Microbiology Reader
Equipment to run microbiology work automatically

Growth Curves of any strain.
Microbiological calculations.

Microbiology Home
Microbioloy Reader
Growth Curves
Photo Album
Microorganisms
Software
Download
Purchasing
Contact Us



Epidemiol Mikrobiol Imunol, 1994 May, 43(2), 75 - 8
{Comparison of susceptibility to Legionnaires' disease in small laboratory animals}; Spalekova M et al.; The authors tested under laboratory conditions the susceptibility of five species of small laboratory animals (guinea pigs, rats, syrian and chinese hamsters and mice) to legionella infection after intraperitoneal inoculation with 10(8) cells of nine strains of legionellae of the Legionella pneumophila species . The suitability of the animal model was evaluated on the basis of clinical manifestations of the infection, pathological macroscopic changes and detection of legionellae from animal organs on CYE (Charcoal-Yeast Extract) media . The results of the analysis of experimental animal infection revealed that guinea pigs are the most suitable experimental animals for investigations and the diagnosis of legionellosis.

Plant J, 1994 May, 5(5), 735 - 44
Analysis of clones carrying repeated DNA sequences in two YAC libraries of Arabidopsis thaliana DNA; Schmidt R et al.; YAC clones carrying repeated DNA sequences from the Arabidopsis thaliana genome have been characterized in two widely used Arabidopsis YAC libraries, the EG library and the EW library . Ribosomal, chloroplast and the paracentromeric repeat sequences are differentially represented in the two libraries . The coordinates of YAC clones hybridizing to these sequences are given . A high proportion of EG YAC clones were classified as containing chimaeric inserts because individual clones carried unique sequences and repetitive sequences originating from different locations in the genome . None of the EW YAC clones analysed were chimaeric in this way . YAC clones carrying tandemly repeated sequences, such as the paracentromeric or rDNA sequences, exhibited a high degree of instability . These observations need to be taken into account when using these libraries in the development of a physical map of the Arabidopsis genome and in chromosome walking experiments.

Plant Mol Biol, 1994 May, 25(2), 271 - 81
Molecular features, processing and import of the Rieske iron-sulfur protein from potato mitochondria; Emmermann M et al.; The mitochondrial iron-sulfur protein (also termed Rieske iron-sulfur protein) of cytochrome c reductase was purified from potato tubers and identified with heterologous antibodies . The sequences of the N-terminus of this 25 kDa protein and of an internal peptide were determined to design oligonucleotide mixtures for screening a cDNA library . One class of cDNA clones containing an open reading frame of 265 amino acids was isolated . The encoded protein contains the peptide sequences of the 25 kDa protein and shares about 50% sequence identity with the Rieske iron-sulfur proteins from fungi and around 43% with those from mammals . In vitro transcription and translation of the cDNA reveals that the iron-sulfur protein is made as a larger precursor of 30 kDa which is processed by the cytochrome c reductase/processing peptidase complex from potato . The processing product obtained after in vitro processing has the same size as the mature protein imported into isolated mitochondria . The presequence, which targets the protein to the organelle, is 53 amino acids long and has molecular features different from those found in presequences of fungal iron-sulfur proteins, which are processed in two steps . Our results indicate that, unlike in yeast and Neurospora, the presequence of the iron-sulfur protein from potato is removed by a single processing enzyme in one step.

Plant Mol Biol, 1994 May, 25(2), 217 - 27
Differential accumulation of S-adenosylmethionine synthetase transcripts in response to salt stress; Espartero J et al.; NaCl stress causes the accumulation of several mRNAs in tomato seedlings . An upregulated cDNA clone, SAM1, was found to encode a S-adenosyl-L-methionine synthetase enzyme (AdoMet synthetase) . Expression of the cDNA SAM1 in a yeast mutant lacking functional SAM genes resulted in high AdoMet synthetase activity and AdoMet accumulation . We show that tomato plants contain at least four SAM isogenes . Clones corresponding to isogenes SAM2 and SAM3 have also been isolated and sequenced . They encode predicted polypeptides 95% and 92% identical, respectively, to the SAM1-encoded AdoMet Synthetase . RNA hybridization analysis showed a differential response of SAM genes to salt and other stress treatments . SAM1 and SAM3 mRNAs accumulated in the root in response to NaCl, mannitol or ABA treatments . SAM1 mRNA accumulated also in leaf tissue . These increases of mRNA level were apparent as soon as 8 h after the initiation of the salt treatment and were maintained for at least 3 days . A possible role for AdoMet synthetases in the adaptation to salt stress is discussed.

Biophys Chem, 1994 May, 50(1-2), 169 - 81
Effects of DNA topology in the interaction with histone octamers and DNA topoisomerase I; Negri R et al.; Several simple proteins and complex protein systems exist which do not recognize a defined sequence but--rather--a specific DNA conformation . We describe experiments and principles for two of these systems: nucleosomes and eukaryotic DNA topoisomerase I . Evidences are summarized that describe the effects of negative DNA supercoiling on nucleosome formation and the influence of DNA intrinsic curvature on their localization . The function of the DNA rotational information in nucleosome positioning and in the selection of multiple alternative positions on the same helical phase are described . This function suggests a novel genetic regulatory mechanism, based on nucleosome mobility and on the correlation between in vitro and in vivo positions . We observe that the same rules that determine the in vitro localization apply to the in vivo nucleosome positioning, as determined by a technique that relies on the use of nystatin and on the import of active enzymes in living yeast cells . The sensitivity of DNA topoisomerase I to the topological condition of the DNA substrate is reviewed and discussed taking into account recent experiments that describe the effect of the DNA tridimensional context on the reaction . These topics are discussed in the following order: (i) Proteins that look for a consensus DNA conformation; (ii) Nucleosomes; (iii) Negative supercoiling and nucleosomes; (iv) DNA curvature/bending and nucleosomes; (v) Multiple positioning; (vi) Multiple nucleosomes offer a contribution to the solution of the linking number paradox; (vii) Rotational versus translational information; (viii) A regulatory mechanism; (ix) DNA topoisomerase I; (x) DNA topoisomerase I and DNA supercoiling: a regulation by topological feedback; (xi) DNA topoisomerase I and DNA curvature; (xii) The in-and-out problem in the accessibility of DNA information; (xiii) The integrating function of the free energy of supercoiling.

Eur J Cancer B Oral Oncol, 1994 May, 30B(3), 186 - 90
Occurrence of corrugated white patch lesions on lateral border of tongue in lymphoma patients during cytostatic treatment; Laine PO; The question of whether or not there was an association between immunosuppression and occurrence of corrugated white patch lesions on the lateral border of the tongue was studied in 79 patients being treated for non-Hodgkin lymphoma or Hodgkin's disease . The mouths of 55 patients (mean age 47.8 years, 34 males, 21 females) were examined during periods of chemotherapy . All patients were HIV-seronegative . White non-removable lesions on the lateral margins of the tongue were noted in 27 patients (42.8%) 74 days after commencement of chemotherapy and 10 days after termination of medication . In 12 cases (44.4%) the lesions were bilateral . Epstein-Barr virus (EBV) DNA was found by gene amplification using polymerase chain reaction (PCR) in one of the two biopsy samples taken . No white lesion on the lateral border of tongue had been seen in any patient before treatment, nor were any evident 1 year after treatment . Leucocyte counts were significantly (P = 0.001) lower when the lesion was present than when it was not detected . Before chemotherapy, 70.4% of patients with lesions and 47.6% of patients without lesions had positive salivary yeast cultures . Yeasts could be cultured from the saliva of 80.5% of patients when the lesions were present . In 2 patients clinical oral candidiasis was diagnosed at the time of the lesion . The study revealed a correlation between the occurrence of corrugated white, non-removable lesions of the lateral borders of the tongue, high salivary yeast counts and leucocytopenia.(ABSTRACT TRUNCATED AT 250 WORDS)

Genomics, 1994 May 1, 21(1), 144 - 9
Gene order is conserved within the human chromosome 21 linkage group on mouse chromosome 10; Irving NG et al.; One hundred progeny from each of two intersubspecific mouse backcrosses were used to construct a comparative genetic map of a region of mouse chromosome 10 (MMU10) that is homologous to the distal tip of the long arm of human chromosome 21 (HSA21) . The analysis included five genes and three simple sequence repeat markers, two of which flanked the HSA21-homologous cluster on either side . Analysis of 200 backcross progeny detected at least one crossover between each pair of adjacent genes and demonstrated that the proximal to distal orientation of the cluster was reversed between human and mouse . The order was determined to be Fyn-1-D10Mit20-S100b-Col6a1-Itgb2-Pfkl+ ++/D10Mit7-D10Mit11 . Comparative mapping supports the order of corresponding markers on HSA21 determined using pulsed-field gel electrophoresis and radiation hybrid line data . However, sequence tagged site content mapping of human yeast artificial chromosomes (YACs) yielded conflicting data on the relative positions of human COL6A1 and S100B on HSA21 . This discrepancy was resolved here by demonstrating that several key YACs used in the human contig analysis were mistyped for S100B . The murine map reported here provides a scaffold for construction of physical maps and yeast artificial chromosome contigs that will be useful in the development of mouse models for the study of Down syndrome.

Hum Mol Genet, 1994 May, 3(5), 735 - 40
BLOCK-based PCR markers to find gene family members in human and comparative genome analysis; D'Esposito M et al.; Degenerate primer pairs that include consensus sequences of evolutionary conserved portions of protein families (BLOCKs or ancient conserved regions) can be used to screen by polymerase chain reaction (PCR) for cognate cDNAs and YACs through much of phylogeny . Nine such primer pairs were developed, and five with sites on human chromosomes 7 or X were shown to identify YACs from chromosome-specific locations, including a candidate for a new zinc finger gene in Xq28 . When linked to contig-based genomic maps, such BLOCK-based PCR assays may provide a route to recover the members and study the development of families containing up to 40% of genes, in genomes as diverse as humans, nematodes, and yeast.

Rev Inst Med Trop Sao Paulo, 1994 May-Jun, 36(3), 225 - 30
{Comparison between CSF samples from AIDS and non AIDS patients with neurocryptococcosis}; dos Reis-Filho JB et al.; Neurocryptococcosis was a rare nervous system infection . With the rising number of patients with AIDS it became a very frequent disease . This infection is supposed to infect patients with some kind of immunodeficiency and the CSF alterations often simulate tuberculous meningitis . The purpose of this research was to compare the CSF changes in AIDS and non-AIDS patients with meningoencephalitis caused by Cr . neoformans . There were analysed 41 CSF samples from non-AIDS patients with neurocryptococcosis and 23 CSF samples from AIDS patients with neurocryptococcosis . The results of this research allowed to conclude that the inflammatory changes in the CSF from AIDS patients showed a lower intensity compared to those non-AIDS patients . These results showed as well, that the CSF samples from non-AIDS patients always revealed some changes besides the yeast cells . In some samples of AIDS patients, however the unique change was the presence of the yeast . It was demonstrated also, that the presence of Cr . neoformans in CSF, not accompanied by any other change, may suggest that is a patient with AIDS . In non-AIDS patients CSF alterations often simulates tuberculous meningitis . However these alterations were rare in AIDS patients . The yeast cells were more numerous in CSF samples from AIDS patients than in those from non-AIDS patients.

Hum Mol Genet, 1994 May, 3(5), 779 - 85
A 2.8 Mb YAC contig in 11q12-q13 localizes candidate genes for atopy: Fc epsilon RI beta and CD20; Stafford AN et al.; An important locus for Atopy (familial asthma, hay fever and eczema) has been localized to the 11q12-q13 region with the minimum recombination fraction around the CD20 gene . We have constructed a 2.8 megabase (Mb) Yeast Artificial Chromosome (YAC) contig of the candidate region using 15 STSs . A total of seven genes have been mapped within this interval in the order cen-OSBP-TCN1-GIF-Fc epsilon RI beta-CD20-CD5-PGA-q(ter) and can be covered by a minimum of eight YAC clones . Contig integrity was assayed with fluorescence in-situ hybridization (FISH) and the mapping of YAC ends on somatic cell and radiation hybrid panels . A long range restriction map of the contig has been constructed to establish the order of and distance between loci . Two promising candidates for the atopy locus, the beta subunit of the high affinity immunoglobulin E receptor (Fc epsilon RI beta) and CD20, a molecule involved in B cell differentiation, have been placed within the contig.

Anal Biochem, 1994 May 1, 218(2), 436 - 43
Electrochemically active DNA probes: detection of target DNA sequences at femtomole level by high-performance liquid chromatography with electrochemical detection; Takenaka S et al.; Electrochemically active DNA probes were prepared by linking a ferrocene unit with 5'-aminohexyl-terminated oligonucleotides . The DNA sequences of probes 5a, 5b, and 5c were 5'-T12-3', 5'-T20-3', and 5'-TGCAG TTCCG GTGGC TGATC-3', respectively . Probe 5a could form a complex selectively with a single-strand poly(A) and a double-strand DNA fragment containing an A13 sequence and these complexes could be detected at femtomole levels by an electrochemical detector (ECD) on HPLC . The observed ECD response was proportional to the amount of the complex over the range 20-100 fmol . Probe 5c was capable of detecting femtomole levels of a restriction DNA fragment having oncogene v-myc . Moreover, probe 5b was able to detect picogram levels of mRNA taken from rat brain or yeast total cellular RNA . This proves that the electrochemically active DNA probes are useful in analyzing traces of DNA and RNA carrying the complementary sequence.

Genes Chromosomes Cancer, 1994 May, 10(1), 26 - 9
Deletion of a common region on the long arm of chromosome 6 in acute lymphoblastic leukaemia; Menasce LP et al.; We have characterised a region of deletion on the long arm of chromosome 6 (6q) in six cases of acute lymphoblastic leukaemia, by fluorescence in situ hybridisation, using a series of YAC clones which map to 6q . Conventional cytogenetic analysis of four of these cases had been interpreted as showing terminal deletions of 6q . We demonstrated by FISH that in all cases the deletions were interstitial . D6S246 (6q16.3) was the only marker which was missing in all six cases, indicating a common region of deletion between the markers M6P1 at 6q14-15 and FYN at 6q21 . Our results suggest the presence of a tumour suppressor gene within this interval.

Cell Tissue Res, 1994 May, 276(2), 213 - 21
Cytokeratin 18 is an M-cell marker in porcine Peyer's patches; Gebert A et al.; The intermediate filaments of the dome epithelium of porcine Peyer's patches were studied by immunohistochemistry . The labelling patterns of monospecific antibodies directed against cytokeratins 8, 18 and 19 differed considerably . About 40% of the dome epithelial cells were intensely labelled by three different anti-cytokeratin 18 antibodies, indicating that large amounts of cytokeratin 18 are present in these cells . In order to verify that these cytokeratin-18-immunoreactive cells were M-cells, uptake studies using fluorescein-labelled yeast particles were performed . Numerous yeast particles were found exclusively in dome epithelial cells that were highly positive for cytokeratin 18, thus representing M-cells . In contrast, the content of cytokeratin 19 in M-cells was lower than that in neighbouring enterocytes . The labelling intensity of cytokeratin 8 did not differ between M-cells and enterocytes . In addition, the absence of vimentin and desmin from the dome epithelium of porcine Peyer's patches was demonstrated . The results show (1) that porcine M-cells differ from enterocytes in the composition of their cytoskeleton, (2) that cytokeratin 18 is a useful marker for detecting porcine M-cells and (3) that this marker directly correlates with M-cell function.

Biochem Biophys Res Commun, 1994 Apr 29, 200(2), 966 - 72
Strand scission in DNA induced by S-nitrosothiol with hydrogen peroxide; Park JW et al.; Strand breaks can be produced in pBluescript plasmid DNA by S-nitrosothiol and H2O2 in the presence of a metal chelator, diethylenetriaminepentaacetic acid . S-Nitrosothiols with a wide range of stability were found to be active as a DNA cleaver in the presence of H2O2 . Strand breaks were temperature dependent, occurring more rapidly at higher temperature . Sodium azide and mannitol inhibited S-nitrosothiol/H2O2-induced strand breaks in DNA . Catalase inhibited damage to DNA in a concentration-dependent manner whereas both superoxide dismutase and a yeast protector protein did not prevent damage to DNA . It is suggested that observed strand breaks in DNA are mediated by hydroxyl radicals arising from the reaction between H2O2 and thiyl radicals generated by homolytic decomposition of S-nitrosothiol.

Proc Natl Acad Sci U S A, 1994 Apr 26, 91(9), 3593 - 7
A recombinant bisphosphoglycerate mutase variant with acid phosphatase homology degrades 2,3-diphosphoglycerate; Garel MC et al.; To date no definite and undisputed treatment has been found for sickle cell anemia, which is characterized by polymerization of a deoxygenated hemoglobin mutant (HbS) giving rise to deformed erythrocytes and vasoocclusive complications . Since the erythrocyte glycerate 2,3-bisphosphate (2,3-DPG) has been shown to facilitate this polymerization, one therapeutic approach would be to decrease the intraerythrocytic level of 2,3-DPG by increasing the phosphatase activity of the bisphosphoglycerate mutase (BPGM; 3-phospho-D-glycerate 1,2-phosphomutase, EC 5.4.2.4) . For this purpose, we have investigated the role of Gly-13, which is located in the active site sequence Arg9-His10-Gly11-Glu12-Gly13 in human BPGM . This sequence is similar to the Arg-His-Gly-Xaa-Arg* sequence of the distantly related acid phosphatases, which catalyze as BPGM similar phosphoryl transfers but to a greater extent . We hypothesized that the conserved Arg* residue in acid phosphatase sequences facilitates the phosphoryl transfer . Consequently, in human BPGM, we replaced by site-directed mutagenesis the corresponding amino acid residue Gly13 with an Arg or a Lys . In another experiment, we replaced Gly13 with Ser, the amino acid present at the corresponding position of the homologous yeast phosphoglycerate mutase (D-phosphoglycerate 2,3-phosphomutase, EC 5.4.2.1) . Mutation of Gly13 to Ser did not modify the synthase activity, whereas the mutase and the phosphatase were 2-fold increased or decreased, respectively . However, replacing Gly13 with Arg enhanced phosphatase activity 28.6-fold, whereas synthase and mutase activities were 10-fold decreased . The presence of a Lys in position 13 gave rise to a smaller increase in phosphatase activity (6.5-fold) but an identical decrease in synthase and mutase activities . Taken together these results support the hypothesis that a positively charged amino acid residue in position 13, especially Arg, greatly activates the phosphoryl transfer to water . These results also provide elements for locating the conserved Arg* residue in the active site of acid phosphatases and facilitating the phosphoryl transfer . The implications for genetic therapy of sickle cell disease are discussed.

J Mol Biol, 1994 Apr 22, 238(1), 128 - 30
Crystallization and preliminary X-ray analysis of phenol hydroxylase from Trichosporon cutaneum; Enroth C et al.; Recombinant phenol hydroxylase from the soil yeast Trichosporon cutaneum has been crystallized with PEG 4000 as precipitant . The crystals are monoclinic, space group P2(1) with cell dimensions a = 101.8 A, b = 153.0 A, c = 116.0 A and beta = 114.8 degrees . The crystal asymmetric unit most likely contains two dimers of phenol hydroxylase corresponding to a packing density in the crystals of 2.54 A 3/Da . The self-rotation function is consistent with the packing of two dimers in the asymmetric unit . The observed diffraction pattern extends beyond 2.8 A resolution and the crystals are well suited for structural analysis by X-ray diffraction methods.

Eur J Biochem, 1994 Apr 15, 221(2), 847 - 54
Inhibition and activation studies on sheep liver sorbitol dehydrogenase; Lindstad RI et al.; Reversible inhibition and activation, as well as protection against affinity labelling with DL-2-bromo-3-(5-imidazolyl)propionic acid, of sheep liver sorbitol dehydrogenase have been studied . The results presented are discussed in terms of enzyme active-site properties and may have potential applications for drug design . Kinetics with mainly sorbitol competitive inhibitors reveals that aliphatic thiols are generally the most potent inhibitors of enzyme activity . Inhibition and inactivation by heterocyclics parallel that seen previously with sorbitol dehydrogenase from other sources as well as with alcohol dehydrogenase from yeast . However, there are significant differences in relation to the structurally similar horse liver alcohol dehydrogenase, as the catalytic zinc of sorbitol dehydrogenase is more easily removed by chelating molecules . Several aldose reductase inhibitors are shown to also inhibit sorbitol dehydrogenase, but at concentrations unlikely to be reached clinically . Enzyme activation has been observed with various compounds, in particular halo-alcohols and detergents . Several inhibitors provide competitive protection against enzyme inactivation by DL-2-bromo-3-(5-imidazolyl)propionic acid . This enables the dissociation constants for binary enzyme-inhibitor complexes to be determined . NADH protects noncompetitively against inactivation . The presence of some binary and ternary enzyme-NADH complexes is indicated from fluorescence emission spectra, as a shift in the fluorescence maximum and intensity is observed due to their formation.

Biochem Biophys Res Commun, 1994 Apr 15, 200(1), 202 - 5
The putative fifth human serum amyloid A protein (SAA)-related gene "SAA5" is defined by SAA3; Sellar GC et al.; The four well characterised members of the human serum amyloid A protein (SAA) gene family are clustered on chromosome 11p15.1 . The acute phase SAA genes, SAA1 and SAA2, are hyperinducible in response to inflammatory stimuli, whereas SAA4 is only minimally induced, and SAA3 is a pseudogene . We recently demonstrated that the GSAA4 sequence, reported by others (Sack, G.H . Jr . and Talbot, C.C . Jr., 1992 . Biochem . Biophys . Res . Comm . 183, 362-366), and misidentified as corresponding to the SAA4 locus, maps to the 11p15 region and speculated that it may be in close proximity to a distinct fifth SAA locus: "SAA5" . In this report we have used vectorette PCR in combination with direct sequencing and computer based homology searches of the nucleotide sequence databases to establish that the putative fifth SAA-related locus, "SAA5", is defined by SAA3 and therefore does not represent a distinct SAA gene.

Structure, 1994 Apr 15, 2(4), 293 - 308
The sequence, crystal structure determination and refinement of two crystal forms of lipase B from Candida antarctica; Uppenberg J et al.; BACKGROUND: Lipases constitute a family of enzymes that hydrolyze triglycerides . They occur in many organisms and display a wide variety of substrate specificities . In recent years, much progress has been made towards explaining the mechanism of these enzymes and their ability to hydrolyze their substrates at an oil-water interface . RESULTS: We have determined the DNA and amino acid sequences for lipase B from the yeast Candida antarctica . The primary sequence has no significant homology to any other known lipase and deviates from the consensus sequence around the active site serine that is found in other lipases . We have determined the crystal structure of this enzyme using multiple isomorphous replacement methods for two crystal forms . Models for the orthorhombic and monoclinic crystal forms of the enzyme have been refined to 1.55 A and 2.1 A resolution, respectively . Lipase B is an alpha/beta type protein that has many features in common with previously determined lipase structures and other related enzymes . In the monoclinic crystal form, lipid-like molecules, most likely beta-octyl glucoside, can be seen close to the active site . The behaviour of these lipid molecules in the crystal structure has been studied at different pH values . CONCLUSION: The structure of Candida antarctica lipase B shows that the enzyme has a Ser-His-Asp catalytic triad in its active site . The structure appears to be in an 'open' conformation with a rather restricted entrance to the active site . We believe that this accounts for the substrate specificity and high degree of stereospecificity of this lipase.

Proc Natl Acad Sci U S A, 1994 Apr 12, 91(8), 3151 - 5
Mutational analysis of the N-terminal topogenic signal of watermelon glyoxysomal malate dehydrogenase using the heterologous host Hansenula polymorpha; Gietl C et al.; We have studied the significance of the N-terminal presequence of watermelon (Citrullus vulgaris) glyoxysomal malate dehydrogenase {gMDH; (S)-malate:NAD+ oxidoreductase; EC 1.1.1.37} in microbody targeting . The yeast Hansenula polymorpha was used as heterologous host for the in vivo expression of various genetically altered watermelon MDH genes, whose protein products were localized by immunocytochemical techniques . It is shown that the presequence of gMDH is essential and sufficient for peroxisomal targeting; it can target the mature part of the mitochondrial MDH to microbodies, whereas deletion of the presequence results in accumulation of the mature form of gMDH in the cytosol . Alignment of the N termini of several peroxisomal proteins that are assumed to contain a peroxisomal targeting signal at the N terminus (PTS2) suggested the consensus seqence RL-X5-HL . A similar motif is present in the presequence of watermelon gMDH--namely, 10RI-X5-17HL . Mutational analysis revealed that substitutions of 10RI into DD or 17HL into DE destroyed the topogenic information, whereas substitutions of 25M into I and 26EE into LV did not . By combining our data with recent analyses of others on the presequences of mammalian thiolases, it is concluded that the peroxisomal targeting information of PTS2 is contained in the consensus sequence RL/I-X5-HL . In contrast to the higher plant and mammals, the Hansenula yeast peroxisomes seem to lack an enzyme capable of removing microbody presequences of higher eukaryotes.

Gene, 1994 Apr 8, 141(1), 145 - 6
A gene from the hypotrichous ciliate Stylonychia lemnae coding for a protein with homology to cyclin B; Maercker C et al.; A nucleotide (nt) sequence of a DNA molecule from Stylonychia lemnae with an open reading frame encoding a protein showing homology to cyclin B has been determined . The DNA molecule is 3791-nt long and the deduced 444-amino-acid (aa) sequence shares about 30% identity with the sequences of two yeast cyclin-B homologs over a length of about 210 aa.

Proteins, 1994 Apr, 18(4), 390 - 3
Lobster enolase crystallized by serendipity; Duquerroy S et al.; An unknown protein crystallized from a lobster muscle preparation in which arginine kinase was the majority component . It was identified as enolase by peptide sequencing and activity testing, and a SIRAS electron density map showed its three-dimensional structure to be very similar to that of yeast enolase.

Curr Opin Obstet Gynecol, 1994 Apr, 6(2), 184 - 9
Fertilization and implantation; Zilberstein M et al.; Recent advances in seemingly remote areas of investigation, i.e . yeast cell cycle research and DNA amplifications, have opened spectacular avenues for understanding reproduction . The new insights on the single cell and subcellular level of processes, such as egg maturation, sperm-egg interaction and implantation enhance, immensely, the power of assisted fertilization . These techniques, have become the mainstay of infertility therapy . This review focuses on the recent developments in these areas.

Am J Physiol, 1994 Apr, 266(4 Pt 1), L319 - 53
Transgenic models for the study of lung biology and disease; Ho YS; Transgenic models provide a means of understanding the molecular mechanisms for the temporal, spatial, and stimulus-responsive regulation of gene expression in vivo and importantly the pathophysiological consequences of the altered expression of a normal or mutated gene . To facilitate the application of transgenic models in lung research, this review describes several practical considerations in generation of transgenic mice . The potential of transgenic models in lung research is also illustrated by depicting the current models in lung research including those for understanding lung gene regulation, tumorigenesis, mutation detection, antioxidant defense, emphysema, fibrosis, and hypertension . The impact of important new development of producing transgenic mice carrying large fragments of DNA contained in yeast artificial chromosomes to achieve proper control of transgene expression and gene targeting technology is also discussed . It is anticipated that transgenic models will provide invaluable information in future lung research.

Jikken Dobutsu, 1994 Apr, 43(2), 199 - 207
{Feeding experiment on laboratory-bred male cynomolgus monkeys . II . Hematological and serum biochemical studies}; Yoshida T et al.; The effects of restricted feeding on hematological and serum biochemical values were studied in laboratory-bred male cynomolgus monkeys (Macaca fascicularis) aged between one year and four years . In animals younger than 2.5 years old, the amount of commercial diet (Type AS, Oriental Yeast Co . Ltd.) given per day was restricted to 50 g (group A), 30 g (group B) or 20 g (group C) and increased to 100 g (group A), 50 g (group B) or 40 g (group C) at 2.5 years old . Throughout the experimental period, about 100 g per day of apples and oranges were fed to the animals . Differences in red blood cell counts, hematocrit values and hemoglobin concentrations between groups A and C were detected in the middle period of the experiment . The function of hematogenesis may be suppressed by restricted feeding . A significant increase in serum triglyceride concentration in group C and slight increase in group B were observed during the second trimester of the experiment . A decrease in serum alkaline phosphatase activities in group C during the same period suggests that restricted feeding has a suppressive effect on bone growth . The results obtained by hematological and serum biochemical observations in this study are in good agreement with the previous somatometric study {10}.

Jikken Dobutsu, 1994 Apr, 43(2), 173 - 80
{A feeding experiment on laboratory-bred male cynomolgus monkeys . I . Morphometrical study}; Shimizu T et al.; Effects of restricted feeding on the growth of laboratory-bred male cynomolgus monkeys (Macaca fascicularis) aged between one year and four years were studied morphometrically . A series of 11 variables representing physical elements were measured . Before 2.5 years of age, the amount of commercial diet (Type AS, 382kcal/100g and 28.1% of crude protein, Oriental Yeast Co . Ltd.) per day was restricted to 50g (group A), 30g (group B) or 20g (group C) and increased to 100g (group A), 50g (group B) or 40g (group C) respectively at 2.5 years old . Throughout the experimental period ca 100g of apples and oranges per day were provided . Significant differences in body weight between group A and C were detected excepting the early period of the experiment . Although the slight suppression in weight gain was observed in group B during the second trimester of the experiment, body weight increased gradually after increasing the amount of food and no significant difference from A was observed at four years of age . The minimum requirement of diets is judged to be 30g/day before two years old and 50g/day over two years old in the laboratory-bred male cynomolgus monkey . Moreover, the suppressive effects of restricted feeding were most significant on the growth of the limbs and, secondarily, on the growth of the trunk . Practically no effect on the growth of the head was observed.

J Parasitol, 1994 Apr, 80(2), 225 - 31
In vitro culture of equine strongylidae to the fourth larval stage in a cell-free medium; Chapman MR et al.; An efficient and reliable method is described for the culture of equine strongyles from the third (L3) to the fourth (L4) larval stage . Medium consists of 50% fetal calf serum and 50% NCTC with additions of L-glutamine, NaHCO3, yeast extract, bactopeptone, and dextrose . The gas phase used is of prime importance; it is a mixture of 10% CO2, 5% O2, and 85% N2 . Strongylus vulgaris, Strongylus edentatus, Strongylus equinus, Triodontophorus brevicauda, Triodontophorus serratus, Triodontophorus tenuicollis, Oesophagodontus robustus, Cylicocyclus insigne, and mixed species of cyathostomes were cultured to the L4 stage . Oesophagodontus robustus was cultured to the fifth larval stage . Depending on species, 44-95% of Strongylinae L3 inoculated into this system molted to L4 . Although some development of the Cyathostominae L3 occurred, only a small portion (1%) completed ecdysis to L4 . Viability in cultures of all species remained high (> 60-70% larvae surviving) for at least 4 wk (cyathostomes) and as long as 6 mo (S . edentatus) . The addition of equine hemin to cultures of S . vulgaris and O . robustus L4 enhanced development and prolonged viability of these larvae . Hemin had no effect on cultures of S . edentatus or S . equinus, and it was not tested in cultures of other species.

EMBO J, 1994 Apr 1, 13(7), 1620 - 7
Pheromones trigger filamentous growth in Ustilago maydis; Spellig T et al.; Cell recognition and mating in the smut fungus Ustilago maydis have been proposed to involve specific pheromones and pheromone receptors . The respective structural genes are located in the a mating type locus that exists in the alleles a1 and a2 . We demonstrate that binding of pheromone to the receptor can induce a morphological switch from yeast-like to filamentous growth in certain strains . Using this as biological assay we were able to purify both the a1 and a2 pheromone . The structure of the secreted pheromones was determined to be 13 amino acids for a1 and nine amino acids for a2 . Both pheromones are post-translationally modified by farnesylation and carboxyl methyl esterification of the C-terminal cysteine . An unmodified a1 peptide exhibits dramatically reduced activity . The pheromone alone is able to induce characteristic conjugation tubes in cells of opposite mating type and confers mating competence; even cells of the same mating type undergo fusion . We discuss the role of pheromones in initiating filamentous growth and pathogenic development.

Arterioscler Thromb, 1994 Apr, 14(4), 534 - 41
The human apolipoprotein(a)/plasminogen gene cluster contains a novel homologue transcribed in liver; Byrne CD et al.; Lipoprotein(a) is an atherogenic lipoprotein whose function and plasma concentration reflect the structure and regulation of the apolipoprotein(a) gene . Apolipoprotein(a) is a close homologue of plasminogen, and their genes are tightly linked on chromosome 6 . To further characterize these genes, we analyzed overlapping human genomic yeast artificial chromosome clones, which revealed a cluster of four highly homologous genes encoding apolipoprotein(a), plasminogen, and two apolipoprotein(a)-related genes (rg) or pseudogenes . Hybridization analysis and reverse transcriptase polymerase chain reaction showed that one of these novel genes, designated apolipoprotein(a)rg-C, has a domain structure similar to apolipoprotein(a) and is transcribed in human liver . Three additional homologues designated as plasminogen-related genes are shown to be unlinked to this gene cluster and reside on chromosomes 2 and 4.

J Biol Chem, 1994 Apr 1, 269(13), 9493 - 9
ATP-dependent chaperoning activity of reticulocyte lysate; Schumacher RJ et al.; We have developed an assay for chaperone-mediated protein renaturation using thermally denatured Firefly luciferase . Dilution of denatured luciferase (> 99% loss of activity) into reticulocyte lysate typically results in recovery of 5-15% activity . Addition of an ATP-regenerating system increases yields to > 60%, while heat shock or the addition of denatured proteins inhibits the chaperoning activity . Reticulocyte lysate contains abundant quantities of the heat shock proteins, hsp90 and hsp70, and a 60-kDa protein homologous to the yeast stress protein, STI1 . Immune isolated samples of these three proteins support recovery of up to 35% of luciferase activity in an ATP-dependent manner, suggesting that these or associated proteins are involved in the renaturation of luciferase . Furthermore, we observed a correlation between luciferase renaturation activity and the levels of hsp70 and hsp90 in reticulocyte lysate preparations . Purified hsp90 and hsp70, along with an ATP-regenerating system, are able to renature luciferase to greater than 20% of its original activity . This renaturation is most efficient when hsp90 and hsp70 are at about a 2:1 ratio and at concentrations similar to those found in reticulocyte lysate . This study provides evidence for an ATP-dependent chaperoning activity in reticulocyte lysate that involves a cooperative action of hsp70 and hsp90.

Blood, 1994 Apr 1, 83(7), 1922 - 8
Detection of chimeric BCR-ABL genes on bone marrow samples and blood smears in chronic myeloid and acute lymphoblastic leukemia by in situ hybridization; Bentz M et al.; The presence of BCR-ABL fusion genes has important diagnostic and prognostic implications in chronic myeloid leukemia (CML) and acute lymphoblastic leukemia (ALL) . The CML-specific chimeric BCR-ABL gene with a break involving the major breakpoint cluster region (M-bcr) of the BCR-gene has been detected by means of fluorescence in situ hybridization (FISH) . In this study, we present a FISH protocol that allows the detection of breaks in both the major and the minor breakpoint cluster region (m-bcr) . Three hybridization signals of D107F9, a yeast artificial chromosome (YAC)-derived probe spanning the breakpoint regions of the BCR gene, were indicative of the translocation events . To increase the specificity further, this probe was combined with cos-abl 8, a cosmid probe flanking the breakpoint within the ABL gene for dual-color hybridization . Samples of 21 patients with CML, the ALL-derived cell line SUP-B15, and of seven patients with Philadelphia chromosome (Ph1)-positive ALL (three of them with breakpoints within m-bcr) were examined . BCR-ABL fusion was detected in all cases with high specificity (false-positive nuclei: mean, 0.1%) . On cytogenetic preparations, the percentages of BCR-ABL-positive interphase cells ranged from 53% to 91% . Comparable efficiencies were achieved on blood smears . In conclusion, hybridization with D107F9 and cos-abl 8 allows unambiguous diagnosis of BCR-ABL genes and is likely to become an important tool for the monitoring of therapies in patients with CML and ALL.

Am J Hum Genet, 1994 Apr, 54(4), 687 - 94
Use of genetic and physical mapping to locate the spinal muscular atrophy locus between two new highly polymorphic DNA markers; Clermont O et al.; The gene for autosomal recessive forms of spinal muscular atrophy (SMA) has recently been mapped to chromosome 5q13, within a 4-cM region between the blocks D5S465/D5S125 and MAP-1B/D5S112 . We identified two new highly polymorphic microsatellite DNA markers--namely, AFM265wf5 (D5S629) and AFM281yh9 (D5S637)--which are the closest markers to the SMA locus . Multilocus analysis by the location-score method was used to establish the best estimate of the SMA gene location . Our data suggest that the most likely location for SMA is between locus D5S629 and the block D5S637/D5S351/MAP-1B/D5S112/D5S357 . Genetic analysis of inbred SMA families, based on homozygosity by descent and physical mapping using mega-YACs, gave additional information for the loci order as follows: cen-D5S6-D5S125/D5S465-D5S435-D5S629-SMA-+ ++D5S637-D5S351-MAP-1B/D5S112-D5S357- D5S39-tel . These data give the direction for bidirectional walking in order to clone this interval and isolate the SMA gene.

J Biochem (Tokyo), 1994 Apr, 115(4), 693 - 700
Improving cytochrome c function by protein engineering?: studies of site-directed mutants of the human protein; Wallace CJ et al.; We have expressed the gene for human cytochrome c, and six mutants of the native sequence, in yeast defective in its own iso-1-cytochrome c gene . All constructs support strong growth in strict aerobic metabolism, and substantial amounts of protein could be extracted from permeabilized cells . The purified analogs, Cys14Ala, Gly37Arg, Arg38Lys, Arg38Gly, Gly84Ser, and Thr28Ile,Gly84Ser, were examined for changes in functional properties, since the majority of these residues are strongly or absolutely conserved . Indeed, although growth rates of the host yeast strains were very similar, there was great divergence in both physicochemical and biological properties, which have been rationalized in terms of changes to the stability of the cytochrome fold, and to the dipole moment of the protein . Interestingly, although modification of electrostatic properties in some mutants can apparently produce a twofold increase in electron transfer efficiency, such changes are not evolutionarily acceptable . The "improvement" is illusory . We suggest that an associated decrease in the stability of the heme crevice offsets any advantage of increased transfer rates.

