Microbiology Reader
Equipment to run microbiology work automatically

Growth Curves of any strain.
Microbiological calculations.

Microbiology Home
Microbioloy Reader
Growth Curves
Photo Album
Microorganisms
Software
Download
Purchasing
Contact Us



J Virol, 1976 Feb, 17(2), 326 - 34
Bacteriophage T4-induced shut-off of host-specific translation; Svenson SB et al.; To study the mechanism by which bacteriophage T4 inhibits the synthesis of inducible host enzymes we measured the formation of beta-galactosidase from preformed lac mRNA . Beta-Galactosidase was induced with isopropyl-beta-D-thiogalactopyranoside in the presence of 7-azatryptophan, a tryptophan analogue that is incorporated into proteins and renders the beta-galactosidase formed inactive . The accumulated las mRNA was measured by capacity to form active beta-galactosidase after a chase of the analogue with excess tryptophan . After T4 infection the ability to form beta-galactosidase from the preformed lac mRNA was rapidly lost even when T4 infection took place in the presence of rifampin . This restriction was dependent on the multiplicity of infection . At a multiplicity of infection of 8.6, 90% of the ability to express preformed lac mRNA was lost within 30 s . The kinetics of cessation of beta-galactosidase synthesis after T4 infection indicate that infection blocks initiation of lac mRNA translation.

J Virol, 1976 Feb, 17(2), 307 - 15
Effect of the "RNA control" locus in Escherichia coli on RNA bacteriophage R23 replication; Ernberg J et al.; The effect of the rel gene of Escherichia coli on the RNA synthesis induced by phage R23 was studied . This RNA phage has the property of inhibiting ribosomal RNA formation and completely dominating the RNA synthesis of the host . Phage-specific RNA formation was found to be dependent on the allelic state of the rel gene . Determinations of RNA synthesis were made by both cumulative and short-term incorporations of uracil and adenine . Variations in labeling of nucleotide pools were compensated for by determining specific activities of ATP and UTP and using these values to obtain true, relative rates of RNA synthesis.

Chem Biol Interact, 1976 Feb, 12(2), 197 - 210
The effect of 5-iodouracil on the growth and biosynthetic processes of bacteriophage T4td8 in the absence of light; Byrd DM et al.; 5-Iodouracil (IUra)-substituted progeny bacteriophage T4td8 were grown under conditions such that, upon CsCl equilibrium isopycnic gradient centrifugation, progeny with density distributions about the median similar to that of unsubstituted phage are obtained . In the absence of light a monotonic relationship exists between decreasing progeny viability and increasing percent IUra substitution . IUra is equivalent to thymine as a growth factor on a molar basis, and at concentrations of IUra plus thymine above that required for maximum particle production, the percent IUra substitution in phage DNA is determined by the mole fraction of IUra in the medium . The lethal effects of 5-iodo-2'-deoxyuridine (IdUrd) and IUra are equivalent, and are not produced by a direct effect on the phage particles . At equivalent percent substitution in phage DNA the order of lethality is IUra greater than 5-bromouracil (BrUra) greater than 5-chlorouracil (ClUra) . There is no interference with the transfer of thymine from host cell to progeny phage by the presence of IUra in the medium, and IUra affects neither the time of lysis nor the content of phage DNA in the infected cells.

J Virol, 1976 Feb, 17(2), 538 - 49
Level of specific prereplicative mRNA's during bacteriophage T4 regA-, 43- and T4 43- infection of Escherichia coli B; Trimble RB et al.; The role of the T4 bacteriophage regA gene in stabilizing early mRNA was investigated by assaying the level of functional mRNA from eight prereplicative genes (56 {dCMP hydroxymethylase}, cd {dCMP deaminase}, 1 {deoxynucleotide kinase}, rIIA, rIIB, 46 {DNA arrest}, and 45) during extended infection of Escherichia coli B with T4 regA-, 43- and T4 43- bacteriophage . The above gene-specific transcripts in RNA isolated from infected cells were quantitated by translation with an E . coli B cell-free system . Conditions were chosen to insure that the amount of gene product formed in vitro, measured either as an enzyme activity or as a radioactive band in acrylamide gel, was directly proportional to the level of mRNA present . The failure of T4 regA-, 43- phage to terminate prereplicative synthesis (Wiberg et al., 1973) resulted in an enhanced production of many early gene products over those formed during T4 43- infection . This increase did not appear to be associated with an increment in mRNA levels, since in the present study gene-specific early mRNA's were found to be only marginally elevated and slightly more stable in T4 regA-, 43-- than in T4 43--infected cells . Of interest was the observation that significant quantities of all of the mRNA's studied; with the exception of those from genes 45 and 46, could be isolated from T4 43--infected cells after synthesis of the respective gene products had ceased . On termination of normal prereplicative synthesis during infection with T4 43- phage, polyribosomes were found to be dissociated completely, a finding which suggests that the residual mRNA present in these cells is free in the cytoplasm . The persistence in T4 43--infected cells of translatable mRNA for many prereplicative genes after product synthesis ceased indicates that the impairment in protein synthesis is not due solely to regA-mediated messenger degradation or modification . Rather, the results suggest that the regA gene product may act either by interfering with early mRNA polypeptide chain initiation or by promoting prereplicative polysome dissociation.

J Virol, 1976 Feb, 17(2), 550 - 67
Bacteriophage T4 head morphogenesis . VII . Terminal stages of head maturation; Hamilton DL et al.; Several aspects of the terminal stages of T4 head maturation were investigated using ts and am mutants blocked at single steps of the assembly pathway . We had previously found that cells infected with mutants of gene 13, e.g., tsN38 and amE609, accumulated both stable (10 to 20%)- and fragile (80%)-filled head precursors (Hamilton and Luftig, 1972) . Here we showed the following for such gene 13-defective, mutant-infected cells . (i) Using thin-section analysis the pool of phage precursor structures observed under nonpermissive conditions was one-third of that observed when the cells were cultured under permissive conditions . (ii) In order for complete conversion of the precursors into viable phage to occur, there were apparent requirements of metabolic energy, protein, and DNA synthesis . (iii) The intracellular DNA pool under nonpermissive conditions exhibited a 50% distribution between 63S (mature size) and 200 S (concatenate size) DNA, with the latter DNA serving as a precursor pool . Further, this DNA pool when spread onto a protein monolayer exhibited a dispersed array of DNA, strands around a core, which was less dense than that found for the greater than 1,000S DNA concatenate isolated from gene 49-defective infected cells . (iv) When precuations were taken to stabilize the head precursors, such as lysis of the cells into glutaraldehyde, there was a 30% increase in the yield of 1,200S filled heads . Correlating these results and previous results concerning gene 49-defective unfilled heads, we propose that there are several forms of gene 13 fragile head precursors which serve as intermediates between gene 49 unfilled heads and gene 13 stable filled heads . We cannot, however, rule out the possibility that all gene 13-defective heads represent a single class of unstable particles, which decay slowly . In either case, we have shown that gene 13-defective particles are unstable to some degree inside the cell and are highly unstable outside the cell; yet all particles can still be efficiently converted to phage in vivo.

J Bacteriol, 1976 Feb, 125(2), 409 - 15
Nature of the energy requirement for the irreversible adsorption of bacteriophages T1 and phi80 to Escherichia coli; Hancock RW et al.; The nature of the energy requirement for irreversible adsorption of phages T1 and phi80 was studied by using various specific energy inhibitors and mutants lacking either the Ca2+, Mg2+-adenosine triphosphatase or the ability to produce cytochromes in the absence of added 5-aminolaevulinic acid . It was found that irreversible adsorption could be energized both through the electron transport chain and from adenosine 5'-triphosphate via the Ca2+, Mg2+-adenosine triphosphatase, indicating the involvement of the energized membrane state . These results and the discovery that phages T1 and phi80 adsorb reversibly to the isolated tonA gene product are discussed in terms of the possible involvement of functions expressed by the tonB gene region in irreversible adsorption and the relationship to iron transport.

J Virol, 1976 Feb, 17(2), 316 - 25
Isoaccepting species of serine tRNA coded by bacteriophage T5sto; Henckes G et al.; By aminoacyl-tRNA-DNA hybridization and chromatographic analysis, evidence was provided that the bacteriophage T5stO codes for two tRNAser species . Trinucleotide- or polynucleotide-stimulated binding experiments assigned the codons UCC or UCU to these two tRNAser species . They also suggested that the synthesis of these two tRNAser species does not modify the reading capacity for codons less used in Escherichia coli F and corresponds to a different situation compared with the T4-coded tRNA's.

Biochemistry, 1976 Jan 27, 15(2), 407 - 14
Nucleotide clusters in deoxyribonucleic acids . Comparison of the sequences of the large pyrimidine oligonucleotides of bacteriophages S13 and phiX174 deoxyribonucleic acids; Harbers B et al.; The large pyrimidine oligonucleotides from the DNAs of the two related bacteriophages phiX174 and S13 have been sequenced . The largest pyrimidine oligonucleotide present is unique to S13 DNA and is the undecanucleotide C5T6, sequence C-T-T-C-C-T-C-T-T-C-T . Considerable sequence homology has been found between the pyrimidine oligonucleotides of the two phage DNAs . Out of 14 oligonucleotide sequences from S13 DNA (120 bases) at least ten are identical with sequences of oligonucleotides from phiX174 DNA (92 bases) and two are closely related (17 bases), the only difference being a single thymine to cytosine transition in each sequence (a total of 107 identical bases) . The pyrimidine oligonucleotides of each phage DNA show extensive internal sequence homology among each other with up to eight bases identical in sequence in pairs of different oligonucleotides . Another interesting observation is the occurrence of symmetrical sequences (true palindromes) which read the same forwards as backwards . The longest symmetrical sequence is the nonanucleotide C4T5 sequence, C-T-C-T-T-T-C-T-C, present in both S13 and phiX174 DNAs . The extensive sequence homology observed between the pyrimidine oligonucleotides of S13 and phiX174 supports the close relationship of the two phages and provides further evidence that they were derived from recent common ancestors.

J Biol Chem, 1976 Jan 25, 251(2), 536 - 47
The physical mapping of bacteriophage T5 transfer tRNAs; Chen MJ et al.; Transfer RNAs, isolated from Escherichia coli F cells infected with T5 bacteriophage, were charged with radioactive amino acids and used in RNA-DNA hybridization studies to detect and locate T5 tRNA cistrons in the T5 DNA chromosome . Hybridization of 14 3H-aminoacyl-tRNA species, including purified T5 {35S}Met-tRNAm and {35S}Met-tRNAf, to the separated strands of T5+ DNA indicates that most, if not all, of the T5 tRNAs are transcribed from the continuous heavy strand of T5 DNA . Heteroduplex mapping of eight mutant T5 DNA deletions has enabled us to locate and determine the size of these deleted segments . By correlating this information with the presence and absence of specific tDNA sequences in these mutants, as determined by tRNA-DNA hybridization, we were able to define the physical limits of four tDNA-containing loci along the T5 DNA molecule . A physical map for 15 tRNA species examined indicates that the structural genes for these tRNAs are clustered within a segment length of T5 DNA that represents approximately 11.2% of the total wild type T5 DNA . The existence of the deletion mutants indicates that T5 tRNAs are dispensable for T5 replication under the growth conditions and for the host employed.

Biochim Biophys Acta, 1976 Jan 19, 418(2), 175 - 83
The binding site for coat protein on bacteriophage Qbeta RNA; Weber H; The site of interaction of phage Qbeta coat protein with Qbeta RNA was determined by ribonuclease T1 degradation of complexes of coat protein and {32P}-RNA obtained by codialysis of the components from urea into buffer solutions . The degraded complexes were recovered by filtration through nitrocellulose filters, and bound {32P}RNA fragments were extracted and separated by polyacrylamide gel electrophoresis . Fingerprinting and further sequence analysis established that the three main fragments obtained (chain lengths 88, 71 and 27 nucleotides) all consist of sequences extending from the intercistronic region to the beginning of the replicase cistron . These results suggest that in the replication of Qbeta, as in the case of R17, coat protein acts as a translational repressor by binding to the ribosomal initiation site of the replicase cistron.

