|
|
|
Mol Gen Genet, 1975 Jul 10, 138(4), 333 - 43 9-Aminoacridine mutagenesis of bacteriophage T4 intracellular DNA; Altman S et al.; Most of the intracellular T4 DNA made in the presence of 9-aminoacridine is of lower molecular weight than mature T4 DNA and does not get packaged into phage particles . Using a T4 DNA transformation assay, we have examined this intracellular T4 DNA for its content of 9-aminoacridine-induced revertants of certain rII gene frameshift mutations . The proportion of acridine-induced revertants in the intracellular DNA population is close to that found in the phage progency made in the presence of 9-aminoacridine . Thus, the generation of low molecular weight T4 DNA in the presence of 9-aminoacridine is not, in itself, also a mutagenic process. Biochim Biophys Acta, 1975 Jul 7, 395(3), 258 - 73 Fine structures in denaturation curves of bacteriophage lambda DNA . Their relation to the intramolecular heterogeneity in base compositon; Yabuki S et al.; Precise recording of polyphasic optical melting curves was carried out for three kinds of bacteriophage lambda DNA differing in length (lambdac1857s7, lambdacIb2 and lambdacIb2b5) . Each of denaturation steps in melting profiles was characterized by two parameters, the melting temperature and the relative size . Any difference in fine structures in melting profiles was not recognized between the intact lambdacI857s7DNA and the DNA fragmented into halves . The change in fine structures in melting profiles caused by the deletions of the b2 and b5 region agreed qualitatively well with the prediction based on the physical and the genetical maps of phage lambda chromosome . The combined results indicate that, first, the well-known linear relationship between melting temperature and G+C content may apply also to each of denaturation steps in polyphasic melting curves due to heterogeneity of nucleotide distribution in a single DNA species, and, second, the effect of molecular ends on melting fine structures can be neglected at moderate salt concentration (0.01 M less than or equal to Na+ less than or equal to 0.2 M) for such a high molecular weight DNA . The heterogeneous distribution of nucleotides was derived for lambdaDNA and for its b2 and b5 regions. J Microsc, 1975 Jul, 104(2), 187 - 98 Adsorption of DNA molecules to different support films; Sogo JM et al.; Protein-free adsorption of the DNA of the Escherichia coli bacteriophage T7 to carbon, collodion, aluminium-beryllium and aluminium films was studied . It was found that the appearance of DNA strands depended greatly upon the kind of support film used . Direct adsorption of DNA to aluminium-beryllium or aluminium films yielded specimens with 'thin and long' and 'thick and short' regions along the strand . Well extended, uncoiled and unaggregated DNA molecules were obtained only when DNA was adsorbed to carbon, collodion or mica in the presence of intercalating dyes such as ethidium bromide . Adsorption properties of the different films are well correlated with their surface charge . Aluminium-beryllium films carry a strong positive surface charge, aluminium films a weak positive charge and carbon films a weak negative charge . It is suggested that for the preparation of specimens by spontaneous adsorption of well extended and unaggregated strands it is necessary that the DNA molecule is stiffened by a ligand such as an intercalating dye, and that the charge on the surface of the support film is opposite to the charge of the macromolecule. Nucleic Acids Res, 1975 Jul, 2(7), 1129 - 42 U.V . induced enhancement of recombination among lambda bacteriophages: relation with replication of irradiated DNA; Cordone L et al.; Experimental results are reported showing the dependence of the U.V . induced enhancement of recombinants on the presence of the functional O gene product . This fact is tentatively interpreted as a replication dependence of the U.V . induced recombination. J Virol, 1975 Jul, 16(1), 94 - 100 Role of gene 2 in bacteriophage T7 DNA synthesis; Center MS; Studies have been carried out to elucidate the in vivo function of gene 2 in T7 DNA synthesis . In gene 2-infected cells the rate of incorporation of (3-H)thymidine into acid-insoluble material is about 60% that of cells infected with T7 wild type . Gene 2 mutants do not however produce viable phage after infection of the nonpermissive host . In T7 wild type-infected cells, a major portion of the newly alkaline sucrose gradients . The concatemers serve as precursors for the formation of mature T7 DNA as demonstrated in pulse-chase experiments . In similar studies carried out with gene 2-infected cells, concatemers are not detected when the intracellular DNA is analyzed at several different times during the infection process . The DNA made during a gene 2 infection is present as duplex structures with a sedimentation rate close to mature T7 DNA. Ukr Biokhim Zh, 1975 Jul-Aug, 47(4), 417 - 21 {Synthesis of RNA and proteins with exogenous template in the DNA-directed cell-free system from Escherichia coli B . after UV-irradiation}; Fel'dman OL et al.; The RNA and protein synthesis was studied in the DNA-directed cell-free system with extracts and ribosomes of intact and ultraviolet (UV) irradiated E . coli B . The UV-doses used did not kill the cells, but produced noticeable morphological changes . DNA of bacteriophage T2 was used as a template for the RNA synthesis . All the UV-doses used cause an approximately equal decrease in the incorporation of uracil-14C into the acid-insoluble sediment in assays incubated with the extracts of the irradiated cells . The presence of ribosomes from the irradiated cells does not affect the uracil-14C incorporation . With the lower UV-doses incorporation of 14C-labelled amino acids into the acid-insoluble seciment by the irradiated cells extract decreases to the same degree as the uracil-14C incorporation . This may be the result of proportional decrease in the intensity of total RNA and m-RNA synthesis . The intensity of 14C-labelled amino-acid 14C incorporation with the ribosomes from the cells irradiated with lower UV-doses is decreased too . This testifies to a direct effect of uv on the ribosomes . With an increase in the UV-doses these effects disappear . It is supposed that the applied doses of UV-irradiation change differently the properties of the components of RNA- and protein-synthesing systens . This discrepancy becomes more noticeable with an increase in UV-dose. Proc Natl Acad Sci U S A, 1975 Jul, 72(7), 2770 - 4 A bacterial mutation blocking P2 phage late gene expression; Sunshine MG et al.; A mutant of Escherichia coli strain C has been isolated, called gro109, that blocks bacteriophage P2 propagation by interfering with late gene expression . DNA replication proceeds normally in P2+-infected gro109 cells, but late phage proteins are not made . Early P2 mRNA is made in normal amounts, but very little late mRNA can be detected . P2 mutants (P2 ogr) able to overcome the gro109 block have been isolated in which synthesis of late P2 mRNA and phage proteins Is restored . The gro109 mutation is closely linked to the cluster of ribosomal genes at 64 min and is recessive to the wild-type (gro+) allele . A P2 ogr mutation has been mapped on the left arm of the P2 genome, between the right-most known late gene (D) and the phage attachment site . P2 ogr can complement P2+ in gro109 cells, indicating that ogr codes for a diffusible product. Proc Natl Acad Sci U S A, 1975 Jul, 72(7), 2765 - 9 New chromosomal location for structural genes of ribosomal proteins; Watson RJ et al.; An Escherichia coli mutant, ts9, previously reported by Flaks et al . (Cold Spring Harbor Symp . Quant . Biol . 31, 623-631, 1966) to have an electrophoretically altered ribosomal protein, has been further characterized and the altered component has been identified as L7/L12 . Although mutant ts9 is temperature sensitive for growth (rts-), the rts and L7/L12 mutations are genetically separable and are both located between argH and rif . The L7/L12 mutation (rpyL) maps very close to relC, mutants of which have a defect in the 50S ribosomal subunit . The gene order is argH-rts-(rpyL,relC)-rif . Protein synthesis directed by bacteriophage lambdacI857S7drifd18 in ultraviolet-irradiated cells indicates that L7/L12, As well as L1, L10, L11, and possibly L8 or L9 are coded by the phage DNA . Our results indicate that rpyL is the structural gene for L7/L12 and that this region of the E . coli chromosome contains a cluster of structural genes for ribosomal proteins. Proc Natl Acad Sci U S A, 1975 Jul, 72(7), 2506 - 10 In vivo and in vitro phosphorylation of DNA-dependent RNA polymerase of Escherichia coli by bacteriophage-T7-induced protein kinase; Zillig W et al.; After infection with bacteriophage T7 the beta' and to a lesser extent the beta subunits of E . coli DNA-dependent RNA polymerase (nucleosidetriphosphate:RNA nucleotidyltransferase, EC 2.7.7.6) are phosphorylated by a phage-gene-encoded protein kinase (ATP:protein phosphotransferase, EC 2.7.1.37) . The phosphorylation occurs on threonine residues and appears site-specific . It is probably the molecular basis of the early transcriptional control. J Bacteriol, 1975 Jul, 123(1), 69 - 74 Regulation of the Escherichia coli methylgalactoside transport system by gene mglD; Robbins AR; Constitutive activity of the methylgalactoside transport system of Escherichia coli K-12 is shown to result from mutation of a genetic locus distinct from the two previously described regulatory loci for this permease . Employing an autoradiographic procedure whereby constitutive and inducible cells can be differentiated, it is demonstrated that this locus, termed mglD, is 20% cotransducible with ptsF by bacteriophage P1 . Selection for constitutive mutants among an inducible population yielded cells who mutations mapped in mglD . Cotransduction of mglD with mglB, minus C, and minus A, three genes required for activity of the methylgalactoside transport system, is 95, 88, and 81%, respectively . The results of recombination studies employing three and four factors indicate that the order of genes in this region is ptsF, mglD, B, C, A. J Bacteriol, 1975 Jul, 123(1), 41 - 6 Quantitation of the loss of the bacteriophage lambda receptor protein from the outer membrane of lipopolysaccharide-deficient strains of Escherichia coli; Randall LL; The recpetor for the phage lambda, a protein component of the outer membrane, is present at decreased levels in strains of Escherichia coli that are deficient in lipopolysaccharide . Loss of the protein was quantitated both by an assay of the phage receptor function and by an assay of antiserum-blocking ability to detect inactive protein . The loss of protein was correlated with the loss of sugar residues and phosphage from the core region of the lipopolysaccharide . Implications for the importance of ionic interactions in the stabilization of the outer membrane are discussed. J Bacteriol, 1975 Jul, 123(1), 212 - 21 Lambda bacteriophage gene produces and X-ray sensitivity of Escherichia coli: comparison of red-dependent and gam-dependent radioresistance; Trogovcevic Z et al.; When gene products of lambda bacteriophage are introduced into a cell by transient induction of a lysogen, increased resistance of the cells to X rays results . This phenomenon has been called phage-induced radioresistance . Genetic studies show at least two classes of induced radioresistance . The first type depends on the products of the lambda red genes and is observed in bacteria that are mutated in the recB gene . It is thought that the lambda red products compensate for the missing RecBC nuclease in the repair of X-ray damage . An optimal effect is obtained even when the lambda red products are supplied 1 h after irradiation . The lesions that are affected by the red-dependent process are probably not deoxyribonucleic acid strand breaks because the extent of deoxyribonucleic acid strand rejoining is not altered by the red products . The second type of phage-induced radioresistance requires the gam product of lambda and is observed in wild-type and polA strains . The lambda gam+ gene produce must be present immediately after irradiation to exert its full effect . In its presence, DNA breakdown is decreased, and a greater fraction of DNA is converted back to high molecular weight . Strains carrying lex, recA, or certain other combinations of mutations do not show any detectable phage-induced radioresistance. J Virol, 1975 Jul, 16(1), 85 - 93 Resolution of the DNA strands of the specialized transducing bacteriophage lambda-h80C 1-857 dargF; Sens D et al.; The DNA strands of lambdoid phages with deletions or substitutions of the guanine plus cytosine-rich region in the left arm are not resolvable by complexing with poly UG followed by centrifugation in CsCl . This work describes a completely general procedure for the strand resolution of these phages by hybridization with fragments of separated strands of the parent phage . In particular, resolution of the DNA strands of the specialized transducing phage lambda-h80C1-857dargF is described, and evidence is presented which indicates that argF is transcribed from the r strand. J Virol, 1975 Jul, 16(1), 62 - 9 Presence of active polyribosomes in bacterial cells infected with T4 bacteriophage ghosts; Takeishi K et al.; Host protein synthesis of Escherichia coli stops abruptly after T4 bacteriophage ghost infection . When infection was carried out in the presence of 10 mM Mg2plus, infected cells still have active polyribosomes despite the complete stoppage of protein synthesis . On the other hand, when T4 ghost infection was carried out in the presence of 1 mM Mg2plus, no polyribosomes were observed and most of the ribosomes were 30S and 50S subunit particles . Subunits obtained from extracts of ghost-infected cells at 1 mM M'G2++ concentration could not be converted to polyribosomes, even when Mg2plus concentration was adjusted to 10 mM after ghost infection . There was very little difference in amino acid incorporation activities between polyribosomes from ghost-infected and uninfected cells . In addition, the activity of 70S ribosomes isolated from uninfected cells was identical to that from cells infected with ghosts at 10 mM Mg2plus. J Virol, 1975 Jul, 16(1), 203 - 5 Effect of DNA delay mutations of bacteriophage T4 on genetic recombination; Leung D et al.; Studies have been made of the effect of the DNA delay mutations of bacteriophage T4 on growth and genetic recombination in a number of Escherichia coli hosts . DNA delay mutations in genes 39, 52, 58 (61), and 60 result in abnormally high recombination frequencies . These high recombination frequencies are discussed in the context of other observations. Proc Natl Acad Sci U S A, 1975 Jul, 72(7), 2555 - 8 Site-specific cleavage of single-stranded DNA by a Hemophilus restriction endonuclease; Horiuchi K et al.; Single-stranded viral DNA of bacteriophage f1 is cleaved into specific fragments by endo R-HaeIII, a restriction endonuclease isolated from Hemophilus aegyptius . The sites of the single strand cleavage correspond to those of the double strand cleavage . A single-stranded DNA fragment containing only one HaeIII site is also cleaved by this enzyme . This observation suggests that the reaction of single-stranded DNA cleavage does not require the formation of a symmetrical double-stranded structure that would result from the intramolecular base-pairing between two different HaeIII sites . Other restriction endonucleases may also cleave single-stranded DNA. Proc Natl Acad Sci U S A, 1975 Jul, 72(7), 2559 - 62 3'-Terminal nucletide sequence (n equals 361) of bacteriophage MS2 RNA; Vandenberghe A et al.; 32P-Labeled MS2 RNA was partially digested with ribonuclease T1 (guanyloribonuclease; ribonucleate 3'-guanylo-oligonucleotidohydrolase; EC 3.1.4.8) or with epilson-carboxymethyl-lysine-41 pancreatic ribonuclease A (ribonucleate 3'-pyrimidino-oligonucleotidohydrolase; EC 3.1.4.22) . A series of overlapping fragments was obtained which allowed the reconstruction of a 361-nucleotide-long 3'-terminal sequence . A unique reading frame could be deduced, which indicated that the replicase gene ends with a U-A-G termination signal and is followed by a 174-nucleotide-long untranslated segment. J Virol, 1975 Jul, 16(1), 1 - 4 Transfection of Escherichia coli spheroplasts . VI . Transfection of nonpermissive spheroplasts by T5 and BF23 bacteriophage DNA carrying amber mutations in DNA transfer genes; Benzinger R et al.; DNA was extracted from T5 and BF23 phage carrying amber mutations in genes A2, A1, or D9 and tested for its ability to transfect su minus spheroplasts . DNA from T5 am231, defective in gene A2, transfects Escherichia coli su minus recB minus spheroplasts with an efficiency of 16% of that of wild-type T5 DNA, whereas DNA from T5 am16d or BF23 am57, both defective in gene A1 or its equivalent, transfects E . coli su minus recB minus spheroplasts with an efficiency of 1.4% of that of wild-type T5 DNA, provided E . coli su+ bacteria is used as the indicator in all cases . More than 95% of the progeny from the am231, am16d, and am57 DNA that transfects su minus recB minus spheroplasts is still amber mutant . From these efficiencies of transfection we conclude that the product of gene A2 functions mainly in the mechanism of transfer of phage DNA to intact host cells, and that this function is not essential for transfection of spheroplasts . We also conclude that gene A1 controls functions in addition to DNA transfer, in agreement with previous studies which show that mutations in gene A1 have a pleiotropic effect . Apparently, the absence of these additional functions controlled by gene A1 leads to a high frequency of abortive infection . DNA from amber mutants defective in either gene A1 or A2 does not appreciably transfect su minus rec+ spheroplasts, indicating that the products of these two genes may both be needed to protect T5 DNA from the very active rec BC nuclease in spheroplasts. Mol Biol (Mosk), 1975 Jul-Aug, 9(4), 524 - 32 {MS2 RNA hydrolysis by snake venom phosphodiesterase and template properties of RNA produced by limited exonucleolytic action}; Iansone IV et al.; The action of snake venom phosphodiesterase on bacteriophage MS2 RNA under conditions of limited hydrolysis has been studied . The content of 5'-mononucleotides released during hydrolysis does not correspond to the calculated one based on the 3'-terminal nucleotide sequence of MS2 RNA . This finding suggests the occurrence of endonucleolytic splits in MS2 RNA with concomitant exonucleolytic digestion of some newly formed fragments . A high molecular weight RNA fraction, comprising unfragmented MS2 RNA with about 5-63'-terminal nucleotides removed is separated by sucrose gradient centrifugation and shown not to differ from the native MS2 RNA in its template function in a cell-free protein synthesizing system . It is demonstrated that template activity, polarity of translation, and nascent peptide chain termination on the MS2 replicase cistron are not affected by the removal of 3'terminal nucleotides of MS2 RNA . Consequently, these nucleotides are unessential in translation of native MS2 RNA. Mol Biol Rep, 1975 Jul, 2(2), 89 - 94 In vitro repair of UV-or x-irradiated bacteriophage T4 DNA by extract from blue-green alga Anacystis nidulans; Shestakov SV et al.; The cell-free extract from blue-green alga Anacystis nidulans contains enzymatic activities which repair in vitro transforming DNA of bacteriophage T4 damaged by UV light or X-rays . The repair effect of the extract was observed with double-stranded irradiated DNA but not with denatured irradiated DNA . The level of restoration of the transforming activity depends on the protein concentration in the reaction mixture and on the dose of irradiation . A fraction of DNA lesions induced by X-rays is repaired by a NAD-dependent polynucleotide ligase present in the extract . The repair of UV-induced lesions is the most efficient in the presence of magnesium ions, NAD, ATP and the four deoxynucleoside triphosphates . The results indicate that the repair of UV-irradiated DNA is performed with the participation of DNA polymerase and polynucleotide ligase which function in the cell-free extract of the algae on the background of a low deoxyribonuclease activity. J Virol, 1975 Jul, 16(1), 5 - 16 Role of gene 59 of bacteriophage T4 in repair of UV-irradiated and alkylated DNA in vivo; Wu R et al.; Nonsense mutants in gene 59 (amC5, amHL628) were used to study the role of this gene in the repair of UV-damaged and alkylated DNA of bacteriophage T4 in vivo . The higher sensitivity to UV irradiation and alkylation of gene 59 mutants after exposure to these agents was established by a comparison of the survival fractions with wild type . Zonal centrifugal analysis of both parental and nascent mutant intracellular DNA molecules after UV irradiation showed that immediately after exposure the size of single-stranded DNA fragments was the same as the wild-type intracellular DNA . However, the capability of rejoining fragmented intracellular DNA was greatly reduced in the mutant . In contrast, the wild-type-infected cells under the same condition resumed DNA replication and repaired its DNA to normal size . Methyl methanesulfonate induced more randomly fragmented intracellular DNA, when compared to UV irradiation . The rate of rejoining under these conditions as judged from their sedimentation profiles was also greatly reduced in mutant-infected cells . Further evidence is presented that UV repair is not a simple consequence of arrested DNA replication, which is a phenotype of the mutant when infected in a nonpermissive host, Escherichia coli B (su minus), but rather that the DNA repair function of gene 59 is independent of the replication function . These and other data presented indicate that a product(s) of gene 59 is essential for both repair of UV lesions and repair of alkylation damage of DNA in vivo . It is suggested that gene 59 may have two functions during viral development: DNA replication and replication repair of DNA molecules. J Biol Chem, 1975 Jun 25, 250(12), 4601 - 6 Specific hydrolysis of the cohesive ends of bacteriophage lambda DNA by three single strand-specific nucleases; Ghangas GS et al.; Procedures have been worked out for Aspergillus nuclease S1 and mung been nuclease to quantitatively cleave off both of the 12-nucleotide long, single-stranded cohesive ends of lambdaDNA . This cleavage is indicated by the almost complete elimination of the repair incorporation of radioactive nucleotides by DNA polymerase into the digested DNA . With S1 nuclease, cleavage was complete at 10 degrees as well as at 30 degrees . Under the conditions for quantitative cleavage of the single-stranded regions there was no digestion of the double-stranded lambdaDNA . The mung bean nuclease cleaved off the cohesive ends completely at 30 degrees but at 5 degrees, the cleavage was not complete even at high enzyme concentration . The nearest neighbor analysis of the repaired DNA indicates that at 5 degrees about four nucleotides remained undigested . The mung bean nuclease also introduced, under the conditions used, some nicks into double-stranded DNA as determined by the repair incorporation . The Escherichia coli exonuclease VII cleaved off part of the cohesive ends of lambdaDNA, leaving two nucleotides on each end as single-stranded tails. J Biol Chem, 1975 Jun 25, 250(12), 4755 - 64 Termination of transcription in bacteriophage lambda . Heterogeneous, 3'-terminal oligo-adenylate additions and the effects of rho factor; Rosenberg M et al.; RNA transcripts were synthesized in vitro from a lambda DNA template with purified Escherichia coli RNA polymerase either in the presence or absence of the protein termination factor, rho . The products were initially characterized by electrophoresis on polyacrylamide slab gels, and two of the lower molecular weight discrete species (6 S and 4 S RNA) were further characterized by standard two-dimensional "fingerprint" analysis . Production of the 4 S RNA was strongly affected by the presence of rho, whereas production of the 6 S RNA species was relatively unaffected by rho . 