Hum Mol Genet, 1994 Apr, 3(4), 629 - 33
High resolution ordering of YAC contigs using extended chromatin and chromosomes; Haaf T et al.; The general usefulness of fluorescence in situ hybridization (FISH) for the physical mapping of the human genome is greatly enhanced by improved DNA resolution . Several techniques have been described for decondensing or stretching interphase chromatin in a linear fashion, allowing long-range FISH mapping in finer detail . Highly extended linear chromatin can be hybridized over physical distances of at least several megabases, possibly over the whole length of a chromosome . By multi-color FISH, we have determined the order and overlaps of YACs from a 5q34-35 contig . Cosmids can be localized within larger YAC clones . Extended chromatin mapping can be applied as an adjunct ordering technique in genome studies.

Nat Genet, 1994 Apr, 6(4), 379 - 83
Long-range mapping of gaps and telomeres with RecA-assisted restriction endonuclease (RARE) cleavage; Ferrin LJ et al.; RecA-assisted restriction endonuclease (RARE) cleavage is a method to perform sequence-specific cleavage of genomic DNA, and is useful in physical mapping studies . After making two modifications, we have applied this method to mapping large regions of DNA in several cell types, including a notorious gap near the Huntington disease (HD) locus on chromosome 4 . RARE cleavage fragments were analysed by pulsed field gel electrophoresis and Southern blotting and the distances between cleavage sites determined with accuracy . Using RARE cleavage, the gap measured was less than 60 kilobases in length . RARE cleavage is also a straightforward technique to map the distance from a marker to a telomere . The terminal 1.7 megabases of several HD and control cell lines were mapped with no large differences between cell lines in this region.

Mol Biol Cell, 1994 Apr, 5(4), 413 - 21
Direct interaction of v-Src with the focal adhesion kinase mediated by the Src SH2 domain; Xing Z et al.; The recently described focal adhesion kinase (FAK) has been implicated in signal transduction pathways initiated by cell adhesion receptor integrins and by neuropeptide growth factors . To examine the mechanisms by which FAK relays signals from the membrane to the cell interior, we carried out a series of experiments to detect potential FAK interactions with proteins containing Src homology 2 (SH2) domains that are important intracellular signaling molecules . Using v-Src-transformed NIH3T3 cells, we showed that FAK was present in the immune-complex precipitated by anti-Src antibody, suggesting potential interaction of FAK with v-Src in vivo . We also showed potentially direct interaction of FAK with v-Src in vivo using the yeast two-hybrid system . Using recombinant FAK expressed in insect cells and bacterial fusion proteins containing Src SH2 domains, we showed direct binding of FAK to the Src SH2 domain but not to the SH3 domain in vitro . A kinase-defective mutant of FAK, which is not autophosphorylated, did not interact with the Src SH2 domain under the same conditions, suggesting the involvement of the FAK autophosphorylation sites . Treatment of FAK with a protein-tyrosine phosphatase decreased its binding to the Src SH2 domain, whereas autophosphorylation in vitro increased its binding . These results confirm the importance of FAK autophosphorylation sites in its interaction with SH2 domain-containing proteins . Taken together, these results suggest that FAK may mediate signal transduction events initiated on the cell surface by kinase activation and autophosphorylation that result in its binding to other key intracellular signaling molecules.

J Biol Chem, 1994 Apr 1, 269(13), 9590 - 7
Structure and organization of mouse GlcNAc-1-phosphate transferase gene; Rajput B et al.; The gene encoding UDP-GlcNAc:dolichol phosphate N-acetylglucosamine-1-phosphate transferase (GPT), the enzyme that initiates the pathway for the biosynthesis of asparagine-linked glycoproteins, was isolated and characterized . Southern blot analyses demonstrated a single copy gene for GPT . The gene spans about 7.5 kilobase pairs of DNA and is divided into 9 exons by 8 introns . All the introns are found in the coding region, and most of them occur in segments separating the putative membrane-spanning domains . The exon/intron organization of the gene also correlates with the presence of several highly conserved regions of potential functional importance among yeast, leishmania, hamster, and mouse enzymes . Primer extension and reverse transcription-polymerase chain reaction analyses suggested the presence of several potential transcription start sites, with the closest one being approximately 200 base pairs upstream from the translation initiation codon . The 5'-flanking region lacks a typical TATA box, but is high in GC content and contains two putative Sp1 binding sites (GC boxes), consistent with promoters described for housekeeping genes . The 3'-end reverse transcription-polymerase chain reaction analysis indicated that the first of the two polyadenylation sites was used predominantly, in agreement with a approximately 2.0-kilobase pair GPT message seen on Northern blots of RNA from a wide variety of mouse tissues . This is the first report of cloning of a gene for an enzyme of the dolichol cycle in higher eukaryotes . A novel finding of this study is the observation of a G-->A change between the genomic sequence and nucleotide 280 in the cDNA . This could have important implications as an RNA editing mechanism for regulating the expression of the gene and therefore, protein N-glycosylation . A previous study (11) had shown that the activity of GPT was developmentally regulated in mouse mammary gland, with possible involvement by the hormone prolactin . The availability of the GPT gene with its promoter should facilitate future studies on delineating the mechanism for the hormonal regulation of GPT.

Radiother Oncol, 1994 Apr, 31(1), 1 - 13
The molecular basis for cell cycle delays following ionizing radiation: a review; Maity A et al.; Exposure of a wide variety of cells to ionizing (X- or gamma-) irradiation results in a division delay which may have several components including a G1 block, a G2 arrest or an S phase delay . The G1 arrest is absent in many cell lines, and the S phase delay is typically seen following relatively high doses (> 5 Gy) . In contrast, the G2 arrest is seen in virtually all eukaryotic cells and occurs following high and low doses, even under 1 Gy . The mechanism underlying the G2 arrest may involve suppression of cyclin B1 mRNA and/or protein in some cell lines and tyrosine phosphorylation of p34cdc2 in others . Similar mechanisms are likely to be operative in the G2 arrest induced by various chemotherapeutic agents including nitrogen mustard and etoposide . The upstream signal transduction pathways involved in the G2 arrest following ionizing radiation remain obscure in mammalian cells; however, in the budding yeast the rad9 gene and in the fission yeast the chk1/rad27 gene are involved . There is evidence indicating that shortening of the G2 arrest results in decreased survival which has led to the hypothesis that during this block, cells repair damaged DNA following exposure to genotoxic agents . In cell lines examined to date, wildtype p53 is required for the G1 arrest following ionizing radiation . The gadd45 gene may also have a role in this arrest . Elimination of the G1 arrest leads to no change in survival following radiation in some cell lines and increased radioresistance in others . It has been suggested that this induction of radioresistance in certain cell lines is due to loss of the ability to undergo apoptosis . Relatively little is known about the mechanism underlying the S phase delay . This delay is due to a depression in the rate of DNA synthesis and has both a slow and a fast component . In some cells the S phase delay can be abolished by staurosporine, suggesting involvement of a protein kinase . Understanding the molecular mechanisms behind these delays may lead to improvement in the efficacy of radiotherapy and/or chemotherapy if they can be exploited to decrease repair or increase apoptosis following exposure to those agents.

Genomics, 1994 Apr, 20(3), 463 - 7
Organization of the human annexin V (ANX5) gene; Cookson BT et al.; We characterized the region of human chromosome 4q26-q28 that contains the gene encoding annexin V (placental anticoagulant protein I), a member of a family of calcium-dependent phospholipid binding proteins . A total of 14.5 kb, containing 9 introns, could be directly amplified from genomic DNA; the remainder was characterized from genomic clones in phage lambda and a yeast artificial chromosome . The gene was mapped with restriction enzymes BamHI, EcoRI, HindIII, SacI, StuI, and XbaI; the transcribed region spans 28 kb and contains 13 exons (44 tp 530 bp in size) and 12 introns (0.23 to 8.8 kb in size) . Several putative transcription factor binding sites are present in the 5'-region, but the promoter has no recognizable TATA box . This study will facilitate further analysis of the functions of annexin V and its role in disease.

Genomics, 1994 Apr, 20(3), 341 - 6
A 2-Mb YAC contig encompassing three loci (DXF34, DXS14, and DXS390) that lie between Xp11.2 translocation breakpoints associated with incontinentia pigmenti type 1; Reed V et al.; We demonstrate that all the repeat elements representing the conserved loci DXF34 and DXS390 lie between the X;9 and the X;17 translocation breakpoints associated with incontinentia pigmenti type 1 (IP1) . Sequence-tagged sites (STSs) at DXF34S1, DXS14, and DXS390 have been used to isolate YAC clones containing these loci, and a contig of approximately 2 Mb has been constructed . Patterns of hybridization observed in the YAC clones indicate that DXS390 comprises two distinct regions (A and B) . The STS at DXS390 detects the A region and includes a polymorphic CA repeat (PIC = 0.25) . This expansion of the cloned region around DXF34 and DXS390 will enable the isolation of additional conserved sequences that will help in understanding both the lesions underlying the pathogenesis of IP1 and the size and extent of the man-mouse homologous block defined by DXF34.

Curr Opin Genet Dev, 1994 Apr, 4(2), 298 - 304
Pre-mRNA splicing; Newman AJ; Information from yeast and mammalian pre-mRNA splicing systems has advanced our understanding of the roles of protein factors in the early steps of spliceosome assembly . New results on the stereochemistry of nuclear pre-mRNA splicing and data on the transposition of Group II self-splicing introns in vivo have fuelled the long-running debate on the evolution of introns and RNA splicing.

Curr Opin Genet Dev, 1994 Apr, 4(2), 236 - 44
The role of activators in assembly of RNA polymerase II transcription complexes; Hori R et al.; The past year has provided new insights into the biochemical mechanism of gene activation . Key discoveries include the finding that TFIIA plays an important regulatory role in transcription complex assembly, the TBP-associated factors are direct targets of at least two classes of activator, and a largely pre-assembled transcription complex has been isolated from yeast cells, challenging the step-wise assembly pathway . This review also presents an update on the argument that TFIIB is the target of VP16 and insights into the energetic role of ATP in RNA polymerase II initiation.

Protein Eng, 1994 Apr, 7(4), 531 - 5
Variability within the Candida rugosa lipases family; Lotti M et al.; Several fungi secrete lipase isozymes differing in biochemical properties and in some cases in substrate specificity . In the yeast Candida rugosa, a family of related genes encodes for multiple lipase proteins, highly homologous in sequence but partially different in the regions interacting with the substrate molecule . Analysis of these substitutions performed on the basis of multiple alignments and using a 3-D model of the enzyme, allows identification of a restricted number of amino acids possibly involved in substrate specificity of Candida lipases.

Plant Physiol, 1994 Apr, 104(4), 1359 - 70
Structural organization of the spinach endoplasmic reticulum-luminal 70-kilodalton heat-shock cognate gene and expression of 70-kilodalton heat-shock genes during cold acclimation; Anderson JV et al.; The 70-kD heat-shock proteins (HSP70s) are encoded by a multigene family in eukaryotes . In plants, the 70-kD heat-shock cognate (HSC70) proteins are located in organellar and cytosolic compartments of cells in most tissues . Previous work has indicated that HSC70 proteins of spinach (Spinacia oleracea) are actively synthesized during cold-acclimating conditions . We have isolated, sequenced, and characterized cDNA and genomic clones for the endoplasmic reticulum (ER) luminal HSC70 protein (immunoglobulin heavy chain-binding protein; BiP) of spinach . The spinach ER-luminal HSC70 is a constitutively expressed gene consisting of eight exons . Spinach BiP mRNA appears to be up-regulated during cold acclimation but is not expressed during water stress or heat shock . In contrast to the differential regulation of mRNA, the ER-luminal HSC70 protein levels remain constant in response to various environmental stresses . Two other members of the spinach 70-kD heat-shock (HS70) multigene family also show differential expression in response to a variety of environmental stresses . A constitutively expressed cytosolic HSC70 protein in spinach appears also to be up-regulated in response to both cold-acclimating and heat-shock treatments . Spinach also contains a cold-shock-induced HS70 gene that is not expressed during heat shock or water stress . Since HSP70s are considered to be involved with the chaperoning and folding of proteins, the data further support the concept that they may be important for maintaining cellular homeostasis and proper protein biogenesis during cold acclimation of spinach.

J Trop Pediatr, 1994 Apr, 40(2), 104 - 7
Female children respond to recombinant hepatitis B vaccine with a higher titre than male; Fang JW et al.; One-hundred and eighty Chinese children {age range 5 months to 12 years, seronegative for all hepatitis B virus (HBV) markers} of parents seropositive for HBV surface antigen (HBsAg) were randomized to receive doses of either 10 or 20 micrograms of recombinant yeast-derived HBV vaccine at intervals of 0, 1, and 6 months . Six children defaulted and three other children (1.7 per cent) seroconverted to anti-HBc positivity without detectable HBsAg in the serum . All other children attained an anti-HBs titre of > 10 mlU/ml after three doses . Both 10 and 20 micrograms/dose regime gave a similar geometric mean titre (GMT) of anti-HBs . Children aged 0-4 responded with a similar titre compared with children aged > 4 . Female children responded with a significantly higher GMT than male children and this was due to a high proportion of female children with higher peak titres . No major side-effects were encountered . We conclude that recombinant HB vaccine is highly immunogenic, well tolerated and equally effective with doses of both 10 and 20 micrograms and that girls responded with a higher anti-HBs titre compared with boys.

Plant J, 1994 Apr, 5(4), 459 - 67
FIL2, an extracellular Leucine-Rich Repeat protein, is specifically expressed in Antirrhinum flowers; Steinmayr M et al.; The expression of the Antirrhinum gene FIL2 is affected in mutants of the homeotic transcription factor DEFICIENS . Northern and Western blot analyses showed that FIL2 in wild-type Antirrhinum flowers is expressed weakly in the petals and more abundantly in the reproductive organs; the gene is active in the filaments and anthers of stamens, and in the stigma and transmitting tissue of the carpels . The FIL2 protein is glycosylated with high mannose type glycan chains and is located in the middle lamella of the extracellular matrix . The amino acid sequence contains 10 tandem repeats, the composition of which is similar to the Leucine-Rich Repeat (LRR) motif found in mammals, Drosophila and yeast . The possibility that FIL2 might be a component of a cellular signalling mechanism, involving LRR-mediated protein-protein interactions is discussed.

Genes Dev, 1994 Apr 1, 8(7), 783 - 95
Abl protein-tyrosine kinase selects the Crk adapter as a substrate using SH3-binding sites; Ren R et al.; To understand the normal and oncogenic functions of the protein-tyrosine kinase Abl, the yeast two-hybrid system has been used for identifying proteins that interact with it . One interacting protein is Crk-I, an SH3/SH2-containing adapter protein that was originally identified as the oncogenic element in the avian sarcoma virus CT10 . Direct interaction between the Crk-I SH3 and Abl at novel, approximately 10 amino acid sites just carboxy-terminal to the Abl kinase domain occurs in vitro and in mammalian cells . There is a nearby site specific for binding another adapter, Nck, and these sites also bind Grb-2 . When bound to Abl, Crk-I was phosphorylated on tyrosine . Thus, the SH3-binding sites on Abl serve as substrate recognition sites for the relatively nonspecific kinase of Abl . In Crk-I-transformed cells, Crk-I associates with endogenous c-Abl and is phosphorylated on tyrosine . The association of Crk and Abl suggests that Abl could play a role in v-Crk and Crk-I transformation and that normal Abl function may be partly mediated through bound adapter molecules.

Boll Soc Ital Biol Sper, 1994 Apr, 70(4), 83 - 8
Degradation of aromatic compounds by Trichosporon sp; Caselli L et al.; When cultured in liquid media, samples of the yeast Trichosporon grow readily and degrade phenol; glutamate was found to stimulate both fungal growth and phenol catabolism, with a distinctive lag . In addition, this same strain grows in the presence of 2-chloro-phenol and 2-methyl, 4-chlorophenol (which are also degraded) and in the presence of 2-nitrophenol, 4-nitrophenol, 2,4-dinitrophenol, which are either degraded or not, as in the case of 4-nitrophenol . The kinetics of both growth and of aromatic catabolism is suggestive of inductive phenomena for key metabolic enzymes.

Neuron, 1994 Apr, 12(4), 707 - 16
The exocytotic fusion pore and neurotransmitter release; Monck JR et al.; Membrane fusion is ubiquitous in biological systems, occurring in the simplest of unicellular eukaryotes as well as higher eukaryotes . As soon as the first primitive eukaryotic cell utilized a lipid bilayer as an outer membrane, membrane fusion (and fission) became necessary for the traffic of material from the outside to the inside, the inside to the outside, and between different intracellular membrane-bounded compartments . The earliest cells would have made use of the intrinsic ability of lipid bilayers to fuse under certain conditions . Although this fusogenic property of bilayers has been known for some time, it is has become clear only relatively recently that two phospholipid bilayers will fuse spontaneously, owing to a hydrophobic force, when the bilayers are brought close together under conditions of membrane tension or high curvature (Helm and Israelachvili, 1993) . The primeval cell would have used proteins to develop the appropriate architecture in which such fusion would occur in a regulated manner . During the course of evolution, ever more sophisticated ways of regulating this basic process would evolve, but the underlying fusion mechanism would remain unchanged . We have proposed that a macromolecular scaffold of proteins is responsible for bringing the plasma membrane close to the secretory granule membranes and creating the architecture that enables the hydrophobic force to cause fusion (Figure 1; Nanavati et al., 1992; Monck and Fernandez, 1992; Oberhauser and Fernandez, 1993) . Evidence is now accumulating that there are several highly conserved families of proteins associated with vesicle fusion events, from yeast to mammalian cells, and with intracellular traffic, as well as with regulated exocytosis and synaptic transmission (Bennett and Scheller, 1993; Sollner et al., 1993; Sudhof et al., 1993) . The molecular structures (or scaffolds) that regulate membrane fusion are likely to contain related proteins and share certain fundamental properties.

Infect Agents Dis, 1994 Apr-Jun, 3(2-3), 77 - 84
Cis-acting signals and trans-acting factors involved in influenza virus RNA synthesis; O'Neill RE et al.; Influenza A virus RNA replication and expression is directed from cis-acting sequences present on the viral RNAs with the help of trans-acting factors encoded by the virus . Ribonucleoprotein (RNP) complexes reconstituted from synthetic cDNA-derived RNA and purified viral proteins have facilitated the dissection of these cis-acting signals and trans-acting factors . Prior to these studies influenza viruses and other negative-strand RNA viruses were refractory to molecular genetic manipulations . These reverse genetic studies have helped in defining the promoter and polyadenylation signals required for viral RNA synthesis . Studies involving the use of reconstituted RNP complexes have revealed that the viral proteins PB1, PB2, PA, and the nucleoprotein (NP) are necessary for replication and expression of influenza virus RNA . Inroads have also been made in determining the cellular proteins that participate in influenza virus gene expression and replication . The yeast interactive trap system has been used to identify and clone a gene (NPI-1), which encodes a protein that interacts with the influenza virus NP suggesting that this cellular protein is a trans-acting factor functioning in viral RNA synthesis.

Biosci Biotechnol Biochem, 1994 Apr, 58(4), 639 - 43
Formation of beta-galactosyl compounds of arabinosylcytosine in growing culture of Sporobolomyces singularis; Suzuki Y et al.; Two new compounds of 1-beta-D-arabinofuranosylcytosine (ara-C) were found to be produced in a high yield in a culture filtrate of Sporobolomyces singularis, when grown on a medium containing lactose and ara-C . The compounds I and II were obtained as white needle crystals from the culture filtrate by preparative paper chromatography, gel-filtration on Sephadex G-10 and Toyopearl HW-40S, lyophilization, and ethanol treatment . The compounds I and II were identified as 3'-O-(beta-D-galactopyranosyl)-ara-C and 3'-O-{beta-D-galactopyranosyl-(1-->4)-O-beta-D-galactopyranosyl}-ara-C, respectively, on the basis of the various experimental results, viz., elementary analyses, UV, IR, 1H-, and 13C-NMR spectra, and products by hydrolysis with alpha- and beta-galactosidases . Also, the yeast produced a large amount of 3'-O-beta-galactosyl compounds of adenosine and inosine in the culture filtrate when grown on a medium containing lactose and their ribonucleosides.

J Biol Chem, 1994 Apr 1, 269(13), 9562 - 7
Role of gamma 87 Gln in the inhibition of hemoglobin S polymerization by hemoglobin F; Adachi K et al.; Previous studies suggested that gamma 87 Gln in hemoglobin (Hb) F is an important site for promoting inhibition of Hb S (alpha 2 beta 2(6 Glu-->Val) polymerization by Hb F . We engineered and isolated the double mutant (Hb alpha 2 beta 2(6 Glu-->Val,87 Thr-->Gln) using a yeast expression system and characterized polymerization properties of this modified tetramer in an effort to clarify the role of Gln at position 87 in inhibiting Hb S polymerization . Electrophoretic mobility and absorption spectra of this double mutant were the same as that of Hb S, while oxygen affinity was higher, and effects of organic phosphates on oxygen affinity were reduced . The deoxy form of the double mutant showed a characteristic delay time prior to polymerization in vitro . The critical concentration for polymerization of the double mutant was about 1.5 times higher than Hb S, and delay and polymerization times were much longer than Hb S at the same hemoglobin concentrations . The logarithmic plot of delay time versus hemoglobin concentration for the double mutant showed a straight line that was intermediate between lines for AS and FS mixtures . These results and those of kinetics of polymerization of Hb S/double mutant mixtures indicate that substitution of Gln for Thr at beta 87 in Hb S prolongs delay time and inhibits polymerization, although the double mutant forms polymers like Hb S.

Gene, 1994 Mar 25, 140(2), 239 - 42
Isolation and characterization of the Drosophila melanogaster eIF-2 alpha gene encoding the alpha subunit of translation initiation factor eIF-2; Qu S et al.; Genomic and cDNA clones encoding the Drosophila melanogaster alpha-subunit of translational initiation factor 2 (eIF-2 alpha) were isolated . The D . melanogaster eIF-2 alpha gene encodes a 341 amino-acid (aa) protein that shares 57 and 44% identity to its human and yeast homologues, respectively . The regulatory phosphorylation site at Ser50 is embedded in a segment of 19 conserved aa residues . Analysis of the genomic DNA and cDNA clones indicated that eIF-2 alpha is a single-copy gene and its coding region is interrupted by a 260-bp intron . The D . melanogaster eIF-2 alpha mRNA is 1350 nt in length and is expressed throughout development.

J Biol Chem, 1994 Mar 25, 269(12), 9319 - 24
Isolation of a cDNA encoding 5T4 oncofetal trophoblast glycoprotein . An antigen associated with metastasis contains leucine-rich repeats; Myers KA et al.; The monoclonal antibody 5T4 defines a human oncotrophoblast antigen expressed by a variety of carcinomas but with a restricted pattern of expression in normal adult tissues . The 5T4 antigen has been isolated from term placenta as a 72-kDa glycoprotein consisting of a 42-kDa core protein with extensive N-linked glycosylation . A cDNA has been isolated from a human placental library using pools of oligonucleotides based on amino acid sequence obtained from purified 5T4 molecules . The predicted open reading frame encodes a protein of 420 amino acids with a molecular mass of 46 kDa and 8 potential N-glycosylation sites . There are N- and C-terminal hydrophobic segments corresponding to putative signal and membrane anchorage sequences, respectively . Northern analysis has demonstrated a major 2.5-kilobase mRNA present in cell lines serologically reactive with the monoclonal antibody 5T4 . Comparison of the 5T4 protein sequence with current sequence data bases has identified the presence of leucine-rich repeats, which are found in a variety of proteins from yeast, insects, and mammals . The 5T4 antigen expression is strongly associated with metastasis in colorectal and gastric cancer, and, hence, the possible functions of the gene product and its relationship to tumor growth and progression are discussed.

J Biol Chem, 1994 Mar 25, 269(12), 9147 - 54
A highly active ubiquinol-cytochrome c reductase (bc1 complex) from the colorless alga Polytomella spp., a close relative of Chlamydomonas . Characterization of the heme binding site of cytochrome c1; Gutierrez-Cirlos EB et al.; The alga Polytomella spp . offers extraordinary advantages in the preparation of mitochondria since it lacks chloroplasts and a cell wall . In this work the mitochondrial bc1 complex from Polytomella spp . was solubilized and purified by ion exchange chromatography . The complex was found to be composed of 10 polypeptides and exhibited high rates of ubiquinol-cytochrome c oxidoreductase activity (> 300 s-1) sensitive to antimycin and myxothiazol . The molecular mass of the bc1 complex from Polytomella spp . was assayed by gel filtration and estimated to be of 256,300 Da . Therefore, this complex exhibits the unique property of behaving as a monomer . Amino-terminal sequencing of cytochrome c1 identified 7 residues, from which a deoxyoligonucleotide was designed . A second deoxyoligonucleotide was constructed based on a highly conserved region of the c1 type cytochromes . With these probes, a fragment of the cytochrome c1 gene was amplified by polymerase chain reaction and sequenced . The deduced sequence of the apoprotein exhibited a consensus binding site CXXCH . The data suggest that the cytochrome c1 from Polytomella spp . differs from other protoctists like Crithidia and Euglena, i.e . it exhibits a heme binding domain structurally related to the bovine, yeast, and Neurospora c1 type cytochromes.

J Biol Chem, 1994 Mar 25, 269(12), 9030 - 7
Histidyl phosphorylation and dephosphorylation of P36 in rat liver extract; Motojima K et al.; Protein histidine kinase (Motojima, K., and Goto, S . (1993) FEBS Lett . 319, 75-79) and phosphatase in rat liver extract were characterized . The histidine kinase was recovered mostly in the membrane and the phosphatase in the soluble fraction . The kinase and its substrate 36-kDa protein (P36) were co-solubilized from the membrane under conditions in which most of the other kinases, and their substrate proteins were not solubilized . The solubilized kinase and P36 were co-eluted after high pressure liquid chromatography gel filtration, showing an apparent molecular mass of 70-75 kDa . They were also co-eluted after ion exchange chromatography . These characteristics, together with its complete resistance to genistein, indicate that the rat liver histidine kinase is not cognate to the yeast enzyme (Huang, J., Nasr, M., Kim, Y., and Matthews, H.R . (1992) J . Biol . Chem . 267, 15511-15515) . The phosphatase that dephosphorylates histidyl-phosphorylated P36 was also studied using rat liver subcellular fractions and in vitro phosphorylated P36 as the substrate . The characteristics of the phosphatase, that is, 1) Mg2+ requirement for activity, 2) apparent molecular mass of 45 kDa by high performance liquid chromatography gel filtration, and 3) resistance to 100 microM okadaic acid, suggest that the primary phosphatase active in vitro is protein phosphatase 2C.

J Biol Chem, 1994 Mar 25, 269(12), 8623 - 6
In chromaffin cells, the mammalian Sec1p homologue is a syntaxin 1A-binding protein associated with chromaffin granules; Hodel A et al.; Membrane proteins of the synaptic vesicle and the presynaptic plasma membrane together with soluble proteins form a secretory fusion complex conserved from yeast to neurons (Sollner, T., Whiteheart, S . W., Brunner, M., Erdjument-Bromage, H., Geromanos, S., Tempst, P., and Rothman, J . E . (1993) Nature 362, 318-324) . Two of the membrane proteins have been localized in chromaffin cells, which secrete catecholamines stored in chromaffin granules . Syntaxin 1A and 1B are found in a plasma membrane-enriched fraction, whereas synaptobrevin is concentrated on the granules . Recombinant syntaxin 1A has been used in an affinity chromatography assay to isolate syntaxin receptor proteins of the chromaffin granules . Solubilized granule membranes contain a single protein with high affinity for syntaxin 1A . Sequencing revealed partial homology with Sec1p, a hydrophilic yeast protein acting late in the secretory process . Genetic suppressor analyses predicted the interaction of Sec1p with Sso1p, a yeast homologue of syntaxin 1A, and with Sec4p, a homologue of rab3A (Aalto, M., Ronne, H., and Keranen, S . (1993) EMBO J . 12, 4095-4104) . Although rab3A is present on chromaffin granules, we did not detect it bound to syntaxin 1A together with the mammalian Sec1p homologue (mSec1) . The mSec1 peptide sequences are almost identical with respective sequences of a soluble protein, termed Munc-18, reported to be the only brain protein with affinity for recombinant syntaxin 1A (Hata, Y., Slaughter, C . A., and Sudhof, T . C . (1993) Nature 366, 347-351) . The mSec1/Munc-18 may be a receptor protein for syntaxin 1A on the transmitter vesicles mediating their interaction with the plasma membrane in docking and fusion.

Biochemistry, 1994 Mar 22, 33(11), 3229 - 36
Human, mouse, and rat calnexin cDNA cloning: identification of potential calcium binding motifs and gene localization to human chromosome 5; Tjoelker LW et al.; Calnexin is a 90-kDa integral membrane protein of the endoplasmic reticulum (ER) . Calnexin binds Ca2+ and may function as a chaperone in the transition of proteins from the ER to the outer cellular membrane . We have purified human calnexin in association with the human interferon-gamma receptor and cloned calnexin cDNA from placenta . Fragments of calnexin have been prepared as glutathione S-transferase fusion proteins and analyzed for their abilities to bind 45Ca2+ and ruthenium red . A subdomain containing four internal repeats binds Ca2+ with the highest affinity . This sequence is highly conserved when compared to calreticulin (a luminal ER protein), an Onchocerca surface antigen, and yeast and plant calnexin homologues . Consequently, this sequence represents a conserved motif for the high-affinity binding of Ca2+, which is clearly distinct from the "E-F hand" motif . An adjacent subdomain, also highly conserved and containing four internal repeats, fails to bind Ca2+ . The carboxyl-terminal, cytosolic domain is highly charged and binds Ca2+ with moderate affinity, presumably by electrostatic interactions . The calnexin amino-terminal domain (residues 1-253) also binds Ca2+, in contrast to the amino-terminal domain of calreticulin, which is relatively less acidic . We have also determined the cDNA sequences of mouse and rat calnexins . Comparison of the known mammalian calnexin sequences reveals very high conservation of sequence identity (93-98%), suggesting that calnexin performs important cellular functions . The gene for human calnexin is located on the distal end of the long arm of human chromosome 5, at 5q35.

J Biol Chem, 1994 Mar 18, 269(11), 8234 - 9
Identification of an essential cysteine residue in pyridoxal phosphatase from human erythrocytes; Gao G et al.; Pyridoxal-specific phosphatase purified from human erythrocytes was inactivated by a variety of thiol-specific reagents in a time- and concentration-dependent manner . The presence of pyridoxal phosphate, a substrate, or inorganic phosphate, a competitive inhibitor, protected the enzyme from inactivation . Phosphatase inactivated by disulfide reagents was reactivated by the addition of excess dithiothreitol, indicating that the inactivation was due to formation of a mixed disulfide between the reagent and a free cysteinyl residue at or near the active site of the enzyme . Incorporation of either 1 mol of 5,5'-dithiobis(2-nitrobenzoic acid) (DTNB), 0.6 mol of iodo{3H}acetate, or 0.6 mol of N-{3H}ethylmaleimide per mol of subunit led to complete inactivation of the enzyme . High concentration of phosphate prevented the incorporation of DTNB and iodo{3H}acetate . Amino acid analysis of carboxymethylated enzyme and DTNB titration of the denatured phosphatase indicated that there may be only 1 cysteinyl residue per subunit . Modification by iodoacetate did not affect the quaternary structure of the enzyme . The phosphatase modified by iodo{3H}acetate was subjected to trypsin digestion, and the resulting peptides were separated on a reverse phase C18 column . Two radioactive peaks were obtained and contained a peptide with the N-terminal sequence of Ala-Gln-Gly-Val-Leu-Phe-Asp-Cys(Cm)-Asp-Gly-Val-Leu-X-Asn-Gly . Most of the radioactivity was released with Cys(Cm) . These results indicate that the cysteinyl residue in this sequence is at or near the active site and is essential for activity . Residues 5-12 and 15 of this peptide are identical with a sequence of a yeast alkaline p-nitrophenylphosphatase, and the peptide has little homology with other mammalian phosphatases.

Science, 1994 Mar 18, 263(5153), 1629 - 31
Coatomer interaction with di-lysine endoplasmic reticulum retention motifs; Cosson P et al.; Although signals for retention in the endoplasmic reticulum (ER) have been identified in the cytoplasmic domain of various ER-resident type I transmembrane proteins, the mechanisms responsible for ER retention are still unknown . Yeast and mammalian ER retention motifs interacted specifically in cell lysates with the coatomer, a polypeptide complex implicated in membrane traffic . Mutations that affect the ER retention capacity of the motifs also abolished binding of the coatomer . These results suggest a role for the coatomer in the retrieval of transmembrane proteins to the ER in both yeast and mammals.

Biochim Biophys Acta, 1994 Mar 16, 1205(1), 29 - 38
A glutathione S-transferase (GST) isozyme from broccoli with significant sequence homology to the mammalian theta-class of GSTs; Lopez MF et al.; A novel glutathione S-transferase (GST) was purified from broccoli (Brassica oleracea var . italica) . Partial amino-acid sequencing indicated that the protein shared significant homology with several different plant GSTs from maize, silene, Dianthus, Nicotiana and Triticum, but little homology to yeast (Issatchenkia) GST . One region of the polypeptide near the N-terminal also shared significant homology to a region of rat 5-5, rat 12-12 and human theta-GST (collectively referred to as the theta-GST-class) but little structural homology to the common mammalian cytosolic GSTs (alpha-, mu- or pi-classes) . The broccoli GST was retained on a novel membrane based glutathione affinity matrix and displayed activity towards 1-chloro-2,4-dinitro-benzene (CDNB), a general GST substrate, as well as 4-nitrophenethyl bromide, a marker substrate for the theta-class of GSTs . The characteristics of the broccoli GST potentially define it as a member of the theta-class . This is consistent with the view that the theta-class may have arisen prior to the divergence of animals and plants while the mammalian mu-, pi- and alpha-classes evolved after the two kingdoms were established.

Biochem Biophys Res Commun, 1994 Mar 15, 199(2), 862 - 8
Chromosomal assignment of the human SA gene to 16p13.11 and demonstration of its expression in the kidney; Samani NJ et al.; The SA gene is a novel gene of yet unknown function recently implicated in blood pressure regulation in rodent models of genetic hypertension . In this study we have located the human homologue of the SA gene to chromosome 16p13.11, by a combination of fluorescence in-situ hybridization and analysis of somatic cell hybrids carrying different segments of chromosome 16 . This should facilitate investigation of its role in the genetic tendency to hypertension in humans . Increased expression of the gene in the kidney may be the mechanism through which some allelic variants of the gene raise blood pressure in rodent models . In this study we also demonstrate that the SA gene is expressed in human kidneys.

Biochem Biophys Res Commun, 1994 Mar 15, 199(2), 706 - 13
A novel heparin-binding protein, HBp15, is identified as mammalian ribosomal protein L22; Fujita Y et al.; A 15kDa-protein (HBp15) was purified from mouse submandibular gland and bovine brain by virtue of its heparin-binding property . The amino acid sequences of mouse and bovine HBp15 showed a high degree of homology to a sea urchin protein encoded by gene called "development specific protein 217." Using reverse transcription-polymerase chain reaction methods, cDNA clones for HBp15 were isolated from submandibular gland mRNA of mouse, human and pig, and sequenced . Database search of HBp15 showed that HBp15 also resembles yeast ribosomal protein YL31 in addition to the 217 protein . Using specific antibodies against HBp15, HBp15 was identified as mammalian ribosomal protein L22, for which no sequence information is available.

Biochemistry, 1994 Mar 15, 33(10), 2830 - 7
Crystal structure of recombinant chicken triosephosphate isomerase-phosphoglycolohydroxamate complex at 1.8-A resolution; Zhang Z et al.; The crystal structure of recombinant chicken triosephosphate isomerase (TIM, E.C . 5.3.1.1) complexed with the intermediate analogue phosphoglycolohydroxamate (PGH) has been solved by the method of molecular replacement and refined to an R-factor of 18.5% at 1.8-A resolution . The structure is essentially identical to that of the yeast TIM-PGH complex {Davenport, R . C., et al . (1991) Biochemistry 30, 5821-5826} determined earlier and refined at comparable resolution . This identity extends to the high-energy conformations of the active-site residues Lys13 and Ser211, as well as the positions of several bound water molecules that are retained in the active site when PGH is bound . Comparison with the structure of uncomplexed chicken TIM shows that the catalytic base, Glu165, moves several angstroms when PGH binds . This movement may provide a trigger for a larger conformational change, one of 7 A, in a loop near the active site, which folds down like a lid to shield the bound inhibitor and catalytic residues from contact with bulk solvent . These same conformational changes were seen in crystalline yeast TIM upon binding of PGH; their occurrence here in a different crystal form of TIM eliminates the possibility that they are an artifact of crystal packing.

Int J Cancer, 1994 Mar 15, 56(6), 900 - 5
Clofazimine alters the energy metabolism and inhibits the growth rate of a human lung-cancer cell line in vitro and in vivo; Sri-Pathmanathan RM et al.; The anti-leprosy drug Clofazimine is known to inhibit respiratory function and hence energy metabolism in yeast and in transformed fibroblasts . The aim of this study was to examine the effect of Clofazimine on the energy metabolism of a chemoresistant human non-small-cell bronchial-carcinoma cell line (WIL) and to determine whether this agent might inhibit the growth rate of this cell line in vitro and in vivo . Oxidative phosphorylation was estimated in vitro by measuring oxygen consumption polarographically and glycolysis was estimated from lactate production . In cells that had been pre-treated with an ATP synthetase inhibitor (oligomycin), the addition of Clofazimine resulted in an increase in oxygen consumption similar to that observed with 2,4-dinitrophenol, a classical inhibitor of oxidative phosphorylation . This inhibition of mitochondrial function was associated with an increase in lactate production . Cellular ATP levels were maintained, possibly indicating a compensatory increase in ATP production via glycolysis . Clofazimine was shown to have a direct cytotoxic effect in vitro with an ID50 of 10.2 microM . When Clofazimine was administered to athymic mice bearing WIL as a subcutaneous xenograft, tumour growth rate was significantly reduced, so that after 3 weeks, tumour size was one third that of controls (p < 0.01) . These results suggest that selective inhibition of tumour energy metabolism with agents such as Clofazimine is a potential novel approach to cancer treatment.