Mol Gen Genet, 1976 Jan 16, 143(2), 185 - 96
Isolation and characterization of lambdadargECBH transducing phages and heteroduplex analysis of the argECBH cluster; Mazaitis AJ et al.; Transducing lambda bacteriophages have been isolated which carry the divergently transcribed argECBH operon of E . coli K12 and various portions of the adjacent ppc and bfe chromosomal regions . They were recovered from lysates prepared by the procedure of Schrenk and Weisberg using a Ppc+ Arg+ Bfe+ strain carrying a deletion of the usual attachment site of lambda . Heteroduplex DNA mapping of these lumbdadarg and of the phi 80 darg isolated by B . Konrad indicates that the two kinds of phages carry the arg cluster in opposite orientations, a situation favorable for the isolation of argECBH DNA . A physical map of the ppc argECBH bfe region including 2 unusual attachment sites of lambda has been constructed . The localization of the end points of certain arg deletions provides a useful reference framework for the currently pursued mapping of mutations affecting the control of divergent transcription and for the location of restriction enzyme cleavage sites in the arg region.

Biokhimiia, 1976 Jan, 41(1), 192 - 6
{Structure and protein composition of the bacteriophage T2L connector}; Volkova TP et al.; Methods of isolating structural bacteriophage T2 fragments containing: 1 . a fragment consisting of a connector, tail tube and contracted sheath; 2 . a fragment consisting of a free head, a connector and contracted sheath; 3 . a fraction of some free tail tube and some free connectors; 4 . a fraction of some free tail, free connectors and free fibers . The following parameters of connector consisting from a neck and a sleeve, which in its turn consists of a cap and a leg, are determined by means of electrone microscopy: 1) the length and the diameter of a cap and a sleeve being 45 and 145 A respectively; 2) the length and the diameter of a sleeve leg being 45 and 85 A respectively; 3) the length and the diameter of a connector neck being 85 and 70 A respectively . Polyacrylamide gel electrophoresis revealed in connectors proteins having molecular weight of 14 000, 15 000, 26 000 and 35 000 daltons.

Arch Immunol Ther Exp (Warsz), 1976, 24(1), 29 - 37
Morphologic homogeneity of bacteriophages and their biological activity; Krzywy T et al.; Lytic activity of morphologically homogeneous phage lysates, obtained from lysates containing morphologically inhomogeneous virions, was studied . Five series of phage lysates found to contain morphologically inhomogeneous virions were investigated . By selecting suitable hosts from each series, two or three lines were obtained which reproduced morphologically homogeneous virions . Morphologic homogeneity of these phage lines was determined by electron microscopy . In the course of this study it was found that phages with different morphologic appearance can produce similar plaques . Hence, appearance of plaques is not an adequate criterion of homogeneity of the phage . The isolated phages differed in biological activity from the original morphologically inhomogeneous bacteriophage . It was concluded that morphology is an important, and the most reliable at present, criterion of homogeneity of bacteriophages.

Nucleic Acids Res, 1976 Jan, 3(1), 261 - 76
Induced formation of covalent bonds between nucleoprotein components . V . UV or bisulfite induced polynucleotide-protein crosslinkage in bacteriophage MS2; Budowsky EI et al.; UV (lambda = 254 nm) irradiation of bacteriophage MS2 or its treatment with bisulfite induce covalent crosslinkage of the RNA to the coat protein . epilsonN-(2-oxopyrimidyl-4)-lysine was found in the phage hydrolysates after either type of treatment . An equimolar mixture of 0-methylhydroxylamine and bisulfite causes complete disappearance of the cross-links . This led to the conclusion that one of the factors responsible for the UV-induced polynucleotide-protein crosslinkage and the main factor in treatment with bisulfite is substitution of the exocyclic amino group of the activated cytosine nucleus by the lysine residue epilson-amino group of the protein.

Proc Natl Acad Sci U S A, 1976 Jan, 73(1), 49 - 53
A DNA fragment from the origin of single-strand to double-strand DNA replication of bacteriophage fd; Schaller H et al.; A specific complex is formed between fd DNA, Escherichia coli DNA unwinding protein, and RNA polymerase (EC 2.7.7.6; nucleosidetriphosphate:RNA nucleotidyltransferase) during the first steps in the conversion of the single-stranded viral DNA to the double-stranded replicative form . In this complex a unique DNA fragment of about 120 nucleotides is protected against nuclease digestion . Both the requirements for its isolation and its position on the map of the phage genome indicate that the fragment contains the origin of single-strand to double-strand DNA replication . The isolated DNA fragment possesses double-strand-like characteristics, which protect it from being covered by the DNA unwinding protein and thus indirectly positions the RNA polymerase to the origin of replication.

J Supramol Struct, 1976, 5(2), 139 - 53
Immunospecific labeling of mouse lymphocytes in the scanning electron microscope; Carter DP et al.; Bone marrow-derived (B) and thymus-derived (T) Balb/c mouse lymphocytes were identified in the scanning electron microscope (SEM) by the immunospecific attachment of one of several kinds of large-molecular-weight markers distinguishable in SEM . These markers (tobacco mosaic virus, keyhole limpet hemocyanin, bushy stunt virus, and bacteriophage T4) could be modified with hapten groups and linked with anti-hapten antibody, in an indirect (sandwich) scheme, to hapten-modified anti-cell-surface antibody bound to the cell surface . Hapten-modified antibodies to B cell antigens (goat anti-mouse-immunoglobulin) or to T cell antigens (rabbit anti-mouse brain) were employed to identify these two lymphoid cell types in unfractionated spleen, mesenteric lymph node, bone marrow, and thymus cell populations . The topography of B cells was always indistinguishable from that of T cells . No surface features were found to be unique to either cell type . In suspension, the majority of B and T cells had one or no microvilli regardless of the tissue source of the labeled cells . Cells in suspension that had microvilli (usually 10% of the total cell population) were always unlabeled . However, after cell contact with a glass surface, approximately half of both the B and T cell population had a villous topography.

Scand J Immunol, 1976, 5(3), 213 - 9
The role of B-cell memory in secondary IgG and IgM responses; Seppala I et al.; Mice were primed with the hapten 3-nitro-4-hydroxy-5 iodophenacetic acid (NIP) conjugated to chicken globulin (cg) and were boosted 2, 6, or 12 months later with CG conjugates of the related haptens 3,5-diiodo-4-hydroxyphenacetic acid (DIP) or 3-nitro-4-hydroxphenacetic acid (NP) . Accelerated secondary responses were demonstrated both in the 7S and 19S class . Fine-specificities of secondary-response antibodies were studied by the hapten inhibition method of haptenated bacteriophage inactivation . 7S antibodies were found to have the fine-specificity of anti-NIP antibodies regardless of whether DIP or NP was the booster hapten ('original antigenic sin') . 19S antibodies had the fine-specificity of anti-DIP when DIP was the booster hapten . NP as the booster hapten resulted in 19S antibodies whose fine-specificity was intermediate between anti-NIP and anti-NP . A strong B-cell memory could thus be demonstrated in the 7S antibody response and a weak B-cell memory in the 19S antibody response.

Int J Radiat Biol Relat Stud Phys Chem Med, 1976 Jan, 29(1), 51 - 63
Binding of radiation-induced phenylalanine radicals to DNA: influence on the biological activity of the DNA and on its sensitivity to the induction of breaks by gamma-rays; Van der Schans GP et al.; When an aqueous solution of double-stranded DNA of bacteriophage PM2 containing phenylalanine and saturated with N2O is irradiated with gamma-rays, radiation-induced phenylalanine radicals are bound covalently . Under the conditions used, about 25 phenylalanine molecules may be bound per lethal hit . For single-stranded PM2 DNA, most of the phenylalanine radicals bound are non-lethal . Evidence is presented that, in double-stranded DNA, an appreciable fraction of the single-strand breaks is induced by phenylalanine radicals . Radiation products of phenylalanine and the phenylalanine bound to the DNA decrease the sensitivity of the DNA to the induction of single-strand breaks . There are indications that the high efficiency of protection by radiation products of phenylalanine is due to their positive charge, which will result in a relatively high concentrations fo these compounds in the vicinity of the negatively-charged DNA molecules.

J Immunol Methods, 1976, 10(1), 39 - 48
Immunology of DNA . II . The effect of size and structure of the antigen on the Farr assay; Arden LA et al.; The Farr assay for the detecton of antibodies to double stranded (ds) DNA is influenced by the DNA preparations used as antigen . To elucidate this the molecular weight of the antigen preparation, contamination with proteins and presence or absence of single stranded (ss) regions were studied with the following conclusions: 1) The degree of DNA binding by antibodies is linearly dependent on the molecular weight of the DNA, provided that this does not exceed 10 X 10(6) . 2) Deproteinization of E . coli DNA by chromatography on methylated albumin-kieselguhr(MAK) columns results in lower binding by most sera . 3) ds DNA preparations sometimes contain ss regions which bind antibodies to ss DNA . The difference in behaviour of different ds DNA preparations may be ascribed entirely to these factors and not to differences in antigenic determinants . We have standardized the Farr assay and enhanced its specificity by the use of circular DNA isolated from bacteriophage PM2.

Int Arch Allergy Appl Immunol, 1976, 50(1), 111 - 22
Bacteriophage MS-2 in the immune response; Snippe H et al.; Several aspects of the immune response to bacteriophage MS-2 were studied . In thymectomized, irradiated and bone marrow-reconstituted (TXBM) mice, the response was normal when a high dose of antigen was used . With a 50-fold lower dose of MS-2, the response was impaired, indicating a T-cell involvement in antibody formation . More evidence for the (partial) T-cell dependence of MS-2 was obtained from experiments with anti-thymocyte serum or cyclophosphamide-treated mice . (3H)-thymidine incorporation experiments demonstrated that both B and T cells were active upon in vitro stimulation with MS-2 . The dose of MS-2 which was able to induce a normal response in TXBM mice, proved to be optimal for both sensitization and elicitation of a DH . It is concluded that MS-2 is a thymus-dependent antigen which is only thymus independent in high doses.

Gene, 1976, 1(1), 3 - 25
In vitro site-directed mutagenesis: generation and properties of an infectious extracistronic mutant of bacteriophage Qbeta; Domingo E et al.; An infectious extracistronic mutant of phage Qbeta has been prepared by site-directed mutagenesis . Qbeta RNA minus strands containing the mutagenic base analog N4-hydroxy-CMP instead of UMP at position 39 from the 5' end were synthesized in vitro and used as template for Qbeta replicase to synthesize one generation of plus strands . E . coli spheroplasts were infected with the newly synthesized plus strands and phage recovered from single plaques . RNA sequence analysis revealed that four out of the eighteen phage clones analyzed contained RNA with an A leads to G transition at position 40 from the 3' end (which corresponds to position 39 of the minus strand) . Thus, the viability of phage Qbeta does not depend on a unique nucleotide sequence in the 3'-extracistronic RNA segment . Upon in vivo propagation of mutant 40, spontaneous true revertants arose with high frequency and overgrew the parental clone within about 10 passages, indicating a selective disadvantage of the extracistronic mutant . Replication of mixtures of wild type and mutant RNA in vitro resulted in a decrease of the proportion of mutated RNA in the progeny plus strands . The fact that Qbeta RNA containing an A leads to G transition in nucleotide--40 of Qbeta RNA is less efficiently replicated in vitro may explain the selective disadvantage of the mutant phage in vivo . The preparation of an infectious mutated RNA by site-directed mutagenesis shows that the method is suitable to produce specific nucleotide exchanges without impairing the biological competence of the RNA.

Genetika, 1976, 12(8), 86 - 90
{Genetic study of bacteriophage phi81 . I . Isolation, study of complementation and preliminary mapping of amber-mutants of bacteriophage phi81}; Sineokii SP et al.; 123 Amber mutants of lambdoid bacteriophage phi81 are isolated and distributed into 19 complementation groups . Deletion mapping made possible to locate 5 gene groups on the genetic map of bacteriophage phi81 and to determine a region of possible location of mm' sticky ends on the prophage genetic map . A gene of phage phi81 is localized, which controls the adsorption specificity, and which functional similarity to a respective gene of phage phi80 is demonstrated.