3'-Terminal oligonucleotide fragments were then selectively isolated on columns of dihydroxyboryl-substituted cellulose from these transcripts . Sequence analysis of these oligonucleotide products indicated: (a) that all of the transcripts examined possess similar degrees of 3'-terminal sequence heterogeneity which consisted predominantly of the addition of 1 to 5 adenylate residues to the 3'-terminus of the transcript; and (b) that rho factor-enhanced termination results in a definite structural change in the nucleotide sequence with which an RNA molecule can terminate. J Biol Chem, 1975 Jun 10, 250(11), 4333 - 9 Proteolytic digestion of the micellar complex of f1 coat protein and deoxycholate; Woolford JL Jr et al.; The major coat protein of bacteriophage f1 radioactively labeled with specific amino acids was solubilized with deoxycholate and digested with trypsin or alpha-chymotrypsin . The degree of proteolysis of the coat protein was assayed by gel filtration chromatography of the digest in the presence of deoxycholate . Hydrolysis occurred at residues in the hydrophilic termini of the coat, releasing peptides containing proline, lysine, and phenylalanine . No cleavage occurred at the tyrosine or methionine residues in the hydrophobic core . However, chymotrypsin could cleave somewhat at these residues in the absence of deoxycholate . A model for the topography of the micellar complex of coat protein and deoxycholate is presented in which the hydrophobic sequence of the coat is bound to deoxycholate within a micelle, while the hydrophilic termini of the coat project from the micelle. J Biol Chem, 1975 Jun 10, 250(11), 4327 - 32 Interaction of deoxycholate and of detergents with the coat protein of bacteriophage f1; Makino S et al.; The major coat protein of bacteriophage f1, which is localized in the host membrane during phage maturation, has a hydrophobic binding site capable of binding deoxycholate and a variety of detergents to form a soluble particle, and in that respect, resembles many membrane proteins . The soluble particle has properties that suggest it is formed by simple insertion of protein into a deoxycholate or detergent micelle, but molecular weight measurements show that the protein is present as a dimer, even in sodium dodecyl sulfate, indicating the existence of unusually strong forces for self-association . A by-product of the investigation has been to show that detergents can be very helpful in the fractionation of the constituent molecules of the virus: deoxycholate-solubilized virus is readily fractionated by gel chromatography into DNA, A protein, and B protein, with virtually no cross-contamination. Mol Gen Genet, 1975 Jun 19, 138(3), 203 - 12 Segregation into the replication of bacteriophage M 13 DNA in minicells of Escherichia coli; Staudenbauer WL et al.; Minicells derived from E . coli x796(F+) are refractory to infection by phage M 13 . However, after infection of the minicell-producing strain with M 13, phage DNA is found to segregate efficiently into newly formed minicells . The M 13 specific DNA present in minicells isolated several hours after infection consists of single stranded viral DNA and double stranded replicative forms in nearly equal amounts . M 13 DNA containing minicells are capable of carrying out at least one complete round of single stranded DNA synthesis as shown by the flow of label from replicative forms to free single strands. Mol Gen Genet, 1975 Jun 19, 138(3), 179 - 92 DNA degradation in minicells of Escherichia coli K-12 . II . Effect of recA1 and recB21 mutations on DNA degradation in minicells and detection of exonuclease V activity; Khachatourians GG et al.; The properties of minicell producing mutants of Escherichia coli deficient in gentic recombination were examined . Experiments were designed to test recombinant formation in conjugal crosses, survival following UV-irradiation in cells, and the state of DNA metabolism in minicells . The REC- phenotypes are unaffected by min+/- genotypes in whole cells . In contrast to minicells produced by rec+ parental cells, minicells from a recB21 strain have limited capacity to degrade linear, Hfr transfereed DNA . The lack of a functional recA gene product, presumably involved in inhibiting the recBC nuclease action(s), permits unrestricted Hfr DNA breakdown in minicells produced by a recA1 strain . This results in an increase in TCA soluble products and in the formation of small DNA molecules that sediment near the top of an alkaline sucrose gradient . Unlike the linear DNA, circular duplex DNA from plasmids R 64-11 or lambdadv, segregated into the minicells, is resistant to breakdown . By using in vitro criteria, and {32P}-labelled linear DNA from bacteriophage T7 for substrate, we found that the ATP-dependent exonuclease of the recBC complex (exo V) is present in rec+ and recA- minicells, and is lacking in the recB21 mutant . In fact, the absence of a functional exo V in recBC- minicells results in isolation of larger than average Hfr DNA from minicells . We suggest that recombination (REC) enzymes segregate into the polar minicells at the time of minicell biogenesis . This system should be useful for studies on DNA metabolism and functions of the recBC and recA gene products. Eur J Biochem, 1975 Jun 16, 55(1), 147 - 55 Initiation of transcription within an RNA-polymerase binding site; Heyden B et al.; 1 . The 5'-terminal sequence of the RNA transcribed from bacteriophage fd replicative form DNA under the control of promotor region I has been determined to be ppp(Gp)nUpApApApGpApCpCpUpGpApUpUp . . . 2 . This sequence is complementary to the 5'-terminal sequence of the minus strand of the corresponding RNA polymerase binding site I, the starting point for RNA synthesis lying approximately in the middle of the binding site . 3 . This initial sequence is also transcribed faithfully from isolated complexes of RNA polymerase and binding site I, obtained by DNase digestion of complexes between RNA polymerase and fd replicative form DNA . These highly stable complexes can not be reconstituted from binding site and enzyme . 4 . It is concluded that RNA polymerase binding site and initiation site are identical parts of a promoter region, and that no "drift" between these sites is required as a step in RNA chain initiation . An additional non-transcribed outside region is implicated as essential for full promoter function. Eur J Biochem, 1975 Jun 16, 55(1), 305 - 14 Protein kinase of bacteriophage T7 . 2 . Properties, enzyme synthesis in vitro and regulation of enzyme synthesis and activity in vivo; Pai SH et al.; Protein kinase, which was isolated from cells infected with T7, is indeed a viral gene product . This is shown by DNA-dependent synthesis in vitro . The protein kinase transfers phosphate from ATP to seryl or threonyl residues in protein . The enzyme has only a relative requirement for magnesium ions, but is only active at low ionic strength . The best substrate is lysozyme . T7 protein kinase activity is not stimulated by cyclic 3':5'-AMP and/or cyclic 3':5'-GMP . The T7 protein kinase carries -- SH groups essential for activity . There is indication that the enzyme phosphorylates itself and causes self inactivation, which may explain the fast disappearance of enzyme activity in vivo . Bacteriophage T3 also induces a protein kinase which is similar to the T7-induced enzyme in all respects tested. Eur J Biochem, 1975 Jun 16, 55(1), 299 - 304 Protein kinase of bacteriophage T7 . 1 . Purification; Pai SH et al.; A protein kinase, ATP:protein phosphotransferase (EC 2.7.1.37) was detected in Escherichia coli after infection with bacteriophage T7 . The enzyme was purified from the ribosomal wash fraction by conventional methods, affinity chromatography on Cibacron blue and on lysozyme coupled to Sepharose, and by cellogel electrophoresis . An approximately 5000-fold purification was achieved. J Biol Chem, 1975 Jun 10, 250(11), 4207 - 19 Nucleotide sequence determination of bacteriophage T2 and T6 species I ribonucleic acids; Paddock GV et al.; The nucleotide sequences of species I RNA coded for by bacteriophages T2 and T6 have been analyzed using 32-P-labeled material from T2 and T6-infected cultures of Escherichia coli . The T1 and pancreatic ribonuclease digestion products were partially analyzed and the results were compared with nucleotide sequences from T4 species I RNA to obtain a minimum estimate of the number of nucleotide sequence differences among the three species I RNAs . Analysis of fragments obtained by digestion with epsilon-carboxymethyl-lysine-41-pancreatic ribonuclease and with E . coli Q13 S30 crude extract was also performed to provide some additional confirmation for the nucleotide sequences that were derived for the T2 and T6 species I RNAs . T2 species I RNA was found to be different at three positions in the nucleotide sequence, and unlike T4 species I RNA, contained in addition the modified nucleotide, psi, in a region where the proposed secondary structure is identical to the TpsiC-loop of a tRNA . T6 species I RNA was found to contain nucleotide differences from the T4 species I RNA sequence at four positions . The U at position 119 in the sequence appears to be modified to psi only to a small extent . While a biological function for species I RNA is unknown, the fact that there is over 97% homology in the sequences suggests strong evolutionary pressures to retain the nucleotide sequence in the T-even genomes. J Biol Chem, 1975 Jun 10, 250(11), 4185 - 206 Nucleotide sequence determination of bacteriophage T4 species I ribonucleic acid; Paddock GV et al.; The nucleotide sequence of T4 species I RNA, one of several stable RNA's specifically coded for by bacteriophage T4, has been determined using 32-P-labeled material from T4-infected cultures of Escherichia coli . The purified RNA species which has been sequenced has been shown to hybridize well to T4 DNA (Wilson J.H., Kim, J.S., and Abelson, J.N . (1972) J . Mol . Biol . 71, 547-556) . The sequence is: pCGAUUCGAGGAAAUAUCUUUGCCGUAAGCCGAGUAGCGUUUUUGACGGAACGUUCGGAUAUGGUUGAGAUAUGGCCUUUUAAAAUAUUGAGUAGCGUCAACUACUUAAUAACCGGGUUCGAAUCCCGGCGUUUCGU-CAA-OHACA-OH . Species I RNA which is 140 nucleotides long is also found to occur in shorter versions with 135 to 136 nucleotides which terminate with a 3'-phosphate . The molecule can be arranged in a secondary structure which shows some striking similarities to the classic cloverleaf pattern of a tRNA . The molecule is specifically cleaved by an E . coli nuclease into three segments by cleavage at a double-stranded region in the molecule . The function of species I RNA is unknown, but evidence presented elsewhere (Paddock, G.V., and Abelson, J . (1975) J . Biol . Chem . 250, 4207-4219) indicates that the gene for this RNA molecule has been preserved in evolution . The position of a mutation within species I RNA has been determined . This mutation results in incorrect processing of the RNA and lower relative yields of the RNA are present. J Bacteriol, 1975 Jun, 122(3), 1247 - 56 Genetic and physical studies of lambda transducing bacteriophage carrying the beta subunit gene of the Escherichia coli ribonucleic acid polymerase; Ikeuchi T et al.; The prophage lambdac1857 was inserted into the bfe gene located near rif (the structural gene for the beta subunit of deoxyribonucleic acid {DNA}-dependent ribonucleic acid polymerase) on the Escherichia coli chromosome . Induced lysates (low-frequency transducing lysates) of such a lysogen contained defective lambda phage particles (lambdadrif+) that can specifically transduce the wild-type rif+ gene . Upon transduction into a recipient strain carrying recA, heterogenotes harboring both the wild-type and the mutant rif genes were isolated . Rec+ derivatives of these heterogenotes produce high-frequency transducing lysates that contain lambdadrif+ and normal active phages at a ratio of 1 to 2 . The results of marker rescue experiments and of density determination with several transducing phages indicate that most of the late genes are deleted and replaced by a segment of the chromosomal DNA carrying the bfe-rif region . The length of the chromosomal segment seems to vary between approximately 0.5 and 0.6% of the total bacterial DNA among the three independently isolated lambdadrif+ phages . Electron microscopy of heteroduplex DNA consisting of one strand from lambdadrif+-6 and the other from lambdaimm-21 phages directly confirmed that most of the phage DNA of the "left arm" was replaced by the bacterial DNA . The heteroduplex study also demonstrated that the integration of prophage lambda into the bfe region occurred at the normal cross-over point within the phage attachment site. Cell, 1975 Jun, 5(2), 109 - 13 Recognition sequences of repressor and polymerase in the operators of bacteriophage lambda; Maniatis T et al.; Nucleotide sequences in two wild-type and six mutant operators in the DNA of phage lambda are compared . Strikingly similar 17 base pair units are found which we identify as the repressor binding sites . Each operator contains multiple repressor binding sites separated by A-T rich spacers . Elements of 2 fold rotational symmetry are present in each of the sites . Superimposed on each operator is an E . coli RNA polymerase recognition site (promoter) . Similarities in the sequences of the two lambda promoters, a lac promoter, and an E . coli RNA polymerase recognition site in SV40 DNA are noted. Proc Natl Acad Sci U S A, 1975 Jun, 72(6), 2394 - 8 Uptake of homologous single-stranded fragments by superhelical DNA: a possible mechanism for initiation of genetic recombination; Holloman WK et al.; Superhelical {3-H}DNA (replicative form I, RFI) of bacteriophage phiX174 slowly but spontaneously took up 32-P-labeled homologous single-stranded fragments at 4 degrees . Uptake was accelerated by heating to 75 degrees . RFI did not take up single-stranded fragments derived from DNA of Escherichia coli or from separated strands of phage lambda . Uptake was inhibited by low concentrations of ethidium bromide . Relaxed circular phiX174 DNA did not take up homologous fragments . Per molecule of RFI, the complexes contained as much as 90 nucleotide residues of homologous fragment . The 32-P-lebeled fragments were largely resistant to digestion by exonuclease I, and were not displaced by heating complexes at 60 degrees for 1 min in 16 mM or 100 mM NaCl . Under comparable conditions of temperature and salt all of the fragments were displaced from complexes in which at least one phosphodiester bond was cleaved by pancreatic DNase, but a significant fraction of the fragments was retained in complexes that were relaxed by digestion with S1 nuclease . These observations are interpreted to mean that S1 nuclease digested the plus (viral) strand of the recipient RF at the site of uptake in some instances . Transfection of E . coli by heterozygous complexes produced recombinant progeny, thereby showing that genetic information can be transferred from the fragment of plus strand to progeny plus strands . We propose that both uptake of a third strand by superhelical DNA and the action of nucleases on the resulting complex may simulate early steps in genetic recombination. Proc Natl Acad Sci U S A, 1975 Jun, 72(6), 2222 - 6 Permeability lesions in male Escherichia coli infected with bacteriophage T7; Britton JR et al.; The abortive development of bacteriophage T7 in E . coli cells carrying F factors has previously been attributed to a lack of virus-directed modification of ribosomes in such cells . We find it unnecessary to postulate such translational control to explain the failure of T7 development . Instead, there is a general cessation of macromolecular syntheses around 8 min after T7 infection of F' cells . This cessation is correlated with a sudden outflow of the entire acid-soluble pool of phosphorus-containing compounds and loss of the ability to accumulate amino acids . Manifestation of these defects requires expression of at least one T7 gene and one episomal gene. Proc Natl Acad Sci U S A, 1975 Jun, 72(6), 2202 - 6 Mismatch repair in heteroduplex DNA; Wildenberg J et al.; DNA with base pair mismatches was prepared by annealing mixtures of genetically marked DNA from bacteriophage lambda . This heteroduplex DNA was used to transfect bacteria under conditions minimizing recombination . Genetic analysis of the progeny phages indicates that: (i) Mismatch repair occurs, usually giving rise to a DNA molecule with one chain with the genotype arising from repair and one parental chain . (ii) The frequency of repair of a given mismatch to wild type depends on the marker, ranging from 3 to 20% . (iii) Excision tracts may extend several hundred nucleotides but are usually shorter than about 2000 nucleotides . (iv) In Rec-mediated bacteriophage crosses, recombination of markers closer than about 10-3 nucleotide pairs frequently occurs by mismatch repair within heteroduplex DNA . (V) The average amount of heteroduplex DNA formed in a Rec-mediated recombination event is a few thousand nucleotide pairs. Proc Natl Acad Sci U S A, 1975 Jun, 72(6), 2084 - 7 A link between streptomycin and rifampicin mutation; Chakrabarti SL et al.; Introduction of str A mutations frequently make "male" strains of Escherichia coli permissive to bacteriophage T7; certain rif mutations reverse the permissive effect of strA mutation . Permissiveness of the strA mutation is accompanied by enhanced transcription of bacteriophage T7 genome . Introduction of the nonpermissive rif allele to the permissive strA strain reduces or abolishes the transcription of T7 genome . Thus, a link is implied in the functioning of the ribosome and the RNA polymerase (RNA nucleotidyltransferase, EC 2.7.7.6). Int J Radiat Biol Relat Stud Phys Chem Med, 1975 Jun, 27(6), 553 - 60 Further studies of DNA damage and lethality from the decay of iodine-125 in bacteriophages; Krisch RE et al.; The DNA of coliphages T4 and T1 was labelled with 125I-iododeoxyuridine . 125I decay is known to cause severe molecular damage via vacancy cascades (the Auger effect) . We have compared the induction of both single- and double-strand breaks (SSBs and DSBs) in 125I-labelled T4 DNA stored at - 196 degrees C during decay, either as intact phage or as free DNA . These comparative experiments indicate that, in addition to one DSB which apparently results directly from the Auger effect, each decay in an intact phage also give rise to an additional 0-05 DSBs, as well as 1-6 SSBs, as a result of ionizing radiation absorbed in the same phage particle where the decay occurs . An examination of T4-killing by 125I decay reveals a two-phase survival curve, whose initial slope corresponds to a lethal efficency per 125I decay of 0-95 +/- 0-05, which is considerably higher than values previously determined . The results for phage T4, and of a more limited comparison of 125I suicide and DNA damage in phage T1, support the hypothesis that the vacancy cascades which accompany each 125I decay in DNA result in a double-strand break at the decay site and that each such break is a lethal event. Int J Radiat Biol Relat Stud Phys Chem Med, 1975 Jun, 27(6), 543 - 52 Energy requirements for damaging DNA molecules . III . The mechanisms of inactivation of bacteriophage chiX 174 DNA by vacuum ultra-violet radiation; Sontag W et al.; Strand break formation and biological inactivation of infectious DNA of bacteriophage phi chi 174 exposed to vacuum-ultra-violet radiation of 4-9 to 21-2 eV quantum energy is investigated . At 21-2 eV as many as 84 per cent of the DNA molecules are inactivated by breaks whereas breaks do not contribute to inactivation at 4-9 eV . The quantum yield of break formation increases from 1-7 X 10(-5) (4-9 EV) to 0-55 (21-2 eV) and shows a dependence on energy similar to that of electron emission (due to ionization) above 8 eV . The mechanisms leading to break formation and inactivation are discussed taking the absorption spectrum of DNA in the vacuum-ultra-violet region into consideration. Nucleic Acids Res, 1975 Jun, 2(6), 839 - 52 Determination of the sequences of 18 nucleotides from the 5'-end of the 1-strand and 15 nucleotides from the 5'-end of the r-strand of T7 DNA; Loewen PC; The sequences of 18 nucleotides from the 5'-end of the 1-strand and 15 nucleotides from the 5'-end of the r-strand of T7 bacteriophage DNA have been determined to be pT-C-T-C-A-C-A-G-T-G-T-A-C-G-T-C-C-C (1-strand) and pA-G-G-G-A-C-A-C-A-G-C-G-C-T-C (r-strand) . The 5'-termini of whole DNA or separated strands were kinased using polynucleotide kinase and (gamma-32-P) rATP . The DNA was partially digested with pancreatic DNase and the fragments were separated by two dimensional electrophoresis and homochromatography . To complete the sequence, snake venom phosphodiesterase digestions of these fragments were carried out . The relationship of these sequences to the proposed cleavage of concatemeric DNA during DNA replication is discussed. J Virol, 1975 Jun, 15(6), 1511 - 3 Effect of DNA-negative and maturation-defective conditions on accumulation of functional messengers for T4 bacteriophage-specific dihydrofolate reductase and deoxynucleoside monophosphate kinase; Witmer H; Messengers for T4 phage-specific deoxynucleoside monophosphate kinase overaccumulated in nonpermissive hosts infected with amber-defective viruses that displayed either the DNA-negative or maturation-defective phenotype . Under both conditions, however, transcription of functional messengers for dihydrofolate reductase followed essentially normal kinetics. Eur J Biochem, 1975 May 6, 53(2), 343 - 8 Structure and synthesis of a lipid-containing bacteriophage . The molecular weight and other physical properties of bacterophage PM2; Camerini-Otero RD et al.; Several physical and chemical parameters of bacteriophage PM2 have been measured . The sedimentation constant was determined to be s-20,w=293 S . The buoyant density in sucrose at 20 degrees C was 1.24 g cm+-3 and in CsCl at 25 degrees C was 1.29 g cm-3 . The high-speed equilibrium centrifugation method of Yphantis (1964) was used to measure the molecular weight of PM2 . The necessary auxiliary parameters were also determined . A value of 0.771 plus or minus 0.005 cm-3 g-1 for the apparent specific volume at constant chemical potential in 1 M sodiium chloride has been obtained by pycnometry; the viral concentration was determined using the absorption coefficient at 260 nm (4.60 plus or minus 0.10 cm-2 mg-1), which in turn was calculated from the phosphorous content of the virus (17.89 plus or minus 0.28 mu-g of P per mg dry weight dry weight of virus) . The molecular weight of PM2 determined with these parameters is (44.1 plus or minus 1.2 x 10-6) . From the phosphorous content of the virus, the percentage of phosphorous known to be in its DNA (Camerini-Otero and Franklin, 1972), and the molecular weight of the bacteriophage, we have calculated a molecular weight for PM2 DNA of 6.26 x 10-6, which confirms values determined using empirical relationships. Biochemistry, 1975 May 6, 14(9), 1951 - 5 New method for isolation and sequence determination of 5'-terminal regions of bacteriophage phiX174 in vitro mRNAs; Grohmann K/Smith LH et al.; We have determined the nucleotide sequences of the 5'-terminal oligonucleotides, produced by RNase T1 digestion of bacteriophage phiX174 mRNAs synthesized in vitro . The major sequences are: pppCpGp(Ap), pppApUpCpGp(Cp), pppAp(Ap)2UpCp(Up)2Gp(Gp), and pppAp(Ap)3UpCp(Up)2Gp(Gp) . The sequences of several minor 5'-terminal oligonucleotides were also determined . For this research we have devised a simple isolation procedure, for the 5'-terminal oligonucleotides, based upon hydroxylapatite chromatography and two-dimensional thin-layer separation . This method allows for the rapid and quantitative recovery of all oligonucleotides containing 5'-triphosphate end groups and should be generally useful for sequence on 5' termini of mRNAs. Eur J Biochem, 1975 May 6, 53(2), 371 - 85 Structure and function of the genome of coliphage T5 . Transcription in vitro of the "nicked" and "nick-free" T5+ DNA; Knopf K et al.; Purified T5+ DNA in nicked form and after repair of the specific single-strand interruptions with DNA ligase was used in transcription studies using Escherichia coli RNA polymerase (holoenzyme) in the presence and absence of E . coli termination protein rho . The transcriptional products were analyzed with respect to their size distribution and the sequences transcribed from the different templates . The results indicate that the single-strand breaks in the DNA of bacteriophage T5, though in genetically defined positions, do not have any specific effect on transcription in vitro . Furthermore, the E . coli rho protein, although it depresses net RNA synthesis and reduces the average molecular weight of the transcripts, seems to act in a non-specific way in this system. Mol Biol (Mosk), 1975 May-Jun, 9(3), 370 - 7 {Infectivity of different forms of lambda bacteriophage DNA in transfection of calcinated Escherichia coli}; Drabkina LE et al.; Infectivity of linear lambdaDNA molecules is proved to be about a hundred times higher in calcinated E . coli K12 (lambai434) than in E . coli K12(lambda-): the levels of transfection were 1-3-10(7) and 1-2-10(5) infective centers per 1 mug DNA, respectively . In E . coli JC 5743 rec B21 defective for exonucleases I and V the level of transfection was 