Genomics, 1994 Mar 15, 20(2), 249 - 57
High-resolution genomic mapping of the three human replication protein A genes (RPA1, RPA2, and RPA3); Umbricht CB et al.; Human replication protein A (RPA) is a three-subunit protein that plays a central role in eukaryotic DNA replication, homologous recombination, and excision repair . We have previously reported the cloning and bacterial overexpression of the three RPA genes and have mapped them to chromosome 1 (RPA2), chromosome 7 (RPA3), and chromosome 17 (RPA1) . We have now obtained yeast strains with artificial chromosomes carrying the three human RPA genes and report the more detailed genomic mapping of RPA . RPA1 was mapped to chromosome 17p13.3 using a combination of PCR amplification of somatic cell hybrids and radiation hybrids containing chromosome 17 fragments . RPA2 was mapped to chromosome 1p35 by PCR amplification of somatic cell hybrids of chromosome 1 and by fluorescence in situ hybridization . RPA3 was mapped to chromosome 7p22 by Southern analysis and PCR amplification of somatic cell hybrids of chromosome 7 as well as fluorescence in situ hybridization . Since RPA is an essential component of major metabolic events affecting DNA, the physical mapping of the genes for it may help elucidate the biochemical basis of genetic disorders involving DNA metabolism.

Genomics, 1994 Mar 15, 20(2), 231 - 7
Structure of the gene for the testis-specific proprotein convertase 4 and of its alternate messenger RNA isoforms; Mbikay M et al.; Proprotein convertase 4 (PC4) is a mammalian secretory serine endoproteinase similar to the yeast KEX2 gene product and specifically expressed in testicular germs cells . PC4 mRNA isoforms that vary in size and 3' coding sequence have been reported (N . G . Seitah, R . Day, J . Hamelin, A . Gaspar, M . W . Collard, and M . Chretien, 1992, Mol . Endocrinol . 6: 1559-1570) . To determine the origin of these various forms, the mouse PC4 gene was cloned and its organization determined . The structural gene is approximately 9.5 kb long . It contains 15 exons and 14 introns . The exon-intron organization is very similar to that of the genes for the related convertases furin, PC1, and PC2 . The upstream region carries several GGGCGG and three CCAAT but no TATAA motifs . Analysis of the 5' end of PC4 mRNA in the testis has led to the identification of two novel 5' splice variants that might encode a nonsecretory enzyme . The multiple forms of PC4 mRNA can all be explained by alternate splicing of primary transcripts of a single gene.

J Biol Chem, 1994 Mar 11, 269(10), 7435 - 8
A single mutation in uncoupling protein of rat brown adipose tissue mitochondria abolishes GDP sensitivity of H+ transport; Murdza-Inglis DL et al.; The uncoupling protein is one of a family of mitochondrial transport proteins involved in energy metabolism . It dissipates oxidative energy to generate heat, either by catalyzing proton transport directly or by catalyzing fatty acid anion transport, thus enabling fatty acids to act as cycling protonophores . This transport process is tightly regulated by purine nucleotides . We have expressed uncoupling protein in yeast and examined its proton transport activity after its reconstitution into proteoliposomes . A directed change of Arg276 to Leu or Gln completely abolished nucleotide inhibition of protonophoretic action of the reconstituted mutant uncoupling proteins without affecting the transport process . Arg276 is the first residue of functional importance to be identified in uncoupling protein . Mutation of the homologous residue in the yeast ADP/ATP translocator prevented the growth of yeast on a nonfermentable carbon source, presumably by interfering with nucleotide exchange (Nelson, D . R., Lawson, J . E., Klingenberg, M., and Douglas, M . G . (1993) J . Mol . Biol . 230, 1159-1170) . Demonstration of the essential role of a single homologous residue in protein-nucleotide interaction within these two transporters is the first direct evidence that uncoupling protein and the ADP/ATP translocator belong to the same gene family.

J Biol Chem, 1994 Mar 4, 269(9), 6498 - 505
Regulation of enzymatic activity by active site fatty acylation . A new role for long chain fatty acid acylation of proteins; Berthiaume L et al.; Methylmalonate semialdehyde dehydrogenase (MMSDH) is a mitochondrial enzyme which can be acylated by myristoyl-CoA analogs (Deichaite, I., Berthiaume, L., Peseckis, S . M., Patton, W . F., and Resh, M . D . (1993) J . Biol . Chem . 268, 13788-13747) . Here we describe the mechanisms which mediate regulation of the enzymatic activity of bovine MMSDH by long chain fatty acylation . The substrate specificity of the acylation reaction was measured in vitro using purified MMSDH and the coenzyme A derivative of an 125I-labeled long chain fatty acid (13-iodotridecanoate), an analog of myristoyl-CoA . Long chain fatty acyl CoAs (> 8 carbons) were able to inhibit radiolabeling of MMSDH . In order to study the physiological role of the acylation process in vivo, a system using highly purified mitochondria from COS-1 cells overexpressing MMSDH was exploited . MMSDH was shown to be processed properly, targeted to the mitochondrial fraction, and enzymatically active . The extent of fatty acylation of MMSDH as well as of other mitochondrial proteins was correlated with the mitochondrial energy level . Biochemical evidence as well as site-specific mutagenesis of cysteine 319 revealed that this highly conserved active site cysteine of MMSDH was the target of the fatty acylation . Another member of the aldehyde dehydrogenase family, yeast aldehyde dehydrogenase was also covalently modified by {125I}13-iodotridecanoyl-CoA and thereby inactivated . Furthermore, we demonstrate that glutamate dehydrogenase, an enzyme that has been previously shown to be strongly inhibited by palmitoyl-CoA, is fatty acylated by the 125I-labeled myristoyl-CoA analog . Our data suggest that attachment of long chain fatty acids to proteins is a new and potentially widespread type of enzyme regulation mechanism that we denote active site fatty acylation.

J Biol Chem, 1994 Mar 4, 269(9), 6566 - 70
Human serum biotinidase . cDNA cloning, sequence, and characterization; Cole H et al.; Biotinidase (EC 3.5.1.12) catalyzes the hydrolysis of biocytin, the product of biotin-dependent carboxylase degradation, to biotin and lysine . Biotinidase deficiency is an inherited metabolic disorder of biotin recycling that is characterized by neurological and cutaneous abnormalities, and can be successfully treated with biotin supplementation . Sequences of tryptic peptides of the purified human serum enzyme were used to design oligonucleotide primers for polymerase chain reaction amplification from human hepatic total RNA to generate putative biotinidase cDNA fragments . Sequence analysis of a cDNA isolated from a human liver library by plaque hybridization with the largest cDNA probe revealed an open reading frame of 1629 bases encoding a protein of 543 amino acid residues, including 41 amino acids of a potential signal peptide . Comparison of the open reading frame with the known biotinidase tryptic peptides and recognition of the expressed protein encoded by this cDNA by monoclonal antibodies prepared against purified biotinidase demonstrated the identity of this cDNA . Southern analyses suggested that biotinidase is a single copy gene and revealed that human cDNA probes hybridized to genomic DNA from mammals, but not from chicken or yeast . Northern analysis indicated the presence of biotinidase mRNA in human heart, brain, placenta, liver, lung, skeletal muscle, kidney, and pancreas.

Plant Mol Biol, 1994 Mar, 24(6), 969 - 72
Sequence of a plant cDNA from Vicia faba encoding a novel Ran-related GTP-binding protein; Saalbach G et al.; A clone obtained from a broad bean (Vicia faba) developing cotyledon cDNA library contained the complete coding sequence of a polypeptide with very high homology to the small GTP-binding proteins Ran from human cells and Spi1 from yeast . These proteins belong to the ras superfamily of proteins involved in different basic cellular processes . The Ran/Spi1 proteins interact with a protein bound to DNA (RCC1) and are thought to function in the regulation of the cell cycle . The amino acid sequence of the obtained plant Ran-homologue, designated Vfa-ran, is 74% and 76% identical to Ran and Spi1, respectively . The five functional, conserved domains of ras-related proteins are present in the Vfa-ran sequence . However, as in Ran/Spi1 the C-terminus of Vfa-ran is very acidic and lacks the Cys motif for isoprenylation . Northern blotting revealed a corresponding mRNA expression in broad bean roots, leaves, and cotyledons with the highest level in roots.

Bone Marrow Transplant, 1994 Mar, 13(3), 333 - 4
Native valve endocarditis due to Candida parapsilosis: a late complication after bone marrow transplantation-related fungemia; Cancelas JA et al.; A case of Candida parapsilosis endocarditis observed 16 months after BMT is reported . The patient, a 35-year-old female with CML, suffered from Candida parapsilosis fungemia on day +22 after BMT . In spite of treatment with amphotericin B, fluconazole and catheter withdrawal, the same yeast was isolated > 1 year later from a vegetation on an old rheumatic mitral valve . Although the patient remained in complete cytogenetical and hematological remission, in vitro tests showed reduced phagocytic and chemotactic capacity of neutrophils and monocytes . This case stresses the need of prolonged therapy for patients with candidemia after BMT.

Development, 1994 Mar, 120(3), 535 - 44
The Serrate locus of Drosophila and its role in morphogenesis of the wing imaginal discs: control of cell proliferation; Speicher SA et al.; The Drosophila gene Serrate encodes a transmembrane protein with 14 EGF-like repeats in its extracellular domain . Here we show that loss-of-function mutations in this gene lead to larval lethality . Homozygous mutant larvae fail to differentiate the anterior spiracles, exhibit poorly developed mouth-hooks and show a severe reduction in the size of the wing and haltere primordia, which is not due to cell death . The few homozygous mutant escapers that pupariate develop into pharate adults that almost completely lack wings and halteres . Clonal analysis in the adult epidermis demonstrates a requirement for Serrate during wing and haltere development . Targeted ectopic expression of Serrate in the imaginal discs using the yeast transcriptional activator Gal4 results in regionally restricted induction of cell proliferation, e.g . the ventral tissues in the case of the wings and halteres . The results suggest that the wild-type function of Serrate is required for the control of position-specific cell proliferation during development of meso- and metathoracic dorsal discs, which in turn exerts a direct effect on morphogenesis.

J Clin Invest, 1994 Mar, 93(3), 944 - 50
17 beta-Estradiol inhibits expression of human interleukin-6 promoter-reporter constructs by a receptor-dependent mechanism; Pottratz ST et al.; We previously reported that 17 beta-estradiol inhibits cytokine-stimulated bioassayable IL-6 and the steady-state level of IL-6 mRNA . To determine the molecular basis of this effect, the transient expression of chloramphenicol acetyltransferase (CAT) reporter plasmid driven by the human IL-6 promoter was studied here in HeLa or murine bone marrow stromal cells (MBA 13.2) . 17 beta-estradiol (10(-8) M) completely suppressed stimulated CAT expression in HeLa cells cotransfected with IL-6/CAT constructs and a human estrogen receptor (hER) expression plasmid; but had no effect on reporter expression in HeLa cells not transfected with hER . 17 beta-estradiol also inhibited stimulated expression in MBA 13.2 cells (which express the estrogen receptor constitutively) without the requirement of cotransfection of the hER plasmid . The hormonal effects were indistinguishable between constructs containing a 1.2-kb fragment of the 5' flanking region of the IL-6 gene or only the proximal 225-bp fragment . However, yeast-derived recombinant hER did not bind to the 225-bp segment in DNA band shift assays, nor did the 225-bp fragment compete for binding of an estrogen response element oligonucleotide to yeast-derived estrogen receptor . These data suggest that 17 beta-estradiol inhibits the stimulated expression of the human IL-6 gene through an estrogen receptor mediated indirect effect on the transcriptional activity of the proximal 225-bp sequence of the promoter.

Chemotherapy, 1994 Mar-Apr, 40(2), 92 - 8
In vitro susceptibility of fungal isolates of clinically important specimens to itraconazole, fluconazole and amphotericin B; Dermoumi H; The in vitro activity of itraconazole, fluconazole and amphotericin B was tested against 207 yeast strains and 3 Aspergillus fumigatus strains isolated from blood . The other 42 A . fumigatus strains were selected from respiratory tract infections . A microdilution method was employed to determine the inhibitory concentrations to restrain 70% of isolate growth (IC30) . The inhibition concentrations of amphotericin B are all around the value 0.25 mg/l with a deviation of two concentration degrees, indicating sensitivity of all strains . The test results of itraconazole showed the majority of strains in the range of sensitivity (200 isolates) and low sensitivity (44 isolates) . Five of 19 Candida glabrata strains demonstrated resistance to itraconazole . The results of fluconazole showed a good sensibility of C . albicans, but 4.5% of strains were resistant . Low sensitivity (1 strain) and resistance (24 strains) were evaluated for C . glabrata and C . krusei isolates . No strain of A . fumigatus was inhibited by fluconazole . The data show the necessity of in vitro tests.

RN, 1994 Mar, 57(3), 44 - 7
Teaching teens about condoms; Bolus J; PIP: Detailed information was given which would be useful in advising adolescents about condoms and safe sexual practices . The concern is for protection from HIV infection and sexually transmitted diseases . 3% of the HIV-infected and sexually transmitted diseases . 3% of the HIV-infected population are currently adolescents . In teaching about condoms it was stressed that adolescents expect a willingness and openness in maintaining a discussion about all aspects of sex, and if the teacher is uneasy, then another teacher should be presenting the information and instruction . Important points were that AIDS is most likely to be transmitted through anal sex, and that even HIV-infected partners should use condoms, and that condoms should be used for protection regardless of sexual practices . Latex condoms are the most effective in preventing diseases are porous . US-made condoms meet strict standards and have expiration dates clearly marked on the box and on the condom wrapper . The safest are latex condoms with nonoxynol-9 as a lubricant . Latex condoms deteriorate in heat, sunlight, and moisture and should be carried in a breast pocket or purse . Never use condoms from an unsealed package . Instructions for use were provided in a description and in drawings . Females with yeast infections are advised to refrain from sex until the infection is cleared up because of the increased risk of infection; use plenty of spermicide when having sex during yeast infections . Allergies to latex or spermicides can be handled by applying a lambskin condom over the latex one or by applying a condom without spermicidal lubricant over a lubricated one . For a man's allergy, use the lambskin first and then the latex . After ejaculation, withdrawal should be immediate to prevent semen from leaking out . Holding the rim will assure that the condom does not slip off . Three ways of safe condom removal were recommended . Hands and genitals should be washed before putting on a new condom . Nonlubricated male (or female) condoms should be used for oral sex . Food placed on genitals should be free from oils . Biting and nibbling can puncture latex . Lubricated condoms should be used for anal sex . Advice on insertion of female condoms and the warning that effectiveness is unknown was provided .

Hum Genet, 1994 Mar, 93(3), 291 - 4
Refining the genetic map for the region flanking the X-linked hypophosphataemic rickets locus (Xp22.1-22.2); Rowe PS et al.; We have screened fourteen kindreds with X-linked hypophosphataemic rickets with four microsatellite markers, viz AFM163yh2, DXS999 (AFM234yf12), DXS443 and DXS365, in order to refine the genetic map flanking the gene, and to define a close flanking interval for the construction of a yeast artificial chromosome (YAC) and cosmid contig . The genetic data were enhanced after the isolation of a large 1.2-megabase YAC derived from AFM163yh2, in which marker DXS274 was present but not DXS365 or DXS443 . Against HYP, DXS365, AFM163yh2 and DXS443 showed no recombinants (Zmax = 18.1, Zmax = 9.9, and Zmax = 16.0 respectively) . DXS999 gave Zmax = 9.6 at 4% recombination and lies distal to HYP but proximal to DXS197 and DXS43 . The disease gene and markers AFM163yh2 and DXS365 are flanked by DXS443 and DXS274 . Combining the genetic and physical data, we are able to propose the following gene marker order: Xptel-DXS43-DXS197-DXS999-DXS443-{(DXS3 65-AFM163yh2), HYP}-DXS274-DXS41-Xcen.

Hum Genet, 1994 Mar, 93(3), 229 - 35
Multicolor fluorescence in situ hybridization on metaphase chromosomes and interphase Halo-preparations using cosmid and YAC clones for the simultaneous high resolution mapping of deletions in the dystrophin gene; Tocharoentanaphol C et al.; We report on multicolor fluorescence in situ hybridization protocols for the simultaneous visualization of deletion-prone regions for carrier detection of Duchenne/Becker (DMD/BMD) muscular dystrophy . Cosmid and yeast artificial chromosome (YAC) clones specific for preferentially deleted subregions of the dystrophin gene were labeled differentially and detected with three different fluorochromes using digital imaging microscopy . This approach allows for an assessment of the carrier status of female relatives even in families where no index patient is available . Cosmid and YAC clones, and different probe-generation protocols are compared with respect to their feasibility for carrier detection . The use of histone-depleted interphase nuclei (Halo-preparations) for deletion mapping is demonstrated and shown to have a resolution power of 5 kb.

Blood, 1994 Mar 1, 83(5), 1348 - 54
DNA rearrangements proximal to the EVI1 locus associated with the 3q21q26 syndrome; Levy ER et al.; Specific rearrangements involving 3q21 and 3q26 are well documented in acute myeloid leukemia (AML) . Aberrant expression of the Ecotropic virus integration-1 (EVI1) gene, located at 3q26, has been reported in individuals with AML and translocations or inversions of chromosome 3 long arm . We have studied six individuals with AML and inv(3)(q21q26) for disruptions to the EVI1 locus by in situ hybridization and long-range mapping . EVI1 transcripts have been detected in the blast cells of the two individuals available for expression studies . We derived a YAC containing the EVI1 gene and showed that it crossed the 3q26 inversion breakpoints in three of four cases examined . Pulsed field analysis detected aberrant fragments 3' of the EVI1 gene in all six patients . The orientation of the gene was established and the locations of the breakpoints were refined by in situ hybridization using phage clones from this region.

Am J Hum Genet, 1994 Mar, 54(3), 526 - 34
A radiation hybrid map of the BRCA1 region; O'Connell P et al.; A locus on chromosome 17q, designated "BRCA1," has been identified as a predisposition gene for breast cancer . A panel of chromosome 17-specific radiation-reduced somatic cell hybrid clones has been assembled for high-resolution mapping of chromosome 17 . A series of 35 markers, known to span the BRCA1 locus, were tested against this hybrid panel by PCR assays . Statistical analysis of these data yields a BRCA1 radiation hybrid map at a density sufficient to initiate YAC cloning and pulsed-field gel electrophoretic mapping of the candidate region . In addition, many of the markers reveal genetic polymorphisms and may be tested in breast cancer families and in loss-of-heterozygosity studies of sporadic breast cancers to better define the BRCA1 gene candidate region.

Am J Hum Genet, 1994 Mar, 54(3), 516 - 25
Genetic mapping of the BRCA1 region on chromosome 17q21; Albertsen H et al.; Chromosome 17q21 harbors a gene (BRCA1) associated with a hereditary form of breast cancer . As a step toward identification of this gene itself we developed a number of simple-sequence-repeat (SSR) markers for chromosome 17 and constructed a high-resolution genetic map of a 40-cM region around 17q21 . As part of this effort we captured genotypes from five of the markers by using an ABI sequencing instrument and stored them in a locally developed database, as a step toward automated genotyping . In addition, YACs that physically link some of the SSR markers were identified . The results provided by this study should facilitate physical mapping of the BRCA1 region and isolation of the BRCA1 gene.

Mol Biochem Parasitol, 1994 Mar, 64(1), 95 - 110
Expression of heat shock protein 83 in Leishmania is regulated post-transcriptionally; Argaman M et al.; Mechanisms for regulation of heat shock protein (hsp) 83 expression were examined in Leishmania amazonesis . Transcripts of hsp83 accumulated upon temperature elevation; however, in contrast to non-protozoan eukaryotes (i.e . Drosophila, yeast, avian or human cells), no transcriptional activation was observed . The increase in the hsp83 mRNA level evolved from temperature induced variations in mRNA turn-over: the hsp83 transcript was rapidly degraded at normal temperatures, whereas heat shock led to its stabilization . The quick decay of the mRNA at lower temperatures was dependent on active protein synthesis . A similar pattern of regulation was observed for the transfected chloramphenicol acetyltransferase (CAT) gene, which was flanked by sequences from the hsp83 intergenic region (IR), and cloned into the pX transfection vector (pX-ICI) . CAT mRNA was abundant at normal temperatures and further accumulated upon temperature elevation . The altered turn-over rates of CAT mRNA at the different temperatures were observed only in the presence of flanking hsp83 IR sequences . The increase in temperature also affected translational regulation of hsps, and synthesis of hsp83 was more efficient at 35 degrees C than at 26 degrees C . However, the effect of translation was transient, and the steady state level of the protein was hardly altered.

Virus Genes, 1994 Mar, 8(2), 151 - 8
Chilo iridescent virus encodes a putative helicase belonging to a distinct family within the "DEAD/H" superfamily: implications for the evolution of large DNA viruses; Sonntag KC et al.; The complete nucleotide sequence of the EcoRI DNA fragment M (7099 bp; 0.310-0.345 map units) of the genome of insect iridescent virus type 6--Chilo iridescent virus (CIV)--was determined . A 606 codon open reading frame located in this region encoded a protein (p69) related to a distinct family of putative DNA and/or RNA helicases belonging to the "DEAD/H" superfamily . Unique sequence signatures were derived that allowed selective retrieval of the putative helicases of the new family from amino acid sequence databases . The family includes yeast, Drosophila, mammalian, and bacterial proteins involved in transcription regulation and in repair of damaged DNA . It is hypothesized that p69 of CIV may be a DNA or RNA helicase possibly involved in viral transcription . A distant relationship was observed to exist between this family of helicases and another group of proteins that consists of putative helicases of poxviruses, African swine fever virus, and yeast mitochondrial plasmids . It is shown that p69 of CIV is much more closely related to cellular helicases than any of the other known viral helicases . Phylogenetic analysis suggested an independent origin for the p69 gene and the genes encoding other viral helicases.

Mycopathologia, 1994 Mar, 125(3), 157 - 62
Comparison of four media for the isolation of Aspergillus flavus group fungi; Cotty PJ; Four agar media used to isolate aflatoxin producing fungi were compared for utility in isolating fungi in the Aspergillus flavus group from agricultural soils collected in 15 fields and four states in the southern United States . The four media were Aspergillus flavus and parasiticus Agar (AFPA, 14), the rose bengal agar described by Bell and Crawford (BCRB; 3), a modified rose bengal agar (M-RB), and Czapek's-Dox Agar supplemented with the antibiotics in BC-RB (CZ-RB) . M-RB was the most useful for studying the population biology of this group because it permitted both identification of the greatest number of A . flavus group strains and growth of the fewest competing fungi . M-RB supported an average of 12% more A . flavus group colonies than the original rose bengal medium while reducing the number of mucorales colonies and the number of total fungi by 99% and 70%, respectively . M-RB was successfully employed to isolate all three aflatoxin producing species, A . flavus, A . parasiticus and A . nomius, and both the S and L strains of A . flavus . M-RB is a defined medium without complex nitrogen and carbon sources (e.g . peptone and yeast extract) present in BC-RB . M-RB should be useful for studies on the population biology of the A . flavus group.

Mol Microbiol, 1994 Mar, 11(5), 897 - 902
Disruption of two genes for chitin synthase in the phytopathogenic fungus Ustilago maydis; Gold SE et al.; The phytopathogenic fungus Ustilago maydis exhibits a dimorphic transition in which non-pathogenic, yeast-like cells mate to form a pathogenic, filamentous dikaryon . Northern analysis indicated that two chitin synthase genes, chs1 and chs2, from U . maydis are expressed at similar levels in yeast-like cells and in cells undergoing the mating reaction leading to the filamentous cell type . A mutation was constructed in each of the chitin synthase genes by targeted gene disruption . Each mutant showed a reduction in the level of trypsin-activated enzyme activity, compared with a wild-type strain, but retained the wild-type morphology, the ability to mate and the ability to form the filamentous pathogenic cell type.

Genomics, 1994 Mar 1, 20(1), 75 - 83
Identification of YAC and cosmid clones encompassing the ZFX-POLA region using irradiation hybrid cell lines; Francis F et al.; The human Xp21.3-p22.1 region is poorly mapped relative to other X chromosome regions . To target cosmid and YAC clones specifically from Xp21.3-p22.1 for rapid contig construction, a hybridization-based screening approach using irradiation hybrids has been used . Alu-PCR products generated from hybrid lines containing small overlapping fragments from Xp21-p22 were hybridized to an X chromosome cosmid library, and cosmids predicted by their hybridization pattern to map to the region of interest were analyzed by fluorescence in situ hybridization (FISH) . Hybridization of the cosmids in pools to gridded YAC libraries identified 15 YACs, which were verified and tested for chimerism by FISH . Cosmid content analysis of the YACs defined two contigs, one with 12 YACs covering about 1.5 Mb and one with 3 YACs . Five YACs from the 12-YAC cluster had been previously recognized by DNA polymerase alpha (POLA) . ZFX identified a single YAC; hence, the physical linkage of ZFX and POLA was demonstrated within the contig . Four YACs had been isolated previously with ZFX and these extend the contig to 2 Mb . Restriction mapping of several YACs demonstrates that ZFX and POLA are about 700 kb apart, a distance similar to that reported in the mouse between Zfx and Pola . The order of these two loci and two additional loci identified by homologous mouse linking clones was found to be conserved between human and mouse: tel-ZFX-DXCrc57-DXCrc140-POLA-cen . We have shown that YAC contigs can be rapidly constructed from targeted regions without the need for time-consuming YAC end rescue and chromosomal walking.(ABSTRACT TRUNCATED AT 250 WORDS)

Genomics, 1994 Mar 1, 20(1), 116 - 8
Localization of the squalene synthase gene (FDFT1) to human chromosome 8p22-p23.1; Schechter I et al.; Recently, we reported the isolation of a cDNA encoding the human enzyme squalene synthase, the first step of sterol biosynthesis uniquely committed to synthesis of cholesterol (6) . As such, it is likely that this enzyme occupies a critical regulatory position in the synthesis of cholesterol . As part of continuing studies of the role of this gene in cellular metabolism, we undertook the mapping of this gene on the human chromosomes . To localize the gene, we have first isolated a yeast artificial chromosome (YAC) containing the squalene synthase gene . We then used fluorescence in situ hybridization (FISH) with yeast DNA containing the YAC to localize the gene to chromosome 8 . Assignment to human chromosome 8 was confirmed by polymerase chain reaction analysis of a somatic cell hybrid containing human chromosome 8 . Use of a somatic cell hybrid regional mapping panel dividing chromosome 8 into several fragments localized the gene to 8p21-pter . Fractional length analysis of the FISH mapping placed the signal generated with this YAC at 8p22-p23.1.

Hum Mol Genet, 1994 Mar, 3(3), 437 - 42
Molecular characterisation of the human apo(a)-plasminogen gene family clustered on the telomeric region of chromosome 6 (6q26-27); Magnaghi P et al.; The genes coding for apo(a) and plasminogen belong to a family of related genes sharing several structural sequences like leader, kringle, and protease domains . YAC cloning has allowed to understand that all these genes are clustered within 400 Kb of genomic DNA on the telomeric region of chromosome 6 (6q26-27) . We have now characterized the two remaining members of the apo(a) and plasminogen gene cluster . One of them was found to contain a leader highly homologous to that of apo(a) and plasminogen, followed by several kringle IV-like units, kringle V and protease domains although no tail sequences could be detected . This apo(a)-like gene was found to be expressed at the RNA level in liver although an in-frame stop codon was detected in one of its kringle units . The other member of the cluster besides the leader shows a plasminogen tail-like domain whose sequences contain a frameshift resulting in a stop codon; another mutation, destroying a consensus splicing site, has been found in a large intron separating the exon coding for the leader from the one encoding the tail-like sequences . The structural organisation of this cluster suggests that new arrangements of these four genes will be a likely finding.

Boll Chim Farm, 1994 Mar, 133(3), 160 - 2
Bioavailability of selenium from selenium preparations in rats; Ryszka F et al.; In the study the relative bioavailability as well as the extent of bioavailability of selenium after a single intragastric administration of selenium yeast and sodium selenite have been determined . Also, the mean values of biopharmaceutical parameters of the tested selenium preparations have been presented.

Somat Cell Mol Genet, 1994 Mar, 20(2), 137 - 42
Identification of human chromosome region 3p14.2-21.3-specific YAC clones using Alu-PCR products from a radiation hybrid; Siden TS et al.; Deletion of DNA sequences from at least three different regions on the short arm of human chromosome 3 (3p13-14, 3p21 and 3p25) are frequently observed during the development of many solid tumors, including lung cancers and renal cell carcinomas . In order to physically characterize the 3p21 region, we previously identified a radiation fusion hybrid that contained about 20 megabases of DNA from chromosome region 3p14.2-p21.3 . In this study total Alu-PCR products from this hybrid were used as a probe to isolate 86 yeast artificial chromosomes (YAC) clones from a 620-kb average insert YAC library (ICRF) . Sixty-nine Alu-PCR markers, generated from the YACs, and seven PCR primers were used to screen for overlaps between individual clones . Seven contigs were identified encompassing 32 YAC clones . Based on previous information about localization of the PCR primers, the three largest contigs could be assigned to smaller subregions between 3p14.2 and 3p21.3 . By this work a large proportion of the 3p14.2-21.3 region is covered with large-insert YAC clones.

Somat Cell Mol Genet, 1994 Mar, 20(2), 133 - 6
Region-specific microdissection library and single-copy microclones for human chromosome 2p11-p13; Yu J et al.; We report the construction and characterization of a region-specific microdissection library for human chromosome 2p11-p13 . This library (designated 2P4 library) is large, comprising 600,000 recombinant microclones . Thirty to 40% of the clones contain unique sequences . The insert sizes range from 100 to 800 bp, with a mean of 380 bp . A subset of the microclones was selected, based on their weak or no hybridization to total human DNA, for further analysis . Of 50 single-copy microclones analyzed, 35 clones (70%) were derived from human and are chromosome 2-specific . The insert sizes and the hybridizing genomic HindIII fragments of these clones were also determined . The 2P4 microdissection library and the single-copy microclones from the library are useful in preparing STS (sequence-tagged site) to isolate corresponding YAC (yeast artificial chromosome) or other clones with large inserts and for isolating region-specific cDNA clones as candidate genes for cloning disease-related genes assigned to this region.

J Cell Sci, 1994 Mar, 107 ( Pt 3), 387 - 96
Cytostellin distributes to nuclear regions enriched with splicing factors; Bregman DB et al.; Cytostellin, a approximately 240 kDa phosphoprotein found in all cells examined from human to yeast, is predominantly intranuclear in interphase mammalian cells and undergoes continuous redistribution during the cell cycle . Here, mammalian cytostellin is shown to localize to intranuclear regions enriched with multiple splicing proteins, including spliceosome assembly factor, SC-35 . Cytostellin and the splicing proteins also co-localize to discrete foci (called 'dots'), which are distributed throughout the cell during mitosis and part of G1 . The cytostellin that is localized to these dots resists extraction by Triton X-100, indicating that it is tightly associated with insoluble cell structures . All immunostainable cytostellin reappears in the nucleus before S-phase . Although cytostellin and the splicing proteins co-localize in interphase and dividing cells, cytostellin is not detected in purified spliceosomes, and it associates with six unidentified proteins, forming a macromolecular complex that is biochemically distinct from the proteins that comprise spliceosomes . This macromolecular complex is detected at constant levels throughout the cell cycle, and the level of cytostellin protein remains constant during the cell cycle . Nevertheless, intranuclear cytostellin immunostaining fluctuates markedly during the cell cycle . The monoclonal antibody (mAb) H5 epitope of cytostellin is 'masked' in serum-starved cells, but 60 minutes after serum stimulation intense cytostellin immunoreactivity appears in the nuclear speckles . This rapid induction of cytostellin immunoreactivity in subnuclear regions enriched with many splicing factors, as well as accumulations of RNA polymerase II (Pol II) transcripts, suggests that cytostellin may have a function related to mRNA biogenesis.

Genetics, 1994 Mar, 136(3), 913 - 26
Effects of the maleless mutation on X and autosomal gene expression in Drosophila melanogaster; Hiebert JC et al.; The mutational effect of the maleless (mle) gene in Drosophila has been reexamined . Earlier work had suggested that mle along with other male-lethal genes was responsible for hypertranscription of the X chromosome in males to bring about dosage compensation . Prompted by studies on dosage sensitive regulatory genes, we tested for effects of mlets on the phenotypes of 16 X or autosomal mutations in adult escapers of lethality . In third instar larvae, prior to the major lethal phase of mle, we examined activities of 6 X or autosomally encoded enzymes, steady state mRNA levels of 15 X-linked or autosomal genes and transcripts from two large genomic segments derived from either the X or from chromosome 2 and present in yeast artificial chromosomes . In contrast to the previously hypothesized role, we detected pronounced effects of mle on the expression of both X-linked and autosomal loci such that a large proportion of the tested genes were increased in expression, while only two X-linked loci were reduced . The most prevalent consequence was an increase of autosomal gene expression, which can explain previously observed reduced X:autosome transcription ratios . These observations suggest that if mle plays a role in the discrimination of the X and the autosomes, it may do so by modification of the effects of dosage sensitive regulatory genes.

Genetics, 1994 Mar, 136(3), 1001 - 11
P element-mediated in vivo deletion analysis of white-apricot: deletions between direct repeats are strongly favored; Kurkulos M et al.; We have isolated and characterized deletions arising within a P transposon, P{hswa}, in the presence of P transposase . P{hswa} carries white-apricot (wa) sequences, including a complete copia element, under the control of an hsp70 promoter, and resembles the original wa allele in eye color phenotype . In the presence of P transposase, P{hswa} shows a high overall rate (approximately 3%) of germline mutations that result in increased eye pigmentation . Of 234 derivatives of P{hswa} with greatly increased eye pigmentation, at least 205 carried deletions within copia . Of these, 201 were precise deletions between the directly repeated 276-nucleotide copia long terminal repeats (LTRs), and four were unique deletions . High rates of transposase-induced precise deletion were observed within another P transposon carrying unrelated 599 nucleotide repeats (yeast 2 mu FLP; recombinase target sites) separated by 5.7 kb . Our observation that P element-mediated deletion formation occurs preferentially between direct repeats suggests general methods for controlling deletion formation.

Neuropharmacology, 1994 Mar-Apr, 33(3-4), 319 - 24
The molecular evolution of G protein-coupled receptors: focus on 5-hydroxytryptamine receptors; Peroutka SJ et al.; Phylogenetic comparisons between homologous proteins can provide information on the rates of molecular evolution of the proteins . G protein-coupled receptors are a "superfamily" of proteins which exist in species ranging from yeast to man . Based on an analysis of the percentage of amino acid homology between various species, the rate of molecular evolution of G protein-coupled receptors can be estimated at approx 1% per 10 million years . Based on this assumption, the primordial 5-HT receptor must have evolved more than 700-800 million years ago since the 3 major classes of G protein-coupled 5-HT receptors (i.e . 5-HT1, 5-HT2 and 5-HT6 receptors) are less than 25% homologous . 5-HT5, 5-HT7, 5-HTsnail, 5-HTdro and 5-HT1A receptors differentiated approx 600-700 million years ago, the time period during which vertebrates diverged from invertebrates . The mammalian 5-HT receptor subtypes have differentiated over the past 90 million years . Thus, although a recent flurry of "new" 5-HT receptors have appeared in the literature, the first "primordial" 5-HT receptor evolved over 750 million years ago, a date which likely predates the evolution of muscarinic, dopaminergic and adrenergic receptor systems . This analysis also predicts that a significant number of both mammalian and invertebrate G protein-coupled 5-HT receptor subtypes remain to be identified.

Wiad Lek, 1994 Mar, 47(5-6), 198 - 202
{Modulatory properties of selenium in immune processes}; Jendryczko A; Selenium, administered in various forms, is promoted as an immunostimulating agent . However, the relationship between selenium status of the organism and the immune system is particularly complex . Taking into account the results obtained from various animal models it is now difficult to find the site or sites of selenium action on the immune system . It is not known whether selenium exerts effect on all or only on selected stages of immune response . The survey of literature which includes in vast majority experiments on various animals, shows that selenium is an immunostimulating agent only under certain conditions and in adequate concentration . Further studies have to be performed before selenium in the form of selenium yeast or in another form is a recognized immunostimulator and could be accepted for medical practice.

Indian J Pediatr, 1994 Mar-Apr, 61(2), 183 - 8
Simultaneous administration of hepatitis B vaccine with other E.P.I . vaccines; Mittal SK et al.; Development of recombinant DNA vaccine against hepatitis B grown on cultured yeast cell has made it possible to mount a world-wide effort to control and eradicate Hepatitis B infection . However, the currently recommended schedules (0, 1 & 2 months, and 0-1 and 6 months) do not coincide with the scheduled visits for other E.P.I . vaccines, and necessitate additional visits for Hepatitis B vaccination . This study was therefore carried out to find out if adequate seroconversion occurs to Hepatitis B vaccine when given with other EPI vaccines or not? Thirty nine infants born to Australia antigen positive mothers from among 850 screened pregnant mothers were recruited to receive Hepatitis B vaccine (Engerix B-10 micro gram each) at 0, 6 and 14 wks (group A) or at 0, 1 and 2 months (group B) . Thirty-one infants were recruited in group A and 8 in group B . The cord blood was collected and the first dose of vaccine was given within 48 hours of birth . Simultaneous B.C.G . was given at the left deltoid . Other E.P.I . vaccines were given qt 6, 10 and 14 wks in group A and at 2, 3 and 4 months in group B . Repeat blood samples were collected prior to giving each dose of Hepatitis B vaccine, and 4 weeks after the last dose . All blood samples were assayed for HBsAg and HBsAb at the National Institute Of Communicable Diseases, utilizing standard ELISA kits . The seroconversion rates following one, two and three doses of Hepatitis B vaccine were 3.33%, 55.5%, 96.15% and 0%, 62.5% and 100% in group A and B respectively.(ABSTRACT TRUNCATED AT 250 WORDS)

Curr Genet, 1994 Mar, 25(3), 233 - 8
Replacement of a conserved glycine residue in subunit II of cytochrome c oxidase interferes with protein function; Wilson TM et al.; In this paper we describe the isolation and characterization of a respiration-deficient yeast strain which is defective in the function of subunit II of cytochrome c oxidase . This strain, VC32, carries a mutation in the mitochondrial COX2 gene which converts a conserved glycine residue to arginine . The conserved glycine is in a region implicated as important for ligating the CuA redox center and for interaction with cytochrome c . We have also characterized five revertants of VC32 which have recovered respiratory function; all five were mapped to the mitochondrial genome . In three of the five revertants the wild-type glycine codon is restored, while in two of the five the mutant arginine codon is still present . These two strains are likely to possess alterations either in components of the mitochondrial translation machinery or in mitochondrially-encoded gene products that interact directly with subunit II to assemble an active oxidase complex.