Genetika, 1976, 12(7), 109 - 18
{Lethal and mutagenic photodynamic effect of acridine orange on bacteriophage cd}; Kriviskii AS et al.; Both acridine-sensitized inactivation and mutagenesis in phage sd have been studied and compared with the effect of other mutagens . Inactivation curve was not stictly exponential, with a small shoulder at short light doses and deviation of survival lower than 10(-5) . The lethal effect was not reactivated by multiplicity reactivation . Photodynamic damage in phage sd was accompanied by the increase of the rise (but not of the latent) period in the one-step curve of phage multiplication and increase of the burst size . Experiments were carried out at dye concentration of 1-10(-5) M or lower; a strong dark effect of the dye being observed under 2-fold increase of the dye concentration . Plaque-type mutants were formed up to the maximum approximately 1% at the survival approximately 2--10(-5); in comparison with other mutagens photo-sensitized mutagenesis in phage sd was lower . The significant increase in the number of plaque mutants was observed after the illumination of phage fraction surviving the pre-treatment with higher acridine orange concentration (greater than or equal to 2-10(-5)M).

Acta Microbiol Pol A, 1976, 8(1), 3 - 16
Effect of ts mutation in gene 43 of bacteriophage T4 on recombination of the bacteriophage; Klimuszko D et al.; Certain ts mutations in gene 43 of bacteriophage T4 are known to exhibit mutator or antimutator activities with respect to different rII mutations of this phage . The effect of these mutations on recombination frequencies of double mutant strains of phage T4 with genotype rII ts--homoallelic with respect to the ts trait--was examined . The results implicate the essential role of the genetic background in the investigated process.

J Nutr Sci Vitaminol (Tokyo), 1976, 22(5), 347 - 54
Mechanism of inactivation of bacteriophage MS2 containing single-stranded RNA by ascorbic acid; Murata A et al.; The mechanism of inactivation of a single-stranded RNA phage, MS2, by AsA was investigated as a part of the studies on the mechanism of inactivation of viruses by AsA . Investigations on the effects of oxygen, oxidizing or reducing agents, metals or chelating agents, and free radical scavengers on the inactivation of the RNA phage by AsA indicated that the free radical intermediates formed during the course of oxidation of AsA are responsible for the inactivation of the phage . Hydrogen peroxide and DAsA themselves had no effect on the infectivity of the phage . Sucrose density gradient centrifugation analyses indicated that the reactive radicals react with the phage RNA to cause strand scissions in the RNA.

J Gen Virol, 1976 Jan, 30(1), 99 - 112
Bacteriophage MX-1: properties of the phage and its structural proteins; Tsopanakis C et al.; Bacteriophage MX-1 is a virulent DNA phage for Myxococcus . The host range includes strains of Myxococcus xanthus, M . fulvus and M . virescens . The phage has a sedimentation coefficient (S degrees 20,w) of 1145S and a density of 1-531 g/ml . By using SDS-polyacrylamide gel electrophoresis, 23 phage proteins with apparent mol . wt . between 10000 and 150000 were resolved . Gel filtration in the presence of non-ionic detergent partially resolved the proteins . The fraction excluded from Sephadex G-100, fraction 1, contains two glycoproteins . Fraction 1 was resolved into three fractions (1-1, 1-2 and 1-3) by chromatography on Sephadex G-200 . The glycoproteins were present in fraction 1-2; all the proteins from this fraction were derived from the phage tail . Comparison of the amino-acid, hexosamine and neutral-sugar compositions of the two glycoproteins showed that they are distinct molecular species; the smaller molecule is not a subunit of the larger . The significance of these findings is discussed and compared with the proteins of the tails of T-even phage of Escherichia coli.

J Gen Virol, 1976 Jan, 30(1), 141 - 3
A lack of inhibitory action of bacteriophage T4 ghosts in the presence of EDTA; Okamoto K et al.; Adsorption of bacteriophage T4 ghosts on to Escherichia coli cells has been known to cause a dramatic change in the cellular metabolism, the effect being similar to that of colicin K . It is shown here that the inhibitory activity of ghosts is not expressed either at 0 degrees C in the ordinary media (like colicin K) or even at 30 degrees C in a medium containing EDTA, in contrast to colicin K . Since the process of sheath contraction of T4 phage is blocked by EDTA, it is suggested that the adsorbed ghosts may not exert their inhibitory activity until sheath extraction occurs.

Gene, 1976, 1(1), 93 - 106
In vitro construction of bacteriophage lambda and plasmid DNA molecules containing DNA fragments from bacteriophage T4; Velten J et al.; Restriction endonucleases EcoRI and HindIII generated fragments of T4 cytosine-containing DNA were inserted into bacteriophage vector lambdagtSuIII and plasmid vectors pMB9 and pBR313 . Resulting clones were screened for hybridization with 32P labeled T4 tRNA . Recombinant bacteriophages and plasmids were isolated which contained a T4 fragment coding for T4 RNA species 1 and 2 and T4 tRNA Arg . Selected lambda-T4 hybrid bacteriophages were grown to high titer and their DNA analyzed by gel electrophoresis.

Gene, 1976, 1(1), 49 - 63
Propagation in E . coli of bacteriophage lambda with integrated fragments of adenovirus 2 DNA; Tiollais P et al.; Hybrid genomes of bacteriophage lambda with integrated fragments of adenovirus type 2 (Ad2) DNA have been constructed in vitro and propagated in E . coli . DNA from a derivative of bacteriophage lambdaplac5 (Rambach and Tiollais, 1974) was used as a vector . The two fragments of the vector DNA contain all the essential genes for the replication of the lambda DNA but are too short to be encapsidated . Insertion of DNA is therefore essential for plaque formation which constitutes a selection method for phages containing hybrid genomes . Fragments EcoRI-B and EcoRI-F of Ad2 DNA were purified, and separately ligated with the vector fragments . Clones of hybrid phage could readily be isolated . Two clones of hybrid phage containing fragment EcoRI-B inserted in opposite directions were used to study the transcription of adenovirus-specific sequences . Hybridization experiments showed that transcripts from both strands of fragment Ad2-Eco RI-B could be detected and that transcription probably was controlled by the "early" leftward and the "late" rightward promoters on the lambda genome . No polypeptides specified by the adenovirus fragment have so far been identified.

Intervirology, 1976, 7(6), 351 - 5
A correlation between the genome compositions of bacteriophages and their hosts; Gibbs A et al.; The base composition of the genomes of bacteriophages and other viruses is, in a very general way, related to the base composition of the genomes of their hosts by the statistically significant linear regression: (phage GC%)=9.12 + 0.74 (host GC%) . The significance and possible use of this relationship is discussed.

Biochimie, 1976, 58(11-12), 1321 - 7
Lysogenization by bacteriophage lambda IV inhibition of phage DNA synthesis by the products of genes cII and cIII; Kourilsky P et al.; In direct measurements of phage lambda DNA synthesis, we have detected an inhibition caused by the cII and cIII gene products . This inhibition was more clearly observed when P amber phages were grown in a permissive host, presumably because of the limitation in DNA synthesis due to uncomplete suppression . The inhibition takes place in cells infected at high multiplicity, but not in cells infected at low multiplicity . To explain these findings, we propose a model in which the bacterial population is heterogeneous with respect to its ability to support phage DNA synthesis . An initial limitation caused by host factors would be amplified by the action of the cII and cIII products, at high multiplicity only, and the resulting inhibition would be essential in the "choice" towards lysogeny.

Genetika, 1976, 12(9), 79 - 85
{Allele specificity of the mutator action of bacteriophage T4 genes 43 and 32}; Kobets NS et al.; The substitution of tester mutant ri31 (fs-type) for transition mutants rUV30 and rUV48 allowed to reveal new mutator alleles of DNA polymerase gene of phage T4 . In these conditions about 70% alleles of this gene were found to be mutators . Unlike experiments carried out with mutant-tester ri31, in experiments with mutants rUV30 and rUV48 the presence of mutator alleles in gene 32 was demonstrated . The transition pathway AT leads to GC is the preferential direction of the mutation alteration under the action of suppressed amber alleles of genes 43 and 32 . The data obtained suggest allele specificity of the mutator effect in bacteriophage T4.

Genetika, 1976, 12(9), 71 - 8
{Mutator effect of suppressed amber-alleles of early genes of bacteriophage T4}; Alikhanian SI et al.; The mutator effect of amber alleles of three early genes (43, 32, 47), which were suppressed by the bacterial suppressor gene, was studied . There are some advantages in using the suppressed amber alleles instead of ts, because in this case definite amino acid substitutions take place in the protein due to certain suppressor gene effect . For example, in Escherichia coli CR63(Su+-1) the replacement of the original amino acid by serine takes place . Studying the mutator effect of 43 alleles of DNA polymerase gene of phage T4 with tester mutant r131 showed that in condition of suppression by the gene Su+ -1 only 13,9% of alleles possessed the mutator activity . In the same experiments with mutants of genes 32 and 47 the mutator effect was not observed.

Z Allg Mikrobiol, 1976, 16(4), 283 - 7
Mutagenesis in bacteriophage T7 . II . UV induced mutagenesis; Meyer M et al.; UV induced mutagenesis of bacteriophage T7 was investigated by using a forward mutation system (host range system) and a back mutation system (amber system) . The results indicate a dependence of mutation of T7 after UV irradiation only on the rec gene controlled functions of the bacterial host . The functions controlled by pol and uvr genes have no influence . Among other types of mutations UV irradiation leads to transitions from AT to GC.

Z Allg Mikrobiol, 1976, 16(4), 279 - 82
Mutagenesis in bacteriophage T7 . I . Chemically induced mutagenesis; Meyer M; The mutagenesis in phage T7 after MMS-, HNO2-, hydroxylamine-, 5-BUdR-, and 2-AP-treatment in relation to host controlled functions is investigated . There was no dependence of the induction of mutations on the character of the host strains (rec, hcr) . A back mutation system (amber system) and a forward mutation system (host range system) have been used . Substances which cause mainly transitions from GC to AT do not lead or only rarely lead to reversions of the amber system; but chemicals producing transitions from AT to GC do so.

Mol Biol (Mosk), 1976 Jan-Feb, 10(1), 64 - 9
{Influence of proteins bound to single-stranded DNA on RNA and poly(A) synthesis . II . Protein--product of T4 phage gene 32}; Polonskii IS et al.; It has been shown that the protein product of T4 bacteriophage gene 32 (protein 32) completely prevents RNA and poly(A) synthesis on the denatured DNA as a template at the protein/DNA ratio about 13:1 . Under the same conditions protein 32 has no effect on these syntheses on the native DNA and inhibit poly(A) synthesis with oligo(dT)9 and oligo(dT)12 as a template, preventing binding of enzyme with oligonucleotide . It is possible that the unwinded regions of double-stranded DNA within transcription complexes are too small to allow cooperative binding of protein 32 or are unavailable for this protein . We suppose that the protein 32 and other "unwinding" protein plays not only "protective" and "structural" roles but also participates in the regulation of template activity of single-stranded DNA regions in the replicative forks.

Genetika, 1976, 12(4), 109 - 20
{Isolation and study of bacteriophage T4B mutants according to genes functioning at an early stage of the infectious process}; Krylov VN et al.; In previous study irreversible inactivation of rII(ts)-infected lambda-lysogenic bacteria at 42 degrees C was revealed . The inactivationprocess depended on active protein synthesis...

Biochimie, 1976, 58(4), 417 - 25
Attempts to purify a membrane attached chromoid of bacteriophage lambda; Firshein W et al.; Using methods which proved successful for the isolation of E . coli chromosome in a folded form (the E . coli chromoid), we have attempted to purity the "native" form of bacteriophage gamma chromosome from gamma infected cells . Upon sedimentation of lysates we find that phage DNA separates into two fractions, one of which cosediments with the bacterial chromoid ; the other sediments nearer to the top of gradient . Both fractions probably contain membrane-bound phage DNA, and both support the in vivo synthesis of phage DNA . The heavier fraction contains more closed circular parental DNA molecules than the lighter fraction . Formation of the latter is blocked by certain phage mutations . Being relatively free of bacterial DNA, the lighter fraction is suitable for further analysis.

Biokhimiia, 1976 Jan, 41(1), 3 - 13
{Functions of bacteriophage T4 rII genes . Preparatory isolation and several properties of rIIB protein}; Shevchenko NA et al.; A method of preparative isolation of membrane rIIB protein from bacteriophage T4 is worked out . Conditions are found to maximal rIIB protein accumulation in membranes of E . coli cells infected with bacteriophage T4 . The membrane isolation by ultracentrifugation is substituted with their sedimentation from polyethyleneglycol solutions by low-speed centrifugation . A fraction, enriched with rIIB protein, is obtained using the treatment of cell walls with detergents . Preparative polyacrylamide gel electrophoresis in the presence of sodium dodecylsulphate was used for further rIIB protein purification . The method described can be applied for the purification and preparative isolation of memorane and poor-soluble proteins . The problem on location and ufunctioning of rIIB protein is discussed.