1-3-10(6) . High infectivity of linear lambdaDNA in lysogenic cells cannot be explained by a helping effect of phage particles spontaneously liberated by these cells . It can be caused by recombinations of inserted lambdaDNA molecules with prophage or by the low activity of some nucleases in the lysogenic cells . Covalently closed and "Hershey" ring forms of lambdaDNA penetrate the calcinated cells as readily as linear molecules do but the infectivity of the former ones is proved to be very low. Mol Biol (Mosk), 1975 May-Jun, 9(3), 361 - 9 {Defective bacteriophage MS2 particles containing specific RNA FRAGMENTS}; Renkhof RF et al.; Two types of MS2 particle are revealed when phage lysates are banded in CsCl density gradient . The lower band contain normal phage particles with a density of 1.46 g/cm3 . The upper band with a density of 1.44 g/cm3 containes uninfective incomplete MS2 particles . Both phage types reveal no abnormalities in the content of the coat protein and A-protein . They are nearly identical in RNA content . RNA in the normal buoyant density phage particles is native . RNA in the defective particles consists of three specific fragments with molecular weights 6.5-10(5), 5.5-10(5) and 4.4-10(5) and molar ratios 5:4:9 respectively . THE 5'-TERMINAL ANALYSIS OF RNA from defective MS2 particles reveals the presence of native pppGp . THE 3'-TERMINAL ANALYSIS OF THE INDIVIDUAL RNA fragments reveals the presence of adenosine only in the shortest fragment . RNA fragmentation in defective particles can be explained by the action of intracellular RNAses on the unprotected regions on RNA chain in structurally incomplete virions. Mol Biol (Mosk), 1975 May-Jun, 9(3), 361 - 9 {Defective bacteriophage MS2 particles containing specific RNA FRAGMENTS}; Renkhof RF et al.; Two types of MS2 particle are revealed when phage lysates are banded in CsCl density gradient . The lower band contain normal phage particles with a density of 1.46 g/cm3 . The upper band with a density of 1.44 g/cm3 containes uninfective incomplete MS2 particles . Both phage types reveal no abnormalities in the content of the coat protein and A-protein . They are nearly identical in RNA content . RNA in the normal buoyant density phage particles is native . RNA in the defective particles consists of three specific fragments with molecular weights 6.5-10(5), 5.5-10(5) and 4.4-10(5) and molar ratios 5:4:9 respectively . THE 5'-TERMINAL ANALYSIS OF RNA from defective MS2 particles reveals the presence of native pppGp . THE 3'-TERMINAL ANALYSIS OF THE INDIVIDUAL RNA fragments reveals the presence of adenosine only in the shortest fragment . RNA fragmentation in defective particles can be explained by the action of intracellular RNAses on the unprotected regions on RNA chain in structurally incomplete virions. J Med Microbiol, 1975 May, 8(2), 215 - 23 The nature and incidence of lysogeny in Mycobacterium fortuitum; Grange JM et al.; Ten of 28 strain of Mycobacterium fortuitum (ranae) were found to be associated with bacteriophage; three were pseudolysogenic, one liberated a phage that lysed a sensitive indicator strain, two liberated morphologically complete phages that did not lyse any of the strains used in this study and four liberated morphologically defective phages . The lysogenic and defectively lysogenic strains showed anomalies in cultural, biochemical and antigenic properties and in susceptibility to superinfecting phages . In view of the high frequency of lysogeny found in M . fortuitum, the role of bacteriophage in the variation of properties, including pathogenicity, of mycobacteria of greater clinical importance merits further consideration. Am J Dig Dis, 1975 May, 20(5), 430 - 6 The immune response to phi chi 174 in man . II . Primary and secondary antibody production in patients with Crohn's disease; Bucknall RC et al.; 10 patients with Crohn's disease in various states of activity have been injected with 3.3 times 10-9 plaque-forming units of the bacteriophage phi chi 174, as a test for their capacity to produce antibodies . 9 patients had a completely normal primary and secondary antibody response . One patient had higher levels of preimmunization antibodies than have been encountered in normal subjects and developed a secondary (IgG) response to the first dose of antigen . We conclude that there is no evidence of a general disturbance of antibody-producing capacity in subjects with Crohn's disease. Proc Natl Acad Sci U S A, 1975 May, 72(5), 1973 - 6 Proposed mechanism of bacteriophage lambda induction: acquisition of binding sites for lambda repressor by DNA of the host; Sussman R et al.; Interference with the in vitro binding of lambda phage repressor to lambda operator DNA was observed when Escherichia coli DNA containing the following lesions was present in the reaction mixture: (a) DNA with single-strand breaks from pancreatic DNase (nicked DNA); (B) DNA isolated from thymine-straved cells; (c) DNA from ultraviolet-treated cells; (d) DNA of mitomycin-treated cells; and (e) DNA from a temperature-sensitive ligase mutant after 1 hr at 42 degrees . Normal E . coli DNA did not interfere . Binding of lambda cIing-minus repressor to operator DNA was not affected by E . coli DNA with lesions . DNAs from cells treated with increasing doses of mitomycin were proportionately more effective in competition for repressor, suggesting increasing binding sites per unit of DNA . A general model of virus induction is proposed, based on binding affinity of ultraviolet-sensitive repressors for single-strand breaks in the host DNA . The model is extended also to the presumptive repressor of cell division. Proc Natl Acad Sci U S A, 1975 May, 72(5), 1817 - 21 Determination of genes, restriction sites, and DNA sequences surrounding the 6S RNA template of bacteriophage lambda; Sklar J et al.; A major product of the transcription of bacteriophage lambda DNA in vitro is the 6S RNA . This article presents a detailed mapping of restriction endonuclease cleavage sites about the region of the 6S RNA template within the lambda genome . Restriction fragments defined by these sites have been used to localize the 6S RNA template within the physical and genetic maps of the lambda genome . Nucleotide sequence analysis of one of these fragments has largely confimed the nucleotide sequence of the 6S RNA reported previously and has indicated the sequence of DNA that immediately follows the 6S RNA template . This article reports the nucleotide sequence following a known site of transcription termination by RNA polymerase of Escherichia coli. Eur J Biochem, 1975 May, 54(1), 229 - 37 Purification and characterization of a new factor which restores protein synthesis in a conditionally lethal mutant of Escherichia coli; van der Meer JP et al.; The mutant Escherichia coli strain, N4316, has a temperature-sensitive defect in a protein factor required for translation in vitro of bacteriophage f2 RNA . We have purified the normal counterpart of this factor from a wild-type strain, using as an assay its ability to restore the activity of mutant extracts at non-permissive temperature . Our final preparation is free of known initiation, propagation, and release factors, proving that the factor is a new component required for translation . The new factor has a molecular weight of 95000 with preliminary data suggesting a subunit structure . 70% of this protein is found in the soluble-cell fraction, the rest being associated with 70-S ribosomes . Kinetic analyses indicate that the factor acts early in translation . Expression of the defect is highly dependent on the Mg2+ concentration, no temperature-sensitivity being apparent at 15 mM Mg2+ . At lower Mg2+ concentrations, the defect is expressed only with natural mRNAs such as f2 RNA, and not with artifical polymers such as poly(U) . This specificity suggests that the factor may function in events coded by special sequences in the natural messengers J Virol, 1975 May, 15(5), 1176 - 81 Synthesis of viral and rRNA in bacteriophage R17 infection of a stringent strain of Escherichia coli; Fukuma I; A previous paper (1973) indicated that infection with bacteriophage R17 permits the synthesis of RNA and spermidine in Escherichia coli (CP78 in the absence of the exogenous essential amino acid, arginine . We have now isolated RNA formed under such conditions and analyzed the newly synthesized species by agarose-acrylamide electrophoresis . It has been shown that infection of the stringent cells in the absence of exogenous arginine resulted in a marked incorporation of uracil into rRNA, as well as into R17 RNA . It was shown that, although the organism was nonauxotrophic for uracil, addition of {-14C}uracil resulted in the rapid formation of TUP, the specific radioactivity of which approached that of the exogenous uracil . This indicated that the incorporation of exogenous uracil into rRNA in R17 infection of the stringent strain reflected a true stimulated synthesis of this nucleic acid . Infection of the essentially isogenic relaxed strain, CP79, under the same conditions inhibited the RNA synthesis to a much less extent than the inhibition caused during the normal infection . These observations provide another example of the close correlation between synthesis of spermidine and of host RNA, even in cells infected by an RNA bacteriophage. J Virol, 1975 May, 15(5), 1141 - 7 Phospholipase activity in bacteriophage-infected Escherichia . II . Activation of phospholipase by T4 ghost infection; Buller CS; The release of free fatty acids from the phospholipids of Escherichia coli is initiated immediately after the attachment of T4 ghosts . A similar accumulation of free fatty acids is observed if the cells are infected with T4 phage in the presence of chloramphenicol or puromycin . An early accumulation of free fatty acids, however, is not observed in T4 infections in which chloramphenicol or puromycin are not present, nor does it occur if the E . coli are infected with T4 phage before ghost infection, suggesting that phage products can prevent the phospholipid deacylation . If E . coli is infected with T4 ghosts before T4 phage infection, the accumulation of free fatty acids is not suppressed . When phospholipase-deficient E, coli are infected with T4 ghosts the appearance of free fatty acids is not observed, suggesting that T4 ghost attachment can activate the phospholipase of wild-type E . coli . Although the formation of free fatty acid apparently is a consequence of activation of the detergent-resistant phospholipase of the outer membrane, it is not observed in mutants deficient in the detergent-sensitive phospholipase. J Bacteriol, 1975 May, 122(2), 776 - 81 Occurrence of insertion sequence (IS) regions on plasmid deoxyribonucleic acid as direct and inverted nucleotide sequence duplications; Ptashne K et al.; Insertion sequence (IS) regions have been identified previously as a cause of strongly polar mutations in Escherichia coli and several bacteriophages . The present experiments indicate that genetically characterized IS regions occur on bacterial plasmid deoxyribonucleic acid (DNA) as both direct and inverted DNA sequence duplications . The DNA insertion which has been shown previously (Sharp et al., 1973) to control expression of tetracycline resistance in the R6-5 plasmid, and which occurs as directly and inversely repeated DNA sequences adjacent to the region believed to contain the tetracycline resistance gene, has been identified as IS3 . A second genetically characterized insertion sequence (IS1) has been identified as a direct DNA duplication occurring at both junctions of the resistance transfer factor and R-determinant components of R6-5 and related plasmids . A model is presented for the reversible dissociation of resistance transfer factor and R-determinant components of co-integrate R plasmids at the sites of DNA sequence homology provided by the repeated IS regions. J Bacteriol, 1975 May, 122(2), 727 - 42 Isolation and characterization of lambda transducing bacteriophages for argF, argI and adjacent genes; Kikuchi A et al.; Two genes for ornithinetranscarbamylase exist in strain Escherichia coli K-12, argI, at 85 min, and argF, at 7 min . In an attempt to compare the deoxyribonucleic acid material of these two genes, the lambda transducing phages carrying a portion of the argI region, lambda dvalS argI, lambda pvalS, and lambda dvalS pyrB, and of the argF region, lambda dargF, have been isolated . Their structure, including that of phi 80dargF previously isolated, was studied by the method of heteroduplex mapping . In this paper, the results of this mapping are reported. Int J Radiat Biol Relat Stud Phys Chem Med, 1975 May, 27(5), 437 - 46 Comparsion of the oxygen-enhancement ratio for gamma-ray-induced double-strand breaks in the DNA of bacteriophage T7 as determined by two different methods of analysis; van der Schans GP et al.; Bacteriophage T7 was irradiated in a protecting medium under nitrogen and oxygen with 60Co gamma-rays . Double-strand breaks were measured by sucrose-gradient sedimentation and by boundary-sedimentation analysis . Both methods showed that the presence of oxygen during irradiation enhanced the production of double-strand breaks . This is at variance with a recent report which suggests that boundary-sedimentation analysis does not show an effect of oxygen . The discrepancy must be ascribed to differences in interpretation of the sedimentation data. Int J Radiat Biol Relat Stud Phys Chem Med, 1975 May, 27(5), 425 - 35 Mechanisms of protection of gamma-irradiated bacteriophage lambda by proflavine; Maenhaut-Michel G; The protective effect of proflavine on gamma-irradiated bacteriophage lambda and its isolated DNA was investigated under conditions of predominantly indirect or direct effects . In both conditions addition of small amounts of the dye during irradiation of phage or DNA was shown to enhance their biological activity . Protection against indirect effects results probably from extensive scavenging of radioinduced water radicals within the medium . On the other hand the results obtained at minus 196 degrees C, with irradiated DNA-proflavine complexes, imply the existence of a long-range transfer of the primary radiation damage of DNA towards the intercalated molecules of proflavine . A mechanism for the protective effect of proflavine against the direct effect of ionizing radiation on biologically active DNA is suggested. Mol Biol (Mosk), 1975 May-Jun, 9(3), 370 - 7 {Infectivity of different forms of lambda bacteriophage DNA in transfection of calcinated Escherichia coli}; Drabkina LE et al.; Infectivity of linear lambdaDNA molecules is proved to be about a hundred times higher in calcinated E . coli K12 (lambai434) than in E . coli K12(lambda-): the levels of transfection were 1-3-10(7) and 1-2-10(5) infective centers per 1 mug DNA, respectively . In E . coli JC 5743 rec B21 defective for exonucleases I and V the level of transfection was 1-3-10(6) . High infectivity of linear lambdaDNA in lysogenic cells cannot be explained by a helping effect of phage particles spontaneously liberated by these cells . It can be caused by recombinations of inserted lambdaDNA molecules with prophage or by the low activity of some nucleases in the lysogenic cells . Covalently closed and "Hershey" ring forms of lambdaDNA penetrate the calcinated cells as readily as linear molecules do but the infectivity of the former ones is proved to be very low. Mutat Res, 1975 May, 28(2), 257 - 75 Involvement of separate pathways in the repair of mutational and lethal lesions induced by a monofunctional sulfur mustard; Gilbert RM et al.; The mutagenic and lethal effects of a monofunctional sulfur mustard, 2-chloro-ethylethylsulfide (CEES), have been studied in a number of repair deficient variants of Escherichia coli K12, B/r and B . The results indicate that CEES induces a (pre)mutational lesion which is subject to Uvr+-excision-repair . Extensive CEES-induced mutagenesis can occur in exrA- uvrA- and recA- uvrB- variants suggesting that the majority of the mutations in Uvr-bacteria do not arise from error-prone repair . These findings are similar to results previously reported with a volatile degradation product of captan and with ethyl methanesulfonate (EMS) but differ from those reported with methyl methanesulfonate (MMS) . It is hypothesized that CEES alkylates guanine at the O-6 position (R-O-6-G) and that this R-O-6-G which is Uvr+-excisable is directly mutagenic by producing G-C to A-T transitions during replication . Reduced levels of induced mutation frequencies observed in an endonuclease II-deficient variant lead us to postulate that, in constrast to Uvr- bacteria, CEES-induced mutation in wild-type cells arise from error-prone repair of apurinic sites . Analysis of the lethal actions of CEES indicates that the lesion produced is largely unexcisable by the Uvr+ system . Host-cell reactivation of CEES-treated TI bacteriophage shows that the production of the (pre)ethal lesion is dependent on both the initial dose and post-treatment incubation . The efficient repair of the (pre)ethal lesion requires both endonuclease II and polymerase I . Moreover, deficiencies of these two enzymes rendered bacteria more sensitive to the cytotoxic action of CEES . It is postulated that the lethal mechanism of CEES involves: (I) alkylation at the N-3 position of adenine and the N-7 position of guanine; (2) spontaneous depurination of these alkylated bases; and (3) production of apurinic sites which are lethal unless repaired by the endonuclease II-polymerase I excision-repair system. J Bacteriol, 1975 May, 122(2), 510 - 7 Regulation of galactose operon at the gal operator-promoter region in Escherichia coli K-12; Hua SS et al.; The capR (lon) product controls expression of the gal operon independently of the galR repressor . Previously, mutations of the gal operon have been isolated that are semiconstitutive and alter response to the capR and/or capT product . Such mutants imply the existence of a distinct site in the operon that responds to capR (capT) control . This mutation could be either in a site near the operator-distal end of the galE gene, which signals rho factor termination of transcription in vitro or in a site in the operator-promoter region . Bacteriophage U3 was used to isolate galE mutations in HC2142 (a mutant exhibiting reduced response to capR control) . P1 transduction was used to cross these mutants with a set of galE gene deletion . Analysis of the resulting Gal+ recombinants indicates that the regulatory site is in the operator-promoter region . Hence, it is unlikely that capR functions in control as an anti-rho factor at the operator-distal end of the galE gene, but more likely as previously suggested, at a second operator distinct from one responding to galR repressor control . Upon induction with D-fucose, a promoter mutant (UV211) isolated previously expressed 20 to 30% of the galactose enzymes that the wild type exhibited in the presence of the inducer D-fucose . The effects of various mutations in cya, capR, and galR on galactokinase synthesis in this mutant were determined . Galactokinase was derepressed by capR as well as galR, but the presence or absence of the cya gene product was unimportant. Cancer Res, 1975 May, 35(5), 1175 - 81 The covalent binding of daunomycin and adriamycin to antibodies, with retention of both drug and antibody activities; Hurwitz E et al.; Daunomycin and adriamycin, two potent cancer chemotherapeutic agents, were linked to immunoglobulins, making use of various covalent cross-linking methods . The most suitable method for binding of the drugs to the antibodies, which retained both antibody and drug activity, was periodate oxidation of the drug, followed by the linking of the oxidized drug to the immunoglobulin and subsequent reduction of the product with sodium borohydride . The activity of the drug-antibody conjugates was tested in vitro on tumor and normal cell cultures and was found to be similar to that of the free drug . A significant amount of antibody activity was retained, as found both with anti-bovine serum albumin antibodies, assayed by chemically modified bacteriophage, and with anti-mouse tumor antibodies, assayed by C'-dependent cytotoxicity. Z Immunitatsforsch Exp Klin Immunol, 1975 May, 148(5), 431 - 50 {Studies on the in vitro formation of antibodies . III . Induction of primary and secondary immune response in vitro}; Schiek W; Peritoneal cells from normal, unimmunized mice (female NMRI, 28-32 gr) produced in vitro primary and secondary immune response after induction with the bacteriophage T2 6 hours or 7 day resp . after establishing the cultures . We confirmed the induction of a primary and secondary immunological response in vitro in the very same culture by the following data: 1 . In vivo the donor animals were not in contact with the antigen used . We found neither the phage nor its host E . coli B in the gut of 97 mice investigated and no humoral antibodies against T2 . The kinetics of humoral antibody production in vivo by different doses of T2 also showed that there are no related or identical antigen structures incorporated in our animals . 2 . The T2 neutralizing activity in the culture medium after the first induction had the sedimentation constant of 19.7 +/- 2.3 S (n = 9) but the activity found after the second induction sedimented with 8.1 +/- 0.7 S (n = 10) . 3 . The primary activity was more sensitive to mercaptoethanol than the secondary . 