Mycoses, 1994 Mar-Apr, 37(3-4), 131 - 5
A miconazole lacquer in the treatment of Candida-associated denture stomatitis; Budtz-Jorgensen E et al.; An open randomized controlled study involving two parallel treatment groups comprising 50 patients with Candida-associated denture stomatitis was performed to evaluate the efficacy and safety of one application of 1 g of miconazole 55 mg/g denture lacquer in comparison with that of a commercially available miconazole 2% gel applied four times daily for 2 weeks . The results showed a pronounced reduction in the yeast scores and a reduction in the palatal erythema in both treatment groups, but there was no apparent difference between the efficacy of the two treatments . The results indicate that a single application of the denture lacquer (55 mg of miconazole) is safe and almost as effective as administration of gel four times a day for 2 weeks (3000 mg of miconazole).

Mycoses, 1994 Mar-Apr, 37(3-4), 127 - 30
Bioavailability of fluconazole in the skin after oral medication; Wildfeuer A et al.; Fluconazole is an antimycotic drug which until now has been used mostly in the systemic therapy of yeast infections . We have now demonstrated the presence of this drug in various skin structures . After administration of 50 mg of fluconazole per day for 12 days to healthy volunteers, the following mean drug concentrations were measured: serum 1.81 micrograms ml-1, sweat 4.58 micrograms ml-1, dermis-epidermis (without stratum corneum) 2.77 micrograms g-1 and stratum corneum 73 micrograms g-1 . Thus, 4 h after the last dose the antimycotic attains a 40-fold higher concentration in the stratum corneum than in serum . One week after ending the oral treatment, 5.8 micrograms g-1 fluconazole was present in stratum corneum . After daily ingestion of 200 mg of fluconazole for 5 days there was a further increase in the mean concentration of fluconazole in stratum corneum, to 127 micrograms g-1 . Even 4-5 months after completing the oral treatment, fluconazole was detectable in the head hair and toenails of healthy volunteers . Fluconazole is eliminated from the stratum corneum about 2-3 times more slowly than from serum or plasma . After oral administration fluconazole evidently accumulated rapidly and intensively into the stratum corneum . The concentrations then attained or exceeded the in vitro minimal inhibitory concentrations of fluconazole for most of the dermatophytes and yeasts which are involved in cutaneous mycoses.

Genes Chromosomes Cancer, 1994 Mar, 9(3), 173 - 9
Detailed analysis of loss of heterozygosity on chromosome band 17p13 in breast carcinoma on the basis of a high-resolution physical map with 29 markers; Isomura M et al.; We have constructed a physical map of chromosome band 17p13, using 29 markers that had been localized to 17p13 by means of fluorescence in situ hybridization (FISH) and analysis by pulsed-field gel electrophoresis (PFGE) . The map spans nearly 8 Mb of genomic DNA, and the estimated average distance between each marker is roughly 290 kb . The p13 band of chromosome 17 is thought to contain a putative tumor suppressor gene in addition and distal to TP53 . Deletion mapping in a large number of breast carcinomas indicated that the tumor suppressor gene lies between the loci defined by cC117-708 (D17S878) and p144D6 (D17S34), which are an estimated 7 Mb apart . Our results should contribute to construction of a contig map of chromosome band 17p13 with cosmid and/or YAC (yeast artificial chromosome) clones, and to isolation of the putative tumor suppressor gene.

Cell, 1994 Feb 25, 76(4), 735 - 46
The role of specific protein-RNA and protein-protein interactions in positive and negative control of pre-mRNA splicing by Transformer 2; Amrein H et al.; We have investigated the function of different structural domains of the Drosophila splicing regulator Transformer 2 (Tra2) . We find that the ribonucleoprotein consensus sequence (RNP-CS) of Tra2 is required for male fertility and positive and negative control of alternative splicing in transgenic flies, as well as for in vitro binding of recombinant Tra2 to doublesex and tra2 pre-mRNAs . Thus, all of the known functions of Tra2 require specific protein-RNA interactions . We also show that one of the two arginine-serine (RS)-rich domains of Tra2 is dispensable, while the other is essential for all of the in vivo functions . Part of this domain is also required for RNA binding in vitro . Significantly, the essential RS domain is also required for specific protein-protein interactions . We find that Tra2 interacts with itself, with the splicing regulator Transformer, and with the general splicing factor SF2 in vitro and in the yeast two-hybrid system . These results demonstrate that both protein-RNA and protein-protein interactions are involved in tra2-dependent activation and repression of alternative splicing.

Gene, 1994 Feb 25, 139(2), 235 - 9
Characterization of a novel murine testis-specific serine/threonine kinase; Bielke W et al.; Using degenerate oligos corresponding to two highly conserved motifs within the protein kinase catalytic domain and a PCR-based cloning strategy, we have isolated a cDNA fragment encoding a new member of the Ser/Thr (serine/threonine) family of protein kinases . Expression analysis revealed that the fragment recognized two transcripts (1.6 and 1.4 kb) exclusively in testis . Using this fragment as a probe, we have cloned a full-length cDNA from a mouse testis cDNA library . The sequence has a 1092-bp open reading frame encoding a protein of 364 amino acids . The N-terminally localized kinase catalytic domain has all the conserved motifs found in other Ser/Thr kinases . Northern blot analysis using the full-length sequence as a probe revealed that the cloned gene corresponds to the 1.6-kb transcript, suggesting the existence of at least two testis-specific novel Ser/Thr kinases . We propose the name testis-specific kinase-1 (TSK-1) for the gene described here . A GenEMBL databank search revealed highest homology to the human gene encoding rac protein kinase-beta and the group of yeast Ser/Thr kinases encoded by SNF-1, nim-1, KIN-1 and KIN-2.

Gene, 1994 Feb 25, 139(2), 147 - 53
Studies on the structure of the mouse CBF-A gene and properties of a truncated CBF-A isoform generated from an alternatively spliced RNA; Sohn KY et al.; CCAAT-binding factor (CBF), a heteromeric transcription factor that binds to sequences containing a CCAAT motif, is composed of three subunits, A, B and C, which are all required for DNA binding . The mouse CBF-A gene contains seven coding exons, which span 12 kb . Evidence is also presented for an additional 5' untranslated exon . The 90-amino-acid (aa) segment of CBF-A, which shows a high degree of sequence identity with the yeast transcription factor, HAP3, is split into exons 3 and 4 . An alternatively spliced RNA that lacks exon 3 was identified by polymerase chain reaction . Although removal of exon 3 interrupts the CBF-A reading frame, a potential start codon at the 3' end of exon 2 is in the same reading frame as the reading frame encoding CBF-A in exons 4 to 7 . A CBF-A polypeptide of the predicted 17-kDa, size, was indeed identified after in vitro transcription and translation of the DNA complementary to RNA (cDNA) corresponding to the alternatively spliced CBF-A mRNA . In contrast to full-length CBF-A, this truncated CBFA did not bind to a DNA sequence containing the CCAAT motif in the presence of the other two components of CBF . This result indicates that the segment corresponding to the exons missing in the truncated isoform of CBF-A is essential for the binding of CBF to DNA.

Biochim Biophys Acta, 1994 Feb 23, 1190(1), 193 - 6
Cloning, sequencing and expression of cDNA encoding an insect V-ATPase subunit E; Graf R et al.; This work presents the first invertebrate cDNA sequence encoding subunit E of a V-ATPase . It was cloned by immuno-shot-gun screening of a Manduca sexta (Insecta, Lepidoptera, Sphingidae) posterior larval midgut cDNA library . The amino acid sequence was 64% identical to that of the mammalian E-subunit and 34% to that of yeast . Southern and Northern blots suggested the existence of only one gene encoding the insect subunit E.

J Mol Biol, 1994 Feb 18, 236(2), 455 - 68
A chloroplast group I intron undergoes the first step of reverse splicing into host cytoplasmic 5.8 S rRNA . Implications for intron-mediated RNA recombination, intron transposition and 5.8 S rRNA structure; Thompson AJ et al.; The chloroplast 23 S rRNA gene of Chlamydomonas reinhardtii contains a self-splicing group I intron, Cr.LSU . Incubation of total RNA from C . reinhardtii with {alpha-32P}GTP produces a GTP-labeled RNA that is derived from Cr.LSU, but is approximately 95 nucleotides longer (and referred to as IA) . We show that IA is derived from an intermolecular reaction of Cr.LSU with cytoplasmic 5.8 S rRNA; the 3'-terminal G of the intron becomes ligated to A64 . This reaction, which was reproduced using synthetic RNAs, is identical to the first step of reverse splicing . The second step of reverse splicing did not occur with any efficiency, even though both P1 and P10-like helices can form between the reactive region of 5.8 S rRNA and the IGS of Cr.LSU . Cloning of IA provided a chimeric Cr.LSU precursor with the normal 3' exon substituted by 95 nucleotides of 5.8 S; this precursor spliced poorly despite having a potential P10 helix (between the 3'-exon and the IGS) . The inefficient reverse splicing of Cr.LSU into 5.8 S RNA and poor forward splicing of the chimera may be explained by competition between helices P1 (between the 5'-exon and IGS) and P10; competition between P1 and P10 is apparently not a factor in forward splicing of the wild-type LSU precursor . The sequence of the 5.8 S gene of C . reinhardtii was determined, and the published RNA sequence revised . A secondary structure model of C . reinhardtii 5.8 S rRNA was proposed incorporating the requirement for base-pairing to the IGS of Cr.LSU . The resulting structure resembles that recently proposed for yeast 5.8 S rRNA, and has considerable advantages over previous models of C . reinhardtii 5.8 S rRNA . These data describe a novel example of a naturally occurring ribozyme reacting with a naturally occurring RNA of the same cell; implications for ribozyme-mediated RNA recombination and intron transposition via reverse splicing are discussed.

Biochim Biophys Acta, 1994 Feb 16, 1204(2), 257 - 64
Primary structure of aspergillopepsin I deduced from nucleotide sequence of the gene and aspartic acid-76 is an essential active site of the enzyme for trypsinogen activation; Shintani T et al.; The coding region of the aspergillopepsin I (EC 3.4.23.18) gene occupies 1340 base pairs of the genomic DNA and is separated into four exons by three introns . The predicted amino-acid sequence of aspergillopepsin I consists of 325 residues and is 32% and 27% homologous with those of human pepsin and calf chymosin . The cDNA of the gene prepared from mRNA has been cloned and expressed in yeast cells . To identify the residue of the substrate binding pocket in determining the specificity of aspergillopepsin I towards basic substrates, this residue was replaced with a serine residue by site-directed mutagenesis . The mutation is a single amino-acid change, Asp-76 converted to Ser-D76S, in the enzyme . The striking feature of this is that only the trypsinogen activating activity was destroyed . We therefore concluded that Asp-76 is the binding site towards basic substrates.

Eur J Biochem, 1994 Feb 15, 220(1), 55 - 61
Purification, characterization, primary structure, crystallization and preliminary crystallographic study of a serine proteinase from Streptomyces fradiae ATCC 14544; Kitadokoro K et al.; A proteinase having wide substrate specificity was isolated from Streptomyces fradiae ATCC 14544 . This proteinase, which we propose to call SFase-2, was purified from the culture filtrate by S-Sepharose chromatography . The purified enzyme showed an apparent molecular mass of 19 kDa on SDS/PAGE . When synthetic peptides were used as substrates, SFase-2 showed broad substrate specificity . It also hydrolyzed keratin, elastin and collagen as proteinaceous substrates . It was completely inhibited by diisopropylfluorophosphate and chymostatin, but not by tosylphenylalaninechloromethane, tosyllysinechloromethane or EDTA, indicating that it can be classified as a serine proteinase . The matured protein sequence of SFase-2 was determined by a combination of amino acid sequencing and the DNA sequencing of the gene . SFase-2, consisting of 191 amino acids, is a novel proteinase . It showed 76% similarity in the amino acid sequence with Streptomyces griseus proteinase A {Johnson P . and Smillie L . B . (1974) FEBS Lett . 47, 1-6} . For insight into the three-dimensional structure of SFase-2, we obtained single crystals by the vapor diffusion method using sodium phosphate as a precipitant . These crystals belonged to the orthorhombic, space group P2(1)2(1)2(1) with cell dimensions a = 6.92 nm, b = 7.28 nm, c = 2.99 nm; one molecule was present in the asymmetric unit.

J Biol Chem, 1994 Feb 11, 269(6), 3913 - 6
Interaction of Ras and Raf in intact mammalian cells upon extracellular stimulation; Hallberg B et al.; It has recently been shown that Ras proteins interact directly with Raf serine/threonine kinases in vitro and in the yeast two-hybrid system, leading to speculation that Raf proteins function as effectors for Ras . Here it is demonstrated that the endogenous Raf-1 protein co-immunoprecipitates with Ras from mammalian cells when the non-neutralizing anti-Ras monoclonal antibody Y13-238 is used . The formation of a Ras-Raf complex is absolutely dependent on prior treatment of the cells with a stimulus that activates Ras: phorbol ester or anti-T cell receptor antibody in the case of human peripheral blood T lymphoblasts, or epidermal growth factor in the case of Rat-1 fibroblasts . Up to 3% of cellular Raf-1 can be found in association with Ras . The association is not competed by addition of exogenous GST-Raf to the cell lysates and is therefore unlikely to be due to Ras-Raf binding after cell lysis . Specific interaction of Ras and Raf therefore occurs in intact mammalian cells in response to stimuli that cause Ras to become GTP-bound.

Gene, 1994 Feb 11, 139(1), 35 - 42
Identification of sequences responsible for transcriptional regulation of the strongly expressed methanol oxidase-encoding gene in Hansenula polymorpha; Godecke S et al.; The methylotrophic yeasts have been the subject of intensive studies, because of their highly regulated methanol metabolism and the biogenesis of peroxisomes . We investigated the 5' regulatory region of the MOX gene from the yeast, Hansenula polymorpha, encoding the peroxisomal methanol oxidase, the key enzyme of methanol metabolism . This tightly regulated yeast promoter of approximately 1.5 kb is unusually large, and also of remarkable strength under inducing conditions, belonging to the strongest yeast promoters yet described . Deletion analyses revealed a complex promoter structure composed of several sequence elements with positive and negative regulatory effects on reporter gene expression and a pronounced cooperation between the elements . Specific binding of several factors was detected in vitro by gel retardation and DNase I footprinting experiments . On the basis of deletion data, two binding sites could be identified as upstream activation sequences (UAS1 and UAS2) and one binding site as an upstream repressing sequence (URS1).

Biochim Biophys Acta, 1994 Feb 10, 1211(1), 85 - 96
Conversion of acetyl-coenzyme A into 3-hydroxy-3-methylglutaryl-coenzyme A in radish seedlings . Evidence of a single monomeric protein catalyzing a FeII/quinone-stimulated double condensation reaction; Weber T et al.; We solubilized from radish membranes and purified to apparent homogeneity a monomeric protein (55.5 kDa) capable of catalyzing the two-step conversion of acetyl-CoA into 3-hydroxy-3-methylglutaryl(HMG)-CoA . Unlike the situation described for other eukaryotes (yeast, animals), both enzyme activities needed for HMG-CoA synthesis (acetoacetyl-CoA thiolase, AACT and HMG-CoA synthase, HMGS) appear to be localized on a single polypeptide . Thus, the enzyme system is further referred to as AACT/HMGS . The reaction as catalyzed by purified AACT/HMGS is strongly stimulated in vitro in presence of FeII-chelates (namely EDTA) and of quinone cofactors with pyrroloquinoline quinone (PQQ) being by far the most effective one studied so far . Whereas the FeII stimulation is apparently due to a Vmax effect, PQQ increases the affinity of the enzyme system towards acetyl-CoA (1.9 microM vs . 5.9 microM, at 50 microM FeII, 100 microM EDTA, 20 microM PQQ) . Stimulation by naphthoquinone (NQ) can be overcome in the presence of halogenated NQ-derivatives, while activation by PQQ remains unaffected, possibly indicating a much more specific-binding of the latter cofactor . Gel filtration experiments of enzyme after preincubation in presence of PQQ indicate that there is no covalent-binding of the quinone cofactor to the enzyme . As is also shown with partially purified enzyme from maize membranes, phenylhydrazine, known to react with PQQ as the prosthetic group of quinoproteins (see van der Meer et al . (1987) FEBS Lett . 221, 299-304), efficiently inhibits the reaction . The data lead us to suggest a reaction mechanism that involves radical formation by the redox couple FeII/PQQ, thereby possibly facilitating the energetically unfavorable Claisen condensation as catalyzed during the first partial (AACT) reaction.

J Biol Chem, 1994 Feb 4, 269(5), 3887 - 90
Topology of the Neurospora plasma membrane H(+)-ATPase . Localization of a transmembrane segment; Lin J et al.; The Neurospora plasma membrane H(+)-ATPase is a polytopic integral membrane protein . To localize transmembrane segments, mutants were constructed that contained the amino and carboxyl termini of the H(+)-ATPase with putative transmembrane segment . A stretch of amino acid residues from yeast invertase that has three consensus N-linked glycosylation sites was placed carboxyl terminal of the putative transmembrane segment . RNA transcripts of these mutants were translated in a Neurospora in vitro system that was supplemented with microsomes from Neurospora . By the criteria of glycosylation of the polypeptide chain, resistance to extraction at pH 11.5, and protection from proteinase K digestion, only one transmembrane segment could be identified within the amino acid residues 272-314 of the primary sequence of the H(+)-ATPase.

J Biol Chem, 1994 Feb 4, 269(5), 3415 - 22
Translation initiation factor eIF-2 . Cloning and expression of the human cDNA encoding the gamma-subunit; Gaspar NJ et al.; Translation initiation factor eIF-2 is a heterotrimeric GTP-binding protein involved in the recruitment of methionyl-tRNA, to the 40 S ribosomal subunit . To complete our characterization of eIF-2, we cloned and characterized a human cDNA encoding the largest subunit, eIF-2 gamma . From limited peptide sequence data, degenerate oligo-nucleotide primers were designed to amplify a 118-base pair DNA fragment from a cDNA library . This fragment was used as a probe to screen for larger cDNAs and eventually a clone containing the complete eIF-2 gamma coding region (1416 base pairs) was identified . It encodes a 472-amino acid protein (51.8 kDa) and contains the three consensus GTP-binding elements . The protein shares strong homology to EF-Tu, GCD11 (the yeast homolog of eIF-2 gamma), and other EF-Tu-like proteins . Transfection of COS-1 cells with the cDNA results in overexpression of a 52-kDa protein which is specifically recognized by anti-eIF-2 gamma antibodies . Cross-linking experiments with diepoxybutane and trans-diaminedichloroplatinum(II) indicate that both the beta- and gamma-subunits of eIF-2 are in close proximity to methionyl-tRNAi in ternary complexes . Possession of the eIF-2 gamma cDNA will facilitate future investigations of the interactions of GTP and methionyl-tRNAi with eIF-2.

Nature, 1994 Feb 3, 367(6462), 489 - 91
The Reference Library System--sharing biological material and experimental data; Zehetner G et al.; Cosmid, yeast artificial chromosome (YAC), P1 and complementary DNA (cDNA) libraries are distributed on high-density filters to the scientific community and experimental results are stored in a common object-based database accessible through the Internet.

Dev Biol, 1994 Feb, 161(2), 538 - 51
Differential expression and tissue distribution of type I and type II neurofibromins during mouse fetal development; Huynh DP et al.; Mutations in the NF1 gene may cause developmental abnormalities and the formation of a variety of tumors of neural crest origin in humans . The NF1 gene codes for a large protein, neurofibromin (nf), which is structurally and functionally related to yeast and human ras-GTPase-activating proteins (ras-GAPs) . Recently, two transcripts coding for type I and type II nf with different ras-GAP activity have been identified . Since ras proteins do not appear to be significantly regulated during mouse development, we examined if differential expression of neurofibromins may provide evidence for a role of nfs in regulating ras-mediated cell proliferation and differentiation . Nfs were expressed as early as E8 . At E11 a marked increase of NF1 transcripts occurred and was associated with expression of nfs in all tissues . Type I and type II nfs each showed a different time course of expression and tissue localization, with type II nf present mainly from E8 through E10, although in the heart type II nf was present at E12 . In some tissues such as heart and dorsal root ganglia rapid increases and decreases of nfs were detected related to differentiation of these tissues . These results are consistent with a role of nfs in regulating ras-mediated cell proliferation and differentiation during development and support distinct functional roles for type I and type II nfs.

Am J Respir Crit Care Med, 1994 Feb, 149(2 Pt 1), 500 - 9
Development of pulmonary infection in mice inoculated with Blastomyces dermatitidis conidia; Williams JE et al.; Intratracheal injection of Balb/cByJ mice with 10(4) Blastomyces dermatitidis conida produces chronic pulmonary and disseminated blastomycosis characterized by pyogranulomatous inflammation . To study the evolution of the pulmonary infection, mice were killed at varying intervals after inoculation, their lungs cultured and examined histologically . Nodular intraalveolar infiltrates of macrophages (M phi) were seen on Day 1 with occasional admixed polymorphonuclear leukocytes (PMN) . Phagocytized yeast forms within M phi were evident by Day 5 . By Day 28 pyogranulomas, which developed first as central microabscesses associated with a peripheral zone of M phi and giant cells containing internalized yeast, were a prominent feature of the infection . Lymphocytic and plasmacytic infiltrates, accumulating next to granulomas, formed the major peripheral component of the granuloma by Day 35 . Formation of pyogranulomas was coincident with the host's failure to contain fungal growth measured by the sharp rise in colony-forming units recovered from lungs . Antibody against B . dermatitidis was first detected at Day 35 by enzyme immunoassay, but not until Day 63 by double immunodiffusion . During the 4 wk after inoculation, pulmonary lavage fluid contained > 90% M phi and < 3% PMN . On day 28, PMN rose to 17%, reaching 40% on Day 42 . These data contribute to our knowledge of this model and help form the basis for investigations into the roles of fungal pathogenic and host defense mechanisms in blastomycosis.

Am J Hum Genet, 1994 Feb, 54(2), 244 - 51
Isolation of novel non-HLA gene fragments from the hemochromatosis region (6p21.3) by cDNA hybridization selection; Goei VL et al.; It has previously been shown that cDNA hybridization selection can identify and recover novel genes from large cloned genomic DNA such as cosmids or YACs . In an effort to identify candidate genes for hemochromatosis, this technique was applied to a 320-kb YAC containing the HLA-A gene . A short fragment cDNA library derived from human duodenum was selected with the YAC DNA . Ten novel gene fragments were isolated, characterized, and localized on the physical map of the YAC.

Am J Hum Genet, 1994 Feb, 54(2), 191 - 200
Clinical heterogeneity within xeroderma pigmentosum associated with mutations in the DNA repair and transcription gene ERCC3; Vermeulen W et al.; The human DNA excision repair gene ERCC3 specifically corrects the nucleotide excision repair (NER) defect of xeroderma pigmentosum (XP) complementation group B . In addition to its function in NER, the ERCC3 DNA helicase was recently identified as one of the components of the human BTF2/TFIIH transcription factor complex, which is required for initiation of transcription of class II genes . To date, a single patient (XP11BE) has been assigned to this XP group B (XP-B), with ther remarkable conjunction of two autosomal recessive DNA repair deficiency disorders: XP and Cockayne syndrome (CS) . The intriguing involvement of the ERCC3 protein in the vital process of transcription may provide an explanation for the rarity, severity, and wide spectrum of clinical features in this complementation group . Here we report the identification of two new XP-B patients: XPCS1BA and XPCS2BA (siblings), by microneedle injection of the cloned ERCC3 repair gene as well as by cell hybridization . Molecular analysis of the ERCC3 gene in both patients revealed a single base substitution causing a missense mutation in a region that is completely conserved in yeast, Drosophila, mouse, and human ERCC3 . As in patient XP11BE, the expression of only one allele (paternal) is detected . The mutation causes a virtually complete inactivation of the NER function of the protein . Despite this severe NER defect, both patients display a late onset of neurologic impairment, mild cutaneous symptoms, and a striking absence of skin tumors even at an age of > 40 years . Analysis of the frequency of hprt- mutant T-lymphocytes in blood samples suggests a relatively low in vivo mutation frequency in these patients . Factors in addition to NER deficiency may be required for the development of cutaneous tumors.

Proc Natl Acad Sci U S A, 1994 Feb 1, 91(3), 903 - 7
Splicing function of mammalian U6 small nuclear RNA: conserved positions in central domain and helix I are essential during the first and second step of pre-mRNA splicing; Wolff T et al.; On the basis of mutational analyses in yeast, the highly conserved ACAGAGA sequence of U6 small nuclear RNA (snRNA) and the adjacent U6-U2 helix I have been proposed to be part of the active center of the spliceosome . We report here a detailed analysis of the human U6 snRNA sequence requirements during the first and second step of splicing, using a mammalian in vitro splicing-complementation system and a mutational approach . Positions A53G54C55 (helix Ib) were identified as important specifically for the first step, but not for spliceosome assembly . A45 of the ACAGAGA sequence and U52 of helix Ia function during the second step; in addition, the bulge separating helices Ia and Ib appears critical for the second step . In contrast, no splicing-essential sequences could be identified in the central domain upstream of the ACAGAGA sequence . In sum, our data demonstrate for the mammalian splicing system that discrete positions within the ACAGAGA sequence and helix I of U6 snRNA function during the first and second step of splicing, suggesting that these two sequence elements are closely associated with the catalytic center of the spliceosome . Comparison with previous results in yeast indicates a fundamental conservation of the U6 snRNA function in the pre-mRNA splicing mechanism.

J Leukoc Biol, 1994 Feb, 55(2), 175 - 82
gp120 HIV envelope glycoprotein increases the production of nitric oxide in human monocyte-derived macrophages; Pietraforte D et al.; The effect of recombinant gp120 HIV envelope glycoprotein on the generation of free radicals by monocyte-derived macrophages (MDM) was measured by EPR spin trapping with 5,5-dimethyl-1-pyrroline-N-oxide (DMPO) . After 1 day in culture, MDM produced a spin trap adduct of DMPO with hyperfine splitting constants superimposable on those of DMPO-OH . The addition of gp120 to MDM increased the production of DMPO-OH and after 1 h, the amount of DMPO-OH produced by 40 micrograms/ml gp120 was about 300% that of untreated MDM . The use of selective inhibitors suggested the participation of the nitric oxide/L-arginine oxidative pathway, but did not provide evidence for trapping of hydroxyl radical or other oxygen free radicals . The specificity of gp120 was proven by two different anti-gp120 antibodies that either inhibited (polyclonal) or increased (monoclonal) the production of free radicals . Dexamethasone inhibited the effect of gp120, suggesting the possible involvement of an inducible nitric oxide (NO) synthase . Moreover, treatment of MDM with gp120 for 15 h increased in a dose-dependent manner the production of NO2-, a stable end product of NO . Soluble CD4 did not modify the intensity of the DMPO-OH adduct, whereas yeast mannan and Ca(2+)-chelators abolished the increase in the DMPO-OH signal induced by gp120 . These data suggest the possible involvement of mannose-specific endocytotic lectin of MDM . The reaction of DMPO with sodium nitroprusside, an organic nitrate that releases NO, also produced DMPO-OH . Our findings indicate that gp120 increases free radical production from MDM as detected by spin-trapping methods, and that the spin trap adduct results from a reaction involving NO or closely related oxidized derivatives.

Infect Immun, 1994 Feb, 62(2), 680 - 4
Recombinant murine gamma interferon stimulates macrophages of the RAW cell line to inhibit intracellular growth of Histoplasma capsulatum; Nakamura LT et al.; Macrophages of the RAW 264.7 cell line, activated by pretreatment with recombinant murine gamma interferon, inhibit the intracellular growth of Histoplasma capsulatum . Growth inhibition occurred by a mechanism that was operative only when L-Arg metabolism was allowed to occur . When activated macrophages were cultured in the absence of L-Arg or in the presence of NG-monomethyl-L-Arg, a competitive inhibitor of L-Arg metabolism, activation to the antihistoplasma growth-inhibitory state did not occur . An increase in levels of NO2-, an end product of L-Arg metabolism, was detected only after activation of RAW 264.7 cells to the growth-inhibitory state . In contrast, only baseline levels of NO2- were detected when L-Arg was excluded or when NG-monomethyl-L-Arg was added to the culture medium . Nitric oxide (NO.), a reactive intermediate product of L-Arg metabolism, was implicated as the relevant antihistoplasma effector molecule . When H . capsulatum yeast cells were cultured for 24 to 28 h in a system designed to generate soluble NO., a dose-dependent cytotoxic effect was observed.

Br J Cancer, 1994 Feb, 69(2), 406 - 8
1st international Beatson symposium--cellular, molecular and clinical aspects of squamous cell carcinomas; Cuthill S; About 80% of neoplasias are epithelial in origin and, as such, understanding the molecular mechanisms involved in the development of epithelial tumours is vital to the diagnosis, prognosis and treatment of the vast majority of human cancers . Obviously this is no easy task but, as outlined above, great efforts are being made to identify important molecules involved in the progression of normal epithelial cells to carcinoma . The development of techniques to identify new oncogenes is of particular importance, and hopefully the cDNA expression cloning system of Stuart Aaronson will be a useful tool in this respect . The potential of some of these molecules to be used as therapeutic targets will require the development of suitable screening procedures, such as that being established by Chris Marshall for the ras-Map kinase pathway in yeast . It is encouraging that the immune response to virally (HPV) induced cancer is being carefully elucidated and the prospects of vaccine development for the treatment of cervical cancer coming nearer since this particular form of SCC is a major cancer globally . Finally it was fitting to end the meeting on an optimistic note with John Mendelsohn's EGFR monoclonal antibody therapy entering clinical trials, and hopefully this will prove efficacious in the treatment of human SSC.

Hepatology, 1994 Feb, 19(2), 286 - 95
T-cell response to structural and nonstructural hepatitis C virus antigens in persistent and self-limited hepatitis C virus infections; Ferrari C et al.; Twenty-nine patients with chronic hepatitis C and 15 asymptomatic hepatitis C virus antibody-positive subjects who clinically recovered from hepatitis C virus infection were studied for their peripheral blood lymphomononuclear cell proliferative response to hepatitis C virus structural and nonstructural antigens (core, envelope, nonstructural 4 and nonstructural 5) expressed in yeast as superoxide dismutase fusion proteins, in an initial attempt to define some of the features of the virus-specific immune response . Hepatitis C virus core was the most immunogenic antigen for human leukocyte antigen class II-restricted T cells in both groups of patients studied, and the proliferative response to it was the most vigorous and the most frequently expressed in comparison with the other antigens tested . The specificity of the results was supported by the lack of response to hepatitis C virus antigens by healthy uninfected controls and confirmed by recognition of recombinant core proteins of different origin (yeast and baculovirus) by polyclonal T-cell lines produced by T-cell stimulation with yeast-derived core . Each of the antigens tested was able to induce significant although variable levels of proliferative response, indicating that all can be immunogenic at the T-cell level . Significant proliferative responses to core, nonstructural 4 and nonstructural 5 antigens were more frequently detected in subjects who were able to eradicate infection than in patients with chronic hepatitis C, although the difference was statistically not significant . No difference was observed between the two groups of patients with respect to the response to the putative envelope antigens.

J Autoimmun, 1994 Feb, 7(1), 67 - 91
Macrogolgin--a new 376 kD Golgi complex outer membrane protein as target of antibodies in patients with rheumatic diseases and HIV infections; Seelig HP et al.; Antibodies against the Golgi complex (GC) were found by indirect immunofluorescence microscopy in the serum of two patients with sclerodermia and Sjogren syndrome . Serum from one patient was used to screen clones from an oligo (dT) primed HeLa cDNA expression library . Four overlapping cross hybridizing clones (G1, G12, G13, G14) were found . One additional 5' clone (G15) was retrieved from a random primed lambda gt11 human thyroid cDNA library by nucleic acid hybridization, exploiting sequence information of clone G12 . Additional clones for both the 5' and 3' ends were generated by RF-PCR from HeLa cell mRNA . Alignment of the overlapping clones resulted in a consensus cDNA of 10,300 bp encoding a protein of 376 kD . A corresponding mRNA of about 10 kb was found in Northern blots of RNA from various cultured cells . The most distinct features of the protein were the extraordinarily high fraction of alpha-helical domains containing heptad repeats with the probability of forming coiled-coils and the structure similarities with the myosin family and the yeast intracellular transport protein USO1 . Five overlapping cDNA fragments covering the entire open reading frame were used to synthesize recombinant proteins for affinity purification of the antibodies in the two patients' sera . By use of these affinity purified antibodies, staining of the GC of various cultured cell lines was reproduced . The antibody target was dissociated within 15 min after brefeldin A exposure of cultured cells, a phenomenon, which was fully reversible within 30 min after withdrawal of the drug . Sucrose step gradient separation of GC enriched microsomal fractions from rat liver showed a natural antigen of about 380 kD co-fractionating with the GC marker galactosyltransferase . KCl extraction, Triton X-114 partition, as well as trypsin digestion of microsomal fractions revealed that the hydrophilic protein has to be located on the cytoplasmatic surface of GC vesicles . Using the five blotted recombinant protein fragments, anti-GC antibodies were found in 18 of 164 (11%) HIV positive patients but in none of the 64 healthy controls . HIV patients as well as the two original patients showed a diverse antibody spectrum recognizing different epitopes of the recombinant proteins . The protein characterized herein, for which we propose the provisional name macrogolgin, constitutes the largest protein known so far associated with the GC.

Pediatr Infect Dis J, 1994 Feb, 13(2), 104 - 8
Nosocomial Malassezia pachydermatis bloodstream infections in a neonatal intensive care unit; Welbel SF et al.; Malassezia pachydermatis, a lipophilic yeast, has been described to cause sporadic nosocomial bloodstream infections (BSI) . Nosocomial outbreaks of M . pachydermatis BSI have never been described . A cluster of M . pachydermatis BSIs in the neonatal intensive care unit at Louisiana State University Medical Center, University Hospital provided the opportunity to investigate the epidemiology of this organism and apply molecular epidemiologic typing techniques . A case-patient was defined as any neonatal intensive care unit patient in University Hospital with a blood culture positive for M . pachydermatis from January 1, 1989, through August 15, 1991 . Five patients met the case definition . Case-patients were premature as estimated by gestational age and required prolonged hospitalization . Case-patients received parenteral nutrition and intravenous lipids for twice as many days as randomly selected controls . No environmental source of M . pachydermatis was identified; however, infants on each side of a previously identified M . pachydermatis-colonized infant became colonized with M . pachydermatis during a 20-day period . Chromosomal analysis of five M . pachydermatis blood isolates from two case-patients had identical banding patterns . These data show that M . pachydermatis can cause nosocomial BSI outbreaks, that premature infants receiving parenteral nutrition and/or lipids may be at greatest risk and that transmission is most likely from person to person, probably via the hands of medical personnel.

Genomics, 1994 Feb, 19(3), 592 - 4
The human NFKB3 gene encoding the p65 subunit of transcription factor NF-kappa B is located on chromosome 11q12; Deloukas P et al.; A YAC clone that contains the human gene NFKB3, encoding the p65 subunit of transcription factor nuclear factor kappa B (NF-kappa B), was isolated . The YAC contains the entire NFKB3 gene, which is smaller than 15 kb and present in a single copy in the genome . Fluorescence in situ hybridization with metaphase chromosomes showed two different chromosomal locations (11q12 and Xp11.4) for sequences present in the YAC . The NFKB3 gene was assigned to chromosome 11q12 by PCR analysis of a panel of relevant hybrid cell lines . Thus, no linkage exists between NFKB3 and genes encoding other known members of the NF-kappa B family.

Genomics, 1994 Feb, 19(3), 532 - 41
YAC contigs for 4q35 in the region of the facioscapulohumeral muscular dystrophy (FSHD) gene; Weiffenbach B et al.; We report here the construction of a genetic linkage map and an overlapping set of clones containing DNA markers linked to the causative locus for facioscapulohumeral muscular dystrophy (FSHD) on 4q35 . Multipoint linkage analysis placed eight loci in the following order with odds greater than 1000:1: cen-D4S171-FXI-D4S426-D4S187-D4S130-D4S 163-D4S139-D4F35S1-qter . The most likely position of D4S809 was distal to D4F35S1 . Thirty-four yeast artificial chromosomes (YACs) were isolated by PCR-based assays for STSs derived from DNA markers with known genetic and physical order . Walking from the insert ends of 2 YACs identified 7 additional YACs, bridging the gaps between three of the markers . Two new YACs were found by hybridization of a cosmid inter-Alu PCR product to dot blots of inter-Alu PCR products of YAC DNA pools . All YAC clones were positioned using the genetic and physical order of the STSs and inter-Alu PCR fingerprint data . Eleven of the YACs and two cosmids were mapped by fluorescence in situ hybridization to confirm the location of the clones and to detect chimerism . The 43 YACs were assembled into two contigs . The larger contig spans approximately 2.4 Mb and contains markers closest to the FSHD gene.