Ann Microbiol (Paris), 1976 Jan, 127A(1), 143 - 52
Functional possibilities for aminoacylation of viral RNA in transcription and translation; Hall TC et al.; RNA from at least ten viruses, representing more than four different group, is known to specifically bind in amino acid in a tRNA-like manner . The biological function of aminoacylation of RNA from these viruses and of tRNA association with tumor viruses and bacteriophage, is discussed . Hypothetical schemes are presented for a role for aminoacylation in viral translational and transcriptional mechanisms, and the current evidence relating to these models is presented.

J Immunol Methods, 1976, 11(2), 165 - 70
An improved quantitative plaque assay for lymphocytes bearing antigen-specific cell receptors; Kleinman R et al.; An improved method for the determination of the number of lymphoid cells bearing antigen-specific receptors is described . The method is based on the use of hapten-coupled bacteriophage (dinitrophenyl-T4) and detection of lytic plaques formed by the action of DNP-T4 on a target E . coli strain . The method is highly specific (up to 90% specific binding) and can be adapted for use with other antigenic determinants chemically attached to an active bacteriophage.

Mol Gen Genet, 1975 Dec 30, 143(1), 101 - 4
Genetic map of the beginning of the rIIB cistron of bacteriophage T4; Katz ER et al.; In this report the herefore uncharacterized mutants at the beginning of the rIIB cistron of bacteriophage T4 have been connected to the main part of the map and have been shown not to be in any way unusual . The temperature sensitive mutant HD263 appears to be the earliest mutant in the cistron.

J Biol Chem, 1975 Dec 25, 250(24), 9262 - 9
Gene V protein of fd bacteriophage . Dimer formation and the role of tyrosyl groups in DNA binding; Pretorius HT et al.; Gene V protein exists principally as a dimer in neutral buffers which are 0.15 M in NaCl, NaF, or NaClO4 . Higher concentrations of NaClO4 or NaCl disrupt the dimers, but higher concentrations of NaF do not . There is a single sulfhydryl group per gene V protein monomer in native monomers, dimers, and DNA-protein complexes . Disulfide formation leads to loss of protein solubility and DNA binding capacity . The fluorescence of tyrosyl groups is the same for monomers and dimers in NaCl and NaClO4 solutions, but it is extensively quenched on binding to poly(dT) and fd-DNA . Complexes of gene V protein and fd-DNA isolated from lysates of infected cells were found to contain 4.70- +/- 0.13 nucleotides per monomer of gene V protein whereas complexes formed in vitro contain 4.05 +/- 0.17 nucleotides/monomer . It is postulated that tyrosyl groups are not involved in the protein-protein interactions of the monomer-dimer equilibrium, that tyrosyl groups stack with DNA bases in the complexes, and that each subunit of gene V protein in the intracellular complexes with fd-DNA is replaced by exactly two subunits of major coat protein during final assembly of the virus.

Mol Gen Genet, 1975 Dec 23, 142(1), 57 - 66
Gene expression of bacteriophage SPP1 . II . Regulatory aspects; Esche H; The expression of late SPP1 genes depends on preceding SPP1 DNA replication . This is shown in nonpermissive infection with a mutant defective in DNA replication and after inhibition of DNA synthesis by HPUra . The potential for host gene expression is not significantly influenced by SPP1 infection, as evidenced by the continuation of host protein synthesis and the inducibility of glycerolphosphate dehydrogenase after infection . The involvement of a positive control element in the regulation of SPP1 gene expression is deduced from the observation that chloramphenicol prevents the synthesis of the only class of mRNA which is transcribed from the L-strand.

Biochemistry, 1975 Dec 16, 14(25), 5485 - 91
Physiochemical properties of DNA binding proteins: gene 32 protein of T4 and Escherichia coli unwinding protein; Anderson RA et al.; The single-stranded DNA binding protein coded for by gene 32 of bacteriophage T4 and a similar protein isolated from uninfected Escherichia coli both induce characteristic changes in the circular dichroism (CD) of single-stranded nucleic acids . These CD changes have been adapted as an assay of protein-DNA complex formation . Far-ultraviolet CD spectra show the secondary structure of the two proteins to be similar with approximately 20% alpha helix, approximately 20% beta structure, and 60% random coil . Both proteins show prominent Cotton effects arising from their aromatic chromophores . Nitration of five of the nine tyrosyl residues of gene 32 protein prevents DNA binding, while prior formation of the DNA complex protects all tyrosyl residues from nitration . The tyrosyl residues may participate in gene 32 protein-DNA binding by intercalation between bases of the single strand . In contrast, no tyrosyl residues can be nitrated in the E . coli protein suggesting that surface tyrosyls do not play a part in binding of E . coli protein to DNA . Approximately 50 amino acids can be cleaved from the gene 32 protein with trypsin . This cleavage also occurs spontaneously in infected cell extracts . The remaining protein of mol wt 30000 has the same CD spectra and DNA binding properties as the native protein . The physicochemical properties can be correlated with previous work on the structures and functions of the group of DNA "unwinding proteins".

J Virol, 1975 Dec, 16(6), 1375 - 9
Alkali lability of bacteriophage phi W-14 DNA; Lewis HA et al.; The molecular weight of bacteriophage phi W-14 DNA, determined by velocity sedimentation in neutral sucrose gradients, was 92 +/- 6 X 10(6) . The DNA showed marked fragmentation in alkaline sucrose gradients . This fragmentation was not a consequence of preexisting single-strand interruptions in the DNA, since thermal denaturation of DNA yielded intact single strands . The alpha-putrescinylthymine groups in phi W-14 DNA appeared to be labile; some, or parts of some, of these groups were cleaved from the DNA in alkali.

J Biol Chem, 1975 Dec 10, 250(23), 8973 - 7
Template properties of bacteriophage T4 vegetative DNA . II . Effect of maturation and DNA-arrest mutations; Cox GS et al.; The DNA in gently lysates of T4-infected Escherichia coli cells sediments in sucrose gradients as two major components; the slower sedimenting component is designated as the S-5 fraction and the faster sedimenting component as the pad fraction . The distribution of these fractions in lysates of cells infected with T4 maturation-defective and DNA-arrest mutants was determined, and their template activities were compared in a DNA-dependent amino acid-incorporating system . The S-5 DNA template was found to be completely absent in E . coli B cells infected with a T4 maturation-defective mutant (gene 55) . On the other hand, DNA sedimenting as the S-5 component is greatly increased, while that sedimenting as the pad component is virtually absent in nonpermissive cells infected with a DNA-arrest mutant (gene 46) . The S-5 fractions prepared from cells infected with a DNA ligase mutant (gene 30) and a gene 30 gene 46 double mutant are reduced in their ability to stimulate amino acid incorporation compared to similar preparations from cells infected with wild type T4 or a gene 46 mutant . Moreover, the template activity of partially purified replicative DNA prepared from cells infected with phage-carrying mutations either on gene 30 or in both genes 46 and 56 (dCTPase) is lower than that of DNA obtained from cells infected with wild type phage . The polypeptide products of reaction mixtures programmed with several of the mutant DNAs were found to be qualitatively different from polypeptides synthesized in response to either mature DNA or replicative DNA prepared from cells infected with wild type phage . These data suggest that the expression of phage DNA may be significantly influenced by physical changes in the DNA arising from abnormal replication.

J Biol Chem, 1975 Dec 10, 250(23), 8963 - 72
Template properties of bacteriophage T4 vegetative DNA . I . Isolation and characterization of two template fractions from gently lysed T4-infected bacteria; Cox GS et al.; The synthesis and template properties of T4 vegetative DNA were studied . The DNA-containing material in lysates of cells taken 20 min past T4 infection sediments in sucrose gradients as two major components . Both fractions function as templates for amino acid incorporation in a DNA-dependent in vitro system (coupled transcription-translation) . The slower sedimenting activity is not present in uninfected cells and appears in wild type T4-infected cells only after 12 min at 30 degrees, shortly after DNA synthesis starts . It is dependent for its activity on an added S-30 fraction from either uninfected or T4-infected cells and is completely inhibited by deoxyribonuclease or rifampin . On a weight basis the slower sedimenting template is about 30 to 70% as active as mature T4 DNA when supplemented with S-30 extracts from uninfected cells . The spectrum of proteins synthesized in response to the slower sedimenting template is different from that produced in response to mature T4 DNA . In contrast to mature DNA, this template is capable of directing the synthesis of material that precipitates with antiserum directed against whole T4 particles . Thus, it appears capable of directing the synthesis of mRNA for phage structural proteins, i.e . late proteins . The faster sedimenting component is about 8-fold less active for stimulating amino acid incorporation than mature DNA . Significant amounts of RNA polymerase are associated with this DNA in active transcription complexes, yet polyacrylamide gel electrophoresis of the proteins synthesized in response to this fraction show a pattern that resembles the early proteins made from mature T4 DNA in extracts from uninfected cells.

Mol Gen Genet, 1975 Dec 9, 141(4), 357 - 66
Isolation and properties of a conditionally lethal bacteriophage lambda mutated in the chi region; Nishimoto T et al.; A thermosensitive lambda phage mutant was isolated which can grow at high temperature only in the presence of the lambda chi gene product supplied in trans . This mutation tn was mapped within the chi region, and lambda tn phage expressed the pRoR-OP operon only poorly at high temperature . Effects of the tn mutation on expression of other operons were also examined and compared with those observed with cro27 or some tof mutations.

Mol Gen Genet, 1975 Dec 9, 141(4), 277 - 84
Specificity of the stimulation of in vitro ribonucleic acid synthesis by guanosine 5'-diphosphate 3'-diphosphate; Smolin DE et al.; The in vitro synthesis of ribonucleic acid (RNA) by S-30 extracts of Escherichia coli K-12 is stimulated from two-to fourfold by 0.16 mM to 0.32 mM guanosine 5'-diphosphate 3'-diphosphate (ppGpp) when either gammacI857St68h80 deoxyribonucleic acid (gammah80 DNA), gammah80dilv DNA or gammah80dlac DNA are employed as templates . Hybridization analysis of the 3H-RNA product transcribed from gammah80dilv DNA in the presence of ppGpp indicates that both bacteriophage- and bacterial-specific transcription is stimulated to an equivalent degree . In the absence of cyclic 3'-5'-adenosine monophosphate (cyclic AMP), correct lac-specifci RNA synthesis from gammah80dlac DNA is not stimulated by 0.32 mM ppGpp although total RNA synthesis is increased nearly twofold . In the presence of 0.5 mM cyclic AMP, correct lacspecific RNA synthesis is stimulated preferentially by ppGpp . These data suggest that ppGpp is capable of stimulating in vitro transcription in both a general and selective manner.

J Virol, 1975 Dec, 16(6), 1391 - 400
Bacteriophage T4 baseplate components . I . Binding and location of the folic acid; Kozloff LM et al.; Two different proteins with high affinities for the pteridine ring of folic acid have been used to determine the location of this portion of the folate molecule in the tail plate of T4D and other T-even bacteriophage particles . The two proteins used were (i) antibody specific for folic acid and (ii) the folate-binding protein from bovine milk . Both proteins were examined for their effect on various intact and incomplete phage particles . Intact T2H was weakly inactivated by the antiserum but not by the milk protein . No other intact T-even phage, including T4D, was affected by these two proteins . When incomplete T4D particles were exposed in an in vitro morphogenesis system, it was found that neither of the two proteins affected either the addition of the long tail fibers to fiberless particles or the addition of tail cores to tail plates . On the other hand, these two proteins specifically blocked the addition of T4D gene 11 product to the bottom of T4D baseplates . After the addition of the gene 11 protein, these two reagents did not inhibit the further addition of the gene 12 protein to the baseplate . It can be concluded that the phage folic acid is a tightly bound baseplate constituent and that the pteridine portion of the folic acid is largely covered by the gene 11 protein.