4 . Complement was bound by the complex T2 + neutralizing activity. Biochim Biophys Acta, 1975 Apr 29, 386(2), 369 - 72 Molecular weight of base plates of bacteriophage T4D; Sultanova RA et al.; Highly purified base plates of bacteriophage T4D were obtained from lysate of gene 19 am mutant of this phage by differential centrifugation and sucrose gradient . Base plates were studied by means of high speed sedimentation equilibrium . The molecular weight determined by this method is (6.7 plus or minus 0.2)-10-6. J Biol Chem, 1975 Apr 25, 250(8), 3050 - 6 Ribonucleic acid processing activity of Escherichia coli ribonuclease III; Robertson HD et al.; We have studied the nuclease activities present in preparations of Escherichia coli RNase III and the "sizing factor" responsible for specific processing of several RNA species . RNase III preparations contain three activities: one which solubilizes stable RNA:RNA duplexes; one which solubilizes the RNA of DNA:RNA hybrids; and one which processes the polycistronic mRNA of bacteriophage T7 in a manner identical with sizing factor . We show that the activity against the RNA of DNA:RNA hybrids can be removed, but that the activity which cleaves RNA:RNA duplexes and that responsible for specific processing of phage T7 polycistronic mRNA appear to be identical by several biochemical criteria . In addition, partially purified enzyme fractions from mutants lacking these two activities contain substantial amounts of activity against the RNA of DNA:RNA hybrids . We have also defined several properties of the two activities solubilize RNA:RNA duplexes and RNA of DNA:RNA hybrids . Average oligonucleotide chain length in an exhaustive digest of double-stranded RNA is about 15 bases, while that in a digest of the RNA in DNA:RNA hybrids is less than 10 bases . Direct analysis shows that both activities cleave RNA chains to yield 5'-phosphate and 3'-hydroxyl termini . All four bases can reside at the 5' end of the resulting oligonucleotides, although both activities show a mild preference for certain bases . These results and previous findings allow us to specify the probably size and structure of potential cleavage sites for these enzymes in biological RNA molecules. J Biol Chem, 1975 Apr 25, 250(8), 2866 - 71 Transcription of bacteriophage deoxyribonucleic acid . Comparison of Escherichia coli and Azotobacter vinelandii sigma subunits; Domingo E et al.; The effect of the sigma subunit of RNA polymerase on the rate and asymmetry of the in vitro transcription of Escherichia coli and Azotobacter vinelandii phage DNAs has been studied with purified E . coli and A . vinelandii RNA polymerases and hybrid enzymes containing the core subunits of one enzyme and sigma from the other . The effect of sigma on the rate of transcription is characteristic of the template and not of the enzyme and depends on ionic strength . The rate of transcription of A . vinelandii phage A21 DNA is decreased by sigma at high ionic strength, but shows the more characteristic stimulation at KCl concentrations below 0.05 M . In contrast, the stimulation by sigma of T4 DNA transcription increased with an increase in the KCl concentrations . All combinations of core and sigma subunits behaved similarly with respect to stimulation or inhibition by sigma and with respect to asymmetric transcription of S13 replicative form (RF)DNA . However, the heterologous, but not the homologous combinations of core and sigma transcribed A21 symmetrically . S13 RF DNA in the superhelical, but not in the relaxed configuration, is transcribed asymmetrically by the A . vinelandii core enzyme . A role for the core subunits in specific site recognition is indicated by this observation. J Biol Chem, 1975 Apr 25, 250(8), 2823 - 9 The ultraviolet endonuclease of bacteriophage T4 . Further characterization; Minton K et al.; The T4 ultraviolet endonuclease was previously shown to produce strand incisions (nicks) in ultraviolet-irradiated DNA on the 5' side of thymine dimers . The present studies demonstrate that the purified endonuclease creates 3'-OH and 5'-P termini at the sites of nicking . Photoreactivation of ultraviolet-sensitive sites, thereby demonstrating directly endonucleause has a molecular weight of approximately 18,000 and attacks ultraviolet-irradiated single-stranded Escherichia coli and M-13 DNA. Biochemistry, 1975 Apr 8, 14(7), 1426 - 32 The effect of modification of T7 DNA by the carcinogen N-1-acetylaminofluorene: termination of transcription in vitro; Millette RL et al.; To study the effects of N-2-acetylaminofluorene (AAF) modification of DNA on transcription, purified DNA from bacteriophage T7 was modified in vitro to varying extent with AAF and transcribed by DNA-dependent RNA polymerase from Escherichia coli . The main effects of AAF modification on transcription are a marked inhibition of the rate and extent of trna synthesis with relatively little effect on initiation except at very high AAF doses . Calibration of the percent modification with {14-C}AAF and analysis of the size of the RNA product by double isotope labeling and polyacrylamide gel electrophoresis support the following mechanism of transcription inhibition: most of the AAF residues bound to the coding strand of the DNA cause premature termination of transcription, at or near the site of modification, with release of RNA polymerase . This results in the production of shorter RNA chains with increasing amounts of bound carcinogen . The data are consistent with there being no reinitiation and/or synthesis of RNA distal to the AAF-modification site. Biochemistry, 1975 Apr 8, 14(7), 1471 - 6 Characterization of a ribonuclease from bovine brain; Elson M et al.; An alkaline ribonuclease (pH optimum near 8) has been purified from whole beef brains and found to have a base specificity like that of bovine pancreatic ribonuclease, but in most other respects to be distinguishable from the enzymes of bovine pancreas, semen, or brain nuclei . The preparation appears homogeneous in sedimentation equilibrium and probably so in polyacrylamide gel electrophoresis under normal or dissociating conditions . Sedimentation equilibrium and SDS gel electrophoresis both indicate a molecular weight of 2.4-2.6 times 10-4, and tryptic and chymotrypic peptide patterns are consistent with a protein of this size . No dissociation into subunits has been attained . The enzyme is not precipitated by antiserum to pancreatic ribonuclease, although its activity is inhibited by this antiserum with low efficiency . In comparisons of the hydrolysis of RNA the brain enzyme was found to have a similar specificity to pancreatic RNase, but to have a loser Km for RNA and to produce significantly different oligonucleotides upon partial hydrolysis of bacteriophage RNA, suggesting differences in the mechanism of substrate recognition . In contrast, nuclease inactivation by iodoacetate at pH 5.5 is indistinguishable for pancreatic or purified brain RNase. J Virol, 1975 Apr, 15(4), 739 - 43 Characterization of the inhomogeneous DNA in virions of bacteriophage Mu by DNA reannealing kinetics; Daniell E et al.; The DNA of bacteriophage Mu has been studied to characterize a region of inhomogeneous sequence that occurs at one end of the molecule . The kinetics of reassocation of tracer amounts of labeled host DNA in the presence of Mu DNA show that Mu DNA contains a complete selection of host sequences . These host sequences are shown to be covalently attached to phage-specific sequences and are present at a concentration that accounts for the inhomogeneity observed in the electron microscope . The significance and possible function of the host DNA attachment is discussed. J Virol, 1975 Apr, 15(4), 1024 - 8 Novel rII duplications in bacteriophage T4; Rothman FG et al.; The properties of two rII complementation heterozygotes (D5B and D7A) of bacteriophage T4 are described . These strains are characterized by their stability, each forming less than 10-3 r segregants among their viable progeny, and by their segregation of only one of the two parental types . No increase in r progeny was found on crossing D7A or D5B with T4r+, indicating that the duplications in these strains are not separated by an essential region of the phage genome . Both D5B and D7A from h-2+/h-4+ heterozygotes at frequencies similar to T4r+, suggesting that the duplicated regions in these strains are short . The progeny of these h-2+/h-4+ heterozygotes retain heterozygosity for rII but not for h: therefore, D5B and D7A are not stabilized terminal redundancy complementation heterozygotes . We conclude that D5B and D7A contain very short tandem duplications and we present structures consistent with the observed characteristics of these phages. Proc Natl Acad Sci U S A, 1975 Apr, 72(4), 1491 - 5 Three steps in conversion of large precursor RNA into serine and proline transfer RNAs; Seidman JG et al.; Bacteriophage T4 serine and proline transfer RNAs are derived from a common precursor RNA . This precusor RNA lacks -C-C-A sequences which could provide 3' termini for the mature transfer RNAs . We have deduced part of the pathway leading to the formation of the C-C-A sequences in the transfer RNAs by characterizing incompletely matured precursor molecules which accumulate during infection of mutant hosts that lack specific enzymes associated with transfer RNA metabolism . Maturation is initiated by the addition of -C-C-AOH to the 3' terminus of the precusor RNA through the combined actionof an unidentified nuclease and tRNA nucleotidyltransferase (EC 2.7.7.25) . Precursor RNA molecules terminating in -C-C-AOH is serine transfer RNA and the second product is immature proline transfer RNA . The terminal steps leading to proline transfer RNA have not been fully delineated, but are known to involve the replacement of a -C-UOH sequence by -C-C-AOH. J Bacteriol, 1975 Apr, 122(1), 206 - 14 Maltose chemoreceptor of Escherichia coli; Hazelbauer GL; Strains carrying mutations in the maltose system of Escherichia coli were assayed for maltose taxis, maltose uptake at 1 and 10 muM maltose, and maltose-binding activity released by osmotic shock . An earlier conclusion that the metabolism of maltose is not necessary for chemoreception is extended to include the functioning of maltodextrin phosphorylase, the product of malP, and the genetic control of the maltose receptor by the product of malT is confirmed . Mutants in malF and malK are defective in maltose transport at low concentrations as well as high concentrations, as previously shown, but are essentially normal in maltose taxis . The product of malE has been previously shown to be the maltose-binding protein and was implicated in maltose transport . Most malE mutants are defective in maltose taxis, and all those tested are defective in maltose transport at low concentrations . Thus, as previously suggested, the maltose-binding protein probably serves as the recognition component of the maltose receptor, as well as a component of the transport system . tsome malE mutants release maltose-binding activity and are tactic toward maltose, although defective in maltose transport, implying that the binding protein has separate sites for interaction with the chemotaxis and transport systems . Some mutations in lamB, whose product is the receptor for the bacteriophage lamba, cause defects in maltose taxis, indicating some involvement of that product in maltose reception. J Bacteriol, 1975 Apr, 122(1), 120 - 8 Isolation and characterization of lambda transducing bacteriophages for the su1+ (supD minus) amber suppressor of Escherichia coli; Steege DA et al.; Specialized lambda transducing phages for the sul+ (supD-) amber suppressor in Escherichia coli K-12 have been isolated, using a secondary site lambda-cI857 lysogen in which we have shown the prophage to be closely linked to sul+.sul+ transducing particles were detected frequently, at 10-5 per plaque-forming unit, in lysates prepared from the secondary-site lysogens . High-frequency transducing lysates were obtained from several independently isolated sul+ transductants and were analyzed by CsCl equilibrium density gradient centrifugation . The transducing phages are defective; marker rescue analysis indicates that the lambda-N gene is not present . In lambda-cI857DELTANdSul+, a bio-type transducing phage, the genes specifying recombination and excision functions have been replaced by bacterial deoxyribonucleic acid. J Virol, 1975 Apr, 15(4), 985 - 93 Escherichia coli capsule bacteriophages . V . Lysozyme 29; Eichholtz H et al.; In addition to the spike-associated host capsule depolymerase, infection by Escherichia coli capsule bacteriophage no . 29 also induces the synthesis of a large bacteriolytic enzyme which has been purified to homogeneity . On incubation of isolated host murein sacculi with this enzyme, no amino groups but reducing sugar groups were liberated, and muraminitol, but no glucosaminitol, was found in the degraded sacculi after subsequent reduction with NaBH4 . The bacteriolytic enzyme is thus another lysozyme (mucopeptide N-acetylmuramylhydrolase; EC 3.2.1.17) . Electron optical visualization of negatively stained lysozyme specimens showed oblong particles of roughly 4.5 to 5.5 nm in diameter and 15 to 19 nm in length . Although the material tended to dissociate, a crude estimate of its molecular weight (270,000 plus or minus 30,000) could be obtained from these dimensions, from its sedimentation equilibrium, and from its behavior in gel chromatography . After disintegration of homogeneous lysozyme 29 by heating in solution with sodium dodecyl sulfate and dithiothreitol, polypeptides of one size only (about 46,000 dalton, probably six copies per molecule) were found in sodium dodecyl sulfate-polyacrylamide electrophoresis . The amino acid analysis of the enzyme accounted for more than 90% of its dry weight . One percent or less of the bacteriolytic activity in phage 29 lysates was found to be associated with the intact or disrupted virus particles, and a polypeptide of 46,000 daltons was not detected in the virions . These results strongly suggest that, in contrast to the host capsule depolymerase also induced by the same phage, and in spite of its comparatively large size, "lysozyme 29" does not constitute an integral part also of the homologous bacteriophage particles. J Virol, 1975 Apr, 15(4), 976 - 84 Escherichia coli capsule bacteriophages . IV . Free capsule depolymerase 29; Bessler W et al.; The free host capsule depolymerase, induced by Escherichia coli capsule bacteriophage no . 29, and causing the formation of haloes around its plaques, has been purified to homogeneity . As judged from the following facts, this "enzyme" consists of free phage 29 spikes . (i) Detached phage organelles and depolymerase 29 particles exhibit the same molecular weight (about 245,000, as determined from the sedimentation equilibrium), contain polypeptide chains of the same two sizes (57,000 plus or minus 3,000 and 29,500 plus or minus 2,000, as determined by SDS-PAA gel electrophoresis), and have (within experimental error) the same sedimentation coefficient, isoelectric point, and amino acid composition . (ii) Isolated depolymerase and phage spikes in situ both catalyze the hydrolysis of glucosidic bonds in host capsular polysaccharide, leading ultimately to the formation of oligosaccharide fragments of one, two, and three hexasaccharide repeating units . (iii) Depolymerase 29 and phage 29 spikes have roughly the same electron optical dimensions . As tentatively estimated from the total and the virus-associated capsule depolymerase activity in the lysates, phage 29 infection seems to produce eight to seventeen times more free than incorporated spikes. J Virol, 1975 Apr, 15(4), 964 - 75 Escherichia coli capsule bacteriophages . III . Fragments of bacteriophage 29; Rieger D et al.; A glycanase activity, catalyzing the depolymerization of host capsular polysaccharide, is associated with Escherichia coli capsule bacteriophage no . 29, a small virus with an isometric head, carrying a base plate with a set of spikes . The bacteriophage particles were disrupted by mild acid treatment (5 to 8 min at pH 3.5 and 37 C), and the enzymatically active fragments were isolated and subjected to sodium dodecyl sulfate-gel electrophoresis as well as to electron microscopy . Of the at least nine different polypeptide chains found in the complete virion, three (of 57,000 plus or minus 3,000, 29,500 plus or minus 2,000 and 13,500 plus or minus 1,000 daltons) were detected in detached base plates . They had the appearance of six-pointed stars of about 14 nm in outer diameter, with a central hole or prop, carrying six (or, possibly, a multiple thereof) spikes . Two sizes of polypeptide chains (57,000 and 29,500) were found in pure spikes, cylindrical particles of about 14.5 to 15 nm in length and 5 nm in diameter, and one (57,000) in -- still capsule depolymerizing -- spike subunits of roughly 5 nm in diameter . Phage 29 spike preparations, homogeneous in analytical ultracentrifugation and immunoelectrophoresis, were found to have a molecular weight of 245,000, as determined from the sedimentation equilibrium, and to contain equimolar amounts of the two polypeptides, probably three copies of each per organelle . The amino acid analysis of the isolated spikes revealed that aspartic acid, alanine, serine, and glycine are their dominant constituents; no amino sugars or other carbohydrates were detected in the preparations. J Virol, 1975 Apr, 15(4), 929 - 45 Characterization of new regulatory mutants of bacteriophage T4 . II . New class of mutants; Chace KV et al.; New mutants of bacteriophage T4 that overproduce the enzyme dihydrofolate reductase were investigated . Unlike previously described overproducers of this enzyme (Johnson and Hall, 1974), these mutants did not overproduce deoxycytidylate deaminase . Overproduction of dihydrofolate reductase by the new mutants occurred because enzymatic activity continued to increase for a longer period of time in cells infected by the mutants than in cells infected by wild-type phage . This continued increase occurred even in the presence of rifampin, indicating that the overproduction is probably due to a post-transcriptional event . Both these new overproducers and the previously described overproducers were studied by using polyacrylamide gel electrophoresis . The two types of overproducers appeared to be very different . The previously described overproducers showed a delay and/or reduction in the synthesis of several proteins that normally started to be made 4 to 6 min after infection . Several proteins could be seen to be overproduced on the gels . The new overproducers did not show the delay in the synthesis of some proteins and only overproduced a few proteins . The new gene defined by the new overproducers is between the gene coding for thymidine kinase and the gene coding for lysozyme. J Virol, 1975 Apr, 15(4), 855 - 60 Isolation of mutants of bacteriophage T4 unable to induce thymidine kinase activity . II . Location of the structural gene for thymidine kinase; Chace KV et al.; Amber mutants of bacteriophage T4 have been isolated that induce thymidine kinase activity only after infection of a strain of Escherichia coli carrying a suppressor mutation . The activity induced when one of these mutants infected this suppressor strain is much more heat sensitive than the activity induced by wild-type T4 . This indicates that this amber mutation lies within the structural gene for thymidine kinase . This gene is between fI and v on the standard T4 genetic map . A mutant of tt4 that is unable to induce thymidine kinase activity incorporates only about one-eighth as much thymidine into its DNA as phage that do induce thymidine kinase . This contrasts to the findings that the total thymidine kinase activity in extracts prepared from cells infected with phage able to induce thymidine kinase in only twice as great as the activity in cells infected with the mutant unable to induce the enzyme. J Virol, 1975 Apr, 15(4), 776 - 84 Bacteriophage-host interaction and restriction of nonglucosylated T6; Hewlett MJ et al.; Nonglucosylated T6 phage (T6gtam 16am30, hereafter called T6alpha gt-) were found to have two structural anomalies when compared with wild-type T6 . The DNA of T6alpha gt- phage contains single-strand interruptions . These can be seen both during infection, in the pool of replicating DNA, and in DNA extracted from purified phage . In addition, the sodium dodecyl sulfate-polyacrylamide gel pattern of T6alpha gt- phage structural proteins reveals a protein band not found in T6 . The altered protein has a mobility slightly faster than that of the major head protein, and it is not removed by osmotic shock . The restriction activity of Escherichia coli B directed against T6alpha gt- phage is abolished by preinfection of the cells for 4 min with T4 im m2 . The shut-off of restriction is observed either by the rescue of superinfecting T6alpha gt- or by the failure to detect degradation of incoming T6alpha gt- DNA . This effect is resistant to rifampin and chloramphenicol. J Virol, 1975 Apr, 15(4), 1042 - 6 Purification and properties of a bacteriophage T5-modified form of Escherichia coli RNA polymerase; Szabo C et al.; A modified form of Escherichia coli RNA polymerase that contains one of the three T5-specific polypeptides known to interact with the host enzyme was purified from bacteriophage T5-infected cells . The properties of this T5-modified enzyme appeared identical to those of the RNA polymerase derived from uninfected non-colicinogenic cells and to a fully active enzyme isolated from T5-infected ColIb+ cells after the limited in vivo transcription of T5 genes allowed by the plasmid had ceased. Int J Radiat Biol Relat Stud Phys Chem Med, 1975 Apr, 27(4), 313 - 23 Photoreactivation of bacteriophage phi chi 174; Mennigmann HD; U.V.-irradiated single-stranded DNA-bacteriophage phi chi 174 shows a photoreactivable sector of 0-17 . That this sector is relatively small compared with those for the double-stranded DNA-phages T2 and T6 (about 0-5) does not necessarily seem to be due to the pyrimidine dimers in single-stranded DNA being intrinsically a poorer substrate for the photoreactivating enzyme . This follows from the observation that intracellularly irradiated single-stranded phi chi 174 DNA also shows a photoreactivable sector of 0-4 to 0-5 . The same value is obtained for intracellularly irradiated double-stranded phi chi 174 DNA . Photoreactivation of intracellularly irradiated single-stranded phi chi 174 DNA is not constant with U.V . dose for the lower dose ranged . Possible explanations for this are discussed. Proc Natl Acad Sci U S A, 1975 Apr, 72(4), 1226 - 30 Genetic evidence for an additional function of phage T4 gene 32 protein: interaction with ligase; Mosig G et al.; Gene 32 of bacteriophage T4 is essential for DNA replication, recombination, and repair . In an attempt to clarify the role of the corresponding gene product, we have looked for mutations that specifically inactivate one but not all of its functions and for compensating suppressor mutations in other genes . Here we describe a gene 32 ts mutant that does not produce progeny, but in contrast to an am mutant investigated by others, is capable of some primary and secondary DNA replication and of forming "joint" recombinational intermediates after infection of Escherichia coli B at the restrictive temperature . However, parental and progeny DNA strands are not ligated to covalently linked "recombinant" molecules, and single strands of vegetative DNA do not exceed unit length . Progeny production as well as capacity for covalent linkage in this gene 32 ts mutant are partially restored by additional rII mutations . Suppression by rII depends on functioning host ligase {EC 6.5.1.2; poly(deoxyribonucleotide):poly(deoxyribonucleotide) ligase (AMP-forming, NMN-forming)} . This gene 32 ts mutation (unlike some others) in turn suppresses the characteristic plaque morphology of rII mutants . We conclude that gene 32 protein, in addition to its role in DNA replication and in the formation of "joint" recombinational intermediates, interacts with T4 ligase {EC 6.5.1.1; poly(deoxyribonucleotide):poly(deoxyribonucleotide) ligase (AMP-forming)} when recombining DNA strands are covalently linked . The protein of the mutant that we describe here is mainly defective in this interaction, thus inactivating T4 ligase in recombination . Suppressing rII mutations facilitate substitution of host ligase . There is suggestive evidence that these interactions occur at the membrane. Am Rev Respir Dis, 1975 Apr, 111(4), 459 - 68 World Health Organization studies on bacteriophage typing of mycobacteria . Subdivision of the species Mycobacterium tuberculosis; Rado TA et al.; The ability of lytic mycobacteriophages to subdivide the species Mycobacterium tuberculosis reliably has been studied using a series of 100 strains isolated from cases of tuberculosis in the Netherlands . Techniques for the propagation and application of the viruses have been standardized, as have the conditions for growth and preparation of bacterial strains . On the basis of lytic results with 11 mycobacteriophages, it is proposed that the species Mycobacterium tuverculosis may be subdivided into at least 3 major phage types, A, B, and C, and into 2 subjects, Ax and A2 . The reliability of the individual bacteriophage lytic result has been assessed, and the relationship between phage reliability and the degree of certainty with which a strain may be assigned to a phage type is described . The effect of rigorous standardization of techniques on the reliability of bacteriphage typing is demonstrated, and a standard protocol is proposed. J Bacteriol, 1975 Apr, 122(1), 295 - 301 Intergration of the receptor for bacteriophage lambda in the outer membrane of Escherichia coli: coupling with cell division; Ryter A et al.; Induction of the synthesis of the receptor for phage lambda is obtained by adding maltose and adenosine 3'-5'-cyclic monophosphate to glucose grown cells of Escherichia coli . Bacteria induced for a short period of time were infected with a high multiplicity of phage lambda , and examined under the electron microscope . Only a fraction of the bacteria were seen to have adsorbed a large number of phage particles . The majority of such bacteria had a constriction indicating formation of a septum, and, in this case, the density of adsorbed particles was highest in the vicinity of the constriction . When found on bacteria showing no sign of septum formation, the adsorbed particles were asymmetrically distributed, one pole of the bacteria being more heavily covered with phage particles than the other . Such asymetrically covered bacteria are believed to have originated from cells which divided during the induction period . The results suggest that the receptor for phage lambda, a protein of the outer membrane, is integrated in the cell envelope during the last quarter of each generation and that the integration process is initiated in the vicinity of the forming septum. J Virol, 1975 Apr, 15(4), 861 - 71 Transfection of Escherichia coli spheroplasts . V . Activity of recBC nuclease in rec+ and rec minus spheroplasts measured with different forms of bacteriophage DNA; Benzinger R et al.; The in vivo activity of the recBC nuclease was assayed by transfection of isogenic rec+ and rec minus spheroplasts with bacteriophage DNA of various origin and structure . The results indicate that the recBC nuclease can limit transfection at several stages during the production of an infective center; such limitations depend primarily on whether the DNA is in, or assumes, a nuclease-sensitive structure . The first stage of limitation can occur when a nuclease-sensitive transfecting molecule enters the spheroplast . Other potential limitation points occur during replication and maturation of the bacteriophage DNA . The initial stage can be bypassed by using recBC nuclease-resistant molecules such as circular forms . Through analysis of results with other DNA structures, we found that in vivo the effects of the