Genomics, 1994 Feb, 19(3), 525 - 31
The DCC gene: structural analysis and mutations in colorectal carcinomas; Cho KR et al.; DCC is a candidate tumor-suppressor gene encoding a protein with sequence similarity to cell adhesion molecules such as N-CAM . A set of overlapping YAC clones that contains the entire DCC coding region was isolated . Studies of this YAC contig showed that the DCC gene spans approximately 1.4 Mb . For elucidation of exon-intron structure, lambda phage clones containing all known coding sequences were isolated from a genomic library . These clones were used to demonstrate the existence of 29 DCC exons, and the sequences of the exon-intron boundaries were determined for each . Twenty-three polymorphic markers from chromosome 18 were then studied in a panel of primary colorectal tumors that had lost some, but not all, of chromosome 18 . In most of these tumors, the region that was lost included DCC . Finally, Southern blot and PCR-based approaches were used to search for subtle mutations in several DCC exons . One tumor that had a point mutation in exon 28 was found, resulting in a proline to histidine substitution . A second tumor with a point mutation in intron 13 was also found . The regional map and genomic structure of DCC should provide the means to more extensively study DCC gene alterations and protein function in normal and neoplastic cells.

Genomics, 1994 Feb, 19(3), 470 - 7
A YAC contig of approximately 3 Mb from human chromosome 5q31-->q33; Li X et al.; The human chromosome 5q31--q33 region contains an interesting cluster of growth factor and receptor genes . In addition, several genetic disease loci have been localized within this region, but have not as yet been isolated as molecular clones . These include those loci involved in autosomal dominant limb-girdle muscular dystrophy, diastrophic dysplasia, Treacher Collins syndrome, and myeloid disorders associated with the 5q- syndrome . A yeast artificial chromosome (YAC) contig of this region would assist in the further localization and isolation of these genes . We have used YACs isolated from the Washington University and Centre d'Etude du Polymorphisme Humain YAC libraries, including YACs from the large insert (mega) YAC library to build a contig greater than 3 Mb in size . An STS content strategy coupled with limited walking from YAC ends was used to isolate 22 overlapping YACs with as much as sixfold coverage . A total of 20 STSs, derived from genes, anonymous sequences, and vector Alu-PCR or inverse PCR products, were used to compile this contig . The order of loci, centromere-GRL-D5S207-D5S70-D5S545-D5S546- D5S547-D5S68-D5S548-D5S210-D5S549- D5S686-ADRB2-D5S559-CSF1R-D5S551-RPS14+ ++-D5S519-SPARC-telomere, was derived from the overlapping clones . This contig and clones derived from it will be useful substrates in selecting candidate cDNAs for the disease loci in this interval.

Genomics, 1994 Feb, 19(3), 462 - 9
3.6-Mb genomic and YAC physical map of the Down syndrome chromosome region on chromosome 21; Dufresne-Zacharia MC et al.; The Down syndrome chromosome region (DCR) on chromosome 21 has been shown to contain a gene(s) important in the pathogenesis of Down syndrome . We constructed a long-range restriction map of the D21S55-D21S65 region covering the proximal part of the DCR . Pulsed-field gel electrophoresis of lymphocyte DNA digested with three rare cutting enzymes . NotI, NruI, and MluI, was used to establish two physical linkage groups of 5 and 7 markers, respectively, spanning 4.6 Mb on the NotI map . Mapping analysis of 40 YACs allowed the selection of 13 YACs covering 95% of the D21S55-D21S65 region and spanning 3.6 Mb . The restriction maps of these YACs and their positioning on the genomic map allowed 19 markers to be ordered, including 4 NotI linking clones, 9 polymorphic markers, the CBR gene, and the AML1 gene . The distances between markers could also be estimated . This physical map and the location of eight NotI sites between D21S55 and D21S17 should facilitate the isolation of previously unidentified genes in this region.

Int J Immunopharmacol, 1994 Feb, 16(2), 171 - 6
Effect of macrophage colony-stimulating factor (M-CSF) on macrophage morphology, phagocytosis, and intracellular multiplication of Histoplasma capsulatum; Brummer E et al.; M-CSF induced dramatic morphological changes in resident peritoneal macrophages (R-PM) in a time and dose dependent manner . Macrophages increased 2-3-fold in size and developed a dendritic morphology . Compared to macrophages cultured in medium alone M-CSF-treated macrophages were less phagocytic (67 versus 82%) for serum opsonized yeast cells of Histoplasma capsulatum . However, in M-CSF macrophages the intracellular multiplication of ingested yeast cells were significantly inhibited compared to growth in control macrophages . The fungistatic activity of M-CSF macrophages persisted for at least 48 h after infection.

Biotechniques, 1994 Feb, 16(2), 264 - 5, 268-9
An improved fluor diffusion assay for chloramphenicol acetyltransferase gene expression; Purschke WG et al.; We report on a substantial improvement of the widely used fluor diffusion assay for chloramphenicol acetyltransferase (CAT) activity . The stable and inexpensive {3H}NaAcetate along with yeast acetyl CoA synthetase is used to produce {3H}acetyl CoA with high specific radioactivity and high yield . In a second step, the enzymatically produced {3H}acetyl CoA is introduced as a substrate for CAT in the fluor diffusion assay . Due to these modifications, the assay becomes more sensitive, the range of linearity is increased by two orders of magnitude and the assay becomes less costly.

Curr Opin Cell Biol, 1994 Feb, 6(1), 96 - 104
Functional properties of non-muscle tropomyosin isoforms; Pittenger MF et al.; Tropomyosins are a family of actin filament binding proteins . They have been identified in many organisms, including yeast, nematodes, Drosophila, birds and mammals . In metazoans, different forms of tropomyosin are characteristic of specific cell types . Most non-muscle cells, such as fibroblasts, express five to eight isoforms of tropomyosins . The various isoforms exhibit distinct biochemical properties that appear to be required for specific cellular functions.

Clin Infect Dis, 1994 Feb, 18(2), 246 - 7
Disseminated Penicillium marneffei infection diagnosed on examination of a peripheral blood smear of a patient with human immunodeficiency virus infection; Supparatpinyo K et al.; We describe a case of disseminated Penicillium marneffei infection in a patient infected with human immunodeficiency virus . The diagnosis was made by examination of a peripheral blood smear . The patient presented with fever, jaundice, generalized lymphadenopathy, hepatosplenomegaly, and an erythematous, papular rash . Microscopic examination of a Wright's-stained peripheral blood smear revealed many yeast cells in neutrophils . Some yeast cells had clear central septation . Presumptive diagnosis of disseminated P . marneffei infection was made, and treatment was started several days before the culture results were available.

J Am Coll Nutr, 1994 Feb, 13(1), 95 - 101
Bioavailability of selenium from raw and cooked ground beef assessed in selenium-deficient Fischer rats; Shi B et al.; OBJECTIVE: The literature on the bioavailability of selenium (Se) from meats, especially beef, is meager, and that which existed when this research began suggested that Se was not highly bioavailable . In addition, much of the analytical values for Se in beef predated the Food and Drug Administration's 1973 approval of Se as an additive to feeds and mineral premixes of livestock . DESIGN: One hundred and thirty-six weanling female Fischer 344 rats were divided into two dietary groups: the selenium deficient group in which animals were fed a torula yeast (TY) basal diet which contained 0.008 mg/kg Se and the control group in which animals were fed the TY diet to which was added 0.10 mg/kg Se as sodium selenite . RESULTS: After 6 weeks of dietary treatment liver glutathione peroxidase (GSHPx) activity had fallen in the Se-deficient rats to 2.4% of that of control rats . At this time (week 6) rats from the Se-deficient TY diet were refed diets containing 0.10 mg/kg Se as selenite, selenate, raw or cooked ground beef that had been freeze-dried . During the Se-repletion period rats were sacrificed at weeks 1, 3, 5 and 8 . Liver GSHPx activity and total Se levels in liver and muscle tissue were the criteria of Se bioavailability . After 8 weeks of Se resupplementation the recovery of liver GSHPx activity compared to the control animals (set at 100%) were selenite (98%, p > 0.05), selenate (117%, p < 0.05), raw beef (127%, p < 0.05) and cooked ground beef (139%, p < 0.05) . Total Se in both liver and muscle tissue reflected the liver GSHPx activity with the total Se concentration in tissues being highest for cooked beef . CONCLUSION: The data suggest that bioavailability of Se from ground beef is greater than that from either selenite or selenate.

Plant Mol Biol, 1994 Feb, 24(4), 651 - 61
Homologues of wheat ubiquitin-conjugating enzymes--TaUBC1 and TaUBC4 are encoded by small multigene families in Arabidopsis thaliana; Sullivan ML et al.; Covalent attachment of ubiquitin to other cellular proteins has been implicated in a multitude of diverse physiological processes in eukaryotes including selective protein degradation . This attachment is carried out by a multi-enzyme pathway consisting of three classes of enzymes: ubiquitin-activating enzymes (E1s), ubiquitin-conjugating enzymes (E2s), and ubiquitin-protein ligases (E3s) . E2s accept activated ubiquitin from E1 and conjugate it to target proteins with or without the participation of specific E3s . Previously, we have isolated wheat cDNAs encoding 16 and 23 kDa E2s, TaUBC1 and TaUBC4, respectively . TaUBC1 shows structural homology to the yeast RAD6 E2 that is essential for DNA repair whereas TaUBC4 is related to the yeast ScUBC8 E2, both of which effectively conjugate ubiquitin to histones in vitro but as yet are without a known in vivo function . Here, we report the isolation of genomic and cDNA homologues of these genes from Arabidopsis thaliana . In Arabidopsis, both of these E2s are encoded by three member gene families . Members of the AtUBC1 gene family, comprising AtUBC1, 2 and 3, encode 150-152 amino acid proteins that are 83-99% identical to each other and TaUBC1 and contain four introns that are conserved with respect to position . Members of the AtUBC4 gene family, comprising AtUBC4, 5 and 6, encode 187-191 amino acid proteins that are 73-88% identical to each other and TaUBC4 and contain five introns that are conserved with respect to position.(ABSTRACT TRUNCATED AT 250 WORDS)

Dtsch Tierarztl Wochenschr, 1994 Feb, 101(2), 53 - 6
Two cases of Holstein calves with bovine leukocyte adhesion deficiency (BLAD) (case report); Nagahata H et al.; Two Holstein calves showing clinical signs such as ulcerative stomatitis, severe gingivitis, periodontitis, loss of teeth and stunted growth, associated with marked neutrophilia, were evaluated by clinicopathologic analysis, neutrophil functions and flow cytometric analysis of CD18 expression on neutrophils . Decreased CL response, chemotaxis, yeast phagocytosis, and deficient CD18 expression of neutrophils from affected animals were demonstrated . Pathological findings involved were ulcerative gingivitis, severe periodontitis, laryngitis, and multiple ulcers in forestomach . This study demonstrates that neutrophil functions are closely associated with impaired iC3b receptor, and these affected animals were diagnosed as bovine leukocyte adhesion deficiency (BLAD).

Plant J, 1994 Feb, 5(2), 215 - 26
Cloning and in vivo expression of functional triose phosphate/phosphate translocators from C3- and C4-plants: evidence for the putative participation of specific amino acid residues in the recognition of phosphoenolpyruvate; Fischer K et al.; The primary sequences of the chloroplast triose phosphate/phosphate translocator precursor proteins from C4-plants (maize mesophyll cells and Flaveria trinervia) and from the C3-type Flaveria pringlei were determined . The mature parts of these translocators possess 83-94% identical amino acid residues . The C4-translocator protein can be correctly targeted to C3-type chloroplasts and inserted into the envelope membrane . Expression of the mature parts of these chloroplast translocators (cTPT) in transformed yeast cells and subsequent reconstitution of the functional proteins reveals the difference between the recombinant translocator proteins from the two cell types with respect to the transport of phosphoenolpyruvate . Comparison of the cTPT sequences from F . pringlei and F . trinervia in combination with computer-aided molecular modelling of the substrate translocation pore leads to the suggestion, that only minor exchanges of amino acid residues between the C3- and C4-translocator proteins are sufficient to extend their substrate specificities to recognize also phosphoenolpyruvate.

Planta Med, 1994 Feb, 60(1), 50 - 3
In vitro antifungal activity of triterpenoid saponins; Favel A et al.; The antifungal activity of triterpenoid saponins, with hederagenin or oleanolic acid as aglycone, was investigated in vitro by the agar dilution method . Monodesmosidic hederagenin derivatives were shown to exhibit a broad spectrum of activity against yeast as well as dermatophyte species . alpha-Hederin was the most active compound, and Candida glabrata was the most susceptible strain . The structure-activity relationships are discussed.

Mol Gen Genet, 1994 Feb, 242(4), 461 - 6
A putative catabolite-repressed cell wall protein from the mycoparasitic fungus Trichoderma harzianum; Lora JM et al.; A cDNA clone encoding a putative cell wall protein (Qid3) was isolated from a library prepared from chitin-induced mRNA in cultures of the mycoparasitic fungus Trichoderma harzianum . The predicted 14 kDa protein shows a potential signal peptide, several hydrophobic domains and certain motifs that are structurally similar to proline-rich and glycine-rich plant cell wall proteins . Expression of the qid3 gene is derepressed in the absence of glucose . When introduced in yeast, qid3 expression causes cell division arrest into cytokinesis and cell separation, probably due to its cell wall localization.

Mol Gen Genet, 1994 Feb, 242(4), 391 - 8
The gene upstream of DmRP128 codes for a novel GTP-binding protein of Drosophila melanogaster; Sommer KA et al.; Upstream of the gene coding for the second-largest subunit of RNA polymerase III (DmRP128) we have found another gene (128up), which is transcribed in the same direction as the RNA polymerase gene . The intergenic distance between the 3' end of 128up mRNA and the 5' end of DmRP128 mRNA is only about 100 bp . Transcripts of 128up are present at a much higher level than DmRP128 RNA in Drosophila Schneider 2 cells, embryos, and adult flies . Two transcription start points, seven nucleotides apart, are found for 128up compared to multiple scattered starts for DmRP128 . Sequence analysis of 128up cDNA reveals that the gene codes for a 41 kDa protein with homology to GTP-binding proteins and matching four of the structural sequence motifs characteristic of the superfamily of GTPases . Bacterially expressed 128up protein fused to maltose-binding protein specifically binds GTP . Sequences closely related to the 128up protein are found in species as distant as Halobacterium, yeast or mouse; the murine protein is 80% identical to 128up . This evolutionary conservation is indicative of an important, but as yet unknown, physiological role . In accordance with the sequence conservation, antibodies against 128up specifically cross-react with mouse 3T3 cells and human Hep2 cells where the subcellular localization of the protein is predominantly perinuclear . We propose that 128up is a member of a novel class of GTP-binding proteins.

Biochem J, 1994 Feb 1, 297 ( Pt 3), 441 - 5
Chromosomal localization of human genes for arylamine N-acetyltransferase; Hickman D et al.; Arylamine N-acetyltransferase is encoded at two loci, AAC-1 and AAC-2, on human chromosome 8 . The products of the two loci are able to catalyse N-acetylation of arylamine carcinogens, such as benzidine and other xenobiotics . AAC-2 is polymorphic and individuals carrying the slow-acetylator phenotype are more susceptible to benzidine-induced bladder cancer . We have identified yeast artificial chromosome clones encoding AAC-1 and AAC-2 and have used the cloned DNAs as fluorescent probes for in situ hybridization . The hybridization patterns allow assignment of AAC-1 and AAC-2 to chromosome 8p21.3-23.1, a region in which deletions have been associated with bladder cancer {Knowles, Shaw and Proctor (1993) Oncogene 8, 1357-1364}.

J Pharm Pharmacol, 1994 Feb, 46(2), 118 - 22
Pharmacological evaluation of the anti-inflammatory activity of a citrus bioflavonoid, hesperidin, and the isoflavonoids, duartin and claussequinone, in rats and mice; Emim JA et al.; Pretreatment of rats with hesperidin (50 and 100 mg kg-1, s.c.) reduced the paw oedema induced by carrageenan by 47 and 63%, respectively, within 5 h . The effect was equivalent to that produced by indomethacin (10 mg kg-1, p.o.), although unrelated to the administered dose, particularly at high doses . At 100 mg kg-1 hesperidin decreased the rat paw oedema induced by dextran by 33%, without influencing the histamine-induced paw oedema . Hesperidin also inhibited pleurisy induced by carrageenan, reducing the volume of exudate and the number of migrating leucocytes by 48 and 34%, respectively, of control values . Equal doses of duartin and claussequinone were ineffective in all the above tests . Pretreatment of mice with hesperidin (100 mg kg-1, s.c.) reduced acetic acid-induced abdominal constriction by 50%, but did not affect the tail flick response . Hyperthermia induced by yeast in rats was slightly reduced by hesperidin . No lesions of the gastric mucosae were detected in rats pretreated with hesperidin . The results indicate that hesperidin obtained from citrus cultures may present a potential therapeutical use as a mild anti-inflammatory agent, being also useful as a precursor of new flavonoids endowed with such activity.

Hum Mol Genet, 1994 Feb, 3(2), 309 - 15
Imprinting analysis of three genes in the Prader-Willi/Angelman region: SNRPN, E6-associated protein, and PAR-2 (D15S225E); Nakao M et al.; In order to identify genes in the Prader-Willi/Angelman syndrome critical region, radiolabeled cDNA probes from poly(A)+ RNA from mouse tissues were used to identify potential exon-containing genomic DNA fragments in cosmid or phage clones from appropriate yeast artificial chromosomes, and these fragments were subsequently used to screen human cDNA libraries . A mouse brain cDNA probe was effective in detecting control genes of various abundance including small nuclear ribonucleoprotein polypeptide N (SNRPN), hypoxanthine-guanine phosphoribosyl transferase, glyceraldehyde-3-phosphate dehydrogenase, and beta-actin . Two genes mapping within the Angelman syndrome critical region were isolated . One gene was found to encode the E6-associated protein (E6-AP; gene symbol HPVE6A), a protein which interacts with the E6 protein of human papilloma virus . The other gene is previously uncharacterized and is designated PAR-2 (D15S225E) for Prader-Willi and Angelman region-gene 2 . Imprinting analysis using reverse transcription-polymerase chain reaction of RNA from fibroblasts and lymphoblasts of deletion Prader-Willi and Angelman patients demonstrated imprinting of SNRPN with exclusive expression from the paternal allele, but E6-AP and PAR-2 were not imprinted in these cultured human cells . The ability to analyze for imprinting and expression of SNRPN and other genes in this region in cultured human cells will be a valuable tool for analyzing the molecular basis of the Prader-Willi and Angelman syndromes, although imprinting may differ between cultured cells and tissues.(ABSTRACT TRUNCATED AT 250 WORDS)

Hum Mol Genet, 1994 Feb, 3(2), 285 - 93
Mapping of a chromosome 15 region involved in limb girdle muscular dystrophy; Fougerousse F et al.; A gene responsible for an autosomal recessive form of limb girdle muscular dystrophy (LGMD2, MIM number 253600) has been localized on chromosome 15 . After genotyping additional markers of this chromosome, two were found to flank the disease locus within an interval that was assessed as 7 centiMorgans . The screening of the CEPH YAC libraries with the corresponding probes allowed the isolation of YACs which were used in fluorescence in situ hybridization to define the LGMD2 cytogenetic interval as 15q15.1-15q21.1 . Four different approaches were pursued for the establishment of the physical map of this area which allowed the assembly of an uninterrupted YAC contig spanning an estimated 10-12 megabases, with an average STS resolution of 140 kb or for the 25 polymorphic microsatellites on this map, of 400 kb . Twelve genes and 25 genetic markers were positioned in this contig, which is constituted of a minimum of 10 clones.

Protein Sci, 1994 Feb, 3(2), 248 - 56
Interaction of semisynthetic variants of RNase A with ribonuclease inhibitor; Neumann U et al.; Derivatives of ribonuclease A (RNase A) with modifications in positions 1 and/or 7 were prepared by subtilisin-catalyzed semisynthesis starting from synthetic RNase 1-20 peptides and S-protein (RNase 21-124) . The lysyl residue at position 1 was replaced by alanine, whereas Lys-7 was replaced by cysteine that was specifically modified prior to semisynthesis . The enzymes obtained were characterized by protein chemical methods and were active toward uridylyl-3',5'-adenosine and yeast RNA . When Lys-7 was replaced by S-methyl-cysteine or S-carboxamido-contrast, the catalytic properties were only slightly altered . The dissociation constant for the RNase A-RI complex increased from 74 fM (RNase A) to 4.5 pM (Lys-1, Cys-7-methyl RNase), corresponding to a decrease in binding energy of 10 kJ mol-1 . Modifications that introduced a positive charge in position 7 (S-aminoethyl- or S-ethylpyridyl-cysteine) led to much smaller losses . The replacement of Lys-1 resulted in a 4-kJ mol-1 loss in binding energy . S-protein bound to RI with Ki = 63.4 pM, 800-fold weaker than RNase A . This corresponded to a 16-kJ mol-1 difference in binding energy . The results show that the N-terminal portion of RNase A contributes significantly to binding of ribonuclease inhibitor and that ionic interactions of Lys-7 and to a smaller extent of Lys-1 provide most of the binding energy.

Curr Biol, 1994 Feb 1, 4(2), 173 - 4
Molecular chaperones . Panning for chaperone-binding peptides; Gierasch LM; Experiments designed to define the substrate-binding preferences of the molecular chaperone BiP show that bound peptides are characterized by a heptameric motif with alternating hydrophobic residues.

Res Commun Chem Pathol Pharmacol, 1994 Feb, 83(2), 209 - 22
Tetrazole isosteres of biologically active acids and their effects on enzymes; Kraus JL et al.; A number of tetrazole analogs of carboxylic substrates and inhibitors have been tested . Lactic and pyruvic tetrazoles were found to be competitive inhibitors of rabbit muscle L-lactate dehydrogenase in both the pyruvate reduction and the lactate oxidation reactions (Ki's of 0.04 M and 0.08 M D,L-lactic tetrazole and 0.02 M and 0.035 M pyruvic tetrazole, respectively) . Lactic tetrazole is a non-competitive inhibitor of yeast L-lactate dehydrogenase (Ki = 0.10 M D,L-lactic tetrazole) while pyruvic tetrazole is predominantly competitive (Ki = 0.15 M) . Alanine tetrazole is a poorer substrate than alanine for D-amino acid oxidase . It also acts as weak inhibitor . Benzoic tetrazole is a substrate-competitive inhibitor of D-amino acid oxidase (Ki = 0.7 mM) and is also a stronger ethanol-competitive inhibitor than benzoic acid (Ki = 0.03 M) of liver alcohol dehydrogenase . In all the substrates and inhibitors tested, substitution of a tetrazole ring for a carboxylic group has resulted in decreased binding, presumably due to a dilution of the negative charge density and the larger size of the tetrazoyl anion.

Vaccine, 1994 Feb, 12(2), 117 - 28
Epitopes recognized by HIV-SF2 nef-specific CD4+ T-cell clones generated from HIV-1-uninfected donors; Wentworth PA et al.; Human T-cell clones with specificity to the HIV-1 nef protein were generated by the in vitro stimulation of peripheral blood mononuclear cells (PBMCs) from HIV-1-seronegative donors with purified nef from the HIV-SF2 isolate produced in genetically engineered yeast . Here the characterization is described of a total of seven discrete clones derived from five different donors . Each clone was CD3+ CD4+ CD8- as determined by FACS analysis . The epitopes recognized by these clones were identified using synthetic overlapping peptides spanning the entire length of nef . Six discrete helper T-cell epitopes located in five distinct regions of nef were identified by this approach . Three of these epitopes are more than 80% conserved among all HIV-1 nef proteins for which sequence data are available . The remaining epitopes are in regions of nef that vary among isolates . Many of the epitopes recognized by our clones overlap T-cell epitopes identified by others examining T-cell responses to nef in HIV-1-infected patients and immunized animals . Using partially class II-matched EBV-transformed B-cell lines, we were able to identify five different HLA class II alleles which encode restricting elements for the in vitro nef-specific proliferative response of these clones (DR1, DRw15(2), DRw6, DQw7, DP5).

Biochem Biophys Res Commun, 1994 Jan 28, 198(2), 748 - 54
The Drosophila melanogaster homolog of ribosomal protein L27a; Garwood J et al.; The amino acid sequence of the Drosophila melanogaster 60S ribosomal sub-unit protein, L27a, was deduced from the sequence of nucleotides in a recombinant cDNA . Ribosomal protein L27a has 149 amino acids with a molecular weight of 17,123 Daltons . Hybridisation of the cDNA to polytene chromosomes indicates the presence of a single gene on chromosome 3R at 87F/88A . There is a single mRNA for the protein of around 650 nucleotides in length . Drosophila ribosomal protein L27a is homologous to the rat and yeast L27a and to the other members of the L15 ribosomal protein family . There is also significant homology with an invertebrate motor protein and a Drosophila photoreceptor morphogenesis protein.

Gene, 1994 Jan 28, 138(1-2), 233 - 7
Mapping of 386 kb of genomic DNA in the human dystrophin-encoding gene (DYS) using an ordered phage lambda sublibrary of a YAC clone containing the DYS region; Wood L et al.; An integrated restriction map for HindIII and EcoRI has been constructed for 386 kb of the human dystrophin-encoding gene by partial digest mapping of 35 overlapping lambda EMBL3cosW phage clones derived from a yeast artificial chromosome containing this region . Map construction was simplified in two ways . Firstly, the sequence arrangement of lambda EMBL3cosW is such that only map data from cloned inserts are generated using partial digests of lambda phage DNA asymmetrically labelled at the left cos end with a complementary 32P-labelled oligodeoxyribonucleotide . Secondly, the degree of partial digestion was standardised for each restriction enzyme by using ultraviolet light-induced formation of thymine dimers in the recognition sequence to partially block the cleavage reaction . The map provides the basis for work on the analysis of chromosomal rearrangements in this region which give rise to Duchenne muscular dystrophy, and for studies of chromosome structure and function.

FEBS Lett, 1994 Jan 24, 338(1), 53 - 7
Expression, purification and characterization of a Kunitz-type protease inhibitor domain from human amyloid precursor protein homolog; Petersen LC et al.; The Kunitz-type protease inhibitor domain from a recently identified homolog of the Alzheimer amyloid precursor protein (APPH KPI) was expressed in yeast, purified and characterized . Its inhibition profile towards several serine proteases was studied and compared to that of APP KPI, the Kunitz domain from the Alzheimer amyloid precursor protein . APPH KPI was shown to inhibit proteases with trypsin-like specificity with an inhibitor profile resembling that of the APP KPI domain . The KPI domains from APP and APPH inhibited trypsin (Ki = 0.02 nM), and plasma kallikrein (Ki = 86 nM) with approximal equal affinity . In comparison to APP KPI (Ki = 82 nM) the KPI domain of the homolog, APPH KPI, (Ki = 8.8 nM) was a more potent inhibitor of glandular kallikrein . APPH KPI was a less potent inhibitor of chymotrypsin than APP KPI (Ki = 78 nM as compared to Ki = 6 nM), plasmin (Ki = 81 nM as compared to 42 nM), and factor XIa (Ki = 14 nM as compared to Ki = 0.7 nM) . The affinity of factor XIa for APPH KPI is sufficiently high to allow for an interaction in the blood . It is, however, well possible that the physiological protease ligand for the receptor-like APPH protein has yet to be identified.

Nature, 1994 Jan 20, 367(6460), 236 - 42
Regulation of progression through the G1 phase of the cell cycle by the rum1+ gene; Moreno S et al.; The rum1+ gene is identified as a new regulator of G1 progression in fission yeast . It influences three aspects of G1 regulation: determination of the length of G1, dependence of S phase upon completion of mitosis, and restraint of mitosis until G1 is finished . We propose that it has a central role in regulating the G1 phase of the cell cycle.

Proc Natl Acad Sci U S A, 1994 Jan 18, 91(2), 619 - 23
The polymorphic subtelomeric regions of Plasmodium falciparum chromosomes contain arrays of repetitive sequence elements; de Bruin D et al.; The human malaria parasite Plasmodium falciparum exhibits a high degree of chromosomal polymorphism, which may contribute to its ability to evade host defenses . The analysis of parasite chromosomes has revealed that these polymorphisms are confined to the subtelomeric regions, which are transcriptionally silent and contain repetitive sequence elements . Several subtelomeric repetitive elements have been isolated and mapped by using P . falciparum yeast artificial chromosome (YAC) clones . Structural analysis of parasite telomeric and subtelomeric YAC clones demonstrated that these repetitive elements are conserved between P . falciparum chromosome ends . We suggest that these subtelomeric elements promote chromosome pairing in P . falciparum and facilitate meiotic recombination and gene conversion between telomere-proximal genes.

EMBO J, 1994 Jan 15, 13(2), 425 - 34
cdt1 is an essential target of the Cdc10/Sct1 transcription factor: requirement for DNA replication and inhibition of mitosis; Hofmann JF et al.; We have used an immunoprecipitation-PCR cycle to isolate physically genomic DNA sequences that are bound by the fission yeast cdc10 gene product in an attempt to identify novel target genes . An essential gene, cdt1, has been isolated whose expression is cell cycle regulated in a cdc10 dependent manner . The cdt1 promoter contains a recognition site for a sequence specific DNA binding factor . The cdc10 gene product is a component of this factor . Ectopic expression of cdt1 can complement a temperature sensitive mutation of cdc10 at semipermissive temperature . Cells carrying a null allele of cdt1 are defective in DNA replication but initiate mitotic events, suggesting that cdt1 is essential for the normal dependency relationship of S-phase and mitosis.

Eur J Biochem, 1994 Jan 15, 219(1-2), 73 - 81
Genuine and apparent cross-reaction of polyclonal antibodies to proteins and peptides; Leder L et al.; Antiserum to a native protein may cross-react with the corresponding denatured protein or with peptides . The cross-reaction is either a genuine property of the antibodies or caused by antibodies produced against some unfolded protein contaminating the native protein used for immunization . Appropriate conformation-sensitive immunoassays must be employed to distinguish a genuine from an apparent cross-reaction . In the present study, we have analyzed critically the cross-reaction of rabbit antisera against proteins and peptides . We have distinguished between genuine and apparent cross-reaction with the help of the protein A antibody-capture ELISA, a new conformation-sensitive ELISA format . Three systems were analyzed: cross-reaction of antisera to native yeast and horse cytochrome c with unfolded apo-cytochrome c; cross-reaction of antisera to a coiled-coil leucine-zipper peptide with a homologous random-coil peptide obtained by introducing two proline residues into the leucine-zipper sequence; cross-reaction of antisera to two peptides that correspond to the N-terminal and an internal sequence of ferredoxin: NADP+ reductase (FNR), with the native enzyme . The reaction of the anti-(cytochrome c) sera was clearly due to antibodies produced against unfolded protein, it was an apparent and not a genuine cross-reaction . Furthermore, the apparently cross-reactive antibodies to horse cytochrome c did not discriminate against sequence-related proteins from dog, beef, rabbit and pigeon . In contrast, antibodies to the leucine-zipper peptide did cross-react in a genuine way with the homologous random-coil peptide, that is, the cross-reactive antibodies do not seem to have been produced against the unfolded form of the leucine-zipper peptide . Of the two anti-peptide sera the one against the unstructured and highly accessible N-terminal segment reacted strongly with the native protein . The second serum against a solvent-accessible turn-like sequence of FNR showed apparent cross-reactivity: antibodies recognizing the native protein were directed against a minor conformational isoform of the free peptide and did not react with the principal form(s) of the free peptide . The generation of cross-reactive antibodies depends on the conformational stability and integrity of the immunogen and on the molecular form of its application, i.e., free, polymerized or carrier-bound . The results clarify the different nature of cross-reactivity of antisera to proteins and peptides . This knowledge is crucial if antisera are to be used as conformation-specific probes.

Genomics, 1994 Jan 15, 19(2), 391 - 3
Targeted development of microsatellite markers from inter-Alu amplification of YAC clones; de Souza AP et al.; Primary genetic maps based on highly informative markers are now available . The local density of these markers may, however, not be sufficient . There is thus a need for new means to generate polymorphic markers from targeted regions of the genome . This can be achieved by selectively cloning and sequencing (CA)n-positive human inter-Alu sequences from targeted YAC clones . This method was tested on 21 YACs and led to the development of seven new polymorphic microsatellite markers.

Genomics, 1994 Jan 15, 19(2), 373 - 5
A high-resolution cytogenetic map of human chromosome 9: localization of 203 new cosmid markers by direct R-banding fluorescence in situ hybridization; Takahashi E et al.; A high-resolution cytogenetic map of human chromosome 9 was constructed with 203 newly isolated cosmid markers by direct R-banding fluorescence in situ hybridization . The clones were localized preferentially to R-positive bands throughout chromosome 9 . Although the number of clones was roughly proportional to the R-band size, many more clones (ca . 80) were mapped at the q34 region compared to its physical size . Based on these cytogenetic mapping data, one can establish physical contig maps with cosmids and yeast artificial chromosomes and a genetic linkage map essential for positional cloning of responsible genes.

Genomics, 1994 Jan 15, 19(2), 291 - 7
Characterization of a microdissection library from human chromosome region 3p14; Bardenheuer W et al.; Structural alterations in human chromosome region 3p14-p23 resulting in the inactivation of one or more tumor suppressor genes are thought to play a pathogenic role in small cell lung cancer, renal cell carcinoma, and other human neoplasms . To identify putative tumor suppressor genes, 428 recombinant clones from a microdissection library specific for human chromosome region 3p14 were isolated and characterized . Ninety-six of these (22.5%) were human single-copy DNA sequences, 57 of which were unique sequence clones . Forty-four of these were mapped to the microdissected region using a cell hybrid mapping panel . Within this mapping panel, four probes detected two new chromosome breakpoints that were previously indistinguishable from the translocation breakpoint t(3;8) in 3p14.2 in hereditary renal cell carcinoma . One probe maps to the homozygously deleted region of the small cell lung cancer cell line U2020 . In addition, microdissection clones have been shown to be suitable for isolation of yeast artificial chromosomes.

J Mol Biol, 1994 Jan 14, 235(2), 508 - 31
Solution structure of the 3'-end of brome mosaic virus genomic RNAs . Conformational mimicry with canonical tRNAs; Felden B et al.; The conformation of the last 201 nucleotides located at the 3'-end of brome mosaic virus (BMV) RNAs was investigated in solution using different chemical and enzymatic probes . Bases were probed with dimethylsulfate (which methylates N-1 positions of A, N-3 positions of C and N-7 positions of G), a carbodiimide (which modifies N-1 positions of G and N-3 positions of U) and diethylpyrocarbonate (which modifies N-7 positions of A) . Ribonucleases T1, U2 and S1 were used to map unpaired nucleotides and ribonuclease V1 to monitor paired bases or stacked nucleotides . Cleavage or modification sites were detected by gel electrophoresis either indirectly by analyzing DNA sequence patterns generated by primer extension with reverse transcriptase of the modified RNAs or by direct identification within the statistical cleavage patterns of the RNA . On the basis of these biochemical results, an atomic model was built by computer modeling and its stereochemistry refined . The deduced secondary structure of the RNA confirms data previously proposed by others but contains additional base-pairs (A27-U32, A28-G31, G41-A134, G64-C68, U80-A99, G81-A98, G88-U91, G100-U126, U104-U125, G162-G166 and A172-A191), one new tertiary long-range interaction (U103-U164) and a small triple helical conformation with (G41-A134)-A18 and (C42-G133)-A17 interactions . The new secondary structure also indicates the existence of a second pseudoknot involving pairing between residues A181 to A184 and residues U197 to U194, outside the domain conferring tyrosylation ability to BMV RNA . The main outcome from the model stems from its intricate folding, which allows a new assignment for the domains mimicking the anticodon- and D-loop regions of tRNA . Interestingly, the stem and loop region found structurally to be analogous to the anticodon arm of tRNA(Tyr) does not contain the tyrosine anticodon involved in the aminoacylation process . The structural analogies with canonical tRNA(Tyr) illustrate the functional mimicry existing between the BMV RNA structure and canonical tRNA(Tyr) that allows for their efficient aminoacylation by tyrosyl-tRNA synthetase . This structural model rationalizes mutagenic and footprinting data that have established the importance of specific regions of the viral RNA for recognition by its replicase, (ATP,CTP):tRNA nucleotidyl-transferase and yeast tyrosyl-tRNA synthetase . The new fold has biological implications that can be used as a predictive tool for elaborating new experiments.

J Mol Biol, 1994 Jan 14, 235(2), 496 - 507
DNA helical instability facilitates initiation at the SV40 replication origin; Lin S et al.; Previous analysis of mutations in bacterial and yeast replication origins has identified a genetic component, termed a DNA unwinding element (DUE), whose intrinsic helical instability is essential for origin function . For the SV40 replication origin, we show here that the early palindrome (EP) and A + T-rich (AT) domains both exhibit helical instability, despite their dissimilar A + T compositions . To test the possible contribution of helical instability to SV40 origin function, the relationship between helical stability of mutant origin sequences and their known origin activity in vitro and in vivo was examined . Origin activity correlates inversely with the helical stability of mutations within the EP domain but not the AT domain or the T-antigen binding domain . The quantitative correlation holds for four different measures of origin activity determined in vitro and in vivo . An even better-correlated collection of mutations was found in a specific portion of the EP domain . This specific EP subdomain coincides with the sequence known to be strand-separated after T-antigen binds the origin in vitro and with the origin of bidirectional replication in vivo . Our analysis of origin mutations indicates that the helical instability of the specific EP subdomain is required to facilitate T-antigen-induced melting and the initiation of DNA replication . The sensitivity of the required EP subdomain to mutations that stabilize the DNA helix defines the DUE of the SV40 replication origin.

Nucleic Acids Res, 1994 Jan 11, 22(1), 59 - 65
Transcriptional repression by the human bZIP factor E4BP4: definition of a minimal repression domain; Cowell IG et al.; The bZIP factor E4BP4 overlaps in DNA binding site specificity with the transcriptional activator CREB and members of the ATF family of transcription factors, but is an active transcriptional repressor . In this study we have mapped the repressing activity of E4BP4 to a small 'domain' of 65 amino acids that retains its ability to repress transcription when transferred to the heterologous DNA binding domain of the yeast transcriptional activator GAL4 . This segment of the E4BP4 polypeptide contains a high proportion of charged amino acids and does not resemble the repression domains that have been characterized so far from other active transcriptional repressors such as the Drosophila Kruppel, Engrailed or Even-skipped proteins . A mutation which changes the charge configuration of this repression module resulted in a complete loss of repressor activity . The E4BP4-GAL4 fusion protein is able to repress the residual transcription from minimal promoters containing the adenovirus E4 or E1b TATA box . This is consistent with a mechanism of action whereby E4BP4 interacts with some component of the general transcription machinery to cause repression of basal and activated transcription . Although a number of nuclear proteins are able to interact with the E4BP4 repression domain in vitro, these proteins do not appear to include the general transcription factors TFIIB or TBP.