J Virol, 1975 Dec, 16(6), 1669 - 77
Identification of P48 and P54 as components of bacteriophage T4 baseplates; Berget PB et al.; The involvement of two bacteriophage T4 gene products in the initiation of T4 tail tube and sheath polymerization on mature baseplates has been studied by radioautography of acrylamide gels of various partially completed tail structures . The products of genes 48 and 54 (P48{the nomenclature P48 refers to the protein product of bacteriophage T4 gene 48} and P54), which are known to be required for the synthesis of mature baseplates, have been shown to be structural components of the baseplate . These gene products have molecular weights of 42,000 and 33,000, respectively . The addition of P54 to the baseplate not only permits the polymerization of the core protein, P19, onto the baseplate, but also caused the disappearance of a polypeptide of molecular weight about 15,000 from the supernatant fraction of infected cells . Another gene product, P27, has been identified in the crude extracts of infected cells . This gene product, which is required for the synthesis of baseplate structures, has the same mobility as one of the unidentified structural polypeptides of the baseplate and is therefore probably also a baseplate component.

J Virol, 1975 Dec, 16(6), 1409 - 19
Bacteriophage T4 baseplate components . III . Location and properties of the bacteriophage structural thymidylate synthetase; Kozloff LM et al.; Two T4D thymidylate synthetase (td) temperature-sensitive mutants have been isolated and characterized . Both mutants produce heat-labile phage particles . This observation supports the view that this viral-induced protein is a phage structural component . Further, antiserum to td has been shown to block a specific step in tail plate morphogenesis . The results indicated that the td protein is largely covered by the T4D tail plate gene 11 protein . Since the phageinduced dihydrofolate reductase (dfr) also is partially covered by the gene 11 protein, it appears that td was adjacent to the tail plate dfr . This location has been confirmed by constructing a T4D mutant which is dfrtstdts and showing that these two tail plate constituents interact and give altered physical properties to the phage particles produced . A structural relationship for the tail plate folate, dfr, and td has been reported.

Proc Natl Acad Sci U S A, 1975 Dec, 72(12), 4754 - 8
Promoter-dependent transcription of tRNAITyr genes using DNA fragments produced by restriction enzymes; Kupper H et al.; Two DNA fragments prepared from the transducing bacteriophage strains o80psuIII+ and o80hpsuIII+,- by digestion with restriction enzymes contain one tyrosine tRNA gene (suIII+) and two tyrosine tRNA genes (suIII+, su-) in tandem, respectively, a single promoter in both cases, and some additional DNA regions at the two ends of both . Using these fragments, we have studied characteristics of the promoter-dependent transcription of the tyrosine tRNA genes . The promoter-dependent transcripts were shown to correspond to the expected tRNA precursors . Exposure of the transcript from the single gene fragment to an S100 extract from Escherichia coli gave, via intermediates, 4S material which was active in enzymatically accepting tyrosine and contained some modified bases.

Proc Natl Acad Sci U S A, 1975 Dec, 72(12), 4734 - 8
How ribosomes select initiator regions in mRNA: base pair formation between the 3' terminus of 16S rRNA and the mRNA during initiation of protein synthesis in Escherichia coli; Steitz JA et al.; Initiation complexes formed by E . coli ribosomes in the presence of 32P-labeled A protein initiator region from R17 bacteriophage Rna have been treated with colicin E3 and disassembled by exposure to 1% sodium dodecyl sulfate . Electrophoresis on 9% polyacrylamide gels reveals a dissociable complex containing the 30-nucleotide-long messenger fragment and the 50-nucleotide-long colicin fragment, which arises from the 3' terminus of the 16S RNA . The complex is a pure RNA-RNA hybird; it is apparently maintained by a seven-base complementarity between the two RNA fragments . Detection of this mRNA-rRNA complex strongly supports the hypothesis that during the initiation step of protein biosynthesis the 3' end of 16S RNA base pairs with the polypurine stretch common to initiator regions in E . coli and bacteriophage mRNAs . The implications of our findings with respect to the molecular mechanism of initiation site selection and mRNA binding to ribosomes, the role of rRNA in ribosome function, and species specificity in translation are explored.

Mol Gen Genet, 1975 Dec 1, 141(3), 213 - 232
Studies on bacteriophage T7 DNA synthesis in vitro . I . Resolution of the T7 replication system into its components; Scherzinger E et al.; A soluble extract prepared from T7-infected E . coli is able to initiate DNA synthesis on an exogenous T7 DNA template . We have developed a fractionation procedure to resolve and identify the proteins required for T7 DNA synthesis . By this method we have purified the following T7 replication-related proteins (each greater than 50% pure as judged by sodium dodecyl sulfate gel electrophoresis): T7 DNA-binding protein (27,000 daltons), T7 RNA polymerase (105,000 daltons), T7 DNA polymerase (gene 5-protein, 85,000 daltons, plus host-factor), T7 DNA ligase (40,000 daltons), and T7 DNA-priming protein (65,000 daltons) . The T7 DNA-priming protein, synthesized between 7.5 and 15 min following infection, was not detectable if the infecting phage carried an amber mutation in gene 4 . Using an in vitro complementation assay which specifically measures the stimulation of DNA synthesis in an extract prepared from T7 gene 4-mutant infected cells, we have purified the DNA-priming protein about 2,000-fold . The purified priming protein preparations are essentially free of endonuclease, exonuclease, DNA ligase and DNA polymerase activity, but they do contain measurable DNA-dependent RNA synthetic acitvity . The enzyme is rapidly inactivated by heating to 46 degrees C and by treatment with N-ethylmalemide . In the presence of T7 DNA-binding protein and all four ribonucleoside triphosphates, the DNA-priming protein enables T7 DNA polymerase to initiate DNA synthesis on intact duplex T7 DNA . Closer studies of its enzymatic function as well as of the possible roles of the other proteins in the T7 replication system will be presented in the accompanying paper.

J Virol, 1975 Dec, 16(6), 1683 - 7
Chemical stability of bacteriophage T7 early mRNA; Yamada Y et al.; T7 early mRNA produced by a gene 1 amber mutant phage, T7 am27, is chemically stable interms of acid insolubility and T7 DNA hybridizability . However, the messenger activity of individual T7 early mRNA species, transcripts of gene 1, gene 0.7, and gene 1.3, decay with a half-life of about 6.5 min at 30 C . An extensive secondary structure is present in all T7 early mRNA species and is probably responsible for the chemical stability of the RNAs after the loss of functional activity . It is unlikely that ribosomes protect T7 early mRNA from nucleolytic degradation.

J Virol, 1975 Dec, 16(6), 1547 - 59
Bacteriophage P22 virion protein which performs an essential early function . II . Characterization of the gene 16 function; Hoffman B et al.; P16 is a virion protein and, as such, is incorporated into the phage head as a step in morphogenesis . The role of P16 in assembly is not essential since particles are formed without this protein which appear normal by electron microscopy . P16 is essential when the particle infects a cell in the following cycle of infection . In the absence of functional P16, the infection does not appear to proceed beyond release of phage DNA from the capsid . No known genes are expressed, no DNA is transcribed, and the host cell survives the infection, continuing to grow and divide normally . The P16 function is required only during infection for the expression of phage functions . Induction in the absence of P16 proceeds with the expression of early and late genes and results in particle formation . P16 must be incorporated during morphogenesis into progeny particles after both infection and induction for the progeny to be infectious . The P16 function is necessary for transduction as well as for infection . Its activity is independent of new protein synthesis and it is not under immunity control . P16 can act in trans, but appears to act preferentially on the phage or phage DNA with which it is packaged . The data from complementation studies are compatible with P16 release from the capsid with the phage DNA . In the absence of P16 the infection is blocked, but the phage genome is not degraded . The various roles which have been ruled out for P16 are: (i) an early regulatory function, (ii) an enzymatic activity necessary for phage production, (iii) protection of phage DNA from host degradation enzymes, (iv) any generalized alteration of the host cell, (v) binding parental DNA to the replication complex, and (vi) any direct involvement in the replication of P22 DNA . P16 can be responsible for: (i) complete release of the DNA and disengagement from the capsid, (ii) bringing the released DNA to some necessary cell site or compartment such as the cytoplasm, (iii) removal of other virion proteins from the injected DNA, and (iv) alterations of the structure of the injected DNA.

J Virol, 1975 Dec, 16(6), 1536 - 46
Bacteriophage P22 virion protein which performs an essential early function . I . Analysis of 16-ts mutants; Hoffman B et al.; The product of gene 16 of phage P22, P16, is a head protein . P16 does not play an essential role in phage assembly since particles formed without this protein appear normal by electron microscopy examination (Botstein et al., 1973) . P16 is essential when the particle infects a cell in the following cycle of infection (Botstein et al., 1973; King et al., 1973) . We have characterized a mutant of P22 carrying a temperature-sensitive allele of gene 16 . This mutant has previously been referred to as P22 25-ts (Levine et al., 1970, 1972) and P22 X-ts (Bezdek and Soska, 1970, 1973) . P22 16-ts behaves as an early mutant at the nonpermissive temperature . Temperature shift experiments show that P16 of the infecting virion acts within the first 10 min at 25 C and that gene 16 product is required late in the latent period for incorporation into infectious phage . Induction does not require P16 for the production of particles . Particles produced either in a P22 16-ts thermal shift-up infection or after induction of 16-ts lysogens at 41 C are missing P16 and are, therefore, defective . P16 in P22 16-ts virions formed at the permissive temperature appears to be heat labile; it is inactivated after infection at 41 C . A simple assay for defective particles based on a complementation test is described.

J Virol, 1975 Dec, 16(6), 1483 - 91
F-Factor-mediated restriction of bacteriophage T7: protein synthesis in cell-free systems from T7-infected Escherichia coli F- and F+ cells; Yamada Y et al.; A characteristic phenomenon in the F-factor-mediated inhibition of T7 phage is a virtual absence of T7 late protein synthesis in T7-infected Escherichia coli male cells, in spite of the presence of T7 late mRNA which is translatable in vitro when isolated from the cell . To determine whether the translational defect in T7-infected F+ cells is due to a T7 late mRNA-specific translational block, or to a general decrease of F+ cell translational activity, we compared the activities of cell-free, protein-synthesizing systems prepared from isogenic F- and F+ cells harvested at different times of T7 infection . The cell-free systems from uninfected F- and F+ cells translated T7late mRNA equally as well as MS2 RNA and T7early mRNA . The activity of cell-free systems from T7-infected F+ cells to translate MS2 RAN, T7 early mRNA, and T7 late mRNA decreased concomitantly at a much faster rate than that of T7-infected F- cells . Therefore, the abortive infection of F+ cells by T7 does not result from a T7 late mRNA-specific translational inhibition, although a general reduction of the translational activity appears to be a major factor for the inability of the F+ cells to produce a sufficient amount of T7 late proteins.

J Virol, 1975 Dec, 16(6), 1380 - 90
F-Factor-mediated restriction of bacteriophage T7: synthesis of RNA and protein in T7-infected Escherichia coli F- and F+ cells; Whitaker PA et al.; Bacteriophage T7 is unable to productively infect Escherichia coli strains carrying the sex factor F . T7 phage development, in terms of RNA and protein synthesis, was compared in T7-infected isogenic F- and F+ strains of E . coli . Slightly less T7 early mRNA and early protein were synthesized in F+ cells . In addition to the defect in T7 late protein production in F+ cells reported by others, significantly less T7 late mRNA was synthesized, about one-half of that produced in T7-infected F- cells . Moreover, host RNA synthesis was not completely inhibited . The protein-synthesizing ability of T7-infected F+ cells decayed much faster than that of F- cells both in vivo and in vitro . This faster decay appears to explain the failure of F+ cells to produce T7 late protein in vivo, even in the presence of a considerable amount of translatable T7 late mRNA . Therefore, it may not be necessary to postulate the involvement of specific translational discrimination against T7 late mRNA, although it appears that F-factor-mediated restriction of T7 involves changes in transcription as well as translation.

J Bacteriol, 1975 Dec, 124(3), 1403 - 10
Excision of bacteriophage lambda from a site in the arabinose B gene; Kaplan S et al.; A lambda lysogen with the prophage inserted into the arabinose B gene of Escherichia coli strain K-12 has been prepared . Induction of the phage from this lysogen yields viable phage at a frequency 4 X 10(-6) that found for induction of lysogens with phage inserted at the normal attachment site . Over 30% of the phage particles induced from the insertion in ara are arabinose-transducing phage . The excision end points of 62 independently isolated, nondefective araC-transducing phage containing less than the entire araC gene were genetically determined and were found to be randomly distributed through the araC gene . The amount of arabinose deoxyribonucleic acid contained on four selected transducing phage was determined by electron microscopy of deoxyribonucleic acid heteroduplexes, providing a physical map of the araC gene . The efficiency with which these phage transduce araC and araB point mutations was found to be approximately proportional to the homology length available for recombination.

