iron-chelating compound binds iron with
high affinity and is then transported back into the cell . V .
cholerae also uses several siderophores produced by other organisms,
including ferrichrome (9, 32),
enterobactin (22, 53), and schizokinen
(35) .
In the human host, heme is an abundant potential source of iron .
Although siderophores bind iron with high affinity, they cannot
remove the iron from heme or heme compounds . Hence, many pathogenic
bacteria, including V . cholerae, have systems for the direct
utilization of heme, either as free heme or from various heme-containing
proteins (8, 39, 46) .
Heme transport genes have been cloned and characterized from a number
of gram-negative pathogens (for reviews, see references
8, 42, and 46) .
Proteins involved in the transport of heme into the cell have been
identified in V . cholerae . Three distinct outer membrane
receptors, HutA, HutR, and HasR (14, 15,
21), specifically transport heme across the outer
membrane . This transport requires the activity of TonB, which,
together with its accessory proteins ExbB and ExbD, transduces energy
from the inner membrane to heme receptors in the outer membrane . Two
complete sets of tonB system genes are present in the V .
cholerae genome (24) . The tonB1 exbB1 exbD1
operon is located on the small chromosome, and the predicted protein
sequences have low similarity to TonB, ExbB, and ExbD from enteric
bacteria . In contrast, TonB2 is encoded on the large chromosome and
has higher sequence similarity to the TonB proteins from other
enteric bacteria (12, 24) . The
hutBCD genes are cotranscribed with the tonB1 system genes .
HutBCD comprise a periplasmic binding protein-dependent ABC
transport system that is thought to transport heme across the inner
membrane . Strains carrying mutations in hutB or hutC can
still use heme, suggesting that there must be at least one other
mechanism for heme to cross the cytoplasmic membrane (24) .
It appears that the intact heme moiety is transported across the
outer membrane . This is supported by the observation that supplying
heme transport genes from V . cholerae (15) or other
organisms (40) to an Escherichia coli strain
that is defective in heme biosynthesis confers the ability to grow
normally when heme is provided in the medium (15,
40) . In addition, a V . cholerae mutant
strain defective in the synthesis of heme grows normally in media
supplemented with heme or hemoglobin (13) . This indicates
that heme can be taken up and incorporated into cytochromes and
presumably other heme proteins . Transport studies with Yersinia
enterocolitica and 14C-labeled hemin have also indicated that
the entire heme molecule was transported into the cell (41) .
The manner in which the transported heme is transferred from
the heme transport proteins to cellular heme proteins is not known .
Most heme-transporting organisms can use heme as an iron source,
since heme promotes their growth on iron-restricted media . In a few
pathogenic bacterial species, including Corynebacterium
diphtheriae (33, 49), Neisseria
meningitidis (34, 55,
56), Pseudomonas aeruginosa (30), and
Staphylococcus aureus (37), heme oxygenase,
an enzyme that removes the iron from the heme moiety, has been
identified . In these organisms, heme oxygenase is required for the
use of heme as a source of iron . However, no heme oxygenase activity
has been identified in V . cholerae or any other enteric
bacteria, and no gene with homology to known heme oxygenases is
present in the sequenced genomes . It is not known whether these
bacteria have an unidentified enzyme to remove iron from heme or
whether the bacteria can use heme in the absence of such an activity .
For example, the efficient incorporation of the newly transported
heme into heme proteins may reduce the amount of free iron the
bacteria would need to transport from the medium . If this requirement
for free iron was reduced to a sufficient level, it may allow the
bacteria to grow on iron-restricted media .
In this work we show that HutZ (open reading frame [ORF] VCA0907)
is required for efficient heme utilization in V . cholerae . As
observed for other heme utilization proteins, the synthesis of HutZ
is negatively regulated by iron . HutZ was purified and shown to bind
heme with high efficiency . We propose that HutZ may function as a
heme shuttling or storage protein or both .
Bacterial strains, plasmids, and media. The strains and
plasmids used in this study are listed in Table 1 .
The iron chelator ethylenediamine di(ortho-hydroxyphenylacetic
acid) (EDDA) was deferrated by the method of Rogers (31) .
When added, the antibiotic concentrations used were 250 µg
of carbenicillin per ml, 50 µg of kanamycin per ml, and 50 (E .
coli) or 5 (V . cholerae) µg of chloramphenicol per ml .
Corynebacterium strains were routinely grown in heart infusion
broth containing 0.2% (vol/vol) Tween 80 (HIB-Tween) .
| TABLE 1 . Bacterial strains and plasmids used in this study
|
|
Growth assays. Cultures were grown overnight in L broth and
then diluted 200-fold into minimal medium . The M9 medium was modified
and contained 42 mM Na2PO4, 22 mM KH2PO4,
18 mM NH4Cl, 85 mM NaCl, 2.5 mM MgSO4, and 0.4%
(wt/vol) sucrose or another carbon source as indicated . All cultures
were grown with aeration at 37°C . To determine the ability of the
hutZ mutant to grow in iron-restricted medium following growth
with heme as the sole iron source, strains (EWV104, EWV115, and
EWV115/pVHT124) were grown with shaking at 37°C to late log phase in
M9 medium with 200 µg of EDDA per ml and 2.5 µM hemin . Cultures were
centrifuged, washed with saline, and resuspended to an A650
of approximately 0.07 in M9 medium containing 200 µg of EDDA per ml .
Cultures were grown with aeration at 37°C, and A650
was monitored .
For the heme toxicity studies, overnight cultures were diluted
500-fold into L broth containing 600 µg of EDDA per ml and the
indicated quantities of hemin . Cultures were grown with shaking at
37°C . After 3.5 h, the A650 of each culture was
determined, and serial dilutions of the culture were plated to
determine the number of CFU present . The mean inoculum size for
EWV104/pWSK29 was 2.12 x 107; for
EWV115/pWKS30 it was 1.95 x 107,
and for EWV115/pVHT124 it was 1.89 x 107 .
For the spot toxicity assays, overnight cultures were diluted
100-fold into L broth and 25 µl was mixed with 20 ml of L agar
containing 300 µg of EDDA per ml and poured into a 100-mm-diameter
petri plate . After solidification of the agar, 5 µl of either a
5 mM or 500 µM hemin solution was spotted onto the surface of the
agar . Growth around the heme spot was photographed following
incubation for 24 h at 37°C .
For C . ulcerans heme utilization assays, cultures were grown
overnight in HIB-Tween and plated on HIB agar containing 200 µg
of EDDA per ml, 5 µM heme, and 2 µg of chloramphenicol per ml .
Western blot assays. Overnight cultures were diluted
100-fold into L broth containing the indicated concentration of EDDA
or hemin . When the A595 reached approximately 0.6,
1 ml of culture was centrifuged for 1 min in a Microfuge, and the
pellet was resuspended in 0.2 ml of sodium dodecyl sulfate (SDS) gel
sample buffer . The samples were boiled for 10 min and loaded onto an
SDS-15% polyacrylamide gel . Following transfer to nitrocellulose,
HutZ was visualized with a rabbit antiserum raised against purified
HutZ .