J Mol Biol, 1994 Jan 7, 235(1), 331 - 44
Crystal structure of the fungal peroxidase from Arthromyces ramosus at 1.9 A resolution . Structural comparisons with the lignin and cytochrome c peroxidases; Kunishima N et al.; The crystal structure of the peroxidase (donor: H2O2 oxidoreductase, EC 1.11.1.7) from the hyphomycete Arthromyces ramosus (ARP) has been determined by the multiple isomorphous replacement method and refined by the simulated annealing method to a crystallographic R-factor of 17.4% for the 19,191 reflections with F > 2 sigma F between 7.0 and 1.9 A resolution . The model includes residues 9 to 344, the heme group, two N-acetylglucosamine residues, two calcium ions and 246 water molecules . The root-mean-square deviation of bond lengths from the ideal values is 0.02 A . The mean coordinate error is estimated as 0.2 A . The electron density of the glycine-rich region of the amino-terminal eight residues was invisible . ARP has ten major and two short alpha-helices and a few short beta-strands . The overall tertiary structure of ARP is similar to that of yeast cytochrome c peroxidase (CCP) and is particularly similar to that of the lignin peroxidase (LiP) from Phanerochaete chrysosporium . Relative to CCP, ARP and LiP each have an extension of approximately 40 residues at the carboxy terminus . All eight cysteine residues in ARP form disulfide bonds (C12:C24, C23:C293, C43:C129 and C257:C322) . Two calcium sites are inaccessible to solvent . The four disulfide bonds and two calcium sites, which are lacking in CCP, are conserved in ARP and LiP . The bond from Asn304C to Ala305N in ARP is the site sensitive to proteases . An Asx turn present in the Asn303 to Ala305 segment appears to orient the side-chain of Asn304 to outward from the molecule, rendering it easily trappable by pockets of proteases . The proximal heme ligand is His184 in helix F (distance of N epsilon 2 .. . Fe, 2.10 A), and one of several water molecules in the distal pocket of the heme bridges the iron atom and the N epsilon 2 of His56 . The orientation of the imidazole ring of the distal histidine residue relative to the heme group in ARP differs significantly from that in LiP . The access channel to the distal side of the heme of ARP is markedly wider along the heme plane than that of LiP . Many of the amino acid residues that comprise the entrance of this channel differ for ARP and LiP . This may account for the differences in substrate specificity.

J Biol Chem, 1994 Jan 7, 269(1), 567 - 72
The pH-dependent membrane association of procathepsin L is mediated by a 9-residue sequence within the propeptide; McIntyre GF et al.; The lysosomal proprotease procathepsin L binds to mouse fibroblast microsomal membranes at pH 5, but mature active cathepsin L does not (McIntyre, G.F., and Erickson, A . H . (1991) J . Biol . Chem . 266, 15438-15445) . This binding is not dependent on N-linked carbohydrate as procathepsin L synthesized in cells treated with tunicamycin still shows pH-dependent membrane association . These results suggest that the propeptide (Thr18-Lys113) of the cysteine protease mediates its pH-dependent membrane association . Synthetic peptides containing either 24 or 9 residues from the N-terminal portion of the mouse procathepsin L propeptide inhibited the binding of mouse procathepsin L to microsomal membranes at pH 5 . In contrast, the pH-dependent membrane association was not inhibited either by a scrambled version of the 24-residue peptide, in which 3 adjacent residues likely to be positively charged at pH 5 were dispersed, or by a second control peptide containing the 11 N-terminal residues from mature mouse cathepsin L . The 24-residue peptide chemically coupled to horseradish peroxidase bound to microsomes at pH 5, but not at pH 7 . On ligand blots, the same conjugate bound specifically to a 43-kDa integral membrane protein, identifying the microsomal protein that mediates the proenzyme binding . The 9-residue propeptide sequence that inhibits the membrane association of procathepsin L at pH 5 resembles the vacuolar sorting sequences in the propeptides of yeast proteinase A and carboxypeptidase Y . This suggests that the membrane association of procathepsin L may play a role in the transport of the proenzyme to lysosomes, the vacuolar equivalent in mammalian cells.

J Biol Chem, 1994 Jan 7, 269(1), 548 - 55
Role of adenosine 3':5'-monophosphate-dependent protein kinase and cAMP levels in ATP-dependent mitogenesis in Swiss 3T3 cells; Huang NN et al.; To investigate the role of cAMP-dependent protein kinase (PKA) and cAMP levels in ATP-dependent mitogenesis, Swiss 3T3 cells were transfected with an expression vector coding for (i) a mutated regulatory subunit of PKA (PKA mutant) or (ii) a yeast low Km cAMP phosphodiesterase gene (PDE mutant) . The PKA mutant showed 70% reduced PKA activity . Phosphodiesterase activity increased 2.5-fold in the PDE mutant, leading to a great reduction of cAMP levels stimulated by ATP and other cAMP-increasing agents . The mitogenic responses of PKA and PDE mutants to insulin, epidermal growth factor, or 12-O-tetradecanoylphorbol-13-acetate were not significantly changed . However, the further stimulation by ATP, ADP, and adenosine 5'-(beta,gamma-imido)triphosphate in the presence of these growth factors was reduced by > 80% . Mitogenic effect of prostaglandin E2, forskolin, cholera toxin, or adenosine was inhibited in both mutants . The mitogenic stimulation by dibutyryl cAMP, which is resistant to phosphodiesterase, was inhibited in the PKA mutant, but not in the PDE mutant . A partial reduction of platelet-derived growth factor- or bombesin-stimulated mitogenesis, which involves protein kinase C as well as the cAMP signal, was observed in the mutants . These genetic results confirm pharmacological data on the role of PKA and cAMP levels in mitogenesis due to ATP and other growth factors.

Proc Natl Acad Sci U S A, 1994 Jan 4, 91(1), 88 - 92
Construction of libraries enriched for sequence repeats and jumping clones, and hybridization selection for region-specific markers; Kandpal RP et al.; We describe a simple and rapid method for constructing small-insert genomic libraries highly enriched for dimeric, trimeric, and tetrameric nucleotide repeat motifs . The approach involves use of DNA inserts recovered by PCR amplification of a small-insert sonicated genomic phage library or by a single-primer PCR amplification of Mbo I-digested and adaptor-ligated genomic DNA . The genomic DNA inserts are heat denatured and hybridized to a biotinylated oligonucleotide . The biotinylated hybrids are retained on a Vectrex-avidin matrix and eluted specifically . The eluate is PCR amplified and cloned . More than 90% of the clones in a library enriched for (CA)n microsatellites with this approach contained clones with inserts containing CA repeats . We have also used this protocol for enrichment of (CAG)n and (AGAT)n sequence repeats and for Not I jumping clones . We have used the enriched libraries with an adaptation of the cDNA selection method to enrich for repeat motifs encoded in yeast artificial chromosomes.

Cytogenet Cell Genet, 1994, 65(1-2), 115 - 8
Isolation and mapping of 328 new cosmid markers on human chromosome 8: construction of a high-resolution cytogenetic map of chromosome 8 with 416 markers; Nakamura Y et al.; We have determined the chromosomal localizations of newly isolated cosmids by fluorescent in situ hybridization (FISH) on prometaphase R-banded chromosomes and have constructed a high-resolution cytogenetic map for human chromosome 8 with 416 cosmid markers, including 328 new markers and 88 reported previously . Of the 416 markers, 229 were mapped to the long arm of chromosome 8, 181 to the short arm, and 6 to the centromere . Although the clones were scattered throughout the chromosome, they were concentrated in R-positive bands . Since the estimated physical length of chromosome 8 is 135 Mb, the overall average distance between loci is 320 kb, but the average separation of loci on R-positive bands is nearly 130-200 kb . This cytogenetic map will serve as a resource for efforts to characterize chromosomal and molecular aberrations involved in cancers, to clone genes associated with hereditary diseases, and to construct a detailed physical map of large electrophoretic fragments and/or contiguous cosmids and yeast artificial chromosomes.

Cytogenet Cell Genet, 1994, 65(1-2), 104 - 7
Assignments of 37 YAC clones to R-banded chromosomes by fluorescent in situ hybridization; Slim R et al.; Fluorescent in situ hybridization was used to assign 37 yeast artificial chromosomes (YACs) from the CEPH (Centre d'Etude du Polymorphisme Humain) libraries to R-banded metaphases stained with propidium iodide . The use of the whole yeast DNA as probe, allows rapid mapping and characterization of YAC clones . Of 37 YAC clones, 11 were found cytogenetically chimeric (30%) . The YAC clones reported in this study can be used to isolate and characterize targeted regions involved in genetic diseases and cancer breakpoints.

Arch Biochem Biophys, 1994 Jan, 308(1), 8 - 23
Porin proteins in mitochondria from rat pancreatic islet cells and white adipocytes: identification and regulation of hexokinase binding by the sulfonylurea glimepiride; Muller G et al.; The binding of hexo-/glucokinase and glycerol kinase to mitochondria via the channel forming protein, porin, in pancreatic islet beta-cells and adipocytes, was recently proposed to participate in nutritional signaling, glucose sensing, and the control of high-energy phosphate distribution and oxidative phosphorylation . In this study we demonstrate that polyclonal antisera against purified rat liver porin recognize unique proteins in rat pancreatic islets, adipocytes, and RINm5F cells, each with an apparent M(r) about 2000 smaller than that of liver porin . Immunoblotting of subcellular fractions, the purity of which has been controlled by the distribution of marker proteins, revealed the mitochondrial localization of the cross-reacting proteins . Their enrichment with a method used for the purification of porin proteins, the characteristic behavior during isoelectric focusing, and the specific binding of rat liver hexokinase and glycerol kinase to phospholipid vesicles containing the purified cross-reacting beta-cell or adipocyte proteins strongly suggest their identity with mitochondrial porin . The subtle differences in the apparent M(r) and charge heterogeneity raise the possibility of the existence of porin isoforms expressed in a tissue-specific manner . Anti-porin antisera coimmunoprecipitated hexo-/glucokinase from rat insulinoma cell (RINm5F) and adipocyte mitochondria as determined by subsequent immunoblotting of the immunoprecipitates with polyclonal antisera against yeast hexokinase and rat liver glucokinase, respectively . This indicates that some rat pancreatic glucokinase (54 kDa) and liver hexokinase (102 kDa), respectively, is bound to mitochondrial porin . The major portion of the bound fraction is released from mitochondria after treatment with glucose 6-phosphate . Incubation of RINm5F and fat cells with the insulin releasing sulfonylurea drug, glimepiride (20 nM and 5 microM, respectively) for 30 min reduces the amount of hexo-/glucokinase associated with mitochondria and porin to about 50-30% . The reduced kinase binding activity of porin is preserved after isolation of porin from glimepiride-treated cells, reconstitution into phospholipid vesicles and assaying for glucose 6-phosphate inhibitable binding of rat liver hexokinase . The sulfonylurea tolbutamide (20 microM and 5 mM) is significantly less effective . The sulfonylurea-induced inhibition of hexo-/glucokinase binding to mitochondrial porin does not require glucose metabolism or Ca2+ influx into the cells . These data suggest that the sulfonylurea glimepiride, which is thought to inhibit the ATP-regulated K(+)-channel in beta-cells, may have, in addition, an intracellular site of action in pancreatic islet and adipocyte cells at the level of regulation of gluco-/hexokinase binding to mitochondrial porin.

EMBO J, 1994 Jan 1, 13(1), 147 - 57
Cooperativity in vivo between the E2 transactivator and the TATA box binding protein depends on core promoter structure; Ham J et al.; The E2 transactivator protein of bovine papillomavirus 1 (BPV-1) can strongly stimulate complex promoters such as that of the herpes simplex virus thymidine kinase gene but does not efficiently activate minimal promoters that only contain E2 binding sites and a TATA box . Here we show that overexpression of the human, but not yeast, TATA box binding protein (TBP) in transfection experiments overcomes this block and enables E2 to activate a minimal TATA box-containing promoter . This suggests that recruitment of the TFIID complex to such promoters is normally a rate limiting step for transcriptional activation by E2 in vivo . In contrast, minimal promoters that contain an initiator element in addition to a TATA box are efficiently activated by E2 on its own and this activation is only moderately enhanced by TBP overexpression . In such E2-responsive promoters the TATA box or initiator can be functionally replaced by SP1 binding sites . Both the initiator binding protein, TFII-I, and SP1 have been found to interact physically with components of the TFIID complex . Since either TBP overexpression or the presence of an initiator or SP1 binding sites can increase activation by E2, it seems likely that the principal role of the E2 activation domain is to affect a step in the formation of the transcription initiation complex that occurs after TFIID has bound to the promoter . Sequential action of transcription factors, such as TFII-I, SP1 and E2, may be one type of mechanism underlying the widely observed phenomenon of transcriptional synergy.

EMBO J, 1994 Jan 1, 13(1), 128 - 37
A flower-specific Myb protein activates transcription of phenylpropanoid biosynthetic genes; Sablowski RW et al.; Synthesis of flavonoid pigments in flowers requires the co-ordinated expression of genes encoding enzymes in th phenylpropanoid biosynthetic pathway . Some cis-elements involved in the transcriptional control of these genes have been defined . We report binding of petal-specific activities from tobacco and Antirrhinum majus (snapdragon) to an element conserved in promoters of phenylpropanoid biosynthetic genes and implicated in expression in flowers . These binding activities were inhibited by antibodies raised against Myb305, a flower-specific Myb protein previously cloned from Antirrhinum by sequence homology . Myb305 bound to the same element and formed a DNA-protein complex with the same mobility as the Antirrhinum petal protein in electrophoretic mobility shift experiments . Myb305 activated expression from its binding site in yeast and in tobacco protoplasts . In protoplasts, activation also required a G-box-like element, suggesting co-operation with other elements and factors . The results strongly suggest a role for Myb305-related proteins in the activation of phenylpropanoid biosynthetic genes in flowers . This is consistent with the genetically demonstrated role of plant Myb proteins in the regulation of genes involved in flavonoid synthesis.

FASEB J, 1994 Jan, 8(1), 13 - 9
Amino acid-regulated gene expression in eukaryotic cells; Kilberg MS et al.; Given the central role of protein synthesis in cellular function, it is likely that intricate mechanisms exist to detect and respond to amino acid deprivation . However, the current understanding of amino acid-dependent control of gene expression in mammalian cells is limited . A few examples of enzyme, transporters, and unidentified mRNA species subject to amino acid availability have been reported and some examples are summarized here . Each example chosen-asparagine synthetase, system A transport activity, and ribosomal protein L17--are associated with different aspects of amino acid metabolism, and therefore reflect the spectrum of metabolic pathways influenced by substrate control . Most of the data accumulated thus far suggest that a general control response exists such that these various activities are induced when any one of several amino acids becomes limiting . Consistent with observations in yeast, it appears that the degree of tRNA acylation and its resultant effect on protein synthesis may play an important role in initiating the starvation signal . De novo protein synthesis is required for starvation-dependent increases in several mRNA species, which suggests that the amino acid signaling pathway is composed of a series of intermediate steps before activation of specific structural genes.

J Trauma, 1994 Jan, 36(1), 20 - 5; discussion 25-6
Routine prophylactic antifungal agents (clotrimazole, ketoconazole, and nystatin) in nontransplant/nonburned critically ill surgical and trauma patients; Savino JA et al.; A prospective, randomized study was conducted to determine if prophylactic antifungal agents prevented yeast colonization (YC) or yeast sepsis (YS), or if they diminished mortality in 292 critically ill adult (nontransplant/nonburned) surgical and trauma patients admitted to the SICU for 48 hours or longer . Patients were randomized to receive (group I) no therapy, (group II) clotrimazole 10 mg three times a day, (group III) ketoconazole 200 mg per day, or (group IV) nystatin 2 million units every 6 hours . For comparison patients were stratified by the criteria of Slotman and Burchard into high risk (> or = 3 risk factors) and low risk (< 3 risk factors) . Fifty patients (17%) had yeast colonization, nine (3.1%) had yeast sepsis, and 41 (14%) died . Stepwise logistic regression analysis of yeast colonization and sepsis using the variables APACHE II scores > 10, need for ventilator support > 48 hours, and 14 risk factors (Slotman and Burchard) showed that treatment with three or more antibiotics, APACHE II > 10, and ventilatory support > 48 hours were the only three variables that were significant predictors of yeast colonization and sepsis . There was no significant difference between the four groups with regard to YC (23%, 18%, 12%, and 15%, respectively), YS (3%, 1%, 2%, and 7%, respectively), or mortality (15%, 14%, 6%, and 20%, respectively).(ABSTRACT TRUNCATED AT 250 WORDS)

J Cell Biol, 1994 Jan, 124(1-2), 101 - 15
A small rab GTPase is distributed in cytoplasmic vesicles in non polarized cells but colocalizes with the tight junction marker ZO-1 in polarized epithelial cells; Zahraoui A et al.; Small rab/Ypt1/Sec4 GTPase family have been involved in the regulation of membrane traffic along the biosynthetic and endocytic pathways in eucaryotic cells . Polarized epithelial cells have morphologically and functionally distinct apical and basolateral surfaces separated by tight junctions . The establishment and maintenance of these structures require delivery of membrane proteins and lipids to these domains . In this work, we have isolated a cDNA clone from a human intestinal cDNA library encoding a small GTPase, rab13, closely related to the yeast Sec4 protein . Confocal microscopy analysis on polarized Caco-2 cells shows that rab13 protein colocalized with the tight junction marker ZO-1 . Cryostat sections of tissues confirm that rab13 localized to the junctional complex region of a variety of epithelia, including intestine, kidney, liver, and of endothelial cells . This localization requires assembly and integrity of the tight junctions . Disruption of tight junctions by incubation in low Ca2+ media induces the redistribution of rab13 . In cells devoid of tight junctions, rab13 was found associated with vesicles dispersed throughout the cytoplasm . Cell-cell contacts initiated by E-cadherin in transfected L cells do not recruit rab13 to the resulting adherens-like junction complexes . The participation of rab13 in polarized transport, in the assembly and/or the activity of tight junctions is discussed.

Immunogenetics, 1994, 39(3), 194 - 200
Cloning of a new kinesin-related gene located at the centromeric end of the human MHC region; Ando A et al.; We previously reported the presence of a new gene (HSET) with an unknown function, in the centromeric side of the class II gene region of the human major histocompatibility complex (MHC) . cDNA clones corresponding to the HSET gene were isolated from a human testis cDNA library . A 2.4 kilobase transcript from the HSET gene was abundantly expressed in testis, B-cell, T-cell, and ovary cell lines but was not detected in lung or stomach . Analysis of the nucleotide sequence of the HSET cDNA clones revealed significant similarity to kinesin-related proteins in yeast, Drosophila, and human . Its predicted amino acid sequence contains a domain with strong sequence similarity to the ATP-binding and motor domains of a plus end-directed microtubule motor protein, kinesin, which might be involved in mitotic chromosome segregation, suggesting that the HSET gene encodes a novel kinesin-related protein.

Blood, 1994 Jan 1, 83(1), 199 - 208
Consistent loss of the D5S89 locus mapping telomeric to the interleukin gene cluster and centromeric to EGR-1 in patients with 5q- chromosome; Nagarajan L et al.; Interstitial deletions of the long arm of chromosome 5 are common in a number of disorders of leukemic and preleukemic myeloid disorders . Although the limits of these deletions vary among patients, a region of cytogenetic overlap that includes band 5q31 is deleted consistently, suggesting loss of 5q31 loci critical for normal myeloid differentiation and leukemogenesis . An anonymous genomic DNA segment D5S89, previously mapped to 5q21-31, detects consistent loss of alleles in cases showing the 5q- chromosome at presentation or relapse . Analysis of a panel of natural-deletion somatic-cell hybrids in conjunction with irradiation hybrids containing fragments of human chromosome 5q shows that the D5S89 locus is telomeric to the interleukin (IL) genes (IL-3, IL-4, IL-5, IL-9, and granulocyte-macrophage colony-stimulating factor {GM-CSF}) and interferon response factor-1 (IRF-1) gene and centromeric to the early response transcription factor (early growth response gene-1 {EGR-1}) on 5q31 . To further define the principal region of loss, we have isolated and characterized yeast artificial chromosomes (YACs) spanning D5S89 . The presence of several CpG islands within the 300-kb YAC is suggestive of multiple transcription units . However, IL-4, IL-5, IRF-1, IL-3, GM-CSF, and EGR-1 genes were not detected in the YAC clone spanning D5S89, implying that none of these genes are in the vicinity of the D5S89 marker . Further characterization of these YACs should facilitate the isolation of novel candidate genes that may play a role in the evolution of the abnormal phenotype associated with 5q- chromosome.

Cytogenet Cell Genet, 1994, 65(3), 179 - 83
Detection of amplified sequences at 5q11-->q13 in a homogenously staining region found by fluorescent in situ hybridization in a case of B-cell non-Hodgkin's lymphoma; Wlodarska I et al.; Gene amplification is one of the molecular mechanisms possibly involved in the initiation of tumorigenesis . Homogenously staining regions and double minutes have been shown to contain amplified DNA sequences . We report here a case of B-cell non-Hodgkin's lymphoma (NHL) carrying an abnormal chromosome 5 with an hsr-like region at 5q11-->q13 . Chromosome "painting" with a chromosome 5-specific library (pBS5) showed that the amplified material was indeed derived from chromosome 5 . Further identification of the amplified DNA sequences was performed with a set of YAC probes localized to 5q12-->q14 . The amplified region contained genetic loci defined by D5S6, D5S125, D5S112, and D5S39 . A three-fold level of DNA amplification was visualized by Southern blotting using a DNA probe from the amplified region . The present results suggest that unknown gene(s) at 5q11-->q13 might be involved in the process of lymphomagenesis when amplification occurs.

Cytogenet Cell Genet, 1994, 65(3), 172 - 6
Localization of the gene (RSN) coding for restin, a marker for Reed-Sternberg cells in Hodgkin's disease, to human chromosome band 12q24.3 and YAC cloning of the locus; Hilliker C et al.; A novel 160-kDa intermediate filament associated protein, named restin (Reed-Sternberg intermediate filament associated protein), is specifically expressed in the malignant cells of Hodgkin's disease and anaplastic large cell lymphoma (Ki-1 lymphoma) . The combination of chromosomal R-banding and fluorescence in situ hybridization (FISH) with the use of two fluorescent dyes, fluorescein isothiocyanate and propidium iodide, allowed simultaneous detection of the hybridized DNA sequence and chromosomal R-banding . By this technique, the gene coding for restin (RSN) was assigned to chromosome region 12q24.31-->q24.33, while localization of the alpha-2-macroglobulin receptor (A2MR) was refined to 12q13.1-->q13.3 . To further analyze the restin gene, a 500-kb YAC clone containing the gene was isolated and analyzed . A restriction map of this area is presented.

J Med Vet Mycol, 1994, 32(1), 47 - 57
Immunochemical studies of heat-shock protein 80 of Histoplasma capsulatum; Jeavons L et al.; A monoclonal antibody (MAb) of the IgG1 subclass, with greater activity to the yeast than the mycelial phase of Histoplasma capsulatum was raised and was found to predominantly recognize a molecule of 80 kDa by immunoblot . Enzymatic deglycosylation and chemical degradation, followed by reaction with MAb 69F on Western blots showed the molecule to be O-glycosylated, and immunofluorescence studies showed it to be heat-inducible and its distribution to be cytoplasmic and possibly cell membraneous . There was no apparent staining of the cell wall . Culture filtrate was positive by ELISA and Western blot when reacted with MAb 69F . In addition, ELISA and Western blot demonstrated that a similar epitope was present in other fungal species . The glycoprotein had a pI of approximately 4.7 . N-terminal amino acid sequencing revealed this molecule to be homologous to members of the heat-shock protein 70 family and to a recently described antigen from H . capsulatum.

Neth J Med, 1994 Jan, 44(1), 18 - 22
Disseminated Penicillium marneffei infection as an imported disease in HIV-1 infected patients . Description of two cases and a review of the literature; Kok I et al.; Two cases of disseminated Penicillium marneffei infection, as an imported disease, in HIV-1-infected patients with a severe immunodeficiency are reported . These patients had a history of travel in Southeast Asia where P . marneffei is endemic . Fever, cough, malaise, hepatosplenomegaly, anaemia, skin lesions and mucosal ulcers are the main clinical characteristics . Differentiation from histoplasmosis and leishmaniasis might be difficult . Treatment with amphotericin B was successful . Anti-fungal maintenance therapy is most likely indicatedPIP: A 33-year-old, HIV-1 positive, white, homosexual man was hospitalized in May, 1991, because of fever, cough, skin eruptions, anorexia, and weight loss during the previous 2 months . In October, 1990, he had traveled in Sumatra . On examination he was ill, tachypneic, normotensive with a temperature of 39.1 degrees Celsius . The spleen was substantially enlarged . Laboratory investigations showed: ALAT 72 U/I (normal 23 U/1), LDH 508 U/1 (normal 275 U/1) . A bronchoscopy with bronchoalveolar lavage revealed yeast cells . Gastroscopy showed an ulcer in the hypopharynx and an erosion in the stomach . Biopsies of this ulcer demonstrated the presence of Penicillium marneffei . Biopsies of the liver showed the same organism . The patient was treated with amphotericin B induction therapy (1 dd 0.5 mg/kg for 21 days, total dose of 730 mg) in combination with flucytosine (3 dd 2500 mg, total dose 142 g in 19 days) . In the following 2 weeks the temperature became normal, and the dyspnea and the skin eruptions disappeared, except for the mollusca contagiosa . The spleen diminished by 50% . LDH and ALAT became normal . Oral maintenance therapy followed with fluconazole (the first 3 months 400 mg daily, followed by 200 mg a day) . 24 months later, no recurrence had been observed . Case 2 was a 28-year-old, HIV-infected, homosexual man, born in Suriname, who was hospitalized in October, 1991, with prolonged fever, dyspnea, and a painful throat . In March, 1991, he had traveled in rural Thailand . AIDS was diagnosed on the basis of cerebral toxoplasmosis in August, 1991 . A biopsy of the ulcer in the oropharynx showed an active aspecific inflammation and also P . marneffei . Treatment with amphotericin B intravenously (0.5 mg/kg, total dose 1052 mg in 32 days) was commenced . The lesions in the oral cavity and throat, the lymph nodes, and the shortness of breath disappeared within a few days . Ten months later he died from emaciation caused by cryptosporidiosis .

Somat Cell Mol Genet, 1994 Jan, 20(1), 39 - 46
Detection of deletion mutations extending beyond the HPRT gene by multiplex PCR analysis; Fuscoe JC et al.; A multiplex PCR assay was developed for the rapid analysis of deletion size at the hypoxanthine phosphoribosyltransferase (hprt) locus . The DNA sequence of mapped DNA segments flanking the hprt gene was determined . These cloned DNAs were derived from the ends of a set of overlapping yeast artificial chromosomes (YAC) defining a contig of 8 Mb at Xq26 and including hprt . We used "bubble" PCR to isolate an additional YAC end-clone . Seven primer pairs were derived from DNA sequence analysis of the clones and incorporated into a multiplex PCR assay . These primer pairs define loci located approximately 750 kb and 350 kb upstream of hprt and 300 kb, 540 kb, 900 kb, 1260 kb, and 1400 kb downstream of hprt . A primer pair for an unlinked and unselected gene sequence (K-ras) was also included in the multiplex reaction to serve as an internal positive control . Using this new assay, hprt mutant DNAs can be screened to determine the extent of deletion . Deletions larger than 2 Mb have been identified and show that large deletions can be tolerated at this hemizygous locus.

Genomics, 1994 Jan 1, 19(1), 52 - 9
Physical mapping of the NF2/meningioma region on human chromosome 22q12; Ruttledge MH et al.; Loss of genetic information from chromosome 22 has been implicated in the development of neurofibromatosis type 2, meningioma, and several other neoplasia . Molecular studies indicate that genes within chromosomal band 22q12 may be involved in tumorigenesis . We have mapped 29 loci into 16 groups in this region, using pulsed-field gel electrophoresis, fluorescence in situ suppression hybridization, and somatic cell hybrid mapping . The region spans more than 5 Mb of genomic DNA and contains the genes for neurofibromatosis type 2 and meningioma . The order of loci presented here provides the framework for the fine mapping of this region using cosmids and yeast artificial chromosomes, and it facilitates the speedy cloning of novel genes from 22q12.

Cytogenet Cell Genet, 1994, 67(1), 37 - 40
Concurrent mapping of an adenovirus 5/SV40 integration site and the U1 snRNA cluster (RNU1) within 400 kb of the chromosome region 1p36.1; Romani M et al.; Previous reports from our group suggested the preferential integration of the viral construct Ad5/SV40 at the short arm subtelomeric region of human chromosome 1 . The present study narrows the region of viral integration to site 1p36.1 in a close cytogenetic overlap with the U1 snRNA gene cluster (RNU1) within a distance necessarily smaller than 400 kb as suggested by the size of the YAC in which the two markers were found to coexist . This finding supports the hypothesis that the chromosomal site in question may have a constitutional propensity to genetic recombination.

Vaccine, 1994, 12(3), 223 - 34
Comparison of two immunization schedules with recombinant hepatitis B vaccine and natural immunity acquired by hepatitis B infection in dialysis patients; el-Reshaid K et al.; In a prospective study over a 2-year period we compared two practical dosage schedules to vaccinate dialysis patients against hepatitis B virus (HBV) infection using a yeast-derived recombinant hepatitis B vaccine (Engerix-B) . In addition, the natural history of this acquired immunity was compared with that developed through HBV infection in dialysis patients and healthy subjects . Patients on dialysis treatment (haemo or peritoneal) who were tested to be negative for hepatitis B surface antigen (HBsAg), anti-HBs and anti-HB core were allocated at random to receive HB vaccine according to one of the two schedules . The two groups receiving the vaccine were matched for age, sex, mean duration on dialysis and the form of dialysis treatment received . The group of patients who received a four-dose schedule (at 0, 1, 2 and 6 months) of 40 micrograms of HB vaccine each time (group 2) achieved a seroconversion rate of 79% 1 month after the last dose (at month 7) compared with a seroconversion rate of 55% in those who received three doses (at 0, 1 and 6 months) of 40 micrograms each (group 1) . Healthy controls who received half the amount of vaccine on a three-dose schedule (group 3) attained 100% seroconversion (p < 0.05) . When retested at 24 months, 30% of seroconverters in group 1 had lost their protective immunity, compared with only 6% in group 2 and 15% in group 3 . The magnitude of antibody response (total and anti-(a)-specific) was assessed in the vaccinees at 24 months and compared with that of two other control groups, dialysis patients (group 4) and healthy volunteers (group 5), who had acquired immunity from HBV infection . In general, the total and anti-(a)-specific HBs titres in the dialysis patients (groups 1, 2 and 4) were lower than in their corresponding healthy controls (groups 3 and 5), irrespective of whether the protective immunity was acquired by vaccination or HBV infection . However, the anti-HBs titres in dialysis patients who received four doses were significantly higher than in those who received only three doses (p < 0.05), which indicated a better protective immunity in favour of the former regime . The magnitude of antibody response in the vaccinees of groups 2 and 3 compared well with their respective controls, groups 4 and 5, who had acquired their immunity through HBV infection . This implied that the yeast-derived vaccine was sufficiently immunogenic and provided lasting protection in patients and healthy subjects vaccinated by an appropriate dosage schedule.(ABSTRACT TRUNCATED AT 400 WORDS)

J Clin Lab Anal, 1994, 8(1), 1 - 3
Clearance of Histoplasma capsulatum variety capsulatum antigen is useful for monitoring treatment of experimental histoplasmosis; Kohler S et al.; We sought to determine whether measurement of Histoplasma capsulatum var . capsulatum antigen concentration in tissues and blood provided a marker for antifungal effect of itraconazole in a nonlethal murine model of histoplasmosis . Treatment with itraconazole (Sporanox), in cyclodextrin, was evaluated in a pulmonary model of histoplasmosis . Mice infected with 4.0 x 10(7) yeast-phase organisms by endotracheal inoculation were treated with itraconazole, 1.5 mg twice daily by gavage, for 10 consecutive days, beginning on day 4 of infection . All mice were sacrificed on day 15 of infection . Blood, spleen, and lung tissues were removed for culture and quantification of antigen . Numbers of organisms were significantly lower in spleens from the treated group: 20.8 +/- 41.8 vs . 65.8 +/- 39.1 in the control group, P = 0.017 . Numbers of organisms in lung were 9.6 +/- 27.3 colony forming units in treated versus 24.2 +/- 36.3 in control animals, P = 0.267 . Antigen concentrations in spleen tissue and serum were lower in treated versus control mice: spleen, 1.8 +/- .6 units in treated versus 11.0 +/- 2.3 in controls, P < 0.001; serum, 0.8 +/- 0.2 units in treated versus 2.2 +/- 1.0 units in controls, P < 0.001 . Lung antigen concentrations were similar in the two groups, 19.2 +/- 1.4 units in treated compared to 17.9 +/- 3.0 units in control mice, P = 0.142 . The cyclodextrin formulation of itraconazole (Sporanox) demonstrated antifungal activity in experimental histoplasmosis . Antigen detection was a useful marker for antifungal effect.

Hum Mol Genet, 1994 Jan, 3(1), 99 - 106
Construction of a YAC contig and a STS map spanning at least seven megabasepairs in chromosome 5q34-35; Lu-Kuo JM et al.; We have constructed a YAC contig containing 54 clones and a minimum of 7 Mbp of human DNA, that maps to bands q34-35 on chromosome 5 . The contig was nucleated using FISH mapped cosmid clones shown to flank the t(2;5)(p23;q35) translocation breakpoint in a CD30-positive large cell lymphoma cell line . Thirty of the 54 YAC clones are non-chimeric and six span the translocation breakpoint, as determined by FISH analysis . A total of 28 YAC clone end fragments, 14 non-polymorphic YAC end STS probes and 13 polymorphic microsatellite STS markers have been used to order clones within the contig . The most distal genetic markers (D5S498 and D5S619) are separated by 15 cM based on multipoint linkage analysis . This map of overlapping clones and the set of densely spaced physical markers will promote our understanding of the 5q34-35 region and its associated genes.

Proteins, 1994 Jan, 18(1), 81 - 93
Homologous modeling of the lysosomal protective protein/carboxypeptidase L: structural and functional implications of mutations identified in galactosialidosis patients; Elsliger MA et al.; The deficiency of the lysosomal protective protein/carboxypeptidase L (CARB L) causes the lysosomal storage disorder, galactosialidosis, characterized by neuraminidase and beta-galactosidase deficiencies in patients' cells . The three enzymes form a complex inside the lysosome, and the neuraminidase and beta-galactosidase deficiencies are secondary to CARB L deficiency . Sequence similarity and common enzymological properties suggest that the protomeric tertiary structure of CARB L is conserved within a family of serine carboxypeptidases which includes the yeast carboxypeptidase Y, killer expression I gene product and several plant carboxypeptidases . We used this homology to build a model of the CARB L structure based on the recently published X-ray atomic coordinates of the wheat carboxypeptidase II (CPDW-II) which shares 32% primary structure identity with CARB L . Small insertions and deletions were accommodated into the model structure by energy minimization using the DREIDING II force field . The C alpha atomic coordinates of the final CARB L model have a RMS shift of 1.01 A compared to the corresponding conserved residues in the CPDW-II template structure . The correct orientation of the homologous catalytic triad residues Ser150, His429 and Asp392, the potential energy calculations and the distribution of hydrophobic and hydrophillic residues in the structure all support the validity of the CARB L model . Most missense mutations identified in galactosialidosis patients were located in secondary structural elements except for the Tyr211-->Asn mutation which is in a loop . The other mutant residues have their side chains deeply buried in the central beta-sheet of the model structure except for the Phe412-->Val mutation which is located in the dimer interface . The predicted effects of specific mutations on CARB L structural stability correlates well with recently published transient expression studies of mutant CARB L (Shimmoto, M . et al., J . Clin . Invest., 91:2393-2399, 1993).

Mol Biol (Mosk), 1994 Jan-Feb, 28(1), 87 - 95
{Interaction of a synthetic zinc-binding peptide with DNA}; Khokhlov DN et al.; Synthesis, DNA- and zinc ion-binding activities of the synthetic 23-residue peptide, forming a part of the DNA-binding domain of yeast transcription activator GAL-4, are reported . In presence of zinc ions considerable changes in the shapes of the fluorescence and CD spectra of the peptide are observed . It is shown that the peptide forms complexes with zinc ions containing one metal ion per peptide molecule with association constants on the order of (1-2) x 10(6) M-1 . Using gel filtration on a TSK-gel column we have shown that in aqueous solution at concentrations of 10(-4)-10(-6) M the peptide exists predominantly in the dimeric form . Dimerization constants were found to be 5 x 10(6) M-1 and 1.7 x 10(7) M-1 in the absence and in the presence of zinc ions, respectively . It is shown that the peptide binds to DNA . The binding approaches saturation when one peptide molecule is bound approximately to five base pairs of DNA . The shapes of the titration curves obtained from binding of the peptide to DNA show that the peptide can bind to DNA both in the monomeric and self-associated forms (dimer or tetramer) . Increasing DNA concentration and decreasing the peptide/DNA molar ratio lead to a shift in the equilibria between self-associated peptide species and monomers toward the formation of monomer peptide complexes.

Pharmazie, 1994 Jan, 49(1), 47 - 8
Pharmacokinetics and distribution of selenium in blood and organs of rats; Ryszka F et al.; The dynamics of selenium concentration changes in blood, organs and tissues of rats after a single intragastric administration of selenium yeast and sodium selenite was determined . The course of selenium concentration changes in blood was described, the pharmacokinetic parameters were estimated according to the trivalent equation of dicompartment model and the selenium content in liver, kidneys, small intestine, spleen, heart, brain, stomach, testicles and prostate was determined 48 h after the administration of selenium preparations.