J Bacteriol, 1975 Dec, 124(3), 1395 - 402
Deoxyribonucleic acid modification by intermediate-type modification mutants of Escherichia coli K-12 and B; Bulkacz J et al.; The modification of bacteriophages grown on r-m+/- restriction and modification mutants of Escherichia coli K-12 or B appears to be related to the number of restriction-specific sites in the viral genome . Bacteriophage fd and its mutant U1 fd, which carry two and one B-specific sites, respectively, are not modified in vivo by rB-mB+/- mutant strains . In vitro treatment of fd RF-B+/- deoxyribonucleic acid (DNA) or U1 fd RF-B+/- DNA by endo R-Eco B results in cleavage of the substrate DNA . Lambda bacteriophage, after growth in r-m+/- mutant host strains (lambda-K+/- or lambda-B+/-), is partially protected from in vivo degradation by wild-type homospecific strains . Its efficiency of plating on these strains is approximately 10(-2) . However, a hybrid phi80-lambda phage which carries only one K-specific site (sklambda-1) is not modified by rK-mK+/- strains . Labeled DNAs from lambda-B+/- and lambda-K+/- phages were used as substrates for endo R-Eco B and endo R-Eco K nucleases . Zonal centrifugation analysis of the products of the reactions indicate that rK-mK+/- mutants do not protect lambda DNA from in vitro degradation by endo R-Eco K . In contrast, rB-mB+/- mutants appear to partially protect lambda DNA from attack by endo R-Eco B.

Proc Natl Acad Sci U S A, 1975 Dec, 72(12), 4800 - 4
Reconstruction of bacteriophage T4 DNA replication apparatus from purified components: rolling circle replication following de novo chain initiation on a single-stranded circular DNA template; Morris CF et al.; The protein products of T4 bacteriophage genes 41, 43, 45, 44, and 62 have been purified to near homogeneity using an assay which measures their stimulation of DNA synthesis in a crude lysate of Escherichia coli cells in fected by an appropriate mutant phage . When all of these proteins and T4 gene 32 protein are incubated in the presence of deoxyribonucleoside and ribonucleoside triphosphates, extensive DNA synthesis occurs on both single and double-stranded DNA templates . Analysis of this in vitro system reveals most of the features attributed to in vivo DNA replication: (1) De novo DNA chain initiation is found on a single-stranded DNA template only if ribonucleoside triphosphates are present (as expected for RNA priming of Okazaki pieces on the "lagging" strand of a replication fork) . (2) With single-stranded circular DNA as template, synthesis continues for many doublings . The products after extensive synthesis resemble a rolling circle as visualized in the electron microscope, with discontinuous "lagging" strand synthesis generating a long, unbranched double-stranded tail . The fact that all six mutationally identified T4 replication gene products are required for these syntheses suggests the existence of a large multienzyme complex, constituting the T4 replication apparatus.

Proc Natl Acad Sci U S A, 1975 Dec, 72(12), 4810 - 4
Human papillomavirus DNA: physical map; Favre M et al.; Human papillomavirus (HPV) DNA form I (supercoiled) was prepared from plantar warts . HPV DNA was cleaved with restriction enzymes obtained from the following sources: escherichia coli (EcoRI), Hemophilus influenzae strain Rd (both unfractionated Hind and aeparated HindII and HindIII enzymes) and Hemophilus parainfluenzae (HpaI) . The cleavage products were analyzed by polyacrylamide gradient slab gel electrophoresis and electron microscopy . HPV DNA was cleaved into two fragments by EcoRI (87% and 13% of the genome) and into six fragments, ranging in size from 33.5 to 1.2% of the genome, by Hind endonucleases . The six Hind fragments result from the cleavage of three sequences recognized by HindII, two of which are also cleaved by HpaI, and of three sequence recognized by HindIII . The order of these fragments was determined by comparing their size with that of the fragments obtained with HindII, HindIII, HpaI, and the mixture of HindIII + Hpal . The two EcoRI cleavage sites were located on two adjacent Hind fragments and one of these sites has been taken for the zero point to construct a physical map . The treatment of superhelical HPV DNA with bacteriophage T4 gene 32 protein yields circular structures with a denaturation loop . The cleavage of these complexes with EcoRI and HindIII has shown two easily denatured regions which were located on the cleavage map.

Eur J Biochem, 1975 Dec 1, 60(1), 227 - 38
ADP-ribosylation of DNA-dependent RNA polymerase of Escherichia coli by an NAD+: protein ADP-ribosyltransferase from bacteriophage T4; Rohrer H et al.; A protein from bacteriophage T4 responsible for the alteration of host DNA-dependent RNA polymerase and absent in T4 alt- phage was purified from T4 phage and enriched from T4-infected cells . It is injected during infection together with the known internal proteins . It has a molecular weight of about 70000 and catalyses the release of nicotinamide and the transfer of the ADP-ribosyl moiety from NAD+ to arginyl residues of various proteins including itself . RNA polymerase from Escherichia coli accepts ADP-ribosyl residues in all four subunits; the alpha subunit reacts with very high specificity . Only half of the alpha subunits are labelled, 45% with one, 5% with two residues . The main product shows the same electrophoretic mobility as alpha subunits altered or modified in vivo . The alpha subunit in modified RNA polymerase is no acceptor.

Chem Biol Interact, 1975 Dec, 11(6), 575 - 88
Assays for phosphotriester formation in the reaction of bacteriophage R17 with a group of alkylating agents; Shooter KV; The interaction of bacteriophage R17 with 8 compounds has been studied, comparing the contribution of degradation of ribonucleic acid to the total toxicity . Breaks in the RNA chain result from the hydrolysis of phosphotriesters and thus are a measure of the extent of O-alkylation and of the SN1-type mechanism of the reaction . With many alkylating agents mutagenicity and carcinogencity increase with increasing SN1 character of the reaction . In experiments with methyl methanesulphonate no evidence of degradation was observed at up to 19 times the mean lethal dose (620 methylations/RNA molecule) . Breaks in the RNA chain accounted for 1 in 10 of the lethal lesions with beta-hydroxyethyl methanesulphonate, 1 in 60 with bis-(2-chloromethyl)methylamine (nitrogen mustard, HN2), less than 1 in 125 with 2,2-dichlorvinyl dimethyl phospate (dichlorovos, DDVP), and 1 in 200 with propylene oxide . The hydrolysis rate of bis-(2 chloroethyl)ether was too slow for any reaction to be detected . In reactions with the carcinogen bis-(2-chloromethyl)ether the toxicity observed could be accounted for by the formaldehyde produced on hydrolysis . Cross-linking of the bacteriophage components by formaldehyde reduced the survival range over which the physical state of the RNA could be studied . No evidence of RNA degradation was observed . Reaction of the formaldehyde led to a progressive loss of biological activity over 24 h, a loss which was partially reversed by dialysis.

Chem Biol Interact, 1975 Dec, 11(6), 563 - 73
The inactivation of bacteriophage R17 by ethylating agents: the lethal lesions; Shooter KV et al.; The biological inactivation of bacteriophage R17 by ethyl methanesulphonate (EMS) and N-ethyl-N-nitrosourea (ENUA) has been studied . At the mean lethal dose for the first compound 8 moles ethyl are bound/mole RNA and with the nitroso compound 3.5 moles ethyl are bound . Analysis of the amounts of the different ethylated derivatives formed shows that the toxicity of the sulphonate can be accounted for by the formation of 3-ethylcytosine, O6-ethylguanine, 1-ethyladenine and chain breaks produced on the hydrolysis of ethyl phosphotriesters . With the nitroso derivative on the other hand, the sum of chain breaks and of bases alkylated on a position involved in specific hydrogen bonding between base pairs only accounts for 65% of the observed toxicity . The possibility that 3-ethyladenine may constitute a lethal lesion is discussed.

Arch Int Physiol Biochim, 1975 Dec, 83(5), 909 - 48
Structure and function of RNA replicase of bacteriophage Qbeta; Kondo M; (1) The RNA replicase induced by bacteriophage Qbeta consists of four non-identical subunits designated as alpha (mol . wt . 74000), beta (mol . wt . 64000), gamma (mol . wt . 47000) and delta (mol . wt . 33000), only one (subunit beta) of which is specified by the phage genome . (2) Subunit alpha (30 S ribosomal protein "S1" as well as translational interference factor "i") is required only for (+) strand-directed RNA synthesis in the presence of the host factor . (3) Qbeta replicase lacking subunit alpha (R-alpha) is capable of replicating templates other than (+) strand, such as (--), "6S" RNA, poly(C) etc., in the absence of the host factor . (4) Subunit beta is suggested to be the nucleotide-polymerizing enzyme, but is unable to initiate RNA synthesis by itself . (5) Subunits gamma and delta are identical to the protein synthesis elongation factors, EF-Tu and EF-Ts, respectively, and are required only for initiation of RNA synthesis, but not for elongation . (6) A model of Qbeta replicase is presented in order to discuss observed template-enzyme interactions.

Mol Gen Genet, 1975 Dec 1, 141(3), 233 - 49
Studies on bacteriophage T7 DNA synthesis in vitro . II . Reconstitution of the T7 replication system using purified proteins; Scherzinger E et al.; DNA synthesis in vitro using intact duplex T7 DNA as template is dependent on a novel group of three phage T7-induced proteins: DNA-priming protein (activity which complements a cell extract lacking the T7 gene 4-protein), T7 DNA polymerase (gene 5-protein plus host factor), and T7 DNA-binding protein . The reaction requires, in addition to the four deoxyribonucleoside triphosphates, all four ribonucleoside triphosphates and is inhibited by low concentrations of actinomycin D . Evidence is presented that the priming protein serves as a novel RNA polymerase to form a priming segment which is subsequently extended by T7 DNA polymerase . T7 RNA polymerase (gene 1-protein) can only partially substitute for the DNA-priming protein . At 30 degrees C, deoxyribonucleotide incorporation proceeds for more than 2 hours and the amount of newly synthesized DNA can exceed the amount of template DNA by 10-fold . The products of synthesis are not covalently attached to the template and sediment as short (12S) DNA chains in alkaline sucrose gradients . Sealing of these fragments into DNA of higher molecular weight requires the presence of E.coli DNA polymerase I and T7 ligase . Examination of the products in the electron microscope reveals many large, forked molecules and a few "eye"-shaped structures resembling the early replicative intermediates normally observed in vivo.

J Immunol, 1975 Dec, 115(6), 1549 - 54
Determinants of the hierarchy of humoral immune responsiveness during ontogeny; Sherwin WK et al.; A model system of ontogeny was utilized to investigate the development of humoral immunity in both AKR and BALB/c mice . Lethally irradiated adult mice were reconstituted with syngeneic fetal or neonatal liver . These mice were immunized at various times after reconstitution with a series of eight antigens: the bacteriophages F2, phiX-174, and T4; the hapten carrier complexes 2,4 dinitrophenyl-bovine serum albumin and fluorescein-bovine serum albumin; and the small proteins: hen egg lysozyme, sperm whale myoglobin, and bovine pancreatic ribonuclease . Subsequent antibody production to the antigens was assayed with either a direct or a modified bacteriophage neutralization technique . Individual mice responded to the various antigens in a sequential pattern which was basically the same for all mice within each strain . However, there was a marked difference between the two strains in the time at which they developed responsiveness to myoglobin . In order to begin to delineate the separate roles played by B and T cells in the generation of this hierarchical response pattern during ontogeny, the development of anti-DNP and anti-FTC activity was examined in carrier-primed mice . Results of this experiment indicated that functional B cell specificities for the two haptens arise at different times during ontogeny . Further studies are needed to determine whether the hierarchical pattern of immune responsiveness observed for the other antigens is a function of sequential appearance of B cell specificities, T cell specificities, or both.