DNA sequencing. DNA was sequenced with an Applied Biosystems
Prism 377 DNA sequencer (Perkin-Elmer Corp.) . Routine DNA sequence
analysis was performed with the program DNA Strider (18) .
Amino acid sequence alignments were performed with the ClustalW
feature of the MacVector package (25) . The BLAST
program (1) was used to search the National Center
for Biotechnology Information protein database .
Mutant strain construction. To construct EWV107, the
kanamycin resistance gene from plasmid pUC4K was inserted as a BamHI
fragment into the BglII site in hutW carried on plasmid
pHUT10 . The SnaBI/HpaI fragment containing hutW::kan
was subcloned into the NruI site of pACSac . The resulting plasmid was
introduced into V . cholerae strain Lou15 by electroporation,
and an allelic exchange mutant named EWV105 was obtained as
previously described (52) . A vibB::cam mutation
was introduced into EWV105 as previously described (51)
to give hutW::kan vibB::cam mutant strain
EWV107 .
To construct EWV115, the region containing hutZ was amplified
from Lou15 DNA with Taq DNA polymerase and the primers Liz 211
(5'TTATGGCGAAGCATCATCTGC) and Liz 212 (5'AAGAAGCGGTCAATGGGTGC) .
The resulting fragment was subcloned into pGEM-Teasy, and the kan
gene from pUC4K was inserted as a HincII fragment into the AfeI site
in hutZ . The fragment containing hutZ::kan was obtained
by digestion with NotI, made blunt with Klenow, and subcloned
into the SmaI site of pCVD442 . Marker exchange mutations were
obtained as previously described (21) .
Plasmid construction. A series of nonpolar mutations in the
hutWXZ genes was constructed as follows . The SmaI fragment
containing the aphA-3 cassette from plasmid pUC18K was
inserted into the StyI site in hutW, the SphI site in hutX,
or the Eco47III site in hutZ . The StyI and SphI sites were
made blunt with Klenow prior to ligation with the aphA-3
cassette fragment . In each case, the DNA sequence around the 3'
junction of the aphA-3 cassette was determined to
confirm the orientation of the insert and that the hut sequence
was in frame . The plasmids carrying these inserts are listed in
Table 1 . Western blotting confirmed that HutZ is produced
by pVHT111 (hutX::aph) and pVHT122 (hutW::aph),
and the amount produced was similar to that made from the plasmid
carrying the wild-type operon (pVHT105) . As expected, HutZ was not
produced by pVHT116 (hutZ::aph) .
pVHT139 was constructed by PCR amplification of hutZ from V .
cholerae strain Lou15 with Pfu DNA polymerase (Stratagene) and
primers Liz197 (5'-CGGGATCCTATCGCCGAAAAAACAAGC) and Liz198
(5'-CGGGATCCTTCTTTACCGCTCAAGGTGAAAAC) . The PCR product was cleaved
with BamHI and cloned into the BamHI site of pCmZ . The resulting
clone was sequenced to confirm that the cloned fragment did not
contain PCR errors . pEHutZ was constructed by PCR amplification of
hutZ from pVHT105 with Vent DNA polymerase (New England Biolabs)
and a forward primer containing an NdeI site
(5'-GGAATTCCATATGGATCAGCAAGTTAAGCA) and a reverse primer containing
an XhoI site (5'-CCGCTCGAGTTAGCCATTAGAAATCTTAC) . The PCR product was
cleaved with NdeI and XhoI and cloned into pET30a cleaved with NdeI
and XhoI .
Expression and purification of HutZ and preparation of HutZ
antiserum. An overnight culture of E . coli BL21(DE3) carrying
plysS and pEHutZ was diluted into 100 ml of Luria-Bertani (LB) medium
contain ampicillin and grown at 37°C to mid-log phase . Ten
milliliters of the culture was then diluted into 1 liter of LB medium
containing ampicillin, and when the cells reached mid-log phase
isopropyl-ß-D-thiogalactopyranoside was added
to a final concentration of 1 mM . The cells were grown for an
additional 4 to 5 h at 30°C and harvested by centrifugation at 10,000
x g for 20 min . Cells were lysed by
sonication in buffer containing 50 mM Tris-HCl (pH 7.8), 1 mM EDTA,
and 1 mM phenylmethylsulfonyl fluoride, and the suspension was
centrifuged at 27,000 x g
for 40 min .
The supernatant was applied to a Sepharose-Q Fast Flow column (1.5
by 10 cm) previously equilibrated with 20 mM Tris-HCl (pH 7.5) . The
column was washed with 3 column volumes of 20 mM Tris-HCl (pH 7.5)
containing 50 mM NaCl . Protein was then eluted with the same buffer
with a linear gradient of 50 to 500 mM NaCl . HutZ eluted at a
concentration of 200 to 250 mM NaCl, and the peak fractions were
pooled and dialyzed against 10 mM KPO4 (pH 7.4) at 4°C .
HutZ was stored at –80°C or reconstituted with heme as described
below . A portion of the purified protein was used for the preparation
of anti-HutZ antiserum in rabbits . The antiserum was prepared at
Cocalico Biologicals, Inc . (Reamstown, Pa.), in accordance with
standard protocols .
Reconstitution of HutZ with heme. The heme-HutZ complex was
prepared as follows . Hemin was added to the purified HutZ protein at
a final 2:1 heme-to-protein ratio . The sample was then applied to a
Bio-Gel HTP column (1.5 by 6 cm) preequilibrated with 20 mM KPO4
(pH 7.8) buffer . The column was washed with the same buffer (5
volumes) . The protein was then eluted with a linear gradient of 10 mM
KPO4 (pH 7.8) to 150 mM KPO4 (pH 7.8) . The
protein fractions were pooled and dialyzed against 20 mM Tris-HCl (pH
7.8) at 4°C . The protein was concentrated with an Amicon filtration
unit and stored at –80°C .
Absorption spectroscopy of the HutZ protein. The UV and
visible spectra of wild-type HutZ were recorded in 20 mM Tris (pH
7.5) on a Cary 100Bio spectrophotometer . The millimolar extinction
coefficient ( 405)
for the heme-HutZ complex was determined as previously described (7) .
The A412 of a purified heme-HutZ sample was
measured . An excess of dithionite was added, and the spectrum of the
reduced ferrous pyridine hemochrome was recorded . The concentration
was calculated from the absorbance maxima at 418.5, 526, and 555 nm
with millimolar extinction coefficient values of 170, 17.5, and 34.4,
respectively .
Identification of an operon containing heme utilization genes.
To identify genes that could be involved in the utilization of heme
following its entry into the cytoplasm, we examined genes that are
closely linked to known heme transport genes and have no known
function . Three genes linked to the V . cholerae tonB1 operon
have homology with genes in other heme transport loci (Table
2) . These genes, named hutW, hutX, and hutZ,
form an apparent operon that is divergently transcribed from the
tonB1 operon (12, 24) (Fig.
1A) . The promoter region for these genes contains
several potential binding sites for the iron regulatory protein Fur .