Immunology, 1994 Jan, 81(1), 96 - 102
Enhancement of human monocyte beta-glucan receptors by glucocorticoids; Kay J et al.; Glucocorticoids are potent and diverse in their effects on mononuclear phagocytes, ranging from suppression to stimulation . To determine whether glucocorticoids affected functions mediated by monocyte beta-glucan receptors, human mononuclear cells (MNC) were incubated for 20 hr at 37 degrees with 20-2000 nM dexamethasone or hydrocortisone, and the monocytes were subsequently assayed for their ingestion of purified yeast glucan particles . Prior treatment with dexamethasone or hydrocortisone enhanced monocyte phagocytosis of glucan particles in a dose-dependent manner and both steroids effected a twofold increase at 200 nM . Monocytes from three different donors were assessed for secretion of beta-N-acetylglucosaminidase, and all were increased by exposure to 200 nM dexamethasone for 20 hr and subsequent stimulation with glucan particles for 2 hr; the average percentage net release was 16.2% . The enhancement in monocyte phagocytosis of glucan particles did not result by culture of MNC with beta-oestradiol, progesterone, testosterone or spironolactone, indicating a specificity for corticosteroids with glucocorticoid activity . The increases in phagocytic activity by monocytes that had been exposed during culture to either 200 nM dexamethasone or 200 nM hydrocortisone were both reduced by 40-50% by pretreatment of monocytes with the anti-idiotype (anti-Id) that recognizes beta-glucan receptors . Exposure of cells to 200 nM dexamethasone for 2 hr and washing before continued incubation for 18 hr in steroid-free media resulted in stimulation of monocyte beta-glucan receptors, whereas similar exposure without subsequent culture or with the addition of cycloheximide for the final 18 hr did not . Thus, glucocorticoids enhance monocyte functions mediated by beta-glucan receptors, and this stimulation is dependent on proteins that are newly synthesized during culture.

Cytogenet Cell Genet, 1994, 66(3), 196 - 213
A radiation hybrid map of human chromosome 18; Francke U et al.; A human x Chinese hamster (CH) somatic cell hybrid subclone deficient in HPRT and containing only human chromosome 18 was irradiated with 7000 rad and fused to a thymidine kinase deficient CH cell line . Radiation-rescued hybrid cell lines, selected in HAT medium, were analyzed for human DNA with human interspersed-repeat sequence primers . Size and number of human chromosome fragments retained in a subset of hybrids were determined by FISH . A panel of 98 radiation hybrids (RH) was selected and analyzed for 90 chromosome 18-specific STSs by PCR, and for the D18Z1 centromeric marker by Southern blotting . STSs were developed from previously mapped RFLP loci and from published sequences . In addition, 32 novel STSs were generated from an 18-specific lambda library and from 18-specific YACs previously localized to chromosome bands by FISH . Marker retention frequency varied from 8-65% with an average of 24% . In selected RH the STS typing data were correlated with the chromosome 18 regions retained using 'reverse FISH' of IRS-PCR products from the RH to normal metaphase chromosomes . The order and intermarker distances of loci were determined using two-point and multipoint maximum likelihood methods . The resulting RH map covers most of chromosome 18 with four groups of tightly linked markers and three regions of loosely linked markers, one around the centromere and two on the long arm . More than a third of the markers are polymorphic and allow integration with the linkage map . This RH map provides a framework for establishing a clone contig of the entire chromosome 18.

Occup Environ Med, 1994 Jan, 51(1), 62 - 7
Effects of inhaled ceramic fibres on macrophage function of rat lungs; Morimoto Y et al.; To evaluate the biological effect of ceramic fibres on the clearance function of alveolar macrophages (AMs) morphological changes and phagocytic activity of AMs were assessed . Rats were exposed to respirable ceramic fibres with a mass median aerodynamic diameter of 4.4 microns and a concentration of 20.1 mg/m3 in an exposure chamber . They were killed after one week (group A) and two weeks (group B) of exposure, and four weeks (group C) and 12 weeks (group D) after exposure for two weeks . The AMs recovered by bronchoalveolar lavage (BAL) from each test group were incubated with yeast and phagocytic activity was determined by counting the number of yeast cells in AMs . Morphological features of AMs were assessed by scanning electron microscopy and quantified according to morphological changes . Total cell counts in BAL fluid from exposed rats in group A were higher than in control rats . Phagocytic activity of exposed AMs in group B and C exceeded that of control AMs . Morphological changes of the exposed AMs in groups A, B, and C were greater than those of control AMs . These findings suggest that ceramic fibres induced the phagocytic activity and morphological changes in AMs, and that the clearance function of AMs was stimulated by the inhaled ceramic fibres.

Plant Mol Biol, 1994 Jan, 24(2), 283 - 94
Methotrexate does not block import of a DHFR fusion protein into chloroplasts; America T et al.; Protein import into chloroplasts requires the movement of a precursor protein across the envelope membranes . The conformation of a precursor as it passes from the aqueous medium across the hydrophobic membranes is not known in detail . To address this problem we examined precursor conformation during translocation using the chimeric precursor PCDHFR, which contains the plastocyanin (PC) transit peptide in front of mouse cytosolic dihydrofolate reductase (DHFR) . The chimeric protein is targeted to chloroplasts and is competent for import . The conformation of PCDHFR can be stabilized by complexing with methotrexate, an analogue of the substrate of DHFR . Methotrexate strongly inhibits DHFR import into yeast mitochondria (M . Eilers and G . Schatz, Nature 322 (1986) 228-232), presumably because the precursor must unfold to cross the membrane and it cannot do so when complexed with methotrexate . We show here that methotrexate does not block PCDHFR import into chloroplasts . Methotrexate does slow the rate of import, and protects DHFR from degradation once inside chloroplasts . The processed protein is localized in the stroma, indicating that import into thylakoids is impeded . Protease sensitivity assays indicate that the complex of precursor protein with methotrexate changes in conformation during the translocation across the envelope.

Ann Hematol, 1994 Jan, 68(1), 21 - 6
Low incidence of invasive fungal infections after bone marrow transplantation in patients receiving amphotericin B inhalations during neutropenia; Hertenstein B et al.; The incidence of invasive fungal infections after bone marrow transplantation (BMT) was analyzed in 303 consecutive marrow graft recipients (allogeneic n = 271, autologous n = 27, syngeneic n = 5) . All patients received inhalations with amphotericin B (10 mg twice daily) during neutropenia . The overall incidence of invasive fungal infections within the first 120 days after transplant was 3.6% (11/303; aspergillosis: 6; yeast infection: 5) . Four of the 11 cases occurred early, and seven cases were observed after neutrophil recovery and discontinuation of amphotericin B inhalation treatment . Late infection was significantly associated with the development of acute graft-versus-host disease . Four of the 11 infections (early 2/4; late: 2/7) were observed in patients with a history of previous fungal infection . Other patient and treatment characteristics were not helpful in defining potential risk factors . In particular, the incidence of invasive fungal infections did not differ between patients with more or less strict reverse isolation measures . Occasional side effects such as initial mild cough and bad taste were rare, usually disappeared during continued administration, and were in no case the reason for discontinuation of treatment . These data suggest that aerosolized amphotericin B may be a useful, convenient, and efficient prophylactic antifungal regimen in BMT.

Indian J Pathol Microbiol, 1994 Jan, 37(1), 97 - 100
Cutaneous lymphatic sporotrichosis; Anandi V et al.; The first case of cutaneous lymphatic sporotrichosis from Nagaland and a case of cutaneous sporotrichosis from Kerala who had acquired infection from Assam are reported . The diagnosis in both cases were established by isolating Sporothrix schenckii from multiple cutaneous lesions . The dimorphic nature of fungus was established in vitro by demonstrating the mycelial phase at 25-30 degrees C and yeast phase at 37 degrees C and pathogenicity to white mice . Both the patients were successfully treated with oral administration of potassium iodide for 3 months.

Crit Rev Microbiol, 1994, 20(2), 143 - 50
Polyamines, DNA methylation, and fungal differentiation; Ruiz-Herrera J; Mucorales constitute a group of fungi that, because of their growth characteristics, have been used extensively in the study of cell differentiation, cell morphogenesis, and stimuli perception . We have studied the role of polyamine metabolism in the development of different Mucorales, with emphasis on Mucor and Phycomyces species . It has been observed that previous to each differentiative step, the cellular levels of the most regulated enzyme of the pathway, ornithine decarboxylase (ODC), and polyamines suffer a noticeable increase . Addition of diaminobutanone (DAB), a competitive inhibitor of ODC, blocks all the corresponding differentiative phenomena . In its presence, germinating spores fail to produce germ tubes and keep growing isodiametrically; mycelia do not sporulate but continue their vegetative growth, and yeast cells are unable to engage in a dimorphic transition without alterations in their growth rate . This differential effect of the ODC inhibitor in growth and development is apparently due to the location of ODC in at least two different cell compartments, one of which is impermeable to the drug . Inhibition of development is counteracted by putrescine and more noticeably by 5-azacytidine (5AC), a strong inhibitor of DNA methylation . Methylation levels of DNA are high in spores, and they become reduced after germination . Demethylation is inhibited by hydroxyurea, which blocks DNA replication, and by DAB . The effect of the latter is reversed by 5AC . These results suggest a relationship between polyamines and DNA methylation . Analysis of metallothioneine gene (CUP) behavior and expression during spore germination has confirmed this hypothesis.(ABSTRACT TRUNCATED AT 250 WORDS)

Yao Xue Xue Bao, 1994, 29(3), 161 - 5
{The antiinflammatory activity of shikonin and its inhibitory effect on leukotriene B4 biosynthesis}; Wang WJ et al.; Shikonin is one of the active components isolated from the dry root of Arnebia euchroma (Royle) Johnst (AERJ) . It has been shown to have anti inflammatory activity on formaldehyde induced paw swelling in rats . Preparations of AERJ has been used clinically in curing phlebitis and vascular purpura . In the present study, sc administered shikonin was shown to have significant inhibitory effects on ear edema induced by croton oil in mice and paw swelling induced by yeast in rats . In order to investigate the influence of shikonin on biosynthesis of LTB4 and 5-HETE, an in vitro leukocyte incubation system was adopted . The results showed that shikonin has fairly strong inhibitory effects on LTB4 and 5-HETE biosynthesis . Its effects and concentrations fit a positive relationship within the range of 10(-7)-10(-4) mol.L-1 . The equations of inhibition (Y) versus concentration (X, LogC) obtained by linear regression were Y = 166 + 18.7X (r = 0.9319) for LTB4 and Y = 173 + 18.7X (r = 0.9856) for 5-HETE . The IC50 were 6.2 x 10(-7) and 2.6 x 10(-7) mol.L-1, respectively . The results also indicate that natural shikonin derivatives have similar inhibitory effects on LTB4 biosynthesis . These results suggest that inhibition of LTB4 and 5-HETE may play a major role in the mechanism of anti inflammatory effects of shikonin.

Przegl Epidemiol, 1994, 48(1-2), 11 - 5
{Anti-Hbs level after the basic course of vaccination against hepatitis B in health care workers}; Tomasiewicz K et al.; Health care workers are the group at high hepatitis B virus (HBV) infection risk . Groups of physicians and nurses working in hospitals of Lublin have been vaccinated since 1989 . The aim of this work was to assess the level of anti-HBs in different years after the basic course of vaccination . We have examined 166 persons, aged from 18 to 65 years, vaccinated with a yeast recombinant hepatitis B vaccine Engerix B (Smith Kline Biologicals) . They completed the full cycle of vaccination according to the pattern of 0, 1, 6 months . Within the group of people who had got the third dose one year ago we found 100% of women and 88% of men with a protective level of anti-HBs (> or = 10 IU/l) . Four years after the final inoculation differences between female and male population were even more significant: 93% of man had a protective level of anti-HBs . We have also found that humoral response was higher in the group of younger vaccinees (18-40 years) . We propose that timing of booster vaccination should be scheduled on the basis of anti-HBs level . It seems to be necessary to control the level of anti-HBs at least 3 years after the last dose of vaccination.

J Med Vet Mycol, 1994, 32(2), 93 - 103
Oral histoplasmosis in India: a case report and an overview of cases reported during 1968-92; Padhye AA et al.; Oral histoplasmosis in a 30-year-old male with no history of travel outside India is described . An ulcerating lesion was located on the hard palate . A chest X-ray was normal . Based on physical examination, regional lymph nodes, liver and spleen were not involved . The diagnosis was established by demonstrating yeast-like budding cells in a biopsy of the lesion and by isolating Histoplasma capsulatum in pure culture . The identity of the isolate was confirmed by a chemiluminescent DNA-probe assay and the exoantigen test . A review of the Indian literature from 1968 to 1992 revealed the occurrence of 25 authentic cases of histoplasmosis in India . In 19 cases, lesions were confined to the oral cavity confirming prior observation that histoplasmosis in Indian patients tends to occur primarily in extrapulmonary sites, particularly the oral cavity.

Clin Infect Dis, 1994 Jan, 18(1), 77 - 82
Fungemia and colonization with nystatin-resistant Candida rugosa in a burn unit; Dube MP et al.; Yeast isolates from burned patients were analyzed retrospectively for a 7-year period (1984-1991) . Topical nystatin was used routinely in the burn wound dressing as antifungal therapy beginning in July 1986 . Nystatin used was associated with a significant decrease in overall yeast acquisitions in burn wounds; yeasts were isolated from 15.5% of admitted patients before the use of nystatin vs . 10.5% with use of nystatin (odds ratio {OR} = 0.64; 95% confidence interval {CI}, 0.48-0.86) . New acquisitions of Candida rugosa in burn wounds increased from 0.36% of admissions during the period July 1984 to June 1986 (before nystatin use) to 5.25% in the period July 1986 to June 1991 (during use of nystatin) (OR = 15.3; 95% CI, 4.1-128) . The incidence of fungemia decreased from 3.25% of admissions in the pre-nystatin period to 1.43% in the postnystatin period (OR = 0.43; 95% CI, 0.22-0.87) . C . rugosa caused none of 18 fungemias in the former period and 15 of 21 in the latter period (P = .002) . Susceptibility testing of recent C . rugosa isolates demonstrated resistance to nystatin and moderate susceptibility to amphotericin B and fluconazole . Topical nystatin use was associated with a decrease in fungemias and acquisition of yeasts in burn wounds but with an increase in colonization and fungemias caused by nystatin-resistant, amphotericin B-susceptible C . rugosa.

Dev Comp Immunol, 1994 Jan-Feb, 18(1), 3 - 12
Opsonic activity of cell adhesion proteins and beta-1,3-glucan binding proteins from two crustaceans; Thornqvist PO et al.; A beta-1,3-glucan binding protein (beta GBP) from the shore crab Carcinus maenas was purified from plasma by precipitation of the protein at low ionic strength . The protein had a molecular mass of 110 kDa, and was shown to affinity precipitate with laminarin, a soluble beta-1,3-glucan, and to cross-react with an antiserum directed toward beta GBP from the crayfish Pacifastacus leniusculus . Also, a protein from the haemocytes of C . maenas with a molecular mass of 80 kDa was found to mediate cell attachment and cause degranulation of crab cells, similar to the 76 kDa protein present in the haemocytes of P . leniusculus . Antibodies against the crayfish 76-kDa protein reacted with the crab 80-kDa protein present in the granular cells . No 80-kDa protein could be found in the hyaline cells . Using a method with FITC-conjugated yeast particles in a phagocytosis assay, both the beta GBP and the 80-kDa protein from C . maenas were shown to have opsonic activity as had beta GBP and 76-kDa protein from P . leniusculus, resulting in higher levels of phagocytosis by the crab hyaline cells . Treatment of the yeast particles with beta GBP previously reacted with laminarin (beta GBP-L) only resulted in a minor increase of phagocytosis . Moreover, if the phagocytic cells were preincubated with beta GBP-L or with the 80-kDa protein, the enhancement of the phagocytic activity by beta GBP or the 80-kDa protein were abolished, indicating that a saturable number of one kind of cell surface receptor seem to be involved in phagocytosis.

EXS, 1994, 71, 269 - 77
Crystallographic investigations of alcohol dehydrogenases; Eklund H et al.; The structures of horse liver alcohol dehydrogenase class I in its apoenzyme form and in different ternary complexes have been determined at high resolution . The complex with NAD+ and the substrate analogue pentafluorobenzyl alcohol gives a detailed picture of the interactions in an enzyme-substrate complex . The alcohol is bound to the zinc and positioned so that the hydrogen atom can be directly transferred to the C4 atom of the nicotinamide ring . The structure of cod liver alcohol dehydrogenase with hybrid properties (functionally of class I but structurally overall closer to class III) has been determined by molecular replacement methods to 3 A resolution . Yeast alcohol dehydrogenase has been crystallized, and native data have been collected to 3 A resolution.

Acta Biochim Pol, 1994, 41(1), 39 - 44
Mitochondrial adenosine triphosphatase from human placenta--inhibition by free magnesium ions of ITP hydrolysis; Aleksandrowicz Z; The effects of Mg2+ and bicarbonate on the kinetics of ITP hydrolysis by soluble ATPase (F1) from human placental mitochondria were studied . Increasing amounts of Mg2+ at fixed ITP concentration, caused a marked activation of F1 followed by inhibition at higher Mg2+ concentration . The appropriate substrate for the mitochondrial F1 seems to be the MgITP complex as almost no ITP was hydrolysed in the absence of magnesium . Mg2+ behaved as a competitive inhibitor towards the MgITP complex . In this respect the human placental enzyme differ from that from other sources such as yeast, beef liver or rat liver . The linearity of the plot presenting competitive inhibition by free Mg2+ of MgITP hydrolysis (in the presence of activating bicarbonate anion) suggests that both Mg2+ and MgITP bind to the same catalytic site (Km(MgITP) = 0.46 mM, Ki(Mg) = 4 mM) . When bicarbonate was absent in the ITPase assay, placental F1 exhibited apparent negative cooperativity in the presence of 5 mM Mg2+, just as it did with MgATP as a substrate under similar conditions . Bicarbonate ions eliminated the negative cooperativity with respect to ITP (as the Hill coefficient of 0.46 was brought to approx . 1), and thus limited inhibition by free Mg2+ . The results presented suggest that the concentration of free magnesium ions may be an important regulatory factor of the human placental F1 activity.

Histol Histopathol, 1994 Jan, 9(1), 197 - 202
The role of the proteasome in cellular protein degradation; Driscoll J; Eukaryotic cells contain a major intracellular proteolytic activity known as the proteasome . The proteasome is a strongly conserved cylindrical structure of high molecular weight (650 kDa, approximately 20 S) and demonstrates multiple endopeptidase activities . The general structural, biochemical and genetic features of the proteasome are conserved from archaebacteria through yeast to humans . This structure fulfills an essential role by functioning as the proteolytic core of a 26 S multienzyme complex responsible for the energy-dependent degradation of ubiquitinated proteins . The bulk of intracellular proteolysis appears to be through the ubiquitin-dependent pathway . Incorporation of the proteasome into the 26 S multienzyme complex appears to confer both a specificity for ubiquitinated proteins as well as a means to tightly regulate proteolytic activity . Thus, one function of the proteasome is required for the degradation of either abnormal or certain regulatory proteins by the ubiquitin pathway . Proteasome subunits appear to be encoded by a related gene family as defined by extensive sequence similarities . The gene products are confined to either of two general classes: alpha-type which appear to be structural and beta-type which may be catalytic . Genes encoding at least two proteasome subunits map to the Major Histocompatibility Complex . Accumulating evidence points to the proteasome (or a specialized form) participating in the cytosolic degradation of these viral proteins upon cellular infection.(ABSTRACT TRUNCATED AT 250 WORDS)

Biomed Pharmacother, 1994, 48(5-6), 219 - 24
Mapping the Friedreich ataxia locus (FRDA) by linkage disequilibrium analysis with highly polymorphic microsatellites; Sirugo G et al.; The Friedreich's ataxia locus (FRDA) is tightly linked to markers D9S5 and D9S15 located in 9q13-q21 . Cumulated maximum lod scores between FRDA and D9S5 and between FRDA and D9S15 are above 36 and 61, respectively, at a recombination fraction of 0, indicating that recombination events needed to orient the search of the gene are very difficult to identify and ascertain . We have established a 1 Megabase PFGE map around D9S5 and D9S15 and isolated a corresponding 530 kb YAC contig . We found that the two markers are 260 kb apart . This result was surprising, since D9S5 and D9S15 were independently isolated, but in agreement with the strong linkage between the two loci (lod score > 35 at a recombination fraction of 0) . Seven clusters of rare cutter enzyme sites (CpG islands), which are potential indicators of genes, were identified in the 1 Megabase region by PFGE analysis and YAC mapping . The search for genes around the CpG islands is in progress . To map the Friedreich ataxia locus in the absence of clearly identified recombination events, we chose an alternative approach based on haplotype analysis of patients from small populations with precise geographic and historical origins, such as the Louisiana-Acadians, deported from Nova-Scotia about 150 years ago and who remained isolated for historical and cultural reasons . In this population, a single mutation, associated with a specific haplotype may account for the majority of Friedreich ataxia cases . Haplotypes different from the major haplotype at one or the other extremity can indicate ancient recombinations.(ABSTRACT TRUNCATED AT 250 WORDS)

EXS, 1994, 69, 579 - 92
Genome evolution: between the nucleosome and the chromosome; Hartl DL et al.; Intermediate between DNA sequences and broad patterns of karyotypic change there is a major gap in understanding genome structure and evolution . The gap is at the megabase level between genes and chromosomes . New methods for analyzing large DNA fragments cloned in yeast or bacterial vectors provide experimental access to genome evolution at the megabase level by enabling the assembly of megabase-size contiguous regions . Genome evolution at the megabase level can also be studied using high-resolution genetic maps . Rates and patterns of genome evolution in mammals (mouse versus humans) and Drosophila (D . virilis versus D . melanogaster) are compared and contrasted . Opportunities for research in genome evolution using the new technologies are enumerated and discussed.

Antonie Van Leeuwenhoek, 1994, 65(2), 143 - 53
Pleoanamorphic life cycle of Exophiala (Wangiella) dermatitidis; de Hoog GS et al.; The anamorph life cycle of the black yeast Exophiala (Wangiella) dermatitidis is described . The fungus is dimorphic, yeast cells being the prevalent form of propagation . The fungus is strongly hydrophilic, probably completing its anamorph life cycle in submersion . Adaptation to dry conditions is slow . Types of conidiogenesis comprise annellidic, phialidic and sympodial reproduction, in addition to isotropic development . Phialoconidia fail to germinate under the conditions tested, and thus may have a function other than dispersal . Sterile, multicellular bodies resembling a Capronia teleomorph are described.

Cell Motil Cytoskeleton, 1994, 28(3), 243 - 55
Cloning and sequencing of cDNAs encoding the actin cross-linking protein transgelin defines a new family of actin-associated proteins; Prinjha RK et al.; We have used degenerate oligonucleotides, derived from the amino acid sequence of transgelin peptides {Shapland et al., 1993: J . Cell Biol . 121:1065-1073}, to isolate and sequence overlapping cDNA clones encoding this actin gelling protein . Primers with 5' restriction enzyme sites directed against the N and C terminal amino acids present in these clones were then used to amplify and clone the entire transgelin coding region from reverse transcribed rat small intestine cDNA (RT-PCR) . These studies have shown that transgelin is the product of a single gene which is conserved between yeast, Drosophila, molluscs, and humans . Transgelin is expressed as a single message that is regulated at the level of transcription in SV40 transformed 3T3 cells . Our data have shown that transgelin and several other proteins of unknown function, SM22 alpha {Pearlstone et al., 1987: J . Biol . Chem . 262:5985-5991}, mouse p27 {Almendral et al., 1989: Exp . Cell Res . 181:518-530}, and human WS3-10 {Thweatt et al., 1992: Biochem . Biophys . Res . Commun . 187:1-7}, share extensive homology . More limited regions of homology shared between transgelin and other proteins such as rat NP25 (unpublished), chicken calponins alpha and beta {Takahashi and Nadal-Ginard, 1991: J . Biol . Chem . 266:13284-13288}, and Drosophila mp20 {Ayme-Southgate et al., 1989: J . Cell Biol . 108:521-531} suggest that all of these proteins may be classified as members of a new transgelin multigene family.

Adv Enzyme Regul, 1994, 34, 199 - 224
Serine/threonine protein phosphatases in the control of cell function; Depaoli-Roach AA et al.; Reversible protein phosphorylation is a fundamental mechanism by which many biological functions are regulated . Achievement of such control requires the coordinated action of the interconverting enzymes, the protein kinases and protein phosphatases . By comparison with protein kinases, a limited number of protein phosphatase catalytic subunits are present in the cell, which raises the question of how such a small number of dephosphorylating enzymes can counterbalance the action of the more numerous protein kinases . In mammalian cells, four major classes of Ser/Thr-specific phosphatase catalytic subunits have been identified, comprising two distinct gene families . The high degree of homology among members of the same family, PP1, PP2A and PP2B, and the high degree of evolutionary conservation between organisms as divergent as mammals and yeast, implies that these enzymes are involved in fundamental cell functions . Type 1 enzymes appear to acquire specificity by association with targeting regulatory subunits which direct the enzymes to specific cellular compartments, confer substrate specificity and control enzyme activity . In spite of the progress made in determining the structure of the PP2A subunits, very little is known about the control of this activity and about substrate selection . Recent studies have unravelled a significant number of regulatory subunits . The potential existence of five distinct B or B-related polypeptides, some of which are present in multiple isoforms, two A and two C subunit isoforms, raises the possibility that a combinatorial association could generate a large number of specific PP2A forms with different substrate specificity and/or cellular localization . Moreover, biochemical, biological and genetic studies all concur in suggesting that the regulatory subunits may play an important role in determining the properties of the Ser/Thr protein phosphatases and hence their physiological functions.

Soc Gen Physiol Ser, 1994, 49, 249 - 70
Evolution of the G protein alpha subunit multigene family; Wilkie TM et al.; G protein-mediated signal transduction systems have been identified in a diverse group of eukaryotic organisms, including yeast, plants, Dictyostelium and animals . G protein signaling components have been identified in many of these organisms, from the seven transmembrane domain receptors to distinct alpha, beta and gamma subunits of the heterotrimeric G protein and the intracellular effectors which they regulate . Their broad distribution and sequence conservation implies that genes encoding the components of G protein signaling evolved with early eukaryotes . Their subsequent proliferation among eukaryotic organisms provides an opportunity to study the coevolution of these interacting multigene families . We have focused our interests on G protein alpha subunits, which bind and hydrolyze GTP and interact with receptors and effectors . Gene structure and nucleotide sequence comparisons provided a comprehensive picture of G alpha evolution . Sequence comparisons identified three major groups of G alpha genes, termed the GPA, the G alpha-I and G alpha-II Groups . G alpha genes within the three Groups have evolved at different rates . The GPA Group is primarily composed of G alpha genes from fungi, plants, and slime mold . Within the G alpha-I and G alpha-II Groups, four classes of genes have been identified based upon sequence comparisons and functional similarities; Gi, Gq, G12, and GS . Members of all four classes are expressed in invertebrates and vertebrates but not in other eukaryotes, suggesting that this quartet evolved with metazoan progenitors.

Pharmacol Ther, 1994, 61(1-2), 155 - 84
Homeodomain proteins in development and therapy; Dorn A et al.; Homeobox genes encode transcriptional regulators found in all organisms ranging from yeast to humans . In Drosophila, a specific class of homeobox genes, the homeotic genes, specifies the identity of certain spatial units of development . Their genomic organization, in Drosophila, as well as in vertebrates, is uniquely connected with their expression which follows a 5'-posterior-3'-anterior rule along the longitudinal body axis . The 180-bp homeobox is part of the coding sequence of these genes, and the sequence of 60 amino acids it encodes is referred to as the homeodomain . Structural analyses have shown that homeodomains consist of a helix-turn-helix motif that binds the DNA by inserting the recognition helix into the major groove of the DNA and its amino-terminal arm into the adjacent minor groove . Developmental as well as gene regulatory functions of homeobox genes are discussed, with special emphasis on one group, the Antennapedia (Antp) class homeobox genes and a representative 60-amino acid Antennapedia peptide (pAntp) . In cultured neuronal cells, pAntp translocates through the membrane specifically and efficiently and accumulates in the nucleus . The internalization process is followed by a strong induction of neuronal morphological differentiation, which raises the possibility that motoneuron growth is controlled by homeodomain proteins . It has been demonstrated that chimeric peptide molecules encompassing pAntp are also captured by cultured neurons and conveyed to their nuclei . This may be of enormous interest for the internalization of drugs.

J Neural Transm Suppl, 1994, 41, 17 - 26
Kinetic properties of cloned human liver monoamine oxidase A; Ramsay RR et al.; Monoamine oxidases deaminate many amines, including neurotransmitters, by oxidation followed by spontaneous breakdown of the imine product . The reduced enzyme is reoxidized slowly by oxygen, but in the presence of amines, the rate of reoxidation is markedly enhanced . The extent of enhancement depends on the amine substrate, kynuramine enhancing the rate 125-fold, but 5-hydroxytryptamine only 6-fold . Here we describe the properties of human liver monoamine oxidase A which has been cloned into and overexpressed in yeast . The purified enzyme has a higher Km for oxygen than does the placental enzyme, but the steady-state parameters for the endogenous amines are the same . Tertiary amines are oxidized at slightly different rates by the two enzymes . The consequences of the branched pathway mechanism with substrate-dependent enhancement of reoxidation for the steady-state levels of the various enzyme species is discussed.

Immunogenetics, 1994, 40(5), 319 - 24
The genomic structure of human BTK, the defective gene in X-linked agammaglobulinemia; Rohrer J et al.; It has recently been demonstrated that mutations in the gene for Bruton's tyrosine kinase (BTK) are responsible for X-linked agammaglobulinemia . Southern blot analysis and sequencing of cDNA were used to document deletions, insertions, and single base pair substitutions . To facilitate analysis of BTK regulation and to permit the development of assays that could be used to screen genomic DNA for mutations in BTK, we determined the genomic organization of this gene . Subcloning of a cosmid and a yeast artificial chromosome showed that BTK is divided into 19 exons spanning 37 kilobases of genomic DNA . Analysis of the region 5' to the first untranslated exon revealed no consensus TATAA or CAAT boxes; however, three retinoic acid binding sites were identified in this region . Comparison of the structure of BTK with that of other nonreceptor tyrosine kinases, including SRC, FES, and CSK, demonstrated a lack of conservation of exon borders . Information obtained in this study will contribute to our understanding of the evolution of nonreceptor tyrosine kinases . It will also be useful in diagnostic studies, including carrier detection, and in studies directed towards gene therapy or gene replacement.

Plant Mol Biol, 1994 Jan, 24(1), 35 - 49
Molecular cloning of two different cDNAs for maize acetyl CoA carboxylase; Ashton AR et al.; Acetyl CoA carboxylase (EC 6.4.1.2) in plants is a chloroplast-localized, biotin-containing enzyme that catalyses the carboxylation of acetyl CoA to malonyl CoA, the first committed step of the fatty acid biosynthesis pathway . Acetyl CoA carboxylase is the target site for the monocotyledon-specific aryloxyphenoxypropionate and cyclohexanedione groups of herbicides . We have purified a herbicide-sensitive acetyl CoA carboxylase from maize leaves to homogeneity (specific activity 7 mumol min-1 mg-1), separating it during the purification from a minor herbicide-resistant acetyl CoA carboxylase . The purified enzyme is a dimer of 230 kDa subunits . Antibodies raised to the purified acetyl CoA carboxylase detected three cross-reacting clones in a maize leaf cDNA expression library, each having an insert of 4-4.5 kb . Restriction analysis and sequencing showed that the cDNAs were derived from two different transcripts . Comparison of the deduced amino acid sequences with those of chicken and yeast acetyl CoA carboxylases confirmed that both types encoded acetyl CoA carboxylase, corresponding to the C-terminal half of the enzyme . The overall identity of the maize and chicken sequences was 37% (58% similarity) but for some shorter regions was much higher . Analysis of six other acetyl CoA carboxylase clones recovered from the maize cDNA library showed four belonged to one type and two to the other . The nucleotide sequence similarity between the two types of cDNA was approximately 95% in the coding region but considerably less in the 3'-untranslated region . Northern blot analysis of maize RNA showed a single band of 8.2-8.5 kb for acetyl CoA carboxylase mRNA . Southern blot hybridisations indicated that there are probably no more than two genes in maize for acetyl CoA carboxylase . The possible significance of two different cDNAs for acetyl CoA carboxylase is discussed.

Plant Mol Biol, 1994 Jan, 24(1), 21 - 34
Studies on wheat acetyl CoA carboxylase and the cloning of a partial cDNA; Elborough KM et al.; Wheat germ acetyl CoA carboxylase (ACCase) was purified by liquid chromatography and electroelution . During purification bovine serum albumin (BSA) was used to coat Amicon membranes used to concentrate partially pure ACCase . Despite further SDS-PAGE/electroelution and microbore HPLC steps BSA remained associated . This presented serious protein sequencing artefacts which may reflect the affinity of BSA for fatty acids bound to ACCase . To avoid these artefacts the enzyme was digested in gel with Endoproteinase LysC protease without the presence of BSA, and the resulting peptides blotted and sequenced . A partial cDNA (1.85 kb) encoding ACCase from a wheat embryo library was cloned, which hybridised to a 7.5 kb RNA species on northern blot of wheat leaf poly(A)+ RNA . The partial cDNA therefore represents about 0.25 of the full-length cDNA . The clone was authenticated by ACCase peptide sequencing and immuno cross-reactivity of the overexpressed clone . The derived amino acid sequence showed homology with both rat and yeast ACCase sequences (62%) . Antibodies raised against wheat acetyl CoA carboxylase were specific for a 220 kDa protein from both wheat embryo and leaf . In addition, by using a novel quick assay for ACCase that utilised 125I-streptavidin, we showed the major biotin containing protein to be 220 kDa in both leaf and germ . This is in marked contrast to the previously published molecular mass of 75 kDa allocated to wheat leaf ACCase.

J Immunol, 1994 Jan 1, 152(1), 220 - 30
CD11b/CD18 integrin and a beta-glucan receptor act in concert to induce the synthesis of platelet-activating factor by monocytes; Elstad MR et al.; We determined the mechanism by which opsonized zymosan particles, which are derived from yeast and composed of carbohydrate polymers, stimulate platelet-activating factor (PAF) synthesis by monocytes . A role for CD11b/CD18 was demonstrated because antibodies to this integrin decreased PAF synthesis, zymosan bearing only a ligand for CD11b/CD18 (iC3b) induced the synthesis of PAF, and monocytes that did not express CD11b/CD18 produced much less PAF than control monocytes . Ligation of CD11b/CD18 was not sufficient for PAF synthesis suggesting that an additional receptor was involved . Monocytes are known to bind beta-glucan which is a major component of zymosan . Opsonized beta-glucan particles stimulated the synthesis of PAF, and a soluble form of beta-glucan partially inhibited PAF synthesis in response to opsonized zymosan . Two lines of evidence suggested that the beta-glucan receptor mediating this response was distinct from CD11b/CD18 . First, CD11b/CD18-deficient monocytes produced PAF when stimulated by zymosan opsonized with isolated C3b, a molecule that binds to complement receptor type 1 (CD35) . Second, inducing contact of monocytes with zymosan by centrifugation resulted in PAF synthesis that was not inhibited by antibodies to CD11b/CD18 . The combination of soluble beta-glucan and antibodies to CD11b/CD18 completely blocked PAF synthesis in response to opsonized zymosan . Together, these results demonstrate that induction of maximal PAF synthesis by serum-opsonized zymosan requires the concerted interactions of monocyte receptors for iC3b and beta-glucan . Additionally, they suggest that CD11b/CD18 facilitates binding of the particle and that a beta-glucan receptor transduces the activation signal.

Prog Growth Factor Res, 1994, 5(3), 291 - 334
Deciphering the MAP kinase pathway; L'Allemain G; MAP kinases (MAPK) are serine/threonine kinases which are activated by a dual phosphorylation on threonine and tyrosine residues . Their specific upstream activators, called MAP kinase kinases (MAPKK), constitute a new family of dual-specific threonine/tyrosine kinases, which in turn are activated by upstream MAP kinase kinase kinases (MAPKKK) . These three kinase families are successively stimulated in a cascade of activation described in various species such as mammals, frog, fly, worm or yeast . In mammals, the MAP kinase module lies on the signaling pathway triggered by numerous agonists such as growth factors, hormones, lymphokines, tumor promoters, stress factors, etc . Targets of MAP kinase have been characterized in all subcellular compartments . In yeast, genetic epistasis helped to characterize the presence of several MAP kinase modules in the same system . By complementation tests, the relationships existing between phylogenetically distant members of each kinase family have been described . The roles of the MAP kinase cascade have been analyzed by engineering various mutations in the kinases of the module . The MAP kinase cascade has thus been implicated in higher eukaryotes in cell growth, cell fate and differentiation, and in low eukaryotes, in conjugation, osmotic stress, cell wall construct and mitosis.

J Cell Sci Suppl, 1994, 18, 1 - 5
Wilms' tumour--a case of disrupted development; Miyagawa K et al.; Wilms' tumour is a paediatric kidney malignancy that arises through aberrant differentiation of nephric stem cells . We are studying the role of one Wilms' tumour predisposition gene, WT1 . This is a tumour suppressor gene whose function is required for normal development of the genitourinary system . WT1 encodes a putative transcriptional repressor of the zinc finger family . Here we discuss how one of the normal functions of WT1 may be to suppress myogenesis during kidney development . Furthermore, we describe how we are proposing to use YAC (yeast artificial chromosome) transgenesis to analyse WT1 regulation and function in mice . We also discuss the evolution of the WT1 gene amongst different vertebrate classes and how this may provide insights into genitourinary evolution.