double-strand exonucleolytic activity of the recBC nuclease predominated . The effects of the single-strand nuclease activities seem to be modified from those observed for the purified enzyme in vitro (Karu et al., 1974) . Inside the cell, the single-strand exonuclease activity is very weak and the single-strand endonuclease activity is abolished almost completely. Biochemistry, 1975 Mar 25, 14(6), 1265 - 71 Transcription of bacteriophage T4 genome in vitro . Heterogeneity of RNA polymerase in crude extracts of normal and T4-infected Escherichia coli B; Pitale MP et al.; In order to obtain RNA polymerase preparations carrying the necessary specificity determinants to transcribe the delayed-early genes of bacteriophage T4, crude extracts of uninfected and T4-infected Escherichia coli were fractionated in glycerol gradients of low ionic strength . In contrast to the reported sedimentation behavior of the purified enzyme, the RNA polymerase activity in crude extracts of normal and infected cells sedimented heterogeneously over a wide range of sedimentation coefficients . When the "heavy" (24-33 S) and "light" (14-20 S) regions of the gradient were precipitated with ammonium sulfate and recentrifuged, the former split into two subfractions, one again sedimenting heavy and the other sedimenting light . The latter did not split under the same conditions . The resulting subfractions from uninfected cell extracts had different thermal thermal stabilities at 50 degrees (half-lives ranging from 2-3 to 25 min) while those from T4-infected cell extracts were very thermolabile (half-life of 1-2 min) . All the subfractions were more active on T4 DNA than on calf-thymus DNA . They also formed rifampicin-resistant, RNA chain initiation complexes with T4 DNA . Based on the kinetics of heat inactivation with T4 and calf thymus DNAs as templates and preferential transcription of T4 DNA, it is proposed that the T4-infected cell enzymes prepared as described here harbor heat-labile initiation factor(s) . During infection the heavy sedimenting RNA polymerase activity disappears after 2.5 min at 37 degrees . This appears to require phage-specific protein synthesis because (a) it does not happen in the presence of chloramphenicol and (b) it does not happen in T4 ghost-infected cells. J Biol Chem, 1975 Mar 25, 250(6), 2395 - 7 Cleavage of Nonglucosylated Bacteriophage T4 deoxyribonucleic acid by Restriction Endonuclease Eco RI; Kaplan DA et al.; DNAs lacking the glucosyl modification (Glc-) and additionally lacking the 6-methylaminopurine (N6-methyladenine) modification (Glc-, MeAde-) were prepared from appropriate T4 mutants . These DNAs were cleaved by the purified restriction endonuclease Eco TI from Escherichia coli . Normally modified DNA (Glc+, MeAde+) was not attached . The Eco RII and the hemophilus enzymes Hin dII and Hin dIII do not attack Glc-, MeAde- T DNA, possibly due to the presence of 6-hydroxymethylcytosine . Eco RI produces approximately 40 specific fragments from Glc- DNA ranging in molecular weights from 0.3 to 10.5 X 10-6. J Mol Evol, 1975 Mar 24, 4(4), 323 - 46 Doublet frequencies in sequenced nucleic acids; Elton RA; A doublet frequency count (set of frequencies of the 16 possible two-base sequences) can be calculated from the experimentally determined overall sequence of a nucleic acid . In this paper, a statistical methodology is developed for comparing such counts with random, with others of the same type or with doublet proportions found in whole DNAs . The methods are applied to two major categories of sequenced RNAs . It is found that vertebrate ribosomal and transfer RNAs show significant differences from the overall vertebrate DNA pattern, especially in the frequency of the doublet CG . Bacterial rRNA and tRNA, on the other hand, show less dissimilarity from total DNA . In the RNA of the small bacteriophage MS2, the doublet frequencies of the translated regions of the genome resemble those in the host E . coli, whereas those in the intercistronic regions differ substantially . All these findings are discussed in relation to the origin, evolution and selection of the nucleic acids concerned. Biochemistry, 1975 Mar 11, 14(5), 907 - 17 Chemical modifications of functional residues of fd gene 5 DNA-binding protein; Anderson RA et al.; The binding of gene 5 protein from bacteriophage fd to poly{d(A-T)}, fdDNA, and poly(A) is accompanied by a dramatic reversal in the signs of the large ellipticity bands of the nucleic acid chromophores from 250 to 290 nm . The change in the circular dichroism of the DNA induced by the protein, which reaches a maximum at a protein to nucleotide molar ratio of 1:4, has been used as an assay of the alterations in binding of gene 5 protein to DNA accompanying changes in the ionic environment and subsequent to chemical modification of the protein . Divalent cations completely dissociate the gene 5 protein-fd DNA complex at 0.1 M, while 0.5 M monovalent cations are required . All cations are more effective in dissociating the complex with poly{d(A-T)} commensurate with the accompanying stabilization of the double helix to which gene 5 protein does not bind . Acetylation of all six lysyl residues and three of the five tyrosyl residues of the protein with N-acetylimidazole prevents complex formation . Removal of the three tyrosyl O-acetyl groups with hydroxylamine does not restore the binding of gene 5 protein to DNA . Tetranitromethane nitrates the same three tyrosyl residues (Tyr-26, Tyr-41, and Tyr-56 as determined by peptide mapping) and reduces the binding affinity of the protein for fd DNA by similar to 100-fold . The 19F NMR spectrum of gene 5 protein labeled with m-fluorotyrosine shows three surface and two buried fluorotyrosyl residues . All tyrosyl residues are protected from nitration in the complex with fd DNA, but acetylimidazole acetylates surface lysyl residues in the complex and dissociates it . The intrinsic circular dichroism of the acetylated and nitrated gene 5 proteins is not significantly altered . In contrast maleic anhydride reacts with the seven amino groups of the protein and changes the secondary structure to one similar to that present in 6 M guanidine-HCl . The single SH group of the native protein does not react with Ellman's reagent, but it reacts rapidly with one Hg2+ ion which unfolds the protein; fd DNA prevents reaction with Hg2+ . Electrostatic forces may be as important as hydrogen bonding in maintaining the native structure of this protein . The lysyl groups of the protein, exposed in both the free protein and the DNA complex, appear to be of prime importance in DNA binding, probably through electrostatic interactions with the DNA binding, probably through electrostatic interactions with the DNA phosphate groups . Three tyrosyl residues also contribute to binding affinity through hydrogen bonding or intercalation . A model of gene 5 protein structure in relation to interactions with a tetranucleotide is presented. Biochemistry, 1975 Mar 11, 14(5), 989 - 97 The regulation of transcription in bacteriophage T5-infected Escherichia coli; Szabo C et al.; The expression of bacteriophage T5-specific RNA and protein in infected cells is temporally separated into three classes: class I (preearly), class II (early), and class III (late) . By immunoprecipitation techniques we have shown that T5 infection of cells leads to the synthesis of one class I polypeptide (11,000 daltons) and two class II polypeptides (90,000 and 15,000 daltons) capable of binding to the RNA polymerase of the host Escherichia coli cell . One of the class II polypeptides (90,000 daltons) is the product of gene C2, which is an essential gene product required for the initiation of class III RNA synthesis . The colicinogenic factor, ColIb, is a plasmid which prevents the normal synthesis of class II and the III bacteriophage T5-specific RNA in infected colicinogenic (ColIb+) cells . In T5-infected colicinogenic cells, only the T5 class I polypeptide is found associated with the RNA polymerase . Mutants of T5, designated T5h minus, are capable of growth on both noncolicinogenic and ColIb+ hosts . Extracts of T5h minus infected ColIb+ cells were shown to lack a small class I polypeptide (12,000 daltons) as compared to T5-infected cells . The h minus mutation, however, has no effect on the levels of the class I T5 polypeptide of similar molecular weight which is bound to the RNA polymerase . One effect of the h minus mutation is to enhance the quantities of the two class II polypeptides bound to the enzyme. Eur J Biochem, 1975 Mar 3, 52(1), 17 - 23 tRNA nucleotidyltransferase-catalyzed incorporation of CMP and AMP into RNA-bacteriophage genome fragments; Prochiantz A et al.; Fragments of bacteriophage RNAs R17, MS2 and Qbeta obtained by incubation with commercial snake venom phosphodiesterase become substrates of the Escherichia coli tRNA nucleotidyltransferase . The transferase adds back CMP and AMP in conditions in which it remains highly specific of CCA-deprived tRNAs . The results suggest that the fragment from the 3' end of the viral genome and/or possibly one or more internal fragment(s) are recognized by the transferase . These observations might indicate that bacteriophage RNAs contain certain features probably present in all tRNAs and which are recognized by the transferase. Eur J Immunol, 1975 Mar, 5(3), 216 - 8 Inactivation of hapten-modified bacteriophage by antibody: increased sensitivity of the assay in media containing polyethylene glycol; Franek F et al.; Inactivation of dinitrophenylated bacteriophage T4 by porcine and rabbit anti-dinitrophenyl (DNP) antibodies was studied by the complex inactivation methods . The inactivation titers increased 20-30 times when polyethylene glycol, mol . wt . 6000, was added to the incubation media . Consequently, the detection of dinitrophenylated serum albumin with the modified bacteriophage could be carried out with higher sensitivity upon addition of polyethylene glycol. Mol Biol (Mosk), 1975 Mar-Apr, 9(2), 179 - 89 {Biological activity of different forms of bacteriophage lambda DNA}; Fodor I et al.; Hershey circles and linear tandem aggregated forms of DNA have been obtained in vitro and treated with polynucleotide ligase to form phosphodiester bond . Using zone centrifugation in glycerol gradient covalently closed circles and linear dimers have been purified and their biological activity investigated . It was found that closed circular molecules lost most, if not all, of their activity in CaCl2-dependent system . In order to investigate the biological activity of tandem dimer molecules, hybrid dimers consisting of DNA's from lambda C1857 and lambda 1434 have been obtained . In plaque assay with the appropriate non-permissive strains of E . coli the efficiency of infectivity of hybrid dimers was measured . Biological activity of dimer molecules sealed with ligase was about 5% of the activity of linear monomers . Ig has been suggested that tandem dimers of lambda DNA joined by phosphodiester bond are able to penetrate into the CaCl2-treated host cells and both components of dimers are active during subsequent multiplication. Biokhimiia, 1975 Mar-Apr, 40(2), 411 - 5 {Distribution of pyrimidine sequences of different length and base composition in bacteriophage T5 DNA}; Karagbozov LK; Distribution of pyrimidine tracts of different length (isopliths) with general formula PynPn+1 in bacteriophage T5 DNA was studied . The first seven isoplith fractions were subfractionated by the chain length and the quantity of the resulting non-isomeric oligonucleotides was determined . The pattern of distribution of pyrimidine tracts of various length and base composition in bacteriophage T5 DNA is different from that previously observed in the DNAs of bacteriophages T3 and T7 . The observed differences in distribution of pyrimidine nucleotides are in accordance with the other peculiarities of bacteriophage T5 genome. Biull Eksp Biol Med, 1975 Mar, 79(3), 70 - 3 {Restitution of the immune response by macrophages following administration of immunodepressants to mice}; Freidlin IS et al.; A study was made of the restitution by peritoneal macrophages of the primary immune response in the organism of C3H mice immunized with bacteriophage T2 after the depressive effects of actinomycin D, olivomycin, rifamycin, chloroquin, chloramphenicol, of the histone F2a fraction and LPS . The cell transfer technique was used for studying the capacity of macrophages from normal mice to restitute the antibody synthesis in mice given immunosuppressive drugs . In cell transfer experiments the recipients immunosuppressed by drugs were capable of initiating a normal primary response to bacteriophage T2 when given macrophages from normal donors . The data obtained with the drug-treated recipients supported the concept that the antigen processing by the macrophage was necessary for initiating a primary type immune respones; they also demonstrated the selective susceptibility of macrophages to the immunosuppressive drugs. J Virol, 1975 Mar, 15(3), 509 - 14 Template activity of complexes formed between bacteriophage f2 RNA and coat protein; Zagorska L et al.; Formation of complexes between f2 RNA polymerase cistron was partially inhibited, some RNA and coat protein was studied using salt conditions which are optimum for phage protein synthesis . In this ionic environment, coat protein precipitation can be prevented by sulfhydryl group-protecting agents . Complexes formed at different protein-RNA input molar ratios were isolated and tested for template activity in an in vitro protein synthesizing system . Simultaneously, the number of protein molecules bound per RNA strand in such complexes was measured by the membrane (Millipore) filtration technique . Under conditions in which translation of the RNA strands were complexed with six molecules of coat protein, whereas some remained unbound . Strong inhibition of the translation of the RNA polymerase cistron was observed when each of the RNA strands present in the mixture was associated with six molecules of coat protein. J Microsc, 1975 Mar, 103(2), 249 - 57 High resolution scanning electron microscopy at the subcellular level; Lin S et al.; Recently developed scanning electron microscopes provide sufficient resolution to allow useful observation of subcellular biological objects . Preparation methods for such objects need not be limited to the traditional coating and mounting procedures . Many methods developed for transmission electron microscopy are immediately adaptable to scanning electron microscopy . We show that a number of techniques are available to the microscopist which yield adequate contrast and high resolution . As examples we show skeletal muscle myofibrils dispersed to reveal thick filaments, uncoated on a thin carbon film; a tropomyosin tactoid, negatively stained with uranyl acetate; oncornavirus, conventionally coated; and T4 bacteriophage on an aluminium substrate. Proc Natl Acad Sci U S A, 1975 Mar, 72(3), 809 - 13 Fusion of the Escherichia coli lac genes to the ara promoter: a general technique using bacteriophage Mu-1 insertions; Casadaban MJ; The lac genes were fused to the ara promoter by means of phage phi 80 translocations of the lac and ara genes to att80 . Homology for a crossover between the nonhomologous ara and lac operons was provided by mu insertions . Selection for recombinants within the mu insertions generated strains that had the ara promoter on one side of a mu insertion and the lac genes on the other side . ara-lac fusions were obtained from these strains by deleting the mu insertion . These fusions extend the techniques available for studies on the lac operon to studies on the ara operon . It should be possible to fuse other operons by this method. Nucleic Acids Res, 1975 Mar, 02(3), 361 - 71 Photo-incuced cross-linkage of gene-5 protein and bacteriophage fd DNA+; Anderson E et al.; The gene 5 protein, coded for by the bacteriophage fd, forms a complex with single stranded fd-DNA such that one gene 5 protein monomer interacts with four bases . Exposure of this complex to ultraviolet light results in the formation of covalent bonds between 25-30% of the gene 5 protein monomers which are bound to the DNA . In contrast, when the intact fd virion, which is a complex of coat protein and DNA, was exposed to ultraviolet irradiation, no detectable protein DNA cross-links were found. Cell, 1975 Mar, 4(3), 249 - 53 Replicating circular DNA molecules in yeast; Petes TD et al.; The yeast Saccharomyces cerevisiae contains a class of small circular DNA molecules, approximately 2 mum in contour length (Sinclair et al., 1967) . In this report, it is shown that these molecules replicate as double-branched circles, similar to those observed during replication of the bacteriophage lambda and Escherichia coli chromosomes . A normal rate of replication of these DNA circles requires the function of a nuclear gene, cdc 8. J Bacteriol, 1975 Mar, 121(3), 983 - 93 Bacteriophage resistance in Escherichia coli K-12: general pattern of resistance; Hancock RE et al.; Resistant mutants were isolated to 42 virulent bacteriophages in one strain of Escherichia coli K-12 and tested for resistance or sensitivity to a set of 56 bacteriophages . Most of the mutants fell into 11 groups with respect to their resistance patterns . It was possible to classify the bacteriophages broadly, according to the variety of mutants that were resistant to them. J Virol, 1975 Mar, 15(3), 497 - 508 In Vitro system for the study of bacteriophage phi chi 174 adsorption and eclipse; Neuwald PD; An in vitro system was developed for the study of the initial stages of bacteriophage phi chi 174 infection . Escherichia coli C cells were incubated with 20% sucrose and then subjected to cold osmotic shock in 5 mM MgSO4 . The concentrated supernatant shock fluid inactivated phi chi 174 with the same kinetics and requirements as for normal infection . Shock fluids prepared from phi chi 174-resistant strains of E . coli did not show this effect . The 114S phage were initially converted into 70S particles, the process termed "eclipse" . These structurally altered phages then attached to a component of the shock fluid, producing fast-sedimenting complexes, and eventually released at least a part of their DNA into the medium . The fast-sedimenting complex could be radioactively labeled with oleic acid . Radioactivity was found to co-chromatograph with both biological activity and the majority of the high-molecular-weight carbohydrates present in the shock fluid . It is concluded that E . coli C osmotic shock fluid contains isolated phi chi 174-specific receptor sites composed of lipopolysaccharides . This system conveniently separates the early stages of phage phi chi 174 infection from the intracellular events. Proc Natl Acad Sci U S A, 1975 Mar, 72(3), 804 - 8 Repression and autogenous stimulation in vitro by bacteriophage lambda repressor; Dottin RP et al.; Purified lambda repressor protein is shown to reduce the lambda DNA-directed synthesis of proteins in vitro as determined both by net amino-acid incorporation and by analysis of specific lambda-coded proteins resolved by sodium dodecyl sulfate/polyacrylamide slab gel electrophoresis . By means of different lambda DNA templates carrying deletion and point mutations in the operators o-L or o-R, it has been possible to demonstrate repression of the synthesis of two classes of lambda proteins . The synthesis of one, class c, appears to be controlled from the operator o-L and is more efficiently repressed at low concentrations of the repressor than that of the other class of repressible lambda proteins, class d, which is controlled from the operator o-R . Several other proteins synthesized in vitro are not repressible . Some of these are coded by the J-att region . In addition, the repressor appears to have another activity, that of stimulating the synthesis of a protein identified as the repressor itself . Lambda repressor appears to stimulate its own synthesis by acting at prm, a site defined by the cis-acting mutation prm 116. Proc Natl Acad Sci U S A, 1975 Mar, 72(3), 1184 - 8 Nucleotide sequence of the rightward operator of phage lambda; Maniatis T et al.; The sequence of 72 base pairs of the rightward operator (O-R) of bacteriophage lambda is presented as determined with simple and rapid methods for direct DNA sequencing . The sequence of an operator mutant is also described . The methods are of general use in sequencing DNA fragments with unique 5' ends up to 50 base pairs in length . Previous experiments have shown that this operator contains multiple sites recognized by the lambda phage repressor . We believe we have identified three of these sites. Proc Natl Acad Sci U S A, 1975 Mar, 72(3), 1072 - 6 Integrative recombination of bacteriophage lambda DNA in vitro; Nash HA; An in vitro system for the production of integrative recombinant DNA of bacteriophage lambda is described . The in vitro recombination mimics the in vivo integration of viral DNA into host DNA in its requirement for int gene product, for the presence of a thermolabile component, and for the limitation of the recombination to a pair of specialized sites (attachment sites) on the DNA . The enzymes are extracted from Escherichia coli containing phage lambda gene products . The substrate is the DNA from lambda-attB-attP, a phage variant that contains two attachment sites on the same chromosome . The product is a recombinant phage chromosome that has lost the DNA between the attachment sites . The parental and recombinant DNA are distinguished following transfection to mature phage in spheroplasts . The reaction requires ATP, Mg++, spermidine, and a monovalent cation . Recombination occurs preferentially between attachment sites on the same molecule . The enzymatic activity is completely inhibited by extracts containing xis gene product. J Biol Chem, 1975 Feb 25, 250(4), 1460 - 3 Characterization of ribonuclease NU cleavage sites in a bacteriophage phi80-induced ribonucleic acid; Bothwell AL et al.; Ribonuclease NU, an endoribonuclease isolated from human KB tissue culture cells, can cleave a bacteriophage phi80-induced RNA at four distinct sites . Nucleotide sequence analysis of the eight cleavage products has shown that the enzyme produces oligonucleotides terminating in 3'-phosphate groups, and that the four cleavage sites are in the only nonhydrogen-bonded region of the substrate . Various aspects of the cleavage reaction with this RNA and with other substrates are discussed. J Biol Chem, 1975 Feb 10, 250(3), 934 - 8 Initiation and transcription of a set of transfer ribonucleic acid genes in vitro; Kaplan DA et al.; Using RNA polymerase purified from Escherichia coli, DNA isolated from the bacteriophage T4, and a bacterial supernatant fraction containing the necessary processing enzymes, a set of transfer RNAs can be formed in vitro . To characterize the site or sites of initiation of this tRNA transcription, rifampicin-resistant complexes of RNA polymerase, DNA, and either ATP (UTP and CTP) or GTP (UTP and CTP) were formed, and tRNA was transcribed from these stabilized sites . It is concluded that transcription of the entire set is initiated by ATP . To study the transcription of the tRNAs, the time sequence of the appearance of individual species was determined during synchronous transcription of a preformed RNA polymerase-DNA complex . The appearance of three RNA species is found to be consistent with the sequential transcription of a large polycistronic cluster; the order and distances, inferred from the times of transcription, are as required by the existing gene map . It is concluded that the initiation of tRNA transcription can occur, without accessory factors, with the insertion of ATP at a single or a few closely spaced sites, and that the tRNAs encoded by the bacteriophage T4 are present in a single operon. Nature, 1975 Feb 6, 253(5491), 410 - 4 The nucleotide sequence of an RNA polymerase binding site on bacteriophage fd DNA; Sugimoto K et al.; The nucleotide sequence of the RNA polymerase binding site at a promotor on fd RF DNA has been determined in comparison with the starting sequence of RNA initiated at this promoter . The RNA polymerase binding site contained the startpoint of transcription in the centre and a region with twofold symmetry in the non-transcribed part. Nucleic Acids Res, 1975 Feb, 2(2), 143 - 8 Detection by electron microscopy of photo-induced denaturation in lambda DNA; Stafford RS et al.; We have used an electron microscope to study localized denatured regions in ultraviolet-irradiated DNA . DNA from bacteriophage lambda was UV-irradiated and then prepared for electron microscopy after fixing in buffered (pH 9.5) formaldehyde solutions at 25 degrees C . The denatured regions observed corresponded to those