The sequences of these potential Fur boxes are indicated in Fig.
1B . Given this information, we decided to determine
whether HutWXZ has any role in heme utilization in V . cholerae .
| TABLE 2 . Homologies of HutWXZ to selected proteins
|
|
|
FIG . 1 . (A) Map of the V . cholerae hutWXZ region . The direction
of transcription is indicated by the arrows, and the smaller boxes
indicate the potential Fur boxes . (B) Sequence of the tonB1-hutW
intergenic region . The boxes indicate the locations of potential Fur
boxes . Expression of the tonB1 operon was previously shown to be
repressed by iron, and the transcription start was mapped near tonB1
Fur box 1 (25) . Potential Fur boxes identified in
that work are labeled tonB1 Fur box 1 and tonB1 Fur box 2 .
Two additional potential Fur boxes are labeled Fur box 3 and Fur box 4.
|
|
HutW is a member of the radical SAM superfamily of S-adenosylmethionine-dependent
enzymes (38) . This large family of proteins uses a
radical-based mechanism to catalyze diverse chemical reactions . HutW
has the highest homology with proteins encoded by genes linked to
heme transport genes of Vibrio parahaemolyticus (26),
Plesiomonas shigelloides (16), Yersinia
pestis (28), and E . coli O157:H7 (Table
2) . HutW has lower homology with HemN, the oxygen-independent
form of the heme biosynthetic enzyme coproporphyrinogen oxidase
(54), and also with yggW, an ORF of unknown function
present in the genome of E . coli K-12 (2)
and several other bacterial species . The two downstream genes (Fig.
1A) were also analyzed . The predicted amino acid
sequences of HutX and HutZ lack any motifs or signature sequences
that would suggest an activity for these proteins . Both proteins,
however, have homology with proteins encoded within heme transport
regions in other organisms (Table 2) . The functions
of these proteins in other organisms are also unknown .
The homology of HutW with HemN suggested that it might have
coproporphyrinogen oxidase activity . To test this, a Salmonella
enterica serovar Typhimurium hemN mutant was transformed with
plasmid pVHT105, which contains the hutWXZ operon . This clone
did not complement the hemN mutation (data not shown), indicating
that hutW is unlikely to encode an oxygen-independent
coproporphyrinogen oxidase activity . In a positive control, the
hemN gene of E . coli O157:H7 complemented the
Salmonella hemN mutation . HutW and several other HutW homologues
encoded in heme transport loci are generally annotated as hemN
(oxygen-independent coproporphyrinogen oxidases) . The annotation of
this group of proteins may need to be reviewed .
Genetic analysis of hutWXZ. Because the sequence
analysis did not suggest a role for the genes in the hutWXZ
operon, we used allelic exchange to construct a chromosomal mutant in
which a kanamycin resistance cassette was inserted into the hutW
gene (see Materials and Methods) . We anticipated that this hutW::kan
insertion would be polar on hutX and hutZ, allowing us
to identify a role of any or all of these genes in heme utilization .
A mutation in the vibriobactin biosynthetic gene vibB was also
introduced into this strain to reduce growth due to vibriobactin
utilization in iron-restricted media . The resulting strain, EWV107,
grew similarly to the isogenic vibB mutant strain EWV104 in
both LB and minimal media, indicating that the hutWXZ genes do
not encode functions required for growth in these media . However,
EWV107 was defective in heme utilization (Fig . 2) .
In this experiment, all strains grew well in minimal medium with no
added iron, and their growth was inhibited in the same medium
containing the iron chelator EDDA . When the M9-EDDA medium was
supplemented with hemin, the hutW::kan mutant grew
poorly relative to the isogenic vibB mutant (Fig . 2) .
Supplying the hutWXZ genes on a plasmid restored the ability
of the mutant to use heme efficiently . This result was not dependent
on the carbon source used, since the hutW vibB::cam
mutant had a defect in heme utilization when glucose, sucrose,
lactate, succinate, or glycerol was used as the sole carbon source .
In contrast to the result obtained with minimal medium, the hutW::kan
vibB::cam mutant was able to use heme as an iron source in
L broth containing EDDA and hemin (data not shown) . The reason for
this difference in heme utilization between L broth and minimal
medium is not known .
|
FIG . 2 . Growth of hutW mutant with heme as the sole iron source .
Overnight cultures were diluted 1/100 into M9 medium that was either
unsupplemented (minimal M9), supplemented with 200 µg of the iron
chelator EDDA per ml (M9+EDDA), or supplemented with 200 µg of EDDA per
ml and 2.5 µM hemin (M9+hemin) . The optical density at 595 nm (OD595)
of each culture was determined after 6 h of growth at 37°C . The strains
were the vibB::cam mutant EWV104 (white), the vibB::cam
hutW::kan mutant EWV107 (black), and EWV107 carrying
hutWXZ on plasmid pVHT105 (gray) . Although the relative differences
between strains were consistent between experiments, the absolute values
for each strain varied owing to subtle changes in the medium and assay
conditions, and thus results of only one representative experiment are
shown.
|
|
Since the kan insertion in hutW is likely to be polar on hutX
and hutZ, additional experiments were performed to determine
which of these genes is required for optimal heme utilization
(Fig . 3) . A plasmid encoding only hutW did not restore
that ability of the hutW::kan strain to grow in minimal
medium with heme as an iron source . This showed that hutW was
not sufficient to complement the hutW::kan mutation and
supported the model in which the hutWXZ genes form an operon .
The hutW::kan mutant was then transformed with a series
of plasmids containing the hutWXZ operon, in which one each of
these genes was disrupted with the nonpolar aph cassette (20) .
The plasmids carrying insertions in hutW and hutX
complemented the mutation, but the hutZ insertion plasmid did
not . In a further experiment, a plasmid containing only hutZ
complemented the hutW::kan mutation, indicating that
hutZ is necessary and sufficient for efficient heme utilization
by this mutant (Fig . 3) .
|
FIG . 3 . Complementation of a V . cholerae hutW::kan mutant
and suppression of corynebacterial hmuO mutants . For
complementation of hutW::kan, V . cholerae strain
EWV107 was transformed with a plasmid carrying the indicated genes and
then tested for growth in M9 minimal medium supplemented with EDDA and
hemin as described in the legend to Fig . 2 . Where
indicated, one of the genes was disrupted with the nonpolar aph
gene . The plasmids tested for complementation of hutW::kan
were as follows: hutWXZ, pVHT105; hutW, pVHT106; hutXZ,
pVHT122; hutWZ, pVHT111; hutWX, pVHT116; hutZ,
pVHT124 . For suppression of hmuO mutants, either C .
diphtheriae strain HC1-7 or C . ulcerans strain CU29 was
transformed with plasmids carrying the indicated genes and plated on
brain heart infusion medium containing EDDA and hemin . +, colony size of
>1 mm, ±, colony size between 0.1 and 1 mm; –, no colonies were
observed . The plasmids tested for suppression of the hmuO
mutations were as follows: hutWXZ, pVHT108 and pVHT109; hutW,
pVHT106; hutXZ, pVHT128; hutWZ, pVHT130; hutWX,
pVHT132; hutZ, pVHT139.
|
|
To further characterize hutZ, we constructed a chromosomal hutZ::kan
mutation in the vibB genetic background . Like the hutW::kan
mutant EWV107, EWV115 had a heme utilization defect . A representative
experiment is shown in Fig . 4 . All of the strains grew
well in M9 medium supplemented with 40 µM iron (Fig . 4A) .