Biochimie, 1994, 76(6), 480 - 8
Protein interaction sites obtained via sequence homology . The site of complexation of electron transfer partners of cytochrome c revealed by mapping amino acid substitutions onto three-dimensional protein surfaces; Meyer TE et al.; Amino acid substitutions in all but the most divergent of cytochromes c have been categorized as being conservative or radical and mapped onto the three-dimensional structure of yeast cytochrome c . Color-coded, space-filling representations reveal a large 24 A diameter surface area which is invariant or conservatively substituted on the front left face of the cytochrome c molecule . Chemical modifications and mutations which inhibit complex formation and electron transfer with reaction partners also map to this surface . In sharp contrast, the back side of the protein is randomly substituted with both conservative and radical replacements . The invariant/conservatively substituted surface on the front of cytochrome c thus defines the site of interaction with redox partners and provides a measure of its dimensions . Further, this analysis strongly suggests that there is only a single site of oxidation and reduction on cytochrome c for all of its physiological reactions . The same analysis applied to bacterial cytochrome c2 shows that its conserved surface is similar in size and location to that of cytochrome c . Analyses of native and model reaction partners of cytochromes c and c2, such as cytochrome b5, plastocyanin, and bacterial photosynthetic reaction centers, also reveal probable active site surfaces for complexation and electron transfer, which are complementary in size to that of the c-type cytochromes . The availability of a three-dimensional structure and of several closely related amino acid sequences for a given functional class of protein is the only limitation on this type of analysis, which can then serve as a basis for designing site-directed mutagenesis experiments.

Cell Mol Biol Res, 1994, 40(3), 253 - 6
Regulation of the MAP kinase cascade; Cobb MH et al.; The MAP kinase cascade is regulated by many hormones and growth factors and its activation leads to changes in properties of cytoplasmic, membrane-associated, and nuclear proteins . The MAP kinases themselves are activated by MEKS . MEKs lie at a point of convergence for multiple upstream signals, mediated by distinct protein kinases, Raf, MEK kinase, and Mos, all of which have MEK kinase activity . Additional inputs that stimulate the MAP kinase pathway are the activation of protein kinase C and the yeast protein kinase STE20 . Mechanisms of regulation of some of the upstream components of this cascade have not yet been fully elucidated.

Prog Nucleic Acid Res Mol Biol, 1994, 49, 197 - 239
Processing of eukaryotic ribosomal RNA; Eichler DC et al.; In summary, it can be argued that the understanding of eukaryotic rRNA processing is no less important than the understanding of mRNA maturation, since the capacity of a cell to carry out protein synthesis is controlled, in part, by the abundance of ribosomes . Processing of pre-rRNA is highly regulated, involving many cellular components acting either alone or as part of a complex . Some of these components are directly involved in the modification and cleavage of the precursor rRNA, while others direct the packaging of the rRNA into ribosome subunits . As is the case for pre-mRNA processing, snoRNPs are clearly involved in eukaryotic rRNA processing, and have been proposed to assemble with other proteins into at least one complex called a "processosome" (17), which carries out the ordered processing of the pre-rRNA and its assembly into ribosomes . The formation of a processing complex clearly makes possible the regulation required to coordinate the abundance of ribosomes with the physiological and developmental changes of a cell . It may be that eukaryotic rRNA processing is even more complex than pre-mRNA maturation, since pre-rRNA undergoes extensive nucleotide modification and is assembled into a complex structure called the ribosome . Undoubtedly, features of the eukaryotic rRNA-processing pathway have been conserved evolutionarily, and the genetic approach available in yeast research (6) should provide considerable knowledge that will be useful for other investigators working with higher eukaryotic systems . Interestingly, it was originally hoped that the extensive work and understanding of bacterial ribosome formation would provide a useful paradigm for the process in eukaryotes . However, although general features of ribosome structure and function are highly conserved between bacterial and eukaryotic systems, the basic strategy in ribosome biogenesis seems to be, for the most part, distinctly different . Thus, the detailed molecular mechanisms for rRNA processing in each kingdom will have to be independently deciphered in order to elucidate the features and regulation of this important process for cell survival.

Genet Anal Tech Appl, 1994, 11(4), 95 - 101
Alu-based vectorettes and splinkerettes . More efficient and comprehensive polymerase chain reaction amplification of human DNA from complex sources; Qureshi SJ et al.; Alu-polymerase chain reaction (PCR) is widely used to amplify human specific fragments from complex heterologous DNAs, such as somatic cell hybrids or yeast artificial chromosome (YAC) recombinants, but the fragments amplified are limited in number and are nonrepresentative . This report describes a modified one-sided alu-PCR technique, which offers better representation of amplified sequences while maintaining human specificity . The method relies on the ligation of partially mismatched double-stranded oligonucleotides (vectorettes or splinkerettes) to endonuclease-restricted DNA and universal priming with a single alu-consensus primer, the complement to which is the unpaired region . Alu-vectorette and alu-splinkerette-PCR of two somatic cell hybrids results in a greater complexity of products than alu-PCR alone . The advantage of alu-splinkerette over alu-vectorette-PCR is the elimination of nonspecific priming owing to the presence of the vectorette primer and to an increase in the product size range, a consequence of the difference in the splinkerette design . Alu-splinkerette-PCR is a useful technique for generating new and more comprehensive markers of the human sequences contained in somatic cell hybrids and YACs.

Acta Biochim Pol, 1994, 41(3), 269 - 74
Is there a "dolichol recognition sequence" in enzymes that interact with dolichols and other polyisoprenoid substrates?
Schutzbach JS.
Yeast dolichyl-P-mannose synthase and a number of other enzymes that interact with dolichol or dolichyl-P as substrates contain a highly conserved amino-acid sequence that has been proposed as a potential dolichol recognition sequence {Albright, C.F., Orlean, P . & Robbins, P.W . (1989) Proc . Natl . Acad . Sci . U.S.A . 86, 7366-7369} . In dolichyl-P-mannose synthase, the most highly conserved amino-acid residues of this domain were modified by site directed mutagenesis, and for one construct the sequence was completely deleted . Enzymes containing the site directed modifications, and the deletion mutant, were found to retain catalytic activity, and all of the modified enzymes had the same apparent affinity for Dol-P as wild type enzyme when assayed in a phospholipid matrix . Based on these results, the amino-acid composition and sequence of the conserved domain are not critically important for the recognition and binding of Dol-P when the synthase is reconstituted in a lipid matrix.

Curr Opin Nephrol Hypertens, 1994 Jan, 3(1), 73 - 85
Endothelin peptides and compensatory growth of renal cells; Simonson MS; Endothelins are paracrine or autocrine peptides that regulate diverse aspects of renal function . In addition to their potent vasoconstrictor activity, recent evidence suggests that endothelin-1 is a growth factor for renal cells . Different forms of renal injury markedly upregulate endothelin-1 secretion, which is postulated to contribute to compensatory renal growth . Similar roles have been hypothesized for other vasoactive peptides, such as angiotensin II and arginine vasopressin . New information has recently emerged regarding pathways of mitogenic signaling linking activation of endothelin receptors to changes in gene expression . ETA receptor subtypes activate downstream effectors, such as protein kinase C, protein tyrosine kinases of the src gene family, and mitogen-activated protein kinases . These cytosolic effectors in turn lead to altered programs of gene expression by activating, among others, AP-1 and serum response factor transcription factors . In addition, recent studies in organisms amenable to genetic analysis, such as Drosophila, Dictyostelium, and yeast, are providing important clues to effector mechanisms employed by vasoactive peptide receptors in higher organisms . Information on the molecular mechanisms for mitogenic signaling by endothelin receptors might be used to gain insight into the pathogenesis of compensatory renal growth and the development of novel therapeutic strategies.

Adv Second Messenger Phosphoprotein Res, 1994, 29, 81 - 96
Intracellular membrane fusion; Rothman JE; The NSF, SNAP, and SNAP receptors are key elements of the intracellular membrane fusion machinery . We use an affinity purification scheme, based on the function of SNAP receptor in assembling 20S fusion particles from NSF and SNAP proteins, to purify SNAP receptors from brain . Remarkably, each of the four SNAP receptors (or, SNAREs) thus delineated resides in synapses, with one receptor originating in the synaptic vesicle and another in the presynaptic plasma membrane that is targeted for fusion . This suggests a simple mechanism in which the general NSF/SNAP fusion machinery can assemble to bridge partner membranes in a complex containing elements of both vesicle and target membranes, and implies that similar fusion machines drive both constitutive fusion (ER-->Golgi-->surface and endocytosis) and regulated exocytosis . The vesicle (v-SNARE) and the target-associated t-SNAREs from the synapse are each members of compartmentally-specific families of membrane proteins found in yeast, animal cells, and neurons, thus raising the possibility that v-SNAREs and t-SNAREs encode specificity in membrane fusion processes that utilize a common mechanism.

Antonie Van Leeuwenhoek, 1994, 65(3), 191 - 7
Control of mating and development in Ustilago maydis; Spellig T et al.; In Ustilago maydis the a and b mating type loci control pathogenicity as well as sexual development . We review the function of these loci in controlling the cell fusion step, the switch from yeast-like to filamentous growth and subsequent pathogenic development . Our special emphasis will be the role of pheromones and pheromone signaling in these processes.

Biosci Biotechnol Biochem, 1994 Jan, 58(1), 104 - 7
Screening for specific inhibitors of phagocytosis of thioglycollate-elicited macrophages; Magae J et al.; Phagocytosis is one of the basic and characteristic properties of macrophages . We screened metabolites of Actinomyces for low molecular weight substances that selectively inhibited phagocytosis of dried yeast but not pinocytosis of neutral red by thioglycollate-elicited peritoneal macrophages . Inhibitors of actin filament organization, protein kinases, respiration, and lipid synthesis selectively inhibited phagocytosis, and blockers of proton gradients selectively inhibited pinocytosis . This suggests that these functions are differently regulated . We applied this system to screening of metabolites of Actinomyces, and identified mycotrienin, piericidin, and genistein as selective inhibitors of phagocytosis.

Biochimie, 1994, 76(12), 1217 - 22
Unique structure of new serine tRNAs responsible for decoding leucine codon CUG in various Candida species and their putative ancestral tRNA genes; Ueda T et al.; In an asporogenic yeast, Candida cylindracea, codon CUG is not translated as leucine but as serine . On the basis of our recent work on the determination of the genetic code using in vitro translation systems coupled with isolation of the corresponding tRNA molecules, it appears that this non-universal genetic code is unitized not only in C cylindracea but also in various Hemiascomycetes . Here we show that in addition to the species already reported, three pathogenic yeasts, C guilliermondii, C lusitaniae and C tropicalis, have tRNA(Ser)CAG, indicating that this non-universal genetic code (CUG=Ser) also exists in these species . Determination of their primary structures revealed that the uridine conserved at position 33 in usual tRNAs, is replaced by guanosine or cytidine . This suggests that the three-dimensional structures of the anticodon loop of these tRNAs differ from the conventional structure comprising the U turn in this position . Moreover, we succeeded in isolating putative ancestral serine tRNA genes whose sequences are highly homologous to tRNA(Ser)CAG in each case . These tRNA genes all have the anticodon sequence CGA corresponding to the codon UCG, indicating that tRNA(Ser)CAG might have emerged from tRNA(Ser)CGA during evolutionary change of the assignment of codon CUG.

Biochimie, 1994, 76(12), 1161 - 7
How single genes provide tRNA processing enzymes to mitochondria, nuclei and the cytosol; Martin NC et al.; TRM1, MOD5 and CCA1 are yeast genes that provide tRNA processing enzymes to mitochondria and the nuclear/cytosolic compartments . The product of the TRM1 gene is N2,N2 dimethylguanosine tRNA methyltransferase . The product of the MOD5 gene is isopentenyl pyrophosphate: tRNA isopentenyl transferase and the product of the CCA1 gene is ATP (CTP): tRNA nucleotidyltransferase . N2,N2 dimethylguanosine tRNA methyltransferase is found in the mitochondria and the nucleus . The tRNA isopentenyl transferase and tRNA nucleotidyltransferase are found in mitochondria, nuclei and the cytosol . Genes coding for these three enzymes contain more than one in-frame ATG . Where translation begins dictates the efficiency with which these gene products reach mitochondria . Depending on the gene, ATGs choice is by transcription start site selection, by translational selection or by an interplay between these two processes . A short amino acid sequence is necessary and sufficient for the nuclear targeting of the dimethylguanosine transferase . There is a good candidate sequence for a nuclear targeting signal (NTS) for the isopentenyl pyrophosphate: tRNA isopentenyl transferase . There are no obvious candidate sequences for a NTS in the CCA1 sequence.

Med Pregl, 1994, 47(5-6), 194 - 6
{Phagocytic activity of polymorphonuclear cells in patients with psoriasis vulgaris from the aspect of PUVA therapy}; Poljacki M et al.; The authors present results of examining phagocytotic activity of polymorphonuclear (PMN) granulocytes in patients with psoriasis vulgaris from the aspect of applied PUVA-therapy . 100 patients with psoriasis vulgaris were examined and divided into three groups, 20 patients with acute exanthematous form of the disease, 16 patients with chronic stationary form of the disease, and 64 patients with acute phase of the chronic form of the disease . 50 healthy persons made up the control group . Phagocytotic activity of neutrophils was examined by opsonization test, a modified method by Brandt . Phagocytotic index was expressed as a number of ingested particles of yeast germs in 100 PMN . Polymorphonuclears of patients were examined in the autologous and control serum of healthy people . Values of immunoglobulin IgM and IgG as well as values of complement C3 were examined in all patients using the method of laser nephelometry (Behring) . All mentioned parameters were determined prior to and after PUVA therapy which was conducted by apparatus: PUVA 4000 and 6001 . Results of examination show that the phagocytotic activity of PMN in patients with psoriasis vulgaris is normal and that it does not depend on how skin disorders are spread, on the strength of infiltration, exudation, the length of duration and course of the disease, as well as on applied PUVA-therapy . Reduced phagocytotic activity of PMN was determined only in individual cases, that is in 5 patients not depending on the applied therapy . In one patient hypoimmunoglobulinemia IgM as a probable cause of disturbed phagocytosis was established while in the remaining 4 patients causes of reduced phagocytosis remained unknown.

Cell Mol Biol Res, 1994, 40(5-6), 513 - 7
Regulation of protein kinase CKII during the cell division cycle; Marshak DR et al.; Protein kinase CKII is a prevalent serine/threonine protein kinase whose structure is highly conserved among eukaryotic organisms . Its involvement in the eukaryotic cell division cycle has been implicated by genetic experiments in yeast, antisense DNA, and inhibitory antibody experiments in mammalian cells, changes in activity during growth stimulation experiments, and protection of cells from radiation damage to replicating DNA . In addition, the cdc2 protein kinase, which is central to cell division cycle control, serves as a substrate for CKII specifically during the G1 phase of human cells . In this report, extracts of HeLa cells were prepared using neutral, aqueous buffers at low ionic strength . The cells were enriched for specific stages of the cell division cycle by treatment with drugs or by centrifugal elutriation . The results indicate that CKII activity in these extracts is highest during the G1 phase, and there appears to be a reduction in soluble CKII activity during the S phase . These data are consistent with the hypothesis that high CKII is necessary for a normal G1 phase but that progression through the S phase requires inhibition of CKII.

Genet Anal Tech Appl, 1994, 11(5-6), 148 - 57
Construction and preliminary analysis of the ICRF human P1 library; Francis F et al.; P1 clone libraries have now been established as effective complements to cosmid and yeast artificial chromosome libraries in long-range mapping projects . To allow general access to P1 clones, we have constructed human and mouse P1 libraries . Clones have been picked into microtiter plates and used to prepare high-density filter grids, providing an efficient and easy screening system . Filters are being made available to other laboratories through the Reference Library System . In this work, we have developed a reliable protocol for generating P1 clones, based on the use of pulsed-field gel electrophoresis for size selection of DNA . A 1.2x genome coverage human library has been produced using this method . A preliminary analysis of this library is described.

DNA Seq, 1994, 5(2), 67 - 76
ISWAC: proposed system for the integrated assembly of chromosomes; Singh GB et al.; The generation of a physical map as an integral part of sequence project management is a problem that present computer systems do not address . Primarily, the analysis performed is based solely on the information available from a single knowledge level . Management systems that are currently available do not adequately model the multi-layer top down strategy that is most often utilized to manage large scale sequencing projects . Single layered approaches reflect an algorithmic inadequacy since interacting data sets are required to provide a good solution . The analysis tool that is currently under development termed ISWAC, the Integrated System for Wholistic Assembly of Chromosomes, overcomes these limitations by integrating information available from five layers of knowledge . These knowledge layers utilize information from the linkage map, physical map, restriction map, clone strategy map and the DNA sequence itself . The approach we are implementing, reviews current project status and continually refines the experimental strategy necessary to efficiently complete the sequencing task . To facilitate project completion the system is designed to interactively recommend strategies based on partial information . The utility of this tool is enhanced by implementing knowledge representation techniques that allow reasoning with approximate concepts characteristic of these data-sets . In addition, the raw physical data is maintained within an integrated map database to ease data verification . This paper presents the first discussion of the design specifications for a computer system to assimilate the various forms of data that are being generated as part of the human genome project . It was specifically written to stimulate discussion regarding data standardization, translation, analysis and most important, an understandable user-interphase for the molecular biologist . We would hope that interested readers would respond by assisting in the definition of a set of universal data standards and adopting them in their laboratories.

Intervirology, 1994, 37(5), 287 - 97
Identification of the primary structure and the coding capacity of the genome of insect iridescent virus type 6 between the genome coordinates 0.310 and 0.347 (7990 bp); Sonntag KC et al.; The primary structure and the coding capacity of the insect iridescent virus type 6--Chilo iridescent virus (CIV)--were determined between the genome coordinates 0.310 (EcoRI site) and 0.347 (ClaI site) . The EcoRI CIV DNA fragment M (7.1 kb; 0.310-0.345 map units) harbors one out of at least six loci of DNA replication origins which is located at nucleotide position 485-513 . The identification of the structural properties and the coding capacity of the EcoRI CIV DNA fragment M was carried out by DNA nucleotide sequencing, computer-aided sequence analysis and DNA/RNA hybridization . The EcoRI CIV DNA fragment M (7,099 bp; 71.14% A+T and 28.86% G+C) possesses two clusters of five tandemly organized repetitive DNA elements with complex structural arrangements (R1-R5) which are located between nucleotide positions 3272-3350 and 3403-3414 . The analysis of the DNA sequences of the EcoRI CIV DNA fragment M revealed the presence of six open reading frames (ORFs 1-6) . Two out of six detected putative proteins are of particular interest . ORF-2 was found to be terminated at nucleotide position 366 (TAA) within the DNA sequence of the EcoRI CIV DNA fragment L (0.345-0.381 map units; 7.4 kb) . The analysis of ORF-2 (1,051 amino acids; 120 kD) revealed homologies to several DNA-directed RNA polymerases . ORF-6 encodes a protein (606 amino acids; 69 kD) which is related to a group of yeast, Drosophila and mammalian proteins of a distinct family of putative DNA and/or RNA helicases belonging to the 'DEAD/H' superfamily . The transcriptional activity of the EcoRI CIV DNA fragment M was determined by DNA/RNA hybridization experiments . These analyses revealed the existence of three RNA transcripts of about 3.4 kb (t1), 1.8 kb (t2) and 1.2 kb (t3) which agree with the predicted size of the expected RNA transcripts from ORF-2 (1,051 amino acids; 3.1 kb) and ORF-6 (606 amino acids; 1.8 kb).

Immunogenetics, 1994, 39(1), 15 - 20
Large transcripts and sequence from a polymorphic 170 kb MHC region implicated in susceptibility to autoimmune disease; Marshall B et al.; We have used the novel strategy of overlapping yeast artificial chromosome (YAC) clones to localize a series of new transcripts within a 170 kb region of the human major histocompatibility complex (MHC), containing genes likely to be of importance for disease susceptibility . Using cloned genomic probes we have further localized these transcripts to a region 15 kilobases (kb) centromeric of HLA-B . In the liver there are at least four transcripts ranging in size between 7.5 kb and 3.4 kb, while in the lung two transcripts of 5.8 kb and 4.2 kb are detected . The possible implications of these transcripts for autoimmune disease are discussed, given that they are located in a region previously shown to be of importance for susceptibility to insulin-dependent diabetes mellitus and myasthenia gravis . Furthermore, we conclude that YACs as large as 360 kb are able to be used as probes to identify new transcripts and that the MHC region between HLA-B and BAT1 is the site of a large multiply spliced gene, provisionally designated PERB6.

Symp Soc Exp Biol, 1994, 48, 23 - 31
Why isoforms of the plant plasma membrane H(+)-ATPase?
Palmgren MG.
The significance of different isoforms of the plant plasma membrane H(+)-ATPase is essentially unknown . At least some of the isoforms exhibit a tissue-specific and developmental pattern of expression . The three major isoforms of Arabidopsis thaliana plasma membrane H(+)-ATPase have been expressed in a functional form in yeast internal membranes . The isoforms differ significantly from each other in several kinetic parameters . Thus, the isoform diversity of plasma membrane H(+)-ATPase might provide the individual cell with enzymes specifically adapted to that cell.

Symp Soc Exp Biol, 1994, 48, 167 - 77
The heterologous expression of H(+)-coupled transporters in Xenopus oocytes; Miller AJ et al.; The Xenopus oocyte has become a convenient and robust system for the expression of many different animal transport proteins and it has now been demonstrated that oocytes can also translate, process and target plant membrane proteins . Here we review the background to this expression system and discuss how it can be used to express plant transporters . A H+/hexose cotransporter (STP1) from Arabidopsis thaliana has been successfully expressed in oocytes and further characterization has shown the transporter to have properties similar to the same transporter expressed in yeast . However, the expression of H(+)-coupled transporters may present problems for oocyte intracellular pH regulation, because the influx of protons during their operation may acidify the cell . To investigate this possibility, proton-selective microelectrodes have been used to measure intracellular pH during symport of H+ and hexose in oocytes expressing STP1 . These measurements showed that oocyte cytosolic pH is unaltered during H+/glucose cotransport, but is sensitive to changes in external pH.

Glas Srp Akad Nauka {Med}, 1994, (44), 101 - 8
{Effect of interferon alpha on immunologic parameters in patients with carcinoma of the renal parenchyma}; Markinovic M et al.; A wide range of immunological abnormalities have been described in renal-cell carcinoma (RCC) . The only constant one was the decrease of CD4/CD8 ratio, reversible following radical nephrectomy in the absence of metastases . Alpha-interferon was administered with variable benefit to patients with metastatic RCC . The aim of this study was to document whether the treatment of patients with metastatic RCC, with unpurified human alpha-interferon, induced any change in the number and functional properties of peripheral blood T lymphocytes and monocytes . Fifteen patients were included in the study; all were treated with IFN 2,000,000 IJ/24h x 15 days, with an intercycle interval of 15 days during at least 4 cycles . The immunological analyses included the percentage and absolute number of E-rosette forming cells, CD3+, CD4+, CD8+ and CD4/CD8 ratio as well as the percentage and absolute number of monocytes and their phagocytic index toward the yeast particles . The analyses were done before the treatment and after the 4th cycle of the IFN therapy and compared toward the same analyses done in 22 healthy controls . Following IFN treatment two significant changes were noted: a decrease in CD4/CD8 ratio (mean 1.050 fall for 19% to 44%, mean 27.25% from the initial value) as well as a marked decrease in monocyte phagocytic index (p < 0.005) . These data point to either disease-related or treatment-related decrease in the phagocytic properties of monocytes and the decrease of CD4/CD8 ratio.

Proc Int Conf Intell Syst Mol Biol, 1994, 2, 348 - 53
GeneQuiz: a workbench for sequence analysis; Scharf M et al.; We present the prototype of a software system, called GeneQuiz, for large-scale biological sequence analysis . The system was designed to meet the needs that arise in computational sequence analysis and our past experience with the analysis of 171 protein sequences of yeast chromosome III . We explain the cognitive challenges associated with this particular research activity and present our model of the sequence analysis process . The prototype system consists of two parts: (i) the database update and search system (driven by perl programs and rdb, a simple relational database engine also written in perl) and (ii) the visualization and browsing system (developed under C++/ET++) . The principal design requirement for the first part was the complete automation of all repetitive actions: database updates, efficient sequence similarity searches and sampling of results in a uniform fashion . The user is then presented with "hit-lists" that summarize the results from heterogeneous database searches . The expert's primary task now simply becomes the further analysis of the candidate entries, where the problem is to extract adequate information about functional characteristics of the query protein rapidly . This second task is tremendously accelerated by a simple combination of the heterogeneous output into uniform relational tables and the provision of browsing mechanisms that give access to database records, sequence entries and alignment views . Indexing of molecular sequence databases provides fast retrieval of individual entries with the use of unique identifiers as well as browsing through databases using pre-existing cross-references . The presentation here covers an overview of the architecture of the system prototype and our experiences on its applicability in sequence analysis.(ABSTRACT TRUNCATED AT 250 WORDS)

Gene Ther, 1994 Jan, 1(1), 7 - 12
Mammalian artificial chromosomes: a new tool for gene therapy; Huxley C; Effective therapy by in vivo delivery of DNA requires efficient delivery, long-term maintenance of the DNA that is delivered and physiological levels of expression of the therapeutic gene . Full levels of physiologically controlled expression can be obtained after transfer of intact genes on fragments of DNA hundreds of kilobases in size, as has been demonstrated by the transfer of yeast artificial chromosomes into transgenic mice . Long-term maintenance of input DNA could be achieved if the DNA carried replication origins, a centromere and telomeres to allow maintenance and segregation in mammalian cells, and there has been recent progress towards cloning these elements . These features could be combined as a mammalian artificial chromosome which would confer full levels of controlled expression as well as being maintained in any cell into which it was introduced . Methods which would allow delivery of such large fragments of DNA include liposomes and receptor-mediated uptake, both of which have been shown to work in vivo, making such large constructs potentially applicable for use in gene therapy.

DNA Res, 1994, 1(3), 129 - 38
Restriction enzyme-resistant high molecular weight telomeric DNA fragments in tobacco; Suzuki K et al.; Restriction endonuclease-resistant high-molecular-weight (HMW) DNA fragments were isolated from nuclear DNA fragments in tobacco . The size of the fragments produced by EcoRI, HindIII, AfaI, and HaeIII ranged from 20 kb to over 166 kb . The kinetics of digestion by Bal31 nuclease showed that most of the HMW fragments are chromosome ends . The consensus sequence for tobacco telomere repeats was determined to be CCCTAAA by genomic sequencing using the HMW fragments and by sequencing after cloning . Besides the telomere sequence, 9 tandem repeats of a 45-bp sequence were identified, in which a 35-bp unit sequence (AGTCAGCATTAGGGTTTTAAACCCTAAACTGAACT) formed a stem structure . The front of the stem is composed of a palindrome of the telomere repeats . This highly conserved unit is surrounded by less conserved internal sequences that are around 10-11 bp in size and contain a TTTT stretch . The internal sequences resemble the 10-11 bp consensus for the scaffold attachment regions found in yeast and drosophila . The characteristic 45-bp sequence was abundant on the ends of chromosomes . The shortest distance between the repeats containing telomeric stem and the telomere was less than 20 kb . This architecture of the tobacco chromosome end region resembles the end region of yeast chromosomes in which autonomous replication sequences are present frequently.

Acta Biochim Pol, 1994, 41(4), 459 - 66
MspI8, the repetitive sequence specifically interacting with nuclear matrix of rat testis cells; Rzeszowska-Wolny J et al.; The nuclear matrix bound DNA fraction of rat testis showed enrichment in repetitive sequences found in the 450 bp band after gel electrophoresis of the MspI digested rat DNA . DNA fragments isolated from this band were cloned . DNA of the clone pMspI8 showed homology to some representatives of rat LINE sequence family, and complexed in vitro more efficiently with testes nuclear matrix proteins than with yeast ARS1 sequence containing the matrix association region (MAR) or DNA from an other clone, MspI19 . Western blot analysis showed that MspI8 sequence interacts with testes matrix protein of about 120 kDa.

Nahrung, 1994, 38(3), 318 - 26
Mycoflora of post-harvest maize and wheat grains and the implication of their contamination by molds; Adisa A; Thirteen fungi including toxigenic Aspergillus nidulans and A . clavatus were isolated from the grains . The isolated fungi grew well at 25-30 degrees C . A . clavatus and A . nidulans were grown in liquid maize yeast extract medium and wheat yeast extract medium . Both fungi produced amylases on the two media and on the basal medium at 30 degrees C . During incubation more total reducing sugars were detected in maize grains than in wheat while non-reducing sugars were detected than reducing sugars in both grains . A . clavatus showed highest amylase activities at 25-30 degrees C and at a pH 7-8 while 30 degrees C and pH 6.0 were the optimum conditions for highest amylase activities of A . nidulans . During incubation with both fungi a decrease in the protein and carbohydrate contents of both grains was recorded while more fat was accumulated in the grains.

Clin Exp Immunol, 1994 Jan, 95(1), 195 - 200
Peripheral T lymphocyte depletion by apoptosis after CD4 ligation in vivo: selective loss of CD44- and 'activating' memory T cells; Howie SE et al.; We have demonstrated that a single intravenous bolus of rat anti-CD4 MoAb caused a small but prolonged increase in apoptosis in murine lymph nodes . We have quantified this process using the novel Highly Optimized Microscope Environment (HOME) interactive images analysis system and shown that the increase in apoptosis was sufficient to account for the observed depletion of the peripheral CD4+ T cell subset . This occurred in the absence of any other exogenous signal . Furthermore, there was no evidence of an inflammatory or necrotic response in the tissues, indicating that this was unlikely to be Fc or complement-mediated antibody killing . The anti-CD4-induced depletion selectively removed CD44- T cells . Using mice previously immunized with yeast-derived HIV-1 p24 recombinant protein there was sparing of memory T cell function after in vivo anti-CD4 treatment, except during a window of less than 24 h duration, when simultaneous exposure to antigen and anti-CD4 antibody resulted in the depletion of specific memory T lymphocyte function . This indicated that a very minor alteration in the frequency of apoptosis had a marked effect on cell number over time, and suggested that opportunistic infection associated with CD4+ T cell depletion may be explained by loss of memory cells when there is antigenic stimulation at the same time as CD4 ligation . These results have implications for the pathology of HIV-associated disease which is associated with ligation of CD4 molecules in vivo.

Hum Genet, 1994 Jan, 93(1), 35 - 41
Expression of (cac)n/(gtg)n simple repetitive sequences in mRNA of human lymphocytes; Epplen C et al.; Di- and trinucleotide tandem repeat sequences are ubiquitously interspersed and are often polymorphic in the human genome . We have analyzed the transcription of simple (cac)n/(gtg)n repeats in the cDNA of RNA from human lymphocytes . When using such motifs as probes in RNA hybridization experiments, distinct signals are scarcely demonstrable . In order to investigate mRNA sequences that contain such simple repeats, 1 million phage clones from cDNA libraries were screened with the probe (CAC)5 . From 50 hybridizing phages, 38 clones were successfully isolated and characterized . The lengths of the transcripts ranged from 120 bp to 3.5 kb . More than 15 different additional simple repeat motifs were found immediately next to or distant to the (cac)n/(gtg)n repeat . In 12 clones, significant homologies were identified with a wide variety of unrelated genes, such as a processed pseudogene of human ubiquitin, serin protease inhibitor genes, a gene candidate from yeast, and sequence-tagged sites of man and mouse . Of the clones, 18% represented mRNA of MHC class I promotor binding protein; 79% displayed novel single copy sequences or partial similarity to many different organelle and nuclear genomes of animal, fungal, bacterial, and viral sequences . These data indicate that short (cac)n/(gtg)n stretches (n < or = 6) are sometimes contained in open reading frames, but more often in the 3' and 5' untranslated portions of mature mRNAs . Longer stretches of perfect simple (cac)n/(gtg)n repeats can rarely be recovered, even from the hnRNA of human lymphocytes.

Nucleic Acids Res, 1993 Dec 25, 21(25), 5865 - 74
The organisation of repetitive sequences in the pericentromeric region of human chromosome 10; Jackson MS et al.; Three satellite DNA families are present in the pericentromeric region of chromosome 10; the alpha satellite and two 5 bp satellite families defined here as satellites 2 and 3 . Pulsed field gel electrophoresis (PFGE) demonstrates that these sequences are organised into five discrete arrays which are linked within a region of approximately 5.3 Megabases (Mb) of DNA . The alpha satellite is largely confined to a 2.2 Mb array which is flanked on its p arm side by two 100-150 kb satellite 3 arrays and on its q arm side by a 900 kb satellite 2 array and a further 320 kb satellite 3 array . This linear order is corroborated by fluorescent in situ hybridisation analyses . In total, these arrays account for 3.6 Mb of DNA in the pericentromeric region of chromosome 10 . These data provide both physical information on sequences which may be involved in centromere function and a map across the centromere which has the potential to link yeast artificial chromosome (YAC) contigs currently being developed on both arms of this chromosome.

Gene, 1993 Dec 22, 136(1-2), 301 - 5
The leu-1 gene of Neurospora crassa: nucleotide and deduced amino acid sequence comparisons; Li Q et al.; The Neurospora crassa leu-1 gene encodes beta-isopropylmalate dehydrogenase (IPMDH; EC 1.1.1.85), an enzyme in the leucine biosynthetic pathway . We determined the nucleotide sequence of the entire leu-1 gene and of four independent cDNA clones . By comparing the genomic and cDNA sequences, four introns were identified in the 5' portion of the gene and a single open reading frame was established . One of the introns is located within the 5'-noncoding region of the transcript . The deduced amino acid sequence encoded by leu-1 was aligned with that of the homologous yeast enzyme and extensive sequence identity was uncovered . The lesion present in a conventional leu-1 mutant was identified as the insertion of a single base pair.

Gene, 1993 Dec 22, 136(1-2), 177 - 83
Rapid identification of overlapping YACs in the MEN2 region of human chromosome 10 by hybridization with Alu element-mediated PCR products; Moir DT et al.; An overlapping set of 21 yeast artificial chromosomes (YACs) spanning the RET proto-oncogene {Takahashi et al., Oncogene 3 (1988) 571-578} and D10S102 markers on human chromosome 10 was isolated in a series of hybridization-based chromosomal walks in a YAC library . Genetic linkage analyses implicate this chromosomal region as the location of the gene (MEN2A) responsible for multiple endocrine neoplasia type 2A . Four YACs carrying a RET sequence-tagged site (STS) and two YACs carrying a D10S102 STS were used to initiate chromosome walks . These were based on hybridization of Alu element-mediated polymerase chain reaction (Alu-PCR) products from YACs to dot blots of Alu-PCR products from complex pools of YAC clones . The hybridization anchor content of YACs identified in the walks was confirmed by probing blots of Alu-PCR products from individual YACs and by comparing Alu-PCR fingerprints of each YAC . Ten hybridization-based Alu-PCR anchors and three STS anchors were ordered within eleven intervals created by the 21 overlapping YACs . The order of anchors requiring the fewest gaps in the YACs is consistent with the walking results and establishes the STS anchor order as D10S102-D10S94-RET . The overlapping set of YACs represents about 1.55 Mb of the human genome according to restriction mapping of four representative YACs in the contig . These results demonstrate the power of Alu-PCR hybridization for chromosomal walking and provide a rich source of overlapping YACs which can be used to identify candidate MEN2A genes.

J Mol Biol, 1993 Dec 20, 234(4), 1290 - 300
Molecular cloning and developmental expression of the alpha-2 tubulin gene of Caenorhabditis elegans; Fukushige T et al.; Alpha tubulin isotypes are encoded by at least four genes designated alpha-1 to alpha-4 in the nematode Caenorhabditis elegans . We describe here, molecular cloning of the alpha-2 tubulin gene, located on chromosome I, that encodes a protein of 449 amino acids that has high homology to human, mouse and Drosophila alpha tubulins, but relatively lower homology to the yeast alpha tubulins . The alpha-2 tubulin gene is trans-spliced to the SL1 leader sequence . Northern analysis shows that the gene is increasingly transcribed during the early (L1-L3) larval stages but has a lower level of transcription in L4 L4 larvae, adults, and embryos . Using an alpha-2-lacZ fusion gene expression in transgenic animals, we show that the gene is expressed in a tissue-specific manner in the intestine, pharyngeal muscle cells, and a subset of neurons which include a class of DB and VB motor neurons in the ventral nerve cord, posterior touch receptor neurons, PLML, PLMR, in the lumbar ganglia; PVT in the pre-anal ganglion, and ALA in the dorsal ganglion in the head . Our results support the notion that tubulin structure may contribute to the functional specialization of microtubules.






What Is Genetics?, What Is Cell Biology?, What Is Yeast?, What Is Genome?, What Is Biofilm?, o, Microbes, n, Bacterium, s, Microbiology, s, Bacteriology, c, Microbe, n, Bacillus subtilis, a, Bacteroides, e, Acinetobacter, o, Lactococci, o, Pseudomonas aeruginosa, o, Escherichia coli, c, Clostridia, o, Klebsiella, c, S. cerevisiae, s, Bacteria, e, Phage, e, Antibiotic resistance, r, Escherichia coli, o, Culture medium, e, Yeasts, a, Antibiotics, r, Erwinia, s, Antibiotic prophylaxis, n, Escherichia coli, n, Escherichia coli, i, Antimicrobials




 

   Scientific Publications - Work Done by Microbiology Reader Bioscreen C

Agricultural Microbiology
Anaerobic Microbiology
Antimicrobial Susceptibility
Artificial Atmosphere
Bioassay of Antibiotics
Biofilm Microbiology
Bioreactor Technology
Biotechnology
Cell Biology
Clinical Microbiology
Environmental Microbiology
Experiments with Yeast
Fermentation
Food Microbiology
Functional Genomics
Gene Technology
Growth Media Development
Growth Rate and Lag Time
Industrial Microbiology
Medical/Pharmaceutical Field
Microbiological Assay
Microbiological Research
Microbiology of Cosmetics

go to a specific theme...

Military Microbiology
Molecular Microbiology
Mutagenicity and Genotoxicity
Oral Microbiology
Patents
Postantibiotic Studies
Soil Microbiology
Spore Microbiology
Veterinary Microbiology
Waste/Wastewater Treatment
Water Microbiology
Wine Microbiology

 


 

© 2005 Transgalactic Ltd (manufacturer of Bioscreen C software) | Privacy Statement | P.O. Box 1393, 00101 Helsinki, Finland, phone: +358 9 85172920, fax: +358 9 8749481, e-mail: microbiology@bionewsonline.com
 

 

 

Last modified: May 25, 2005