described by Inman and Schnos (1) who used alkaline denaturation to preferentially destroy thymine-adenine base pairing . In UV-irradiated DNA, pairs of neighboring thymine residues are converted into photodimers; hence, loss of hydrogen bonding most likely occurs in thymine-rich regions and denaturation results . Conceivably, photo-induced denaturation may under some circumstances represent a more convenient method than alkaline denaturation for mapping thymine-rich regions in DNA. J Immunol, 1975 Feb, 114(2 pt 2), 863 - 71 Anti-dinitrophenyl antibody production in strain 13 guinea pigs fed or sensitized with dinitrochlorobenzene; Reese RT et al.; Guinea pigs fed dinitrochlorobenzene (DNCB) in corn oil become unresponsive tosensitization by later percutaneous applications of DNCB in olive oil . Sera taken from animals after feeding DNCB or after feeding and intradermal stimulation with DNCB contained no antibody detectable with 2,4-dinitrophenyl (DNP)-labeled T4 bacteriophage; if any antibody was present, its concentration was below 2 mu g/ml . Guinea pigs fed DNCB and then immunized with DNP on a foreign carrier, keyhole limpet hemocyanin (KLH), produced as much antibody 16 to 18 days later as did animals which had only been sensitized by intradermal injection of DNCB in phosphate-buffered saline and then immunized with DNP-KLH . The amount of antibody produced to DNP-KLH WAS MEASURED AT INTERVALS . In the fed animals, the titer either remained approximately the same or increased with time . In contrast, the sera of sensitized guinea pigs contained a decreasing antibody titer when the first and last bleedings were compared . Isoelectric focusing was carried out with sera from DNP-KLH-immunized animals after the sera were first mixed with a radiolabeled hapten . The antibody-hapten profiles revealed that the DNCB-fed animalss contained predominatly IgG2 in their serum by the time of their initial bleedings, whereas sensitized animals still contained a considerable proportion of more acidic antibodies having marked charge heterogeneity . Equilibrium dialysis measurements onpurified antibody from fed animals indicated an average binding affinity for hapten equivalent to that of purified antibody from sensitized animals . Feeding of DNCB did not cause any obvious decrease in the number of lymphoid cells able to bind 125I-labeled guinea pig IgG . Lack of reduction of the average binding affinity coupled with the retention of antigen-binding lymphoid cells, permit the conclusion that feeding DNCB to guinea pigs under the conditions used did not induce an unresponsiveness or a deletion of those cells which have the potential to produce anti-DNP antibody . Thus, feeding of guinea pigs with DNCB in oil seems to induce a central tolerance at the T cell level with adversely affecting their B lymphocytes . The antibody response obtained by immunization with DNP conjugated to a foreign carrier is not only quantitatively equivalent to that obtained in control animals but qualitatively it appeared to be more mature with respect to charge at a relatively early time (16 to 18 days.Since the antibody levels in serum from fed animals increased or remained approximately constant with time instead of waning as occurred in the DNCB-sensitized animals, feeding or sensitization with DNCB may also have affected some cell or cell product important in the regulation of antibody production. Genetics, 1975 Feb, 79(2), 143 - 74 Recombination-deficient deletions in bacteriophage lambda and their interaction with chi mutations; Henderson D et al.; We have isolated a new class of deletion mutants of phage lambda that extend from the prophage attachment site, att, into the gam and cIII genes . In this respect they are similar to certain of the lambda pbio transducing phage, but they differ in having a low burst size and in forming minute plaques . Lytically grown stocks of the deletions contain a variable proportion of phage that produce large plaques . These have been shown to carry an additional point mutation . Similar mutations, called chi, have been described by Lam et al . (1974), who showed that they result in a hot-spot for recombination produced by the host recombination system (Rec) . We show that chi mutations can occurat several sites in the lambda genome and produce a Rec-dependent increase in the burst size of the one deletion tested.---In addition to reducing burst size, the one deletion tested reduces synthesis of DNA and emdolysin but increases production of serum blocking protein . A chi mutation partially restores DNA synthesis and endolysin production and reduces serum blocking protein to normal levels . Our results are consistent with the hypothesis put forward by Lam et al., that chi enhances the frequency of Rec-promoted recombination, which provides the only pathway for production of maturable DNAin a red gam infection . The mechanism of the differential effect on protein production is, however, unclear.---Chi mutations are found to occur in DNA other than that of lambda . We show that, as has been suggested elsewhere (McMilin, Stahl and Stahy 1974), the lambda pbio transducing phages carry a chi mutation within the E . coli DNA substitution . A chi mutation also arose in a new substitution of unknown origin isolated in the course of this work. J Biochem (Tokyo), 1975 Feb, 77(2), 303 - 11 Biochemical studies on radiation-sensitive mutations in bacteriophage T4-1; Ohshima S et al.; Mutants of bacteriophage T4 which exhibit increased sensitivity to ultraviolet radiation were isolated and their abilities to induce an enzyme system to excise pyrimidine dimers were examined . Among 16 mutants isolated, 12 mutants were found to be defective in inducing T4 endonuclease V, which catalyzes the formation of dimer-specific breaks in ultraviolet-irradiated DNA . A leaky v mutant, which exhibits intermediate ultraviolet sensitivity, was also isolated; the mutant induces a low level of endonuclease V and excises only a small amount of kimers in vitro . Three other mutants, as well as x and y mutants, were able to induce both T4 endonuclease V and dimer-excision enzyme (5'yields 3' exonuclease). Zh Mikrobiol Epidemiol Immunobiol, 1975 Feb, (2), 30 - 2 {Typing properties of bacteriophages isolated from Sh . sonnei strains}; Chanishvili LG et al.; On the basis of studying the lytic activity of eight bacteriophages the authors elaborated a scheme of bacteriophage typing of Sh . sonnei consisting of nine bacteriophage types with two subtypes . In typing 2348 strains isolated in various cities of the USSR bacteriophage pattern of Sh . sonnei was found to differ in different towns of the USSR . All the strains isolated repeatedly from the same patients were referred to the same bacteriophage type, this pointing to the stability of the type-determining properties of bacteriophages . Stability of bacteriophage types, a possibility of typing the strains of the I, II phases and of R-forms, simplicity and distinctness of the scheme of bacteriophage typing determined future prospects in using the type bacteriophages selected at the Tbilisi Institute of Vaccine and Sera for intraspecies differentiation of Sh . sonnei. Proc Natl Acad Sci U S A, 1975 Feb, 72(2), 688 - 92 Mutations simultaneously affecting endonuclease II and exonuclease III in Escherichia coli; Yajko DM et al.; We studied mutants of E . coli originally identified as being deficient in either endonuclease II (deoxyribonucleate oligonucleotidohydrolase, EC 3.1.4.30) or exonuclease III {deoxyribonucleate (double-stranded) 5'-nucleotidohydrolase, EC 3.1.4.27} activity . Twelve independently derived mutants were tested, including three new endonuclease II mutants . Deficiency of one enzyme was always accompanied by deficiency of the other . Furthermore, temperature-sensitivity of one activity was always accompanied by temperature-sensitivity of the other, and the enzymes were co-purified . The results suggested a physical association between exonuclease III and endonuclease II, which may be of advantage in the excision-repair of DNA . A thermolabile endonuclease II was purified from one of the new mutants, indicating that it had an altered structural gene . This mutation, and all similar ones mapped by genetic transduction, was located between the pncA and aroD genes on the E . coli chromosome . One mutant had a prolonged generation time, an increased sensitivity to the alkylating agents methyl-methanesulfonate and mitomycin C, and a decreased plating efficiency for bacteriophage lambda, but no marked sensitivity to ultraviolet or gamma-irradiation . Its enzymatic and biological abnormalities were simultaneously revertible, suggesting they were caused by a single mutation . These results suggested a role for these enzymes in normal cell growth processes and in the repair of alkylation damage. Proc Natl Acad Sci U S A, 1975 Feb, 72(2), 558 - 62 Methionine and formylmethionine specific tRNAs coded by bacteriophage T5; Chen MJ et al.; By RNA-DNA hybridization, as well as chemical and chromatographic analysis, evidence is provided that the bacteriophage T5 codes for the synthesis of two isoacceptor methionine transfer RNA species, tRNA-Met and tRNA-f-Met . Because of the differences in chromatographic properties of T5 phage and host methionine tRNAs, the phage tRNA species are readily distinguishable. J Bacteriol, 1975 Feb, 121(2), 670 - 4 Growth of bacteriophages MS2 and T7 on streptomycin-resistant mutants of Escherichia coli; Chakrabarti S et al.; Streptomycin-resistant mutants of an Hfr strain of Escherichia coli K were examined for their ability to support the growth of male-specific ribonucleic acid phage MS2 and female-specific deoxyribonucleic acid phage T7 . Normally, the Hfr strain allows propagation of MS2 and is lysed by it (efficiency of plating equal to 1), whereas the same strain restricts propagation of T7 and is not lysed by it (efficiency of plating smaller than 10-7) . Twenty-four isolates out of 26 independently obtained streptomycin-resistant mutants are partially or completely derestricted for propagation of T7; efficiency of plating of T7 in such strains ranges from 10-3-1 . Depending on their response to plating of MS2 and T7, the streptomycin-resistant mutants can be divided into four classes . The mutants in all four classes continue to be "male" in conjugation with F- strains . Genetic analysis is presented to show that restriction of MS2, derestriction of T7, and resistance to streptomycin are the pleiotropic effects of a single mutation at the strA locus. J Bacteriol, 1975 Feb, 121(2), 594 - 9 Genetic and phenotypic characterization of dnaC mutations; Wechsler JA; The dna-1, dna-2, dna-7, and dna-28 mutations, all of which are located near min 89.5 on the E . coli linkage map, have been characterized further . As previously demonstrated for dna-2 and dna-28, neither the dna-1 nor dna-7 mutation affects the ability of a strain to produce bacteriophage lambda at temperatures non-permissive for the continued replication of the bacterial chromosome . The reported temperature-sensitive inhibition of lambda production in a strain carrying dna-7 is shown to be a consequence of a thermosensitive host specificity mutation in the hsm gene and not of the dna-7 mutation . The four dna mutations are recessive to the wild type and define a single dnaC cistron according to standard complementation criteria . Unlike other characterized dnaC mutants, however, strains carrying the dnaC1 or dnaC7 alleles exhibit an abrupt cessation of deoxyribonucleic acid synthesis at 42 C that appears to be more compatible with a defect in deoxyribonucleic acid chain elongation rather than in initiation . The possibility that the apparent elongation defect is actually a composite effect of residual synthesis and deoxyribonucleic acid degradation is raised by the net deoxyribonucleic acid degradation observed in the dnaC1 strain at 42 C . Several alternative possibilities for the function of the dnaC gene product are suggested. J Bacteriol, 1975 Feb, 121(2), 475 - 84 Genetic analysis of thymidine-resistant and low-thymine-requiring mutants of Escherichia coli K-12 induced by bacteriophage Mu-1; Buxton RS; Four genes, dra, tpp, drm, and pup, that specify enzymes involved in the catabolism of nucleosides and deoxynucleosides in Escherichia coli are known to be very closely linked in the order dra-tpp-drm-pup . By infecting cells with the phage Mu-1 and isolating low-thymine-requiring derivatives of a strain lacking thymidylate synthetase and also thymidine-resistant mutants of a dra-strain, it has been possible to select for strains in which Mu-1 is inserted in this gene cluster . Making use of the polar effect of Mu-induced mutations on more distal genes in the same transcriptional unit, evidence is presented that dra and tpp are co-transcribed from a promoter to the left of dra, and drm and pup are co-transcribed from a promotor located between tpp and drm . Residual levels of purine nucleoside phosphorylase in drm- mutants induced by phage Mu seem to indicate that a weak promotor lies between drm and pup . From a strain in which Mu-1 is inserted in drm, a mutant has been isolated that has a deletion extending into tpp . Since this strain lacks thymidylate synthetase, it is unable to grow on minimal medium containing thymine . Mutants isolated from this strain that can grow on minimal medium containing thymine have been shown to have increased levels of the enzyme uridine phosphorylase. Proc Natl Acad Sci U S A, 1975 Feb, 72(2), 737 - 41 Nucleotide sequence of an RNA polymerase binding site from the DNA of bacteriophage fd; Schaller H et al.; The primary structure of a strong RNA polymerase binding site in the replicative form DNA of phage fd has been determined by direct DNA sequencing . It is: (see article) . The molecule contains regions with 2-fold symmetry and sequence homologies to promoter regions from other DNAs . The startpoint of transcription is located in the center of the binding site. Proc Natl Acad Sci U S A, 1975 Feb, 72(2), 581 - 5 Isolation of the bacteriophage lambda A-gene protein; Becker A et al.; An in vitro assay for measuring the activity of the phage lambda A-gene product has been developed . The assay is based on the observation that A-donor extracts complement A minus extracts for packaging of exogenous immature lambda DNA into phage particles . A partial purification of the A-gene product activity using this assay is presented . A method is suggested by which this A protein-dependent in vitro system might be manipulated to analyze the mechanism of reforming the lambda cohesive termini during chromosome assimilation into phage precursors. J Bacteriol, 1975 Feb, 121(2), 497 - 503 Evidence for common binding sites for ferrichrome compounds and bacteriophage phi 80 in the cell envelope of Escherichia coli; Wayne R et al.; Mutants ton A and ton B of Escherichia coli K12, known to be resistant to bacteriophage phi80, were found to be insensitive as well to albomycin, an analogue of the specific siderochrome ferrichrome . Ferrichrome at micromolar concentrations strongly inhibited plaque production by phi80 . Preincubation with ferrichrome did not inactivate the phage . At a concentration at which ferrichrome allowed 90% inhibition of plaque formation, the chromium analogue of ferrichrome showed no detectable activity . Similarly, ethylenediaminetetraacetic acid, ferrichrome A, and certain siderochromes structurally distinct from ferrichrome, such as ferrioxamine B, schizokinen, citrate, and enterobactin, did not show detectable inhibitory activity . However, rhodotorulic acid showed moderate activity . A host range mutant of phi80, phi80h, was also inhibited by ferrichrome, as was a hybrid of phage lambda possessing the host range of phi80 . However, phage lambdacI- and a hybrid of phi80 possessing the host range of lambda were not affected by ferrichrome . Finally, ferrichrome and chromic deferriferrichrome were shown to inhibit adsorption of phi80 to sensitive cells, ferrichrome giving 50% inhibition of adsorption at a minimal concentration of 8 nM . It is suggested that a component of the ferrichrome uptake system may reside in the outer membrane of E . coli K12 and may also function as a component of the receptor site for bacteriophage phi80, and that ferrichrome inhibition of the phage represents a competition for this common site. J Virol, 1975 Feb, 15(2), 273 - 80 Early events after infection of Escherichia coli by bacteriophage T5 . Induction of a 5'-nucleotidase activity and excretion of free bases; Warner HR et al.; Thymine-containing compounds, produced degradation of Escherichia coli DNA after infection of the cells with bacteriophage T5, did not accumulate in the cell but were excreted into the medium as the DNA was degraded . The ultimate degradation product was extracellular thymine that was not reutilized when T5 DNA synthesis began . This excretion of thymine may have been due in part to the induction of 5'-nucleotidase activity within 3 min after T5 infection . The level of this activity reached a maximum between 4 to 6 min after infection and then rapidly declined to its preinfection level by 10 to 15 min after infection . Chloramphenicol added before or soon after infection prevented the appearance of the nucleotidase . The induced nucleotidase activity was active not only on dTMP but also on dAMP, dGMP, and dCMP. J Virol, 1975 Feb, 15(2), 238 - 43 Temporal appearance of bacteriophage T4-modified valyl tRNA synthetase in Escherichia coli; Muller UR et al.; Bacteriophage T4-induced modification of Escherichia coli vlayl-tRNA synthetase (EC 6.1.1.9) requires: synthesis of a phage-gene specified tau factor, addition of the factor to host valyl-tRNA synthetase to produce a urea-stable enzyme, and interaction of the modified enzyme with tRNA to produce a more rapidly sedimenting valyl-tRNA synthetase activity on sucrose density gradients . This report demonstrates that the coincident, chloramphenicol-sensitive appearance of urea-stable and rapidly sedimenting valyl-tRNA synthetase activity are immediate early phage functions . It implies that once the tau factor is synthesized, further interactions are stoichiometric rather than catalytic . The potential for valyl-tRNA synthetase modification accumylates when E . coli is infected with T4 PHAGE IN THE PRESENCE OF CHLORAMPHINICOL AND IS EXPRESSED DURING THE RESUMPTION OF PROTEIN SYNTHESIS WHEREAS FURTHER RNA synthesis is inhibited by rifampicin . The modification phenomenon occurs similarly in several strains of E . coli and represents a novel virus-host interaction. J Pediatr, 1975 Feb, 86(2), 207 - 11 Defective antibody response to bacteriophage phichi 174 in Down syndrome; Lopez V et al.; Antibody responses to bacteriophage phichi 174 were studied in 17 institutionalized patients with trisomy 21 and in six mentally retarded control patients with normal karyotype . Primary antibody response was significantly impaired in 11 of the 17 patients . Secondary immune response was normal in one, moderately impaired in seven, and very low in nine patients . Tertiary immunization further differentiated the two groups: those with moderately impaired secondary immune responses developed normal serum titers of predominantly IgG antibody; patients with low secondary immune responses had extemely impaired tertiary immune responses consisting mainly of serum IgM antibody. J Biol Chem, 1975 Jan 25, 250(2), 418 - 25 Sensitive methods for the detection and characterization of double helical ribonucleic acid; Robertson HD et al.; We have evaluated three methods which respond specifically to stable RNA-RNA duplexes and have compared their utility for examining several sorts of nucleic acids . We find that these methods, stepwise chromatography on Whatman CF11-cellulose; digestion with Escherichia coli RNase III; and specific inhibition of globin synthesis in vitro in rabbit reticulocyte lysates, are able to distinguish between stable double-stranded RNA and single-stranded RNA in the expected manner . The most sensitive method, inhibition of globin synthesis, responds to double-stranded RNA concentrations below 0.1 ng per ml . We have used the predominantly single-stranded RNA from several RNA bacteriophages of E . coli to test both the sensitivity and selectivity of these methods . The three viral RNAs tested contain low levels of double-stranded RNA which can be readily removed, leaving RNA which is not recognized as double-stranded RNA, despite indications from physical and sequencing studies that secondary structure is present . In particular, a potential hairpir loop of known sequence has been isolated from phage f2 RNA . Its properties were found to depart significantly from those of RNA-RNA duplexes by those two of our three methods capable of testing RNA of this size . Analysis of two eukaryotic mRNA populations by these methods was complicated by the presence of poly(A) . Synthetic poly(A) chromatographs like double-stranded RNA on cellulose CF11 columns, and we could distinguish it from reovirus double-stranded RNA only at elevated temperatures. Science, 1975 Jan 17, 187(4172), 167 - 9 Troponin and parvalbumin calcium binding regions predicted in myosin light chain and T4 lysozyme; Tufty RM et al.; A computer search of available protein sequences and structures suggests that bacteriophage T4 lysozyme contains one region and that rabbit myosin light chains contain three regions similar, and supposedly homologous, to the calcium binding region of carp muscle calcium binding parvalbumin. Genetika, 1975, 11(11), 52 - 7 {Effect of mutant RNA polymerase on spontaneous mutagenesis in bacteriophage T4}; Iaroslavtseva NG et al.; The frequency of spontaneous reversion in r-mutants of phage T4 is determined in order to study the influence of mutant RNA polymerase on the level of spontaneous mutations in phage T4 . The rate of spontaneous mutagenesis in the phage is found to be increased in strains with mutant RNA polymerase. Mol Biol (Mosk), 1975 Jan-Feb, 9(1), 78 - 85 {The ratio of coat protein to bacteriophage f2 RNA in the translational repressor complex}; Shafranski P et al.; One of the mechanisms underlying the regulation of the bacteriophage f2 RNA translation is the repression of the phage RNA-replicase formation by coat protein . This repression is due to the formation of a complex between f2 RNA and coat protein (complex I) . In this work the mechanism of complex I formation as well as the effect of this complex on the f2 RNA-replicase formation was followed by inhibition of alanine incorporation into RNA-replicase polypeptide which was separated by polyacrylamide gel electrophoresis . The molar ratios of protein to f2 RNA in complex I were analyzed by sucrose gradient sedimentation . It was been found that complex I consists of six molecules of coat protein bound per one molecule of RNA . Ribonuclease digestion of the glutaraldehyde-fixed complex resulted in a mixture of products in which the hexamers of coat protein molecules were predominant . This indicates that the six molecules of coat protein bound to f2 RNA are neighbouring . It has been also shown that under conditions required for phage protein synthesis, coat protein occurs in solution is dimer . The results show that the translational repression of the RNA-replicase cistron is due to the cooperative attachment of three dimers of coat protein to phage template, forming a hexameric cluster on the RNA strand . The proposed mechanism of the complex I formation seems to be in good agreement with the sequence of events in the phage F2 life cycle . It is known that shortly after infection of the host cell the coat protein and phage RNA-replicase begin to be synthesised . According to our findings, the first portions of coat protein do not affect the translation of the RNA-replicase gene since at low concentration the coat protein occure in the form of monomers . At a later period of phage development, when the concentration of coat protein is sufficiently high to promote the formation of protein dimers, the translational repressor complex is formed and the RNA-replicase gene becomes inoperative. Genetika, 1975, 11(7), 128 - 34 {Effect of palladium and platinum salts on bacteriophage T4 and its isolated DNA}; Fonshtein LM et al.; The effect of palladium and platinum salts (K2PdCl4, K2PtCl4) on bacteriophage F4 and its isolated DNA in genetic transformation is investigated . Both compounds efficiently inactivated the phage and decreased the transforming activity of donor DNA . The palladium salt exhibited the higher activity . The palladium compounds inhibited the transforming activity of native donor DNA to a greater degree . No difference was observed in the degree of inactivation of the transforming activity of native and denatured DNA under the effect of