However, when heme was the sole iron source, the hutZ mutant
grew more slowly and reached a lower final cell density than its
parent strain (Fig . 4B) . The hutZ::kan
mutant grew more slowly than the previously characterized hutW::kan
mutant in M9-EDDA-hemin medium, and although the difference was
small, it was consistently observed in all experiments . Unlike the
hutW::kan mutant, the hutZ::kan mutant used
heme poorly in L broth (data not shown) . Providing hutZ on a
plasmid restored the ability to grow with heme as the sole iron
source, indicating that the growth defect on heme-containing media
was due to loss of hutZ . These data directly demonstrate that
hutZ is required for optimal heme utilization by V .
cholerae .
|
FIG . 4 . Time course of growth of the hutZ::kan mutation .
Overnight cultures were diluted 1/200 into M9 minimal medium
supplemented with 20 µM iron (A) or 200 µg of EDDA per ml and 2.5 µM
hemin (B) . The optical density at 595 nm (OD595) was measured
at the indicated times . Symbols:
,
vibB mutant strain EWV104 carrying plasmid vector pWSK29;
,
vibB hutW mutant strain EWV107 carrying pWSK29;
,
strain EWV107 carrying hutZ on plasmid pVHT124;
x, vibB hutZ mutant strain
EWV115 carrying pWKS30;
,
strain EWV115 carrying hutZ on plasmid pVHT124.
|
|
The growth defect on heme is not due to heme toxicity. Reduced
growth on heme as the sole iron source could be due either to failure
to efficiently use the heme as a source of iron or to heme toxicity .
To test for heme toxicity, overnight cultures of the hutZ
mutant, the isogenic HutZ+ strain, and the hutZ
mutant complemented with hutZ on a plasmid were diluted into
iron-restricted media containing increasing concentrations of hemin
and incubated for 3.5 h (Fig . 5A) . No growth of the
cells was observed in the absence of an added iron source; in fact,
some cell death occurred since the number of viable cells present at
3.5 h was lower than that of the original inoculation . When the
medium was supplemented with hemin, all three strains grew, although
the final titers of the hutZ mutant cultures were consistently
lower than those of the HutZ+ strains (Fig .
5A), and the extent of this difference was consistent with the
reduced optical density observed in the growth curve (Fig . 4) .
If heme were toxic to the hutZ mutant, it might be expected
that the number of viable hutZ mutant cells would decrease with
increasing heme concentrations . The data show that the growth
of the hutZ mutant was essentially unchanged across the range
of heme concentrations normally used for heme utilization and
toxicity assays .
|
FIG . 5 . Effect of heme on cell viability . (A) Overnight cultures were
diluted to approximately 2 x 107/ml
into L broth containing 600 µg of EDDA per ml and the indicated
concentration of hemin . The cultures were incubated at 37°C with
aeration for 3.5 h, and serial dilutions were plated to determine the
number of CFU . The strains were the vibB::cam mutant
EWV104/pWSK29 (white), the vibB::cam hutZ::kan
mutant EWV115/pWKS30 (black), and EWV115 carrying hutWXZ on
plasmid pVHT105 (gray) . (B) Cultures of the indicated strains were mixed
with L agar containing 300 µg of EDDA per ml . Following solidification
of the agar, 5 µl of the indicated concentration of hemin was spotted on
the surface and plates were incubated at 37°C for 24 h.
|
|
Bioassays also were performed in which heme at a concentration of 5
mM or 500 µM was spotted onto iron-restricted agar containing hutZ
mutant or HutZ+ cells (Fig . 5B) . Cell growth
was observed around both heme concentrations, showing that both
strains were able to use heme as an iron source . The colony size of
the hutZ mutant was smaller than that of the HutZ+ strain,
consistent with the reduced growth of the mutant observed in
liquid assays . However, even at the highest heme concentration,
colonies of the hutZ mutant strain were present at the center
of the growth zone, directly under the spot inoculated with heme .
Some of the colonies directly under the inoculation were slightly
smaller than those at the edge of the inoculated area, but this
effect was also present in the HutZ+ strain . Taken
together, the results of these experiments do not support the model
in which the growth defect of the hutZ mutant observed in our
assays is due to increased susceptibility to heme toxicity .
Visualization of HutZ and regulation of hutZ by iron.
Purified HutZ was used to raise a polyclonal antiserum in rabbits
(see Materials and Methods) . In a Western blot assay, a 20,000-Mr
band was visualized in the sample of cellular protein from the
HutZ+ strain (Fig . 6, lane 1) . The amount of HutZ
present was reduced, but not totally eliminated, in the hutW::kan
mutant strain (EWV107), while HutZ was not observed in the hutZ::kan
strain (EWV115) (Fig . 6, lane 3) . This residual
expression of HutZ in the hutW::kan mutant may explain
why it had a less severe phenotype than the hutZ::kan
mutant . HutZ expression was restored when hutZ was provided on
a plasmid (Fig . 6, lane 4) . In these immunoblots, a
band migrating slightly faster than HutZ was consistently visualized .
The identity of this protein is unknown, but since it was also
recognized by the preimmune serum, it is unlikely to be related to
HutZ .
|
FIG . 6 . Visualization of HutZ and iron regulation of HutZ production .
Extracts of total cellular protein were prepared as described in Methods
and Materials, separated on an SDS-15% polyacrylamide gel, and
visualized with antiserum to HutZ . (A) The following strains were grown
in L broth containing 25 µg of EDDA per ml: EWV104 (vibB::cam)
(lane 1), EWV107 (vibB::cam hutW::kan) (lane 2),
EWV115 (vibB::cam hutZ::kan) (lane 3), and
EWV115/pVHT124 (lane 4) . (B) EWV104 (vibB::cam) was grown
in LB medium containing the following supplement(s): 40 µM FeSO4
(lane 5), no supplement (lane 6), 5 µg of EDDA per ml (lane 7), 50 µg of
EDDA per ml (lane 8), or 600 µg of EDDA per ml and 5 µM hemin (lane 9).
|
|
The presence of potential Fur boxes upstream of the hutW promoter
suggested that this operon would be regulated by iron . The Western
blot shows that only a low level of HutZ is produced when the
culture was grown in LB medium supplemented with 40 µM FeSO4
(Fig . 6, lane 5) and that the amount of HutZ present during
growth in unsupplemented L broth was only slightly greater than
during growth with added iron (lane 6) . When the iron chelator EDDA
was added to a final concentration of either 5 or 50 µg/ml, the
amount of HutZ present was greatly increased (Fig . 6, lanes
7 and 8) . These data are consistent with the idea that the synthesis
of HutZ is negatively regulated by iron . To determine whether
the synthesis of HutZ is also regulated by hemin, we grew a culture
in the presence of EDDA and hemin . The amount of HutZ present when
the strains were grown in media containing EDDA and hemin was similar
to the amount synthesized in the presence of EDDA alone (Fig.