J Gen Virol, 1975 Dec, 29(3), 267 - 80
Disruption of Vi bacteriophage III and localization of its deacetylase activity; Kwiatkowski B et al.; It has been shown that particles of Vi bacteriophage III catalyse deacetylation of O-acetyl pectic (polygalacturonic) acid, a structural analogue of Vi polysaccharide (Vi antigen) . Using this substrate, and determining the acetic acid liberated by gas-liquid chromatogrphy, a method for the estimation of Vi phage deacetylase activity has been developed . Purified particles of Vi phage III were exposed to a variety of mildly dissociative reagents and conditions, and then tested for plaque-forming and for deacetylase activity . They have also been inspected under the electron microscope . Osmotic shock, and incubation in the presence of ethylenediamine tetraacetic acid (greater than or equil 0-01 M), or of L-arginine (0-25 M), were found to cause disintegration of the virions into empty head capsids, deoxyribonucleic acid, and base plates still carrying the spikes . The mixtures of viral fragments exhibited an increased deacetylase activity . Using zonal sedimentation and ion exchange chromatography, the phage fragments obtained by treatment with ethylenediaminetetraacetic acid have been fractionated and the base plates isolated . Amongst the viral components, these structures showed the highest specific deacetylase activity . They had the shape of six-pointed stars (about 9-5 nm inner, and 14-5 nm outer diam.) with a central hole or plug (approximately 3 nm), carrying six spikes, roughly cylindrical organelles of approx . 11 X 4 nm, one at each of the points . Of the polypeptides of six sizes (P.1, about 153,000 daltons; P.2, 91,000; P.3, 71,000; P.4 56,500; P.6, 22,000), detected in whole Vi phage III virions by sodium dodecyl sulphate-polyacrylamide gel electrophoresis, only two, P.2 and P.3 were found in the base plates.

J Virol, 1975 Dec, 16(6), 1401 - 8
Bacteriophage T4 baseplate components . II . Binding and location of bacteriophage-induced dihydrofolate reductase; Kozloff LM et al.; The location of T4D phage-induced dihydrofolate reductase (dfr) has been determined in intact and incomplete phage particles . It has been found that phage mutants inducing a temperature-sensitive dfr (dfrts) procude heat-labile phage particles . The structural dfr produced by these ts mutants was shown to assume different configurations depending on the temperature at which the phage is assembled . Morphogenesis of incomplete phage particles lacking the gene 11 protein on their baseplates was found to be inhibited by reagents binding to dfr, such as antibodies to dfr . Further, cofactor molecules for dfr, such as reduced nicotinamide adenine dinucleotide phosphate and reduced nicotinamide adenine dinucleotide, also inhibited the step in morphogenesis involving the addition of gene 11 product . On the other hand, inhibitors of dfr, such as adenosine dephosphoribose, stimulated the addition of the gene 11 protein . It has been concluded that the phage-induced dfr is a baseplate component which is partially covered by the gene 11 protein . The properties of phage particles produced after infection of the nonpermissive host with the one known T4D mutant containing a nonsense mutation in its dfr gene suggested that these progeny particles contained a partial polypeptide, which was large enough to serve as a structural element.

J Biol Chem, 1975 Nov 25, 250(22), 8748 - 52
Action of bacteriophage T4 ultraviolet endonuclease on duplex DNA containing one ultraviolet-irradiated strand; Simon TJ et al.; Previous studies have indicated that the ultraviolet endonuclease of bacteriophage T4 acts specifically at pyrimidine dimer sites in ultraviolet-irradiated DNA . At such sites the enzyme could conceivably catalyze endonucleolytic incision of the DNA either on the dimer-containing strand or on the strand directly opposite to the dimer . In the present work, a direct test of these alternatives was made . Substrate molecules containing one irradiated and one unirradiated strand were prepared from differentially isotopically labeled purified complementary strands of bacteriophage lambdaDNA . Following incubation with the enzyme, the sedimentation profiles of the DNA strands in alkaline sucrose density gradients were compared . The results show that the enzyme selectively nicks the irradiated strand.

J Biol Chem, 1975 Nov 25, 250(22), 8696 - 703
Isolation and characterization of a bacteriophage polysaccharide; Oeltmann TN et al.; A high molecular weight heteropolysaccharide, composed of glucose, glucuronic acid, N-acetylglucosamine, and mannose in an approximate molar ratio of 1:2:2:5, respectively, was isolated from phage K-2 and from the soluble fraction of phage-infected Aerobacter aerogenes lysates . Treatment of pure phage with 8 M urea at 4 degrees quantitatively solubilizes the bound polysaccharide and capsular polysaccharide (Yurewicz, E.C., Ghalambor, M.A., Duckworth, D.H., and Heath, E.C . (1971) J . Biol . Chem . 246, 5607-5616) with the release of only traces of other phage constituents; on this basis, it was concluded that the polysaccharide, like the the glycanohydrolase, is externally localized in the phage structure . Phage polysaccharide and glycanohydrolase fractionate similarly on ion exchange resins and gel electrophoresis in sodium dodecyl sulfate, but each may be purified to homogeneity by the procedures employed . The biosynthesis of the polysaccharide was shown to be uniquely dependent upon phage K-2 infection by: (a) absence of the polysaccharide in cells, the culture filtrate, or sonicated extracts of uninfected cells; (b) kinetics of polysaccharide synthesis following phage infection; and (c) isotopic double-labeling experiments that demonstrated the synthesis of polysaccharide only after initiation of phage replication in infected cells.

J Biol Chem, 1975 Nov 25, 250(22), 8848 - 55
Specificity of the S1 nuclease from Aspergillus oryzae; Wiegand RC et al.; Conditions are described for digesting single-stranded DNA by S1 nuclease without introducing breaks in double-stranded DNA . The enzyme is inhibited by low concentrations of various compounds of phosphate . Under certain conditions S1 nuclease cleaves the strand opposite a nick in bacteriophage T5 DNA; under other conditions, the enzyme cleaves a loop in one strand of heteroduplex lambdaDNA while leaving the opposite strand intact . S1 nuclease makes many single strand breaks in ultraviolet-irradiated duplex lambdaDNA . Superhelical DNA of phiX174 (Form I) is converted first to a relaxed circular molecule (Form II), and then to a linear molecule (Form III) by cleavage at one site per molecule . Since the cleavage occurs at many sites in the population of molecules, the partially single-stranded regions in phiX174 superhelical DNA are not determined by specific nucleotide sequences.

Mol Gen Genet, 1975 Nov 24, 141(2), 163 - 71
Genetic consequences of transfection with heterduplex bacteriophage lambda DNA; White RL et al.; The role of rectification of heteroduplex heterozygotes in the formation of recombinant genotypes involving closely linked markers has been examined . Heteroduplex molecules of bacteriophage lambda DNA, heterozygous at several alleles, have been constructed and the genetic composition of phage present in infective centers derived by transfection with such molecules has been determined . Allele loss and concomitant recombinant formation is frequent, and appears to reflect marker specificity as well as specificities imposed by whether or not the transfection recipient is permissive or nonpermissive for DNA duplication of the transfecting genome . The observations support the proposal that many, perhaps most, of the events involving separation of closely linked markers occur by rectification of non-recombinant heterozygotes.

Eur J Biochem, 1975 Nov 15, 59(2), 387 - 94
Immunochemical studies on tyrosinase induction in Neurospora; Katan T et al.; An immunoassay for tyrosinase, using the modified bacteriophage technique, was developed: Tyrosinase of Neurospora was conjugated to bacteriophage T4 using glutaraldehyde as a cross-linking agent . The conjugated phage that survived the coupling process could be inactivated by antiserum raised in rabbits against pure tyrosinase, but not by normal serum . This inactivation was specifically inhibited by pure Neurospora tyrosinase, and the degree of inhibition was proportional to the concentration of tyrosinase within the range of 30-150 ng/ml . Crude mycelial extract possessing tyrosinase activity could similarly inhibit the inactivation of the conjugated phage by the antiserum . To evaluate the tyrosinase content of crude extracts their inhibitory capacity was compared to that of known amounts of pure tyrosinase, and the amounts thus calculated agreed with those predicted from an enzymatic assay . The tyrosinase-bacteriophage immunoassay was used for the quantitation of tyrosinase-antigen in crude extracts of Neurospora cultures that had been induced to form tyrosinase by the addition of ethionine . Enzymatic activity appeared after a lag of several hours, increased for 2-3days and then declined . Immunological assays of these cultures showed: (a) serologically reactive protein started to accumulate upon culture starvation and was evident during the lag period; (b) specific activity (units per mg antigen) was constant throughout induction; (c) at the phase of decrease in mycelial enzyme content, increasing amounts of serologically reactive protein were detected in the medium, indicating that some enzyme was eventually excreted . These results show that the lag is not a qualitatively distinct period, and support the previously forwarded notion that tyrosinase is synthesized de novo upon induction.

Arch Microbiol, 1975 Nov 7, 105(3), 217 - 24
Gene transfer agents, bacteriophages, and bacteriocins of Rhodopseudomonas capsulata; Wall JD et al.; Thirty-three wild type strains of Rhodopseudomonas capsulata were examined for ability to engage in genetic recombination through mediation by "gene transfer agent" (GTA) particles . The genetic exchange assays were based on capacity of strains to produce or receive GTA required for restoration of photosynthetic growth competence to a non-photosynthetic "white" mutant or for acquisition of resistance to rifampicin . A majority of the strains could either produce or receive GTA, and it was demonstrated that the agent is species specific . Possible relations between GTA and bacteriophages or bacteriocins were investigated . Sixteen types of virulent phages active on Rps . capsulata were isolated and their host ranges determined . Tests for transduction by the phages gave uniformly negative results . The viruses showed strict species specificity, but there was no apparent correlation between capacity of the Rps . capsulata strains to donate or receive GTA and susceptibility to the phages . A comparable survey disclosed that most of the bacterial strains were sensitive to or capable of producing bacteriocins; the latter also appear to be unrelated to GTA activity . The collection of bacterial strains was also screened for detection of lysogenic properties . None of the isolates is a "true" lysogen, but phages were detected in cultures of two strains, which may be "phage carriers" or pseudolysogens.

Arch Microbiol, 1975 Nov 7, 105(3), 207 - 16
Characterization of Rhodopseudomonas capsulata; Weaver PF et al.; Thirty-three strains of Rhodopseudomonas capsulata have been studied in order to develop a more comprehensive characterization of the species . On the basis of morphological, nutritional, physiological and other properties, the characteristics of an "ideal biotype" have been defined, which can be used to distinguish Rps . capsulata from similar purple bacteria . In this connection, two properties of Rps . capsulata are of particular note: a) sensitivity to penicillin G is 10(3)-10(5) times greater than that shown by closely related species, and b) all strains examined are susceptible to lysis by one or more strains of host species-specific virulent bacteriophages . It appears that members of the species Rps . capsulata form a stringent taxonomic grouping.

Mol Gen Genet, 1975 Nov 3, 141(1), 23 - 40
Transversion mutagenesis in bacteriophage T4; Ripley LS; Transversion mutations can be distinguished from transition mutations by the use of special tauII mutants of bacteriophage T4 . Methyl methanesulfonate did not induce reversion of the tester mutants along transversion or transition pathways from A:T1 base pair sites, nor along transversion pathways from G:C base pair sites . Ethyl methanesulfonate and N-methyl-N-nitrosourea, however, induced both transversions and transitions at an A:T base pair site; no transversions were detected at G:C-sites . Mn++ induced transversions and transitions at both A:T-and G:C-sites . The influence of temperature-sensitive gene-43 DNA polymerase mutator and antimutator mutations on the reversion of the tauII tester mutants was measured: some gene-43 mutants differentially influenced different pathways of reversion . Studies of thymineless mutagenesis demonstrated A:T-site transversion mutations . A synergistic interaction between thymineless mutagenesis and the gene-43 mutator, tsL56, was used to demonstrate thymineless mutagenesis at one site where it was not detected in the presence of the wild type polymerase.

Chem Biol Interact, 1975 Nov, 11(5), 365 - 75
Inactivation of bacteriophages with cis-platinum(II) diamminedichloride; Drobnik J et al.; The ability of the cis-plantinum(II) diamminedichloride and its hydrolytic products to inactive DNA bacteriophages was examined on the models T2, T4, T4BO1, T3, and lambda . The inactivation of all bacteriophages under study increases gradually during the first 40-90 min of the action of neutral cis-Pt(II) and later passes into an exponential phase . The extent of the region of slower inactviation is larger for osmotically sensitive strains T2 and T4 . Inactivation with the hydrolytic products for cis-Pt(II) proceeds exponentially starting from the very beginning and their inactivating effect is higher by 40-80 times than for a comparable concentration of the original complex . The extent of inactivation is not affected with the HCR marker of the host bacteria . The sensitivity to cis-Pt(II) is higher for bacteriophages with a head permeable to salts . An additional inactivation ("after-effect") was observed after dilution of the complex; it can be removed by adding S-aminoisothiuronium dihydrobromide (AET) . The results obtained are in good accord with the assumption that inactivation is due to the hydrolytic products arising in the head of bacteriophage.