platinum salt . It is suggested that the difference in the transforming activity of donor DNA treated with the tested compounds reflect the pattern of their interactions with nucleic acids. Genetika, 1975, 11(7), 121 - 7 {Recombination in amber-mutants of bacteriophage T4B . I . Recombination and complementation in phage T4 amber-mutants}; Piruzian ES; In studying intergenic and intragenic complementation in amber mutants in genes of phage T4 controlling the synthesis of phage tail fibres the data have been obtained indicating the dependency of the results of complementation tests on those of crosses of respective markers . The results obtained show that in complementation of amber mutants of phage T4 the phage yield varies widely and depends on the location of markers on the phage genetic map. J Nutr Sci Vitaminol (Tokyo), 1975, 21(4), 261 - 9 Mechanism of inactivation of bacteriophage deltaA containing single-stranded DNA by ascorbic acid; Murata A et al.; The mechanism of inactivation of a single-stranded DNA phage, deltaA of Escherichia coli, by AsA was investigated as a part of the study on the mechanism of inactivation of viruses by AsA . Bubbling air or oxygen gas through the reaction mixture, and the addition of oxidizing agents or transition metals into the reaction mixture enhanced the inactivation of the phage by AsA . In contrast, nitrogen gas bubling, and the addition of reducing agents, chelating agents or radical scavengers prevented inactivation . The rate of inactivation was faster in the AsA solution preincubated for several minutes than in the freshly prepared AsA solution . DAsA, an oxidized form of AsA, demonstrated little effect on the activity of the phage . Concentrations of hydrogen peroxide which were theoretically produced by the autoxidation of AsA had no effect on the phage . The results indicated that the free radical intermediates produced during the course of the autoxidation of AsA participated in the inactivation . The radicals attacked the DNA of the phage to introduce strand scissions in the DNA, which might be mainly responsible for the inactivation. Genetika, 1975, 11(9), 125 - 30 {Phenotypic characteristics of temperature-sensitive mutants of bacteriophage T4 in gene 19}; Rodikova LP et al.; The order of three thermosensitive mutations in gene 19 is determined and compared with the character of defective structures observed in an electrone microscope study of the lysates obtained in non-permissive and semi-permissive conditions . The degree of defectiveness of core polymerization increases if the mutation is located near the beginning of the gene . In one the combinations among these mutants the interallelic complementation is found . The mechanism of complementation is discussed on the basis of the electrone microscopic pattern . The polymerization of core protein in vivo starts from the base plate. J Virol, 1975 Jan, 17(1), 296 - 7 Molecular weights of DNA from bacteriophages T5, T5st(O), BF23, and BF23st(4); LANG D et al.; The DNA molecular weights were determined by calibrated electron microscopy . The results (in units of 10(6)) are: for T5, 77.4 +/- 2.4 T5st(O), 72.4 +/- 1.9; BF23, 76.7 +/- 2.3; and BF23st(4), 71.4 +/- 1.7. Mol Gen Genet, 1975, 138(2), 85 - 111 A pleiotropic regulatory mutation in lambda bacteriophage; Honigman A et al.; Lambda bacteriophage mutants, lambdasar, were isolated . These mutants can form plaques on a non lysogenic lawn and are unable to grow on nonimmune (imm-), cro constitutive hosts . Analysis of the restriction of lambdasar by a set of defective lysogens suggested that both the cro and cII gene products participate in the inhibition . The sar mutations were mapped in the ori region between the genes cII and O . Complementation experiments showed that under the restrictive conditions lamdasar is defective in the expression of both the N and the O genes . Transcription analyses support these findings, as lambdasar is unable to serve as a template for transcription after infecting cro constitutive hosts . In addition lambdasar does not replicate under the restrictive conditions, although its DNA can bind to the host membrane to some extent . The Sar phenotype can be relieved by removing sites of action of cro either by a V2 mutation or by substituting the lambda immunity region by imm434 or imm21 . Similarly introducing a cy mutation, which interferes with the action of the cII gene product, also eliminates the Sar effect . The sar mutation can suppress cy mutations as manifested in plaque morphology, lysogenization frequency, cI repressor synthesis and the expression of rex function . Suppression takes place only when the sar mutation is present in cis to cy and it requires the action of the cII and cIII gene products . It is suggested that the sar mutation suppresses cy by activating a new promoter for repressor synthesis, pro . The results also suggest that the cII and cIII gene products may act at a site other than y. J Supramol Struct, 1975, 3(1), 24 - 38 Assembly of the tail of bacteriophage T4; Kikuchi Y et al.; The protein products of at least 21 phage genes are needed for the formation of the tail of bacteriophage T4 . Cells infected with amber mutants defective in these genes are blocked in the assembly process . By characterizing the intermediate structures and unassembled proteins accumulating in mutant-infected cells, we have been able to delineate most of the gene-controlled steps in tail assembly . Both the organized structures and unassembled proteins serve as precursors for in vitro tail assembly . We review here studies on the initiation, polymerization, and termination of the tail tube and contractile sheath and the genetic control of these processes . These studies make clear the importance of the baseplate; if baseplate formation is blocked (by mutation) the tube and sheath subunits remain essentially unaggregated, in the form of soluble subunits . Seventeen of the 21 tail genes specify proteins involved in baseplate assembly . The genes map contiguously in two separate clusters, one of nine genes and the other of eight genes . Recent studies show that the hexagonal baseplate is the end-product of two independent subassembly pathways . The proteins of the first gene cluster interact to form a structure which probably represents one-sixth of the outer radius . The products of the other gene cluster interact to form the central part of the baseplate . Most of the phage tail precursor proteins appear to be synthesized in a nonaggregating form; they are converted to a reactive form upon incorporation into preformed substrate complexes, without proteolytic cleavage . Thus reactive sited are limited to growing structures. Birth Defects Orig Artic Ser, 1975, 11(1), 331 - 8 The recognition and classification of immunodeficiency diseases with bacteriophage phiChi 174; Wedgwood RJ et al.; A standard antigen to assess humoral responses is needed for the immunodeficiency syndromes . Bacteriophage phiChi 174 is the best available antigen . Large, standardized batches can be prepared, stored and distributed; samples for assay can be transported by mail . We have systematically studied the immune response to this antigen in over 200 persons, including 49 immunodeficiency patients . Phage provides consistent delineation of humoral responses in primary immunodeficiency diseases. Biokhimiia, 1975 Jan-Feb, 40(1), 115 - 22 {Chromatography of nucleic acids, proteins and certain phages on granulated hydroxyapatite}; Mazin AL et al.; A modification of the classical method of hydroxyapatite synthesis is proposed . The essence of the modification is hydroxyapatite synthesis in the presence of an additional component silicic acid particles . The subsequent steps of the method are modified so, as to retain the intactness of crystals at all the stages of preparation and use of the adsorbent . The final product consists of large spherical agregates (200-250 mu in diameter) and contains about 1% of tightly bound silicic acid . It slightly differs from usual hydroxyapatite in its chromatographic properties . Granulated hydroxyapatite obtained has a high specific capacity and can be repeatedly used in experiments (up to 50 chromatographic cycles) . Native high-polymeric T2 phage DNA was practically quantitatively eluated from the column . Conditions for chromatography of some proteins (lysozyme, RNase, DNase) are described . Fractionation and purification of T2 and T3 bacteriophages and TMV are carried out by means of chromatography on granulated hydroxyapatite. Nucleic Acids Res, 1975 Jan, 2(1), 79 - 85 A possible role of the 5' terminal sequence of 16S ribosomal RNA in the recognition of initiation sequences for protein synthesis; van Knippenberg PH; Extensive complementarity is found between the 5' end of 16S ribosomal RNA and protein synthesis initiation sites of bacteriophage RNA . Hybrids can be constructed from base sequences of 16S-RNA and two initiation regions on phage RNA . A model is proposed for the involvement of 16S-RNA in the unfolding of hairpin loops containing the initiation codon AUG. Nucleic Acids Res, 1975 Jan, 2(1), 131 - 41 Studies on the structure of replicative intermediates in bacteriophage M13 single stranded DNA synthesis; Kessler-Liebscher BE et al.; Pulse-labeled replicative intermediates in M 13 single stranded DNA synthesis can be separated by dye-buoyant density centrifugation into two major fractions: Supercoiled molecules (RI I) containing viral strands of more than one genome length, and "relaxed" molecules (RI II) with labeled DNA chains shorter than unit length . It is postulated that RI II molecules might be formed in vivo by site-specific nicking of RF I molecules. J Gen Virol, 1975 Jan, 26(1), 87 - 94 Miniphage-a class of satellite phage to M13; Hewitt JA; Satellite or defective bacteriophage particles can appear in extensively recycled stocks of coliphage M13 . These particles, herein known as miniphage, replicate using the wild type bacteriophage as a helper . Their physical properties (u.v . spectra, sedimentation of DNA and bacterophage, electrophoretic moblitiy) are described and a method for the isolation of specific satellite bacteriophage is presented. Mutat Res, 1975 Jan, 27(1), 17 - 26 Effects of p-fluorophenylalanine on the induction of mutations in bacteriophage T4 . II . Nitrous acid mutagenesis; Johnston AW; The effects of rho-fluorophenyalanine (PFPA), an analogue of phenylalanine (PHE), on the potency and the specificity of nitrous acid (NA) mutagenesis in the gamma system of bacteriophage T4 were measured . (a) Forward mutation . THE frequencies of NA-induced gamma mutants were approximately doubled when mutagenized phage infected E . coli B in the presence of the analogue compared to controls where PHE was substituted for PFPA, or where no amino acid was added . The spontaneous forward mutation frequency was not affected by the analogue, nor was the specificity of the NA mutagenesis . (b) Reverse mutation . The frequency of spontaneous and NA-induced reversion of an gammaII transition mutant was unaffected by PFPA if the phage were plated direct on the restrictive growth in the presence of PFPA the induced reversion frequency was increased about 3-fold compared to the control. Annu Rev Genet, 1975, 9, 213 - 44 Molecular and genetic recombination of bacteriophage T4; Broker TR et al.; Most genetic characteristics of T4 recombination (the effects of chromosomal termini on recombination, heterozygosity, high negative interference, base mismatch repair, polarized segregation, and the stimulation or depression of recombination in response to phage mutations or external perturbations) can be expressed adequately in terms of our present understanding of the molecular events of T4 infection cycles . T4 DNA replication begins and ends with linear chromosomes and does not require a circular intermediate . Replication is bi-directional, possibly from multiple origins . Two phases of replication are distinguishable: (a) an early mode during which about 20 progeny copies of infecting chromosomes are made prior to (b) a recombination-dependent mode during which progeny molecules associate to form covalently joined linear concatemers . Further replication is generally arrested if concatemerization is prevented . T4 DNA recombination depends on the production of single-stranded gaps and termini . If replication is inhibited, the single-stranded regions are produced by deoxyribonuclease activities . In contrast, during partial replication of damaged chromosomes, during slow replication when enzymes or subtrates are limited, and during normal replication, they are formed by strand-displacement DNA polymerization . As a rule, any agents or perturbations that cause an accumulation of single-stranded regions stimulate recombination, whereas efficient repair of such regions depresses it . Both the preservation and pairing of single-stranded regions are facilitated by the gene-32 single-stranded DNA binding protein . Covalent repair of strand interruptions between recombined DNA segments requires polymerases or nucleases as well as ligases. J Virol, 1975 Jan, 17(1), 175 - 82 Replication and recombination of gene 59 mutant of bacteriophage T4D; Shah DB; After infection of Escherichia coli B with phage T4D carrying an amber mutation in gene 59, recombination between two rII markers is reduced two- to three-fold . This level of recombination deficiency persists even when burst size similar to wild type is induced by the suppression of the mutant DNA-arrest phenotype . In the background of two other DNA-arrest mutants in genes 46 and 47, a 10- to 11-fold reduction in recombination is observed . The cumulative effect of gene 59 mutation on gene 46-47 mutant suggests that complicated interactions must occur in the production of genetic recombinants . The DNA-arrest phenotype of gene 59 mutant can be suppressed by inhibiting the synthesis of late phage proteins . Under these conditions, DNA replicative intermediates similar to those associated with wild-type infection are induced . Synthesis of late phage proteins, however, results in the degradation of mutant 200S replicative intermediate into molecules are associated with membrane, they do not replicate . These results suggest a role for gene 59 product, in addition to a possible requirement of concatemeric DNA in late replication of phage T4 DNA. Basic Life Sci, 1975, 5A, 307 - 12 Recombination and postreplication repair; Rupp WD et al.; The available data concerning postreplication repair are summarized . In Escherichia coli, recombination is implicated in this repair because the recA+ gene is necessary and because strand exchanges occur that extend over long regions . Other experiments involving phage-induced resistance also point to an interrelation between recombination and repair . In this phenomenon, gene products of lambda bacteriophage are introduced into bacteria, resulting in an increased resistance of the cells when they are subsequently exposed to X rays. Basic Life Sci, 1975, 5A, 135 - 42 Enzymic mechanism of excision-repair in T4-infected cells; Sekiguchi M et al.; Excision of pyrimidine dimers from ultraviolet-irradiated DNA in a cell-free system of Escherichia coli infected with bacteriophage T4 consists of two different steps, one to induce a single-strand break at a point close to a pyrimidine dimer and the other to release dimer-containing nucleotide from the DNA . The enzymes responsible for these steps were isolated and the reactions were characterized; T4 endonuclease V introduces a break at the 5' side of a dimer and 5' in equilibrium 3' exonucleases, which are also induced by T4, act at the break to excise dimer-containing nucleotides . We isolated temperature-dependent v mutants, which exhibit increased sensitivity to UV at 42 degrees C but not at 30 degrees C, and found that the mutants induce temperature-sensitive T4 endonuclease V, indicating that the v gene of T4 is indeed the structural gene for T4 endonuclease V and that the enzyme is responsible for the first step of excision-repair . A possible mechanism of excision-repair in T4-infected cells is discussed. Acta Biochim Biophys Acad Sci Hung, 1975, 10(1-2), 115 - 22 Inactivation of bacteriophages T7 and phiX174 by radiomimetics; Ronto G et al.; Inactivation of phages T7 and phiX174 induced by the radiomimetics N-nitroso-N-methylurea (NMU) and N-acetylethylenimine (AEI) has been studied . In semilogarithmic scale the kinetic curves of phage inactivation were steplike in character . This was connected with the occurrence of several processes in the system . A possible kinetic model has been proposed for the process of NMU-induced phage inactivation . The model is applicable to initial phage inactivation only . From the model a kinetic curve parameter, rho can be determined which characterizes the radiomimetic effect on different phages and determines the changes in the repair system after caffeine treatment . NMU exerted a post-inactivation effect on the phage T7 . Also the NMU-induced phage T7 post-inactivation kinetic curves were of steplike character . They can be described as a sum of two exponential processes of different rate constant . The rate constant for the first stage of the post-inactivation process was close to the depurinization rate constant found in the literature. Zentralbl Bakteriol {Orig A}, 1975, 230(3), 379 - 84 {The morphology of a nocardia asteroides-bacteriophage (author's transl)}; Andrzejewski J et al.; The morphology of a new bacteriophage isolated from Nocardia asteroides has been investigated by negative staining . The percent results suggest a model which is valid for many phages . The head of the bacteriophage has the shape of an icosaeder with a diameter of about 420 AU . It probably contains a spherical core which is surrounded by a capsid of 15 AU thickness . A flexible non-contractible tail is connected by a collar to one of the head's edges . Its length is about 1400 AU and its diameter 60 AU . The tail shows a cross striation with a periodicity of 40 AU and a channel . At the distal side it passes over into a conical end structure . Conforming this morphological criteria the new bacteriophage belongs to the group B of Bradley. Med Microbiol Immunol (Berl), 1975, 161(2), 113 - 22 Bacteriophages of Nocardia asteroides; Pulverer G et al.; 101 Nocardia strains from different species and different sources were examined with respect to their lysogeny . 18 phages from 17 Nocardia asteroides strains could be isolated, purified, and propagated . All phages were released spontaneously . Induction experiments with mitomycin C and UV-rays brought no practicale advantages . Using 14 of the 18 phages, 38 of the 101 Nocardia strains tested could be grouped into 18 phage patterns . Nearly all of the typable strains belonged to the species Nocardia asteroides. Mutat Res, 1975 Jan, 27(1), 7 - 16 Effects of p-fluorophenylalanine on the induction of mutations in bacteriophage T4 . I . 5-Bromouracil mutagenesis; Johnston AW; The amino acid analogue rho-fluorophenylalanine (PFPA) was found to have no mutagenic activity in the gamma system of bacteriophage T4 . However, under standard conditions for 5-bromouracil (5-BU) mutagenesis, PFPA depressed the induced frequencies for both forward and reverse mutations . When the folate antagonist sulphanilamide (SU) was omitted from the mutangenic treatment medium or when it was replaced by Trimethoprim (TM), another folate antagonist, this depressive effect was abolished . It was proposed that PFPA alleviated the inhibitory action of SU. Proc Natl Acad Sci U S A, 1975 Jan, 72(1), 122 - 6 T4-induced RNA ligase joins single-stranded oligoribonucleotides; Walker GC et al.; RNA ligase isolated from Escherichia coli infected with bacteriophage T4 will catalyze the formation of an intermolecular 3' leads to 5' phosphodiester linkage between an oligoribonucleotide with a free 3'-hydroxyl and another oligoribonucleotide with a 5'-phosphate . Upon reaction with (Ap)5C, nearly quantitative conversion of the hexamer {5'-32P}p(Up)5U to the dodecamer (Ap)5C{3' leads to 5'-32P}p(Up)5U was observed . The product was identified by its mobility on RPC-5 column chromatography, its resistance to alkaline phosphatase, and the appearance of the expected radiolabeled products on hydrolysis with alkali, ribonuclease A, snake venom phosphodiesterase, and spleen phosphodiesterase . The coupling of other pairs of single-stranded oligoribonucleotides has also been demonstrated . The intermolecular joining reaction is probably mechanistically similar to the intramolecular cyclization activity previously reported for Tr RNA ligase . It is expected that this enzyme will be useful for the synthesis of RNA fragments of defined sequence. Int J Radiat Biol Relat Stud Phys Chem Med, 1975 Jan, 27(1), 83 - 94 Gamma-ray-induced thymine damage in the DNA in coliphage phi chi 174 and in E . coli; Swinehart JL et al.; The radiation chemical reactivity of thymine residues has been compared for single-stranded phi chi 174 DNA free in solution and in the intact bacteriophage, as well as for native E . coli DNA in solution and inside the cell . The gamma-ray-induced release of {3H}H2O from thymine-methyl{3H} was measured to assess the reactivity of the thymine methyl group . Formation of ring-saturated products of the 5,6-dihydroxy-dihydrothymine type (see article) was determined by an alkali-acid degradation assay . It was observed that the formation of that the formation of {3H}H2O was suppressed by a factor of 9 in intact phi chi 174 bacteriophage compared to phi chi 174 DNA, whereas the formation of (see article) was only slightly suppressed in the phage . For E . coli cells the formation of {3H}H29 was reduced 790-fold compared with free E . coli DNA, and (see article) formation was reduced 140-fold . The extents of survival after gamma-irradiation of phi chi 174 phage plaque-forming ability and E . coli colony-forming ability were also determined . Under the conditions used in these experiments, a linear relationship was observed between the loss of biological activity and the formation of thymine damage for both phi chi 174 phage and E . coli cells. Acta Microbiol Pol A, 1975, 7(1), 33 - 6 Effects of disintegration of incorporated 35S on mutation frequency; Najer A et al.; The reverse mutation to the wild type of lambda sus 9 and T4 AM B17 bacteriophages, grown in bacteria prelabeled with 35S and stored at--196 degrees, was studied . No mutagenic effect of 35S was observed in both, lambda and T4 bacteriophages . It is suggested that there is no influence of 35S disintegrations on the properties of DNA polymerase to which the mutagenic activity could be attributed. Acta Microbiol Pol A, 1975, 7(1), 21 - 4 Ribonucleic acid synthesis after adsorption of the bacteriophage lambda on Escherichia coli minicells; Witkiewicz H et al.; Lambda bacteriophage adsorbs on the chromosome-less small bodies (minicells) produced by aberrant cell division of Escherichia coli P678-54 . The plasmid-less minicells, as well as the minicells harbouring the colicinogenic factor E1, reveal a considerable inhibition of total RNA synthesis after phage adsorption . Both kinds of minicells synthesize RNA hybridizable to lambda DNA, but in the plasmid-harbouring minicells lambda RNA synthesis is much more intensive. J Virol, 1975 Jan, 15(1), 22 - 6 Mutations in the new gene stIII of bacteriophage T4B suppressing the lysis defect of gene stII and a gene e mutant; Krylov VN et al.; Mutations of bacteriophage T4B were found which suppress the lysis defect of both gene stII mutants and gene e mutants . The suppressor mutations belong to a new gene, stIII, of phage T4B . Gene stIII is located on the genetic map of T4B between genes stI and e . stIII mutants sometimes form star plaques on Escherichia coli B . The latent period on E . coli 594, but not E . coli B, is shorter with stIII mutants than that with wild-type phage . The premature lysis of E . coli 594 infected with stIII phage does not depend on the expression of both stII+ and e+ function . StIII allele is dominant over the stIII+ with respect to both the ability to suppress the stII defect and the early lysis of infected E . coli 594 cultures. J Virol, 1975 Jan, 15(1), 151 - 60 Process of infection with bacteriophage phiX174 . XXXVII . RNA metabolism in phiX174-infected cells; Clements JB et al.; The RNA produced in vivo from bacteriophage phiX174 DNA has been analyzed by polyacrylamide-agarose gel electrophoresis and sedimentation in dimethyl sulfoxide gradients, and the results of Hayashi and Hayashi (1970) have been confirmed and extended . An efficient procedure for recovery of RNA from gels, followed by a hybridization assay, has indicated the presence in infected cells of 18 distinct RNA species with sizes up to and greater than the unit (viral) length . The sizes of phiX mRNA's were similar irrespective of whether material was analyzed on gels or in dimethyl sulfoxide gradients . When virus-induced RNA was detected by a double-label method, seven additional low-molecular weight species were observed on gels and the resolution of dimethyl sulfoxide gradients was enhanced . The present results lend support to aspects of the model of Hayashi and Hayashi (1970) for the generation of these discrete mRNA species; an alternative model is also discussed. Int J Radiat Biol Relat Stud Phys Chem Med, 1975 Jan, 27(1), 1 - 6 Biological relevance of alkali-labile sites in double-stranded DNA after gamma-irradiation; Lucke-Huhle C; Alkali-labile sites produced by gamma-irradiation in dry RF-DNA of bacteriophage phi chi 174 were found to be lethal lesions with respect to the plaque-forming ability. Cold Spring Harb Symp Quant Biol, 1975, 39 Pt 1, 457 - 74 Mapping of adenovirus 2 RNA sequences in lytically infected cells and transformed cell lines; Sharp PA et al.; The strands of the six EcoRI fragments and the HpaI fragments E and C of Ad2 DNA were separated by electrophoresis in agarose gels . Using 32P-labeled fragment strands in solution hybridization experiments, the fraction of each strand complementary to RNA extracted from infected or transformed cells was assayed by chromatography on hydroxylapatite . In this manner, a tentative map of the cytoplasmic RNA sequences has been constructed for viral RNA extracted from cells both early and late during infection (see Fig . 