6, lane 9) . Thus, HutZ synthesis was neither
induced nor repressed by the presence of heme . Addition of heme to L
broth in the absence of added iron chelators did not affect HutZ
synthesis, indicating that heme also did not influence HutZ synthesis
under iron-replete conditions (data not shown) .
The hutWXZ genes stimulate growth of corynebacterial hmuO
mutants. The gene for heme oxygenase, hmuO, has been identified
in C . diphtheriae and in C . ulcerans, and hmuO
mutants fail to grow when hemin is the sole iron source (33) .
To determine whether the hutWXZ genes might have a function
similar to that of hmuO and allow growth of hmuO
mutants on heme, we subcloned the hutWXZ genes into the
corynebacterial shuttle vector pCmZ (5) . The
presence of the hutWXZ genes restored the ability of the corynebacterial
hmuO mutants to grow with hemin as the sole source of iron (Fig .
3) . The ability of the hutWXZ genes to restore
growth of the Corynebacterium mutants was similar to that seen
when the mutations were complemented with the cloned C .
diphtheriae hmuO gene (data not shown) . To determine which ORF is
required for restoration of growth of the hmuO mutant, the
series of nonpolar aph cassette insertions was subcloned into
the pCmZ shuttle vector . Plasmids carrying insertions in the hutW
and hutX genes restored the growth of the Corynebacterium
hmuO mutants with heme as an iron source, but a plasmid with an
insertion in hutZ did not (Fig . 3) . This
indicates that hutZ was necessary for restoration of growth on
hemin in this assay . To determine whether hutZ is sufficient
for growth, we cloned hutZ into pCmZ . C . diphtheriae or
C . ulcerans hmuO mutants carrying the resulting plasmid,
pVHT139, grew with heme as the sole source of iron, but the colony
size was smaller than that of the hmuO mutants carrying either
the complete hutWXZ operon or the cloned C . diphtheriae
hmuO gene .
Purification and characterization of HutZ. To determine
whether HutZ has heme binding or heme oxygenase activity, the HutZ
protein was expressed and purified as the apoprotein with no heme
bound . Reconstitution of the purified protein with heme resulted in a
protein with a Soret at 412 nm and visible bands at 541 and 575 nm
(Fig . 7) . The spectrum of HutZ closely resembles
that of the previously characterized heme binding protein ShuS from
Shigella dysenteriae (48) . The spectrum
suggests that the heme is a ferric six-coordinate low-spin heme in
which the proximal ligand to the heme is most likely a histidine . We
have recently characterized the heme-ShuS protein by magnetic
circular dichroism and shown that the heme in the ShuS complex is
coordinated by a histidine with a hydroxide ligand in the distal
position at pH 7.8 (A . Wilks, unpublished data) . The millimolar
extinction coefficient ( 412)
of the heme-HutZ complex was calculated to be 166 mM–1 .
|
FIG . 7 . Absorbance of the HutZ-heme complex . Purified apo-HutZ was
reconstituted with heme, and the absorbance spectrum was recorded.
|
|
The heme-HutZ complex was analyzed for HO activity with ascorbate or
the NADPH cytochrome P450 reductase system as previously described (30,
49, 56) . In the presence of either as a
source of reducing equivalents, formation of verdoheme was observed .
While verdoheme is an intermediate in the heme oxygenase-catalyzed
pathway to biliverdin, it can be formed as a result of nonspecific
action of hydrogen peroxide formed during the reaction . This
nonspecific reaction can be prevented by addition of catalase to the
reaction mixture . In the presence of catalase, the known heme
oxygenases catalyze reduction of the iron and binding of oxygen prior
to the formation of Fe3+-verdoheme and subsequently
biliverdin . In contrast, when catalase was added to the reaction
mixture, the heme-HutZ complex did not result in the formation of
either verdoheme or biliverdin .
HutZ is needed for growth at low iron concentrations following growth
with heme as the sole iron source. The ability of HutZ to bind heme
suggested that it might function as a heme storage protein . If this
is the case, we would predict that the hutZ vibB mutant would
have lower levels of internal iron stores than the vibB
parental strain following growth with heme as the sole iron source .
To test this, we diluted overnight cultures of the vibB::cam
mutant EWV104, the hutZ::kan vibB::cam mutant
EWV115, and EWV115 carrying hutZ on a plasmid into M9 medium
containing heme and the iron chelator EDDA and grew the cultures
overnight . The cultures were then diluted into M9 medium containing
EDDA, and growth was monitored . EWV104 and EWV115 carrying hutZ
on a plasmid grew slowly with a doubling time of approximately 3 h,
while EWV115 did not grow at all . This is evidence that EWV115 is
depleted of its internal iron stores (data not shown) .
The current model for heme transport in V . cholerae is shown
in Fig . 8 . In this model, heme is transported across the outer
membrane in a TonB-dependent manner by one of the three heme
receptors . HutBCD likely functions as a periplasmic binding
protein-dependent ABC transporter to transfer heme across the inner
membrane (24) .
|
FIG . 8 . Model for heme utilization in V . cholerae . Heme crosses
the outer membrane through one of three outer membrane receptors, HutA,
HutR, or HasR (14, 21), and this
transport requires the activity of one of the two TonB systems (24)
(not shown) . Heme is then transported across the inner membrane most
likely by the HutBCD transport system (24) . The fate
of the heme moiety following transport is not known, although at least
some of the heme is likely incorporated into cytochromes and other heme
proteins.
|
|
Although many of the proteins that transport heme into the cell have
been identified, the fate of heme after it enters the cell is not
well understood (42) . In principle, transported heme
could have one of three possible fates . It could be incorporated
directly into heme proteins, it could be degraded to release
the iron, or it could be stored for future use . It is known that in
V . cholerae the transported heme can be incorporated into
cytochromes and possibly other heme proteins, but neither heme
storage nor heme degradation has been demonstrated in this or a
related organism . An additional question is how heme moves from the
heme transport proteins in the membrane to heme-containing proteins
located throughout the cell . Since unbound heme is toxic and poorly
soluble in water, it is not anticipated that significant quantities
of heme would be freely diffusing through the cytoplasm . Either the
apo-heme proteins would have to be recruited to the heme transport
system or there must be a carrier to take the heme to these proteins .
As a soluble, heme-binding protein, HutZ has the properties
expected of a heme carrier or storage protein . Its role in heme
storage is supported by the reduced growth of the hutZ mutant
in iron-restricted medium following growth with heme as the sole iron
source . Furthermore, biochemical experiments have indicated that heme
is efficiently transferred from HutZ to the Neisseria heme
oxygenase HmuO (Wilks, unpublished) . This suggests a possible role of
HutZ in heme trafficking within the cell . We propose that HutZ may
function to bind the transported heme, storing it in a nontoxic and
bioavailable form . Then, in response to unknown cellular signals, the
heme could be transferred to cellular heme proteins as needed .
The presence of the hutWXZ operon on a plasmid conferred the
ability to grow with heme as the sole iron source on corynebacterial
hmuO mutants, and hutZ was required for this effect . This
suggested that HutZ could be a heme oxygenase, but purified HutZ did
not have detectible heme oxygenase activity . One possibility is
that HutZ binds heme and this sequesters the heme and prevents
heme toxicity . However, corynebacterial hmuO mutants are not
sensitive to high levels of heme, suggesting that lack of growth of
these mutants is due to lack of usable iron, rather than toxicity of
transported heme . Two additional possibilities are that the
corynebacterial strains have an second, extremely weak heme oxygenase
that is stimulated in the presence of HutZ and that HutZ allows the
cells to bypass the requirement for a heme oxygenase activity in heme
utilization . Either of these possibilities may have implications for
how organisms like V . cholerae use heme as a source of iron in
the absence of an apparent heme oxygenase homologue .
In the hutZ mutant, the ability to use heme was reduced but
not eliminated . It is possible that HutZ performs a nonessential
function that allows more efficient utilization of heme . Alternatively,
HutZ may perform an essential function, but an additional gene
encoding a similar function may be present . There is considerable
redundancy in the V . cholerae heme utilization genes . There
are three heme receptors, two TonB systems, and probably multiple
systems for the transport of heme across the inner membrane . At this
time, there is no candidate gene with a function redundant with
respect to that of hutZ . BLAST searches of the V . cholerae
genome sequence (12) have not revealed another ORF with
homology to HutZ . The S . dysenteriae ShuS protein binds heme
in a manner similar to that of HutZ (48),
suggesting that it might have a function similar to that of HutZ .
However, no ShuS homologue was identified in a BLAST search of the
V . cholerae genome . Little is known about proteins that are
involved in the trafficking of endogenously synthesized heme . It is
possible that any of the proteins that usually bind endogenously
synthesized heme could partially fulfill the role of HutZ .
Many of the characterized heme transport loci contain genes with
homology to hutWXZ . An ORF with homology with hemN was
first identified within the heme transport loci of S . dysenteriae
and E . coli O157:H7 (50), and additional hemN
homologues were later found linked to heme transport genes in V .
parahaemolyticus (26), V . vulnificus (3),
P . shigelloides (16), Y . pestis (28),
and V . cholerae (12) . Each of the loci listed
above also contains a homologue of hutX, but only the P .
shigelloides and the other Vibrio species loci contain a
hutZ homologue . Several other species contain a hutZ
homologue but lack a hutW and hutX homologue, and
Pasteurella multocida lacks a hutW homologue but has two
hutZ homologues and one hutX homologue (19) .
The significance of this diversity is not understood, but the
sequence conservation among these ORFs is comparable to the
conservation observed in heme receptors . Genetic analysis has not
indicated that hutW or hutX homologues are required for
heme utilization . It is not known whether this indicates that the
hutW and hutX homologues do not participate in heme
utilization or whether redundant functions are present .
Prior to this work, an effect of hutWXZ homologues was observed
in the following functional assay . When the P . shigelloides
heme transport genes were used to reconstruct heme transport in
E . coli, bacteria carrying clones that contained the heme
receptor, the tonB system, and the hutWXZ homologues (called
hugWXZ) used heme efficiently as an iron source . When the hugWXZ
genes were deleted from the plasmid, the strain only used heme
weakly and was sensitive to high levels of heme (16) . The
ORF(s) required was not identified . Although these data are
consistent with the findings reported here for the V . cholerae
hutWXZ genes, the hutZ mutant did not appear to be
sensitive to high concentrations of heme . This may be due to
differences in the genetic backgrounds of the V . cholerae hutZ
mutant and E . coli expressing heme utilization proteins from
plasmids .
We thank Doug Henderson and Alex Mey for helpful discussions and
critical reading of the manuscript and Carolyn Fisher and Stacey
Smith for technical assistance . We also thank Tom Elliott for
providing strains .
The work was supported by National Institutes of Health grants
AI50669 to S.M.P . and AI48551 to A.W .
* Corresponding author . Mailing address: Section of Molecular
Genetics and Microbiology, The University of Texas at Austin, 1 University
Station A5000, Austin, TX 78712-0162 . Phone: (512) 471-5204 . Fax: (512)
471-7088 . E-mail:
ewyckoff@mail.utexas.edu .
- Altschul, S . F., W . Gish, W . Miller, E . W . Myers, and D . J .
Lipman. 1990 . Basic local alignment search tool . J . Mol . Biol . 215:403-410.
- Blattner, F . R., G . I . Plunkett, C . A . Bloch, N . T . Perna, V .
Burland, M . Riley, J . Collado-Vides, J . D . Glasner, C . K . Rode, G . F . Mayhew,
J . Gregor, N . W . Davis, H . A . Kirkpatrick, M . A . Goeden, D . J . Rose, B . Mau,
and Y . Shao. 1997 . The complete genome sequence of Escherichia coli
K-12 . Science 277:1453-1474 .
- Chen, C . Y., K . M . Wu, Y . C . Chang, C . H . Chang, H . C . Tsai,
T . L . Liao, Y . M . Liu, H . J . Chen, A . B . Shen, J . C . Li, T . L . Su, C . P . Shao,
C . T . Lee, L . I . Hor, and S . F . Tsai. 2003 . Comparative genome analysis of
Vibrio vulnificus, a marine pathogen . Genome Res . 13:2577-2587 .
- Donnenberg, M . S., and J . B . Kaper. 1991 . Construction of
an eae deletion mutant of enteropathogenic Escherichia coli by
using a positive-selection vector . Infect . Immun . 59:4310-4317.
- Drazek, E . S., C . A . Hammack, and M . Schmitt. 2000 .
Corynebacterium diphtheriae genes required for acquisition of iron from haemin
and haemoglobin are homologous to ABC haemin transporters . Mol . Microbiol .
36:68-84.
- Fleischmann, R . D., M . D . Adams, O . White, R . A . Clayton, E .
F . Kirkness, A . R . Kerlavage, C . J . Bult, J . F . Tomb, B . A . Dougherty, J . M .
Merrick, et al. 1995 . Whole-genome random sequencing and assembly of
Haemophilus influenzae Rd . Science 269:496-512.
- Fuhrop, J . H., and K . M . Smith. 1975 . Laboratory methods,
p . 804-807 . In K . M . Smith (ed.), Porphyrins and metalloporphyrins .
Elsevier Scientific Publishing Co., New York, N.Y.
- Genco, C., and D . W . Dixon. 2001 . Emerging strategies in
microbial haem capture . Mol . Microbiol . 39:1-11.
- Griffiths, G . L., S . P . Sigel, S . M . Payne, and J . B .
Neilands. 1984 . Vibriobactin, a siderophore from Vibrio cholerae .
J . Biol . Chem . 259:383-385 .
- Hanahan, D. 1983 . Studies on transformation of
Escherichia coli with plasmids . J . Mol . Biol . 166:557-580.