16; in the map shown, the two strands of Ad2 are named the r and l strands following the bacteriophage convention) . Since early cytoplasmic RNA anneals to four distinct regions of the genome, Ad2 probably codes for at least four early gene functions . Summation experiments have shown that all RNA sequences found in the cytoplasm of cells early during infection are also present in the cells' cytoplasm at late times . Viral RNA sequences in five independently isolated and cloned transformed rat cell lines were also mapped on the Ad2 genome . One class of Ad2-transformed rat cells contains RNA sequences complementary to only the segment of Ad2 DNA from 0.03-0.10 on the physical map, and this corresponds to one of the four regions of the genome expressed early during infection . If a viral gene product is necessary to maintain the transformed phenotype of the cell or codes for the virus-specific tumor (T) antigen, this genetic information must be at the left end of the genome (see Fig . 16) . The two other classes of Ad2-transformed rat cells contain viral RNA sequences complementary to two or three of the regions of the genome transcribed into early cytoplasmic RNA . At both early and late times during the lytic cycle, the nucleus of the infected cell contains viral RNA sequences that are not transported to the cell's cytoplasm, suggesting that RNA processing and selection may play a role in the regulation of viral mRNA production. Proc Natl Acad Sci U S A, 1975 Jan, 72(1), 235 - 9 Recombinant DNA molecules of bacteriophage phi chi174; Benbow RM et al.; Phi chi174 DNA structures containing two different parental genomes were detected genetically and examined by electron microscopy . These structures consisted of two monomeric double-stranded DNA molecules linked in a figure 8 configuration . Such DNA structures were observed to be formed preferentially in host recA+ cells or recA+ cell-free systems . Since the host recA+ allele is required for most phi chi174 recombinant formation, we conclude that the observed figure 8 molecules are intermediates in, or end products of, 1 phi chi174 recombination event . We propose that recombinant figure 8 DNA molecules arise as a result of "single-strand aggression," are stabilized by double-strand "branch migration," and represent a specific example of a common intermediate in genetic recombination. Proc Natl Acad Sci U S A, 1975 Jan, 72(1), 162 - 6 Evidence for de novo production of self-replicating and environmentally adapted RNA structures by bacteriophage Qbeta replicase; Sumper M et al.; Highly purified coliphage Qbeta replicase when incubated without added template synthesizes self-replicating RNA species in an autocatalytic reaction . In this paper we offer strong evidence that this RNA production is directed by templates generated de novo during the lag phase . Contamination of the enzyme by traces of RNA templates was ruled out by the following experimental results: (1) Additional purification steps do not eliminate this RNA production . (2) The lag phase is lengthened to several hours by lowering substrate or enzyme concentration . At a nucleoside triphosphate concentration of 0.15 mM no RNA is produced although the template-directed RNA synthesis works normally . (3) Different enzyme concentrations lead to RNA species of completely different primary structure . (4) Addition of oligonucleotides or preincubation with only three nucleoside triphosphates affects the final RNA sequence . (5) Manipulation of conditions during the lag phase results in the production of RNA structures that are adapted to the particular incubation conditions applied (e.g., RNA resistant to nuclease attack or resistant to inhibitors or even RNAs "addicted to the drug," in the sense that they only replicate in the presence of a drug like acridine orange) . RNA species obtained in different experiments under optimal incubation conditions show very similar fingerprint patterns, suggesting the operation of an instruction mechanism . A possible mechanism is discussed. Mol Gen Genet, 1975, 137(2), 171 - 80 Bacteriophage SPO1 DNA- and RNA-directed protein synthesis in vitro: comparison with in vivo control; Shub DA; A cell free protein synthesizing system, derived from E . coli, is shown to be a quantitiative assay system for messenger RNA extracted from B . subtilis infected with bacteriophage SPO1 . DNA-directed protein synthesis in this system is shown to be limited mostly to those proteins whose messages are contained in early RNA . A phage induced enzyme, dCMP deaminase, is shown to be dependent on appearance of a class mRNA made in vivo in response to new initiations of transcription dependent on prior synthesis of phage induced protein . Control of the enzyme synthesized in the cell free system is contrasted with in vivo control, and an estimate of "read-through" by RNA polymerase in vitro is presented. Mol Gen Genet, 1975, 137(2), 161 - 9 Bacteriophage SPO1 DNA- and RNA-directed protein synthesis in vitro: the effect of TF1, a template-selective transcription inhibitor; Shub DA et al.; Transcription factor one (TF1), a protein synthesized after infection of B . subtilis by phage SPO1, is a specific inhibitor of SPO1 in vitro transcription . In this paper, we investigate the effect of TF1 on SPO1-specific in vitro protein synthesis, using SPO1 DNA or messenger RNA as templates . Protein syhthesis is measured by incorporation of radioactive amino acids into acid insoluble form, synthesis of a phage-specific enzymatic activity, and analysis of radioactive polypeptides by acrylamide gel electrophoresis . TF1 is shown to inhibit the DNA-dependent synthesis of all SPO1 proteins which can be made in vitro, but to have no specific effect on RNA-dependent protein synthesis in vitro. Biochimie, 1975, 57(8), 905 - 15 Development of bacteriophage Ha2, a phiX174 derivative, in Escherichia coli strains carrying a thermosensitive mutation in the dnaG gene; Truffaut N et al.; Ha2 is a derivative of HaHb, a phiX174 mutant able to grow on several Escherichia coli K 12 strains which are insensitive to phiX174 wild type . Ha2 was isolated after nitrous acid mutagenesis and selected as being able to give large plaques in equal number at 42 degrees C as well as 30 degrees C when plated on Escherichia coli C and CR34 . Hosts carrying a thermosensitive mutation at the dnaG locus are unable to support the replication and maturation of Ha2 at the restrictive temperature . The first steps of Ha2 development: attachment, eclipse and penetration, are not affected by the dnaG mutation . The viral DNA penetrates the cell as single-strands, which are probably attached to a viral protein component . The following steps of viral replication depend on the presence of an active dnaG gene product: no formation of parental RF; no synthesis and replication of progeny RF were observed in the mutant strains at 42 degrees C . The synthesis of viral single-stranded DNA as well as phage formation are lowered after a shift to the restrictive conditions, suggesting that the dnaG gene product is also involved at these stages. Genetika, 1975, 11(6), 114 - 8 {Effect of restricting the action of an amber-mutation suppressor contained in bacteriophage T4 genome}; Maisurian AN et al.; The action of a bacteriophage suppressor can be restricted due to mutations arising in the genome of the host bacteria . Bacterial strains Escherichia coli BN and CAN were isolated in which a complete restriction of the action of phage suppressor psu+ took place . In thees strains obtained the restriction of serin-specific phage suppressors psu + a and psu + b is brought about . The action of bacteriophage suppressor su3+ containing in E . coli CAN is not abolished in this strain . The abolish of the action of glutamine-specific phage suppressor in both strains is not realized . Thus, in bacterial strains of E . coli BN and CAN the restriction of action of only definite tRNA type takes place . Mutation alterations in the bacterial strains obtained can be due to the change of 1) ribosomes, 2) aminoacyl-tRNA-synthetase, 3) suppressor tRNA . In this case the possibility of mutation alterations in the gene controlling the synthesis of suppressor tRNA is excluded, but there is a possibility of changing the tRNA molecule itself during maturation. Biochem J, 1975 Jan, 145(1), 85 - 91 Molecular mechanisms in alkylation mutagenesis . Induced reversion of bacteriophage T4rII AP72 by ethyl methanesulphonate in relation to extent and mode of ethylation of purines in bacteriophage deoxyribonucleic acid; Lawley PD et al.; Survival and reversion to T4r+ of bacteriophage T4rII AP72 after treatment with ethyl methanesulphonate at 37 degrees or 45 degrees C were studied in relation to the extent and mode of alkylation of purines in DNA of ethylated bacteriophage . A single-burst technique was used for reversion assay . Survival was lower at 45 degrees C than at 37 degrees C at a given extent of ethylation of bacteriophage DNA, confirming that events subsequent to ethylation, probably depurinations, are the main cause of decreased survival . Reversion was positively correlated (approximately linearly except at low extents at 37 degrees C) with ethylation of bacteriophage DNA, showing that ethylation itself causes mutation . Following the concept that reversion results from G-C leads to A-T transition at a single site (Krieg, 1963a,b) and the suggestion that O6-alkylation of guanine generates the miscoding base (Loveless, 1969), it was calculated that about one-third of induced O6-ethylguanines at this site would miscode to induce mutation. Cold Spring Harb Symp Quant Biol, 1975, 39 Pt 2, 885 - 95 A biochemical and genetic analysis of mammalian RNA-containing sarcoma viruses; Scolnic EM et al.; Current studies have shown that all mammalian sarcoma-producing viruses, whether isolated from laboratory experiments of naturally occurring tumors, are deletion mutants of replicating mammalian type C viruses . Nonproducer cells transformed by any of these sarcoma viruses contain RNA homologous to mammalian leukemia viruses, even though the cells contain no known proteins currently coded for by the mammalian leukemia virus . This mammalian leukemia virus information (FT-) is a genetically stable part of the mammalian sarcoma viruses (FT+) . Second, another component in the Kirsten and Harvey sarcoma viruses can be identified in addition to this leukemia virus information for the homologous leukemia virus; at least part of the additional information came from rat type C viruses from the animals in which the sarcoma viruses were isolated . This indicates that these two mammalian sarcoma viruses are recombinants between mouse leukemia virus and genetic information in rat cells and suggests that the process of formation of the sarcoma virus is analogous to transduction of information in bacteriophage . Third, the Kirsten sarcoma virus seems to have a third component in it separate from either the mouse leukemia virus or rat leukemia virus information . Fourth, and FT+ leukemia virus isolated from mice, the Abelson leukemia virus which causes as B-cell leukemia, is also defective and can be shown to have information homologous to Moloney leukemia virus . Fifth, in the feline sarcoma virus, feline leukemia information can be detected, but information for the other cat virus, RD-114, cannot be detected . Finally, mutants of Kirsten sarcoma virus temperature sensitive for the maintenance of transformation have been isolated, and out of ten such mutants, thus far no complementation has been observed. Mutat Res, 1975 Jan, 27(1), 27 - 44 Comparative analysis of deletion and base-change mutabilities of Escherichia coli B strains differing in DNA repair capacity (wild-type, uvrA-, polA-, recA-) by various mutagens; Ishii Y et al.; Dose-response curves were compared for deletions {ColBR (resistant to colicin B) mutations being more than 80% deletions} and base changes (reversion of argFam to prototrophy argplus) induced in the same set of E . coli strains (wild-type for DNA repair, uvrA-, polA- and recA-) by N-methyl-N'-nitro-N-nitrosoguanidine (NTG), ethyl methanesulfonate (EMS), hydroxylamine (HA), 4-nitroquinoline I-oxide (4NQO), mitomycin C (MTC, UV and X-rays . All these agents induced deletions as well as base changes in the wild-type strain . Thus chemical mutagenesis differed in E . coli and bacteriophages in vitro, for HA, NTG, EMS and perhaps UV produced only point mutations in phage Tr . The patterns of deletion and base-change mutability in E . coli were surprisingly similar . (I) The recombination less recA- strain was mutable by only three (NTG, EMS, HA) of the seven mutagens for either deletions or base changes . (2) The uvrA- strain, unable to excise pyrimidine dimers, was very highly mutable by 4NQO and UV but immutable by MTC for both deletions and base changes . (3) The polA- strain, defective in DNA polymerase I due to a non-suppressible mutation, was very highly mutable by HA and highly mutable by MTC and 4NQO for both deletions and base changes but was highly mutable only for deletions by UV and X-rays, remaining normally mutable by the other agents for both deletions and base changes despite its high sensitivity to their inactivating action . We conclude that errors in the recA-dependent repair of induced DNA damage (after 4NQO, MTC, UV and X-rays) or errors in replication enhanced by damage to the replication system or to the template strands (after NTG, EMS, and HA) give rise to deletions as well as to base changes . From a comparative analysis of 14 dose-response curves for deletions and base changes, we conclude that the order of mutagenic efficiency relative to killing is (EMS, NTG) greater than (UV, 4NQO) greater than HA greater than (X-rays, MTC), and that X-rays, 4NQO, HA and MTC induce more ColBR deletions than Argplus base changes, whereas UV and EMS induce ColBR deletions and Argplus base changes at nearly equal rates and the specificity of NTG is intermediate between these two types. Proc Natl Acad Sci U S A, 1975 Jan, 72(1), 83 - 7 A routine method for protein-free spreading of double- and single-stranded nucleic acid molecules; Vollenweider HJ et al.; A protein-free nucleic acid preparation method for electron microscopy is described . The basic procedure is very similar to the classical protein monolayer spreading techniques . The carrier protein (usually cytochrome c) is replaced by benzyldimethylalkylammonium chloride . Both the hypophase method and the microdiffusion or droplet method can be applied with this compound . Unlike cytochrome c, benzyldimethylalkylammonium chloride does not lead to any apparent thickening of the nucleic acid strands . Partially denatured DNA spread with this reagent shows a loosened structure with a foamy appearance in the regions previously considered to be "unmelted," which open up locally into melted loops of different size . Specifically bound proteins, such as RNA polymerase on bacteriophage T7 DNA, can be detected unambiguously. Proc Natl Acad Sci U S A, 1975 Jan, 72(1), 333 - 7 Effect of a low-molecular-weight DNA binding protein, H1 factor, on the in vitro transcription of the lactose operon in Escherichia coli; Crepin M et al.; H1 protein, a heat-stable low-molecular-weight DNA-binding factor previously described by Cukier-Kahn et al . {Proc . Nat . Acad . Sci USA (1972) 69, 3643-3647} markedly stimulates in vitro synthesis of lac-specific RNA directed by bacteriophage lambdah80 dlac or phi80 dlac DNA templates in the presence of purified E . coli RNA polymerase holoenzyme . The extent of stimulation obtained by addition of H1 alone is usually greater than that observed with the cAMP receptor protein-cAMP combination . H1 effect varies quite appreciably (from 4- to 16-fold) with the functional state of the promoter, being much larger with lambdah80 dlac p-s, a transducing DNA carrying a superpromoter mutation, than with lambdah80 dlac p+ . H1 and cAMP receptor protein effects are nearly additive, although interpretation of the data obtained at high H1 concentration is complicated by the appearance of some inhibitory property . While the cAMP-receptor-protein-mediated synthesis is asymmetrical ("I" strand almost exclusively copied), the degree of asymmetry observed with H1 is less pronounced, suggesting asymmetrical copying from the lac promoter and symmetric transcription from other regions of the DNA . Synthesis of lac-specific RNA from lambdah80 dtrp/lac or phi80 dlac p-r uv5 templates, in which lac promoters are insensitive to cAMP receptor protein, either as a result of lac fusion to the trp operon or mutation in the lac promoter, is totally H1-insensitive . Glycerol (10-15% w/w) can fully substitute for H1 in stimulating lac RNA synthesis in a fashion analogous to that reported for the cAMP receptor protein-cAMP system . The possibility that H1 acts by causing conformational modifications at the promoter level in a way that increases its functional state, and that this effect is more pronounced with operons sensitive to cAMP receptor protein, is discussed. J Virol, 1975 Jan, 15(1), 161 - 6 Molecular weight of RNA subunits of Rous sarcoma virus determined by electron microscopy; Jacobson AB et al.; Secondary cultures of chicken embryo fibroblasts were infected with the Schmidt Ruppin strain of Rous sarcoma virus (RSV) . Five days after infection, the medium was replaced at 2-h intervals with phosphate-free Eagle medium containing 50 muCi of {32P}orthophosphate per ml . Virus was collected by centrifugation, and the RNA was extracted and denatured with dimethyl sulfoxide, and the 33S subunit RNA was isolated by sucrose gradient centrifugation . The molecular weight of the RSV subunit RNA was determined by length measurement in the electron microscope, by using bacteriophage MS2 RNA as a length marker . Molecules of between 2.5 and 3.3 mum in length made up over 50% of the subunit RNA preparation . In this paper, we define RSV RNA subunits as that RNA released from the 70S RNA complex by dimethyl sulfoxide treatment, which sediments as a peak at 33S . Assuming the molecular weight of MS2 RNA to be 1.2 times 10-6, we calculate the molecular weight of RSV subunit RNA to be 3.12 times 10-6 plus or minus 0.25 times 10-6. J Virol, 1975 Jan, 15(1), 50 - 4 Characterization of a bacteriophage T4 mutant lacking DNA-dependent ATPase; Behme MT et al.; A DNA-dependent ATPase has previously been purified from bacteriophage T4-infected Escherichia coli . A mutant phage strain lacking this enzyme has been isolated and characterized . Although the mutant strain produced no detectable DNA-dependent ATPase, growth properties were not affected . Burst sizes were similar for the mutant phage and T4D in polA1, recB, recC, uvrA, uvrB, uvrC, and various DNA-negative E . coli . UV sensitivity and genetic recombination were normal in a variety of E . coli hosts . Mapping data indicate that the genetic locus controlling the mutant occurs near gene 56 . The nonessential nature of this gene is discussed. Proc Natl Acad Sci U S A, 1975 Jan, 72(1), 367 - 71 Site-directed mutagenesis: effect of an extracistronic mutation on the in vitro propagation of bacteriophage Qbeta RNA; Flavell RA et al.; It has been proposed that the nucleotide sequences of the 3' terminal extracistronic regions of phage RNA plus and minus strands have been strictly conserved during evolution because they are stringently required for recognition by the viral replicase . We have devised a method to generate point mutations at selected sites in the genome of phage Qbeta . The in vitro synthesis of Qbeta RAN with G leads to A transition in the 16th position from the 3' end, i.e., in the terminal extracistronic region of the genome, is outlined . When a mixture of about 60% wild-type and 40% mutant RNA was repeatedly replicated, the mutant RNA was enriched to 80%, showing that at least this point mutation in the terminal sequence of Qbeta RNA does not impair its in vitro replication, but in fact slightly accelerates it. Biken J, 1974 Dec, 17(4), 141 - 8 Phospholipase A-deficient mutants of Escherichia coli B; Inoue K et al.; Phospholipase A-deficient mutants were isolated from Escherichia coli B/SM as follows . Replica plates were incubated to allow formation of colonies and then overlayed with soft agar containing washed sheep erythrocytes, lecithin Ca++, colistin, lysozyme and streptomycin . The mutant colonies were detected as colonies without hemolytic zones . Two or three cycles of treatment with mutagen and selection were necessary for their isolation . The mutants obtained could grow in a synthetic medium with glucose as the sole carbon source, and their phospholipid compositions were similar to that of the parent . They also gave the same agglutination titer as the parent with rabbit antiserum against the parent strain . They supported the growth of all members of the T-series of bacteriophages as effectively as the parent . Some hemolytic substance was produced from either lecithin or bacterial constituents when the mutants were infected with T even phages, but not with T odd phages . When the parent strain was infected with either T1 or T4, free fatty acids (FFA) were produced in the cell debris . Only a trace of FFA was formed in the debris of one of these mutants on infection with T4 and no FFA was formed on infection with T1. Mol Gen Genet, 1974, 135(4), 327 - 37 Transcription of bacteriophage mu . An analysis of the transcription pattern in the early phase of phage development; Wijffelman C et al.; It has previously been shown that the transcription of Mu is asymmetric and takes place on the heavy DNA strand (Bade, 1972; Wijffelman et al., 1974) . The direction of transcription of Mu has now been determined by RNA-DNA hybridizations between purified Mu-RNA and the separated strands of lambda-Mu hybrid phages . The direction of transcription is from the c-gene (immunity gene) end of the heavy strand to the beta-end (immunity distal end) (Fig . 1) . Thermo-inducible, defective Mu lysogens, in which the prophage is deleted from the beta-end, have a normal early transcription pattern, but the increase of RNA at later times is absent . A defective lysogen, which contains only the immunity gene c and the genes A and B, still has an early transcription pattern similar to that of the wild-type . Therefore, we conclude that the early RNA is transcribed from that region of the Mu genome . The early Mu-RNA synthesis is negatively regulated with a minimum rate of transcription at 9 minutes after induction . Before the onset of the late RNA synthesis, at about 22 minutes there is a rather long period in which the rate of Mu-RNA synthesis slowly increases . Using DNA strands of lambda-Mu hybrids which contain only that part of the Mu-DNA on which the early RNA synthesis takes place, we have determined that during the first half in the intermediate phase only early genes are transcribed . The amount of Mu-RNA synthesized by a Mu prophage carrying the X-mutation, which influences the excision of Mu, is greatly reduced . Negative regulation of early transcription occurs normally in this mutant.
|
© 2005
Transgalactic Ltd (manufacturer of Bioscreen C software) |
Privacy Statement | P.O. Box
1393, 00101 Helsinki, Finland,
Last modified: May 25, 2005
| ||||||