- Hayashi, T., K . Makino, M . Ohnishi, K . Kurokawa, K . Ishii,
K . Yokoyama, C . G . Han, E . Ohtsubo, K . Nakayama, T . Murata, M . Tanaka, T .
Tobe, T . Iida, H . Takami, T . Honda, C . Sasakawa, N . Ogasawara, T . Yasunaga, S .
Kuhara, T . Shiba, M . Hattori, and H . Shinagawa. 2001 . Complete genome
sequence of enterohemorrhagic Escherichia coli O157:H7 and genomic
comparison with a laboratory strain K-12 . DNA Res . 8:11-22.
- Heidelberg, J . F., J . A . Eisen, W . C . Nelson, R . A . Clayton,
M . L . Gwinn, R . J . Dodson, D . H . Haft, E . K . Hickey, J . D . Peterson, L .
Umayam, S . R . Gill, K . E . Nelson, T . D . Read, H . Tettelin, D . Richardson, M .
Ermolaeva, J . Vamathevan, S . Bass, H . Qin, I . Dragoi, P . Sellers, L . McDonald,
T . Utterback, R . D . Fleishmann, W . C . Nierman, O . White, S . L . Salzberg, H . O .
Smith, R . R . Colwell, J . J . Mekalanos, J . C . Venter, and C . M . Fraser.
2000 . DNA sequence of both chromosomes of the cholera pathogen Vibrio
cholerae . Nature 406:477-483.
- Henderson, D . P. 1993 . Heme iron utilization in
Vibrio cholerae: genetics and role in virulence . Ph.D . dissertation . The
University of Texas, Austin.
- Henderson, D . P., and S . M . Payne. 1994 .
Characterization of the Vibrio cholerae outer membrane heme transport
protein HutA: sequence of the gene, regulation of expression, and homology to
the family of TonB-dependent proteins . J . Bacteriol . 176:3269-3277.
- Henderson, D . P., and S . M . Payne. 1993 . Cloning and
characterization of the Vibrio cholerae genes encoding the utilization
of iron from haemin and haemoglobin . Mol . Microbiol . 7:461-469.
- Henderson, D . P., E . E . Wyckoff, C . E . Rashidi, H . Verlei,
and A . L . Oldham. 2001 . Characterization of the Plesiomonas
shigelloides genes encoding the utilization of iron from heme . J .
Bacteriol . 183:2715-2723 .
- Makino, K., K . Oshima, K . Kurokawa, K . Yokoyama, T . Uda, K .
Tagomori, Y . Iijima, M . Najima, M . Nakano, A . Yamashita, Y . Kubota, S . Kimura,
T . Yasunaga, T . Honda, H . Shinagawa, M . Hattori, and T . Iida. 2003 . Genome
sequence of Vibrio parahaemolyticus: a pathogenic mechanism distinct
from that of V . cholerae . Lancet 361:743-749.
- Marck, C. 1988 . "DNA strider": a "C" program for the
fast analysis of DNA and protein sequences on the Apple Macintosh family of
computers . Nucleic Acids Res . 16:1829-1836.
- May, B . J., Q . Zhang, L . L . Li, M . L . Paustian, T . S .
Whittam, and V . Kapur. 2001 . Complete genomic sequence of Pasteurella
multocida, Pm70 . Proc . Natl . Acad . Sci . USA 98:3460-3465 .
- Menard, R., P . J . Sansonetti, and C . Parsot. 1993 .
Nonpolar mutagenesis of the ipa genes defines IpaB, IpaC, and IpaD as
effectors of Shigella flexneri entry into epithelial cells . J .
Bacteriol . 175:5899-5906.
- Mey, A . R., and S . M . Payne. 2001 . Haem utilization in
Vibrio cholerae involves multiple TonB-dependent haem receptors . Mol .
Microbiol . 42:835-849.
- Mey, A . R., E . E . Wyckoff, A . Oglesby, E . Rab, R . K . Taylor,
and S . M . Payne. 2002 . Identification of the Vibrio cholerae
enterobactin receptors VctA and IrgA: IrgA is not required for virulence .
Infect . Immun . 70:3419-3426 .
- Miller, V . L., and J . J . Mekalanos. 1988 . A novel
suicide vector and its use in construction of insertion mutations:
osmoregulation of outer membrane proteins and virulence determinants in
Vibrio cholerae requires toxR . J . Bacteriol . 170:2575-2583.
- Occhino, D . A., E . E . Wyckoff, D . P . Henderson, T . J . Wrona,
and S . M . Payne. 1998 . Vibrio cholerae iron transport: haem
transport genes are linked to one of two sets of tonB, exbB,
exbD genes . Mol . Microbiol . 29:1493-1507.
- Olson, S . A. 1994 . MacVector: an integrated sequence
analysis program for the Macintosh . Methods Mol . Biol . 25:195-201.
- O'Malley, S . M., S . L . Mouton, D . A . Occhino, M . T . Deanda,
J . R . Rashidi, K . L . Fuson, C . E . Rashidi, M . Y . Mora, S . M . Payne, and D . P .
Henderson. 1999 . Comparison of the heme iron utilization systems of
pathogenic vibrios . J . Bacteriol . 181:3594-3598 .
- Parkhill, J., B . W . Wren, K . Mungall, J . M . Ketley, C .
Churcher, D . Basham, T . Chillingworth, R . M . Davies, T . Feltwell, S . Holroyd,
K . Jagels, A . V . Karlyshev, S . Moule, M . J . Pollen, C . W . Penn, M . A . Quall,
M.-A . Rajandream, K . M . Rutherford, A . H . M . van Vliet, S . Whitehead, and B .
G . Barrell. 2000 . The genome sequence of the food-borne pathogen
Campylobacter jejuni reveals hypervariable sequences . Nature 403:665-668.
- Parkhill, J., B . W . Wren, N . R . Thomson, R . W . Titball, M .
T . Holden, M . B . Prentice, M . Sebaihia, K . D . James, C . Churcher, K . L .
Mungall, S . Baker, D . Basham, S . D . Bentley, K . Brooks, A . M . Cerdeno-Tarraga,
T . Chillingworth, A . Cronin, R . M . Davies, P . Davis, G . Dougan, T . Feltwell,
N . Hamlin, S . Holroyd, K . Jagels, A . V . Karlyshev, S . Leather, S . Moule, P . C .
Oyston, M . Quail, K . Rutherford, M . Simmonds, J . Skelton, K . Stevens, S .
Whitehead, and B . G . Barrell. 2001 . Genome sequence of Yersinia pestis,
the causative agent of plague . Nature 413:523-527.
- Perna, N . T., G . Plunkett III, V . Burland, B . Mau, J . D .
Glasner, D . J . Rose, G . F . Mayhew, P . S . Evans, J . Gregor, H . A . Kirkpatrick,
G . Posfai, J . Hackett, S . Klink, A . Boutin, Y . Shao, L . Miller, E . J .
Grotbeck, N . W . Davis, A . Lim, E . T . Dimalanta, K . D . Potamousis, J . Apodaca,
T . S . Anantharaman, J . Lin, G . Yen, D . C . Schwartz, R . A . Welch, and F . R .
Blattner. 2001 . Genome sequence of enterohaemorrhagic Escherichia coli
O157:H7 . Nature 409:529-533.
- Ratliff, M., W . Zhu, R . Deshmukh, A . Wilks, and I .
Stojiljkovic. 2001 . Homologues of neisserial heme oxygenase in
gram-negative bacteria: degradation of heme by the product of the pigA
gene of Pseudomonas aeruginosa . J . Bacteriol . 183:6394-6403 .
- Rogers, H . J. 1973 . Iron-binding catechols and virulence
in Escherichia coli . Infect . Immun . 7:445-456.
- Rogers, M . B., J . A . Sexton, G . J . DeCastro, and S . B .
Calderwood. 2000 . Identification of an operon required for ferrichrome
iron utilization in Vibrio cholerae . J . Bacteriol . 182:2350-2353 .
- Schmitt, M . P. 1997 . Utilization of host iron sources of
Corynebacterium diphtheriae: identification of a gene whose product is
homologous to eukaryotic heme oxygenases and is required for acquisition of
iron from heme and hemoglobin . J . Bacteriol . 179:838-845.
- Schuller, D . J., W . Zhu, I . Stojiljkovic, A . Wilks, and T .
L . Poulos. 2001 . Crystal structure of heme oxygenase from the
gram-negative pathogen Neisseria meningitidis and a comparison with
mammalian heme oxygenase-1 . Biochemistry 40:11552-11558.
- Seliger, S . S., A . R . Mey, A.-M . Valle, and S . M . Payne.
2001 . The two TonB systems in Vibrio cholerae: redundant and specific
functions . Mol . Microbiol . 39:801-812.
- Sigel, S . P., and S . M . Payne. 1982 . Effect of iron
limitation on growth, siderophore production and expression of outer membrane
proteins of Vibrio cholerae . J . Bacteriol . 150:148-155.
- Skaar, E . P., A . H . Gaspar, and O . Schneewind. 2004 .
IsdG and IsdI, heme-degrading enzymes in the cytoplasm of Staphylococcus
aureus . J . Biol . Chem . 279:436-443 .
- Sofia, H . J., G . Chen, B . G . Hetzler, J . F . Reyes-Spindola,
and N . E . Miller. 2001 . Radical SAM: a novel protein superfamily linking
unresolved steps in familiar biosynthetic pathways with radical mechanisms:
functional characterization using new analysis and information visualization
methods . Nucleic Acids Res . 29:1097-1106 .
- Stoebner, J . A., and S . M . Payne. 1988 . Iron-regulated
hemolysin production and utilization of heme and hemoglobin by Vibrio
cholerae . Infect . Immun . 56:2891-2895.
- Stojiljkovic, I., and K . Hantke. 1992 . Hemin uptake
system of Yersinia enterocolitica: similarities with other
TonB-dependent systems in gram-negative bacteria . EMBO J . 11:4359-4367.
- Stojiljkovic, I., and K . Hantke. 1994 . Transport of
haemin across the cytoplasmic membrane through a haemin-specific periplasmic
binding-protein-dependent transport system in Yersinia enterocolitica .
Mol . Microbiol . 13:719-732.
- Stojiljkovic, I., and D . Perkins-Balding. 2002 .
Processing of heme and heme-containing proteins by bacteria . DNA Cell Biol .
21:281-295.
- Studier, F . W., and B . A . Moffatt. 1986 . Use of
bacteriophage T7 RNA polymerase to direct selective high-level expression of
cloned genes . J . Mol . Biol . 189:113-130.
- Tomb, J . F., O . White, A . R . Kerlavage, R . A . Clayton, G . G .
Sutton, R . D . Fleischmann, K . A . Ketchum, H . P . Klenk, S . Gill, B . A .
Dougherty, K . Nelson, J . Quackenbush, L . Zhou, E . F . Kirkness, S . Peterson, B .
Loftus, D . Richardson, R . Dodson, H . G . Khalak, A . Glodek, K . McKenney, L . M .
Fitzegerald, N . Lee, M . D . Adams, J . C . Venter, et al. 1997 . The complete
genome sequence of the gastric pathogen Helicobacter pylori . Nature
388:539-547.
- Troup, B., C . Hungerer, and D . Jahn. 1995 . Cloning and
characterization of the Escherichia coli hemN gene encoding the
oxygen-independent coproporphyrinogen III oxidase . J . Bacteriol . 177:3326-3331.
- Wandersman, C., and I . Stojiljkovic. 2000 . Bacterial
heme sources: the role of heme, hemoprotein receptors and hemophores . Curr .
Opin . Microbiol . 3:215-220.
- Wang, R . F., and S . R . Kushner. 1991 . Construction of
versatile low-copy-number vectors for cloning, sequencing and gene expression
in Escherichia coli . Gene 100:195-199.
- Wilks, A. 2001 . The ShuS protein of Shigella
dysenteriae is a heme-sequestering protein that also binds DNA . Arch .
Biochem . Biophys . 387:137-142.
- Wilks, A., and M . P . Schmitt. 1998 . Expression and
characterization of a heme oxygenase (HmuO) from Corynebacterium
diphtheriae . J . Biol . Chem . 273:837-841 .
- Wyckoff, E . E., D . Duncan, A . G . Torres, M . Mills, K . Maase,
and S . M . Payne. 1998 . Structure of the Shigella dysenteriae haem
transport locus and its phylogenetic distribution in enteric bacteria . Mol .
Microbiol . 28:1139-1152.
- Wyckoff, E . E., S . L . Smith, and S . M . Payne. 2001 . VibD
and VibH are required for late steps in vibriobactin biosynthesis in Vibrio
cholerae . J . Bacteriol . 183:1830-1834 .
- Wyckoff, E . E., J . A . Stoebner, K . E . Reed, and S . M . Payne.
1997 . Cloning of a Vibrio cholerae vibriobactin gene cluster:
identification of genes required for early steps in siderophore biosynthesis .
J . Bacteriol . 179:7055-7062.
- Wyckoff, E . E., A.-M . Valle, S . L . Smith, and S . M . Payne.
1999 . A multifunctional ABC transporter system from Vibrio cholerae
transports vibriobactin and enterobactin . J . Bacteriol . 181:7588-7596 .
- Xu, K., J . Delling, and T . Elliott. 1992 . The genes
required for heme synthesis in Salmonella typhimurium include those
encoding alternative functions for aerobic and anaerobic coproporphyrinogen
oxidation . J . Bacteriol . 174:3953-3963.
- Zhu, W., D . J . Hunt, A . Richardson, and I . Stojiljkovic.
2000 . Use of heme compounds as iron sources by pathogenic neisseriae requires
the product of the hemO gene . J . Bacteriol . 182:439-447 .
- Zhu, W., A . Wilks, and I . Stojiljkovic. 2000 .
Degradation of heme in gram-negative bacteria: the product of the hemO
gene of neisseriae is a heme oxygenase . J . Bacteriol . 182:6783-6790 .
Free Online Full-text Article
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
,
|