J Virol, 1975 Nov, 16(5), 1348 - 50
das Mutation in bacteriophage T4D does not suppress an amber mutation in T4 gene 59; Wiberg JS et al.; Mutations termed das were isolated originally (Hercules and Wiberg, 1971) as partial suppressors of mutants in phage T4 genes 46 and 47 . Since mutants in genes 46, 47, and 59 exhibit both an early arrest of phage DNA synthesis and the loss of this arrest in the presence of chloramphenicol or of mutations of T4 genes 33 and 55, we asked whether a das mutation can also suppress a gene 59 mutant . We find that it cannot--either at the level of phage production or DNA synthesis.

J Virol, 1975 Nov, 16(5), 1273 - 81
Structural aberrations in T-even bacteriophage . VII . In vitro analysis of the canavanine-mediated inhibition of proteolytic cleavage; Bolin RW et al.; Canavanine arrests a critical function in head morphogenesis and the potential for forming giant T-even phage particles termed lollipops is induced . Formation of the particles requires the addition of arginine and the restoration of normal functions . We now report on an investigation into the effects of canavanine on both the T4-induced proteolytic activity and on the substrate proteins . Using an in vitro cleavage assay we have shown that the gene 21-dependent proteolytic activity from canavanine-treated extracts is markedly inhibited, whereas the substrate proteins retain a high susceptibility for cleavage . The proteolytic activity in extracts treated with canavanine followed by arginine is readily detectable, and proteins previously synthesized in the presence of canavanine can be cleaved . Protein synthesis is apparently required for the appearance of the proteolytic activity after the canavanine-arginine treatment . Mixing experiments suggest the requirement for a component of the gene 21-dependent proteolytic activity that is not coded for by gene 21.

J Toxicol Environ Health, 1975 Nov, 1(2), 243 - 70
Genetic activity spectra of some antischistosomal compounds, with particular emphasis on thioxanthenones and benzothiopyranoindazoles; Hartman PE et al.; In this review we note that hycanthone (Etrenol) is mutagenic for bacteriophage, bacteria, yeast, Neurospora, Drosophila, and for mammalian tissue culture cells, and we point out other genetic activities of this thioxanthenone and of related compounds . One alarming genetic activity is the ability of hycanthone to cause transformation of tissue culture cells in vitro in a test designed to detect carcinogens, results that parallel the direct demonstration of carcinogenic activity of hycanthone in the mouse in vivo . These and other results are compatible with the somatic mutation theory of cancer induction . Factors likely to affect the quantitative genetic activity of hycanthone and its congeners are summarized . Attempts are made to weave the more critical experimental evidence into a molecular model that accounts for the genetic activities of this series of compounds . We conclude that hycanthone is a directly acting mutagen that intercalates into DNA and preferentially alkylates deoxyguanosine residues via formation of a strongly electrophilic molecular species, the carbonium ion . Finally, we show that genetic activity can be dissociated from schistosomicidal activity by appropriate modifications in the thioxanthenone molecule . Preliminary experiments on a newly synthesized piperazinyl N-oxide derivative demonstrate no detectable mutagenic activity; yet considerable schistosomicidal activity is retained.

J Immunol, 1975 Nov, 115(5), 1432 - 7
In vitro immunogenicity of trinitrophenylated bacteriophage T4 . I . Lack of helper cell cooperation; Jennings JJ et al.; A primary immune response was obtained in vitro to trinitrophenylated bacteriophate T4 (TNP-T4) by using normal BALB/c spleen cells challenged in vitro . The primary response was limited to anti-TNP; we failed to find evidence of a primary anti-T4 response in spleen cell cultures challenged with either TNP-T4 or native T4 . In vivo priming with the carrier T4 failed to enhance the subsequent in vitro response to TNP-T4 although such priming sometimes caused suppression of the anti-hapten response . The addition of excess free carrier to spleen cell cultures challenged with TNP-T4 failed to suppress the anti-tnp response . Spleen cells treated with anti-theta plus complement were unaffected in their ability to respond to TNP-T4 . We conclude that TNP-T4 should be classified among the thymus independent antigens.

Proc Natl Acad Sci U S A, 1975 Nov, 72(11), 4399 - 403
Influence of insertions on packaging of host sequences covalently linked to bacteriophage Mu DNA; Bukhari AI et al.; Insertions in bacteriophage Mu DNA have been identified . These insertions are responsible for at least seven X mutations, all of which eliminate essential Mu functions . The insertions are about 800 base pairs long and are located to the left of the cleavage site of restriction endonuclease EcoRI, near the immunity end of Mu DNA . We have found that such insertions cause a reduction in the length of nonhomologous terminal sequences which are seen as split ends in denatured and renatured Mu DNA molecules . These heterogeneous sequences apparently arise from packaging of host DNA from maturation precursors in which Mu and host DNA are covalently linked . We infer that a single Mu genome length is too short to be cut during morphogenesis, and thus some host DNA is packaged into mature virions . Since the insertions increase the length of Mu DNA, they decrease the amount of host DNA needed for packaging.

Proc Natl Acad Sci U S A, 1975 Nov, 72(11), 4288 - 92
Characterization of DNA condensates induced by poly(ethylene oxide) and polylysine; Laemmli UK; High-molecular-weight DNA is known to collapse into very compact particles in a salt solution containing polymers like poly(ethylene oxide) {(EO)n} or polyacrylate . The biological relevance of this phenomenon is suggested by our recent finding that high concentrations of the highly acidic internal peptides found in the mature T4 bacteriophage head, as well as poly(glutamic acid) and poly(aspartic acid), can collapse DNA in a similar manner . The structure of DNAs collapsed by various methods has been studied with electron microscope . We find (EO)n collapses T4 or T7 bacteriophage DNA into compact particles only slightly larger than the size of the T4 and T7 head, respectively . In contrast, polylysine collapses DNA into different types of structures . Double-stranded DNA collapsed with (EO)n is cut by the single-strand specific Neurospora crassa endonuclease (EC 3.1.4.21) into small fragments . Extensive digestion only occurs above the critical concentration of polymer required for DNA collapse, demonstrating the (EO)n-collapsed DNA contains enzyme-vulnerable regions (probably at each fold), which are preferentially attacked . The size of the DNA fragments produced by limit-digestion with the nuclease ranges between 200 and 400 base pairs when DNA is collapsed by (EO)n . Only fragments of DNA which are larger than 600 base pairs are cut by the endonuclease in (EO)n-containing solution.

Nucleic Acids Res, 1975 Nov, 2(11), 2091 - 100
Studies on bacteriophage fd DNA . III . Nucleotide sequence preceding the RNA start-site on a promoter-containing fragment; Sugimoto K et al.; A short DNA fragment containing a strong promoter was isolated from phage fd replicative form DNA with the use of restriction endonucleases, and the sequence of 110 nucleotides in the region preceding the RNA start-site was determined . The sequence was : (5') CGGTCTGGTTCGCTTTGAGGCTCGAATTAAAACGCGATATTTGAAGTCTTTCGGGCTTCCTCTTAATCTTTTTGATCGAATTCGCTTTGCTTCTGACTATAATAGACAGG (3').

Nucleic Acids Res, 1975 Nov, 2(11), 2037 - 48
In vitro synthesis of large peptide molecules using glucosylated single-stranded bacteriophage T4D DNA template; Hulen C et al.; Denatured Bacteriophage T4D DNA is able to stimulate aminoacid incorporation into TCA-precipitable material in an in vitro protein synthesis system according to base DNA sequences . Newly synthesized polypeptides remain associated with ribosomes and have a molecular weight in range of 15,000 to 45,000 Daltons.

Nucleic Acids Res, 1975 Nov, 2(11), 2021 - 36
Specific binding of the first enzyme for histidine biosynthesis to the DNA of histidine operon; Meyers M et al.; Studies were done to examine direct binding of the first enzyme of the histidine biosynthetic pathway (phosphoribosyltransferase) to 32P-labeled phi80dhis DNA and competition of this binding by unlabeled homologous DNA and by various preparations of unlabeled heterologous DNA, including that from a defective phi80 bacteriophage carrying the histidine operon with a deletion of part of its operator region . Our findings show that phosphoribosyltransferase binds specifically to site in or near the regulatory region of the histidine operon . The stability of the complex formed by interaction of the enzyme with the DNA was markedly decreased by the substrates of the enzyme and was slightly increased by the allosteric inhibitor, histidine . These findings are consistent with previous data that indicate that phosphoribosyltransferase plays a role in regulating expression of the histidine operon.

Cell, 1975 Nov, 6(3), 269 - 77
Yeast super-suppressors are altered tRNAs capable of translating a nonsense codon in vitro; Capecchi MR et al.; tRNA isolated from two different yeast super-suppressor strains translates a known nonsense mutation in vitro, whereas tRNA from a closely related nonsuppressing strain does not . Suppression was assayed by translation of RNA isolated from an amber coat mutant of bacteriophage Qbeta (GB11) in a protein-synthesizing system derived from mouse tissue culture cells (L cells) . Suppressed forms of Qbeta coat protein synthesized in vitro were quantitatively detected by a specific immunoprecipitation assay . The L-cell protein-synthesizing system also responds to E . coli suppressor tRNA . This indicates that the biochemical mechanism for nonsense suppression is very similar in yeast and E . coli . These findings also provide additional evidence that the amber codon (UAG) functions as one of the mammalian chain-terminating codons . Since the suppression assay utilizes protein-synthesizing components isolated from mammalian cells, it should prove useful in the search for mammalian nonsense suppressors.

Zh Mikrobiol Epidemiol Immunobiol, 1975 Nov, (11), 45 - 9
{Transfection of Escherichia coli using bacteriophage MS2 RNA}; Grabovskaia KB et al.; The authors present materials for comparison of three methods of E . coli infection by the RNA of the MS2 bacteriophage . The cells accepted the RNA at the stage of spheroplasts (obtained with the aid of a lysozyme and EDTA) with the efficacy of up to 1.5 X 10(5) IC/mug of the RNA . Diethylpyrocarbonate was used as a transfection stimulant . The product of transfection was identical to the MS2 bacteriophage . The efficacy of transfection in the calcinated system and on the frozen-defrosted bacteria was lower than on the spheroplasts (10(2) IC/mug of the RNA) which was largely associated with the formation of "latent infectious centres" . Formation of latent negative colonies was characteristic of bacteriophage MS2, but formation of these colonies was intensified when calcinated cells were used for transfection.

Biokhimiia, 1975 Nov-Dec, 40(6), 1282 - 91
{Purification, heterogeneity and some properties of T2 bacteriophage lysozyme}; Troitskii AV et al.; Free T2 bacteriophage lysozyme is isolated and purified from 80 l portion of phagolysate by means of ballast protein and bacterial debris precipitation with rivanol, two-stage fractionation on amberlit IRC-50 and chromatography on CM-Sephadex C-50 . Purified enzyme is homogenous under polyacrylamide gel electrophoresis in the presence of sodium dodecylsulphate, it has a molecular weight value similar to that in the literature . A presence of two active enzyme forms (I and II) is demonstrated . They can be separated by means of analytical electrophoresis in polyacrylamide gel at pH 4,5 and of ion-exchange chromatography on Amberlite IRC-50 . T2 lysozymes I and II do not differ in their amino acid composition, ORD parameters, and they are not interconversible . Heterogeneity of phage lysozyme is shown not to be an artefact and to be due neither to heterogeneity of the initial phage poluation, nor to aggregation and to oxidation of enzyme SH-groups . The content of alpha-helix regions, as estimated by ORD is higher in phage lysozyme than in hen egg-white lysozyme, which evidences that these proteins are non-homologous.

J Bacteriol, 1975 Nov, 124(2), 1023 - 7
Biological effects of lipoteichoic acids; Holtje JV et al.; Pneumococcal lipoteichoic acid (Forssman antigen) added to the medium of growing pneumococcal cultures caused chain formation, prevented culture lysis in the stationary phase of growth, and inhibited lysis by penicillin and by the pneumococcal bacteriophage Dp-1.

J Virol, 1975 Nov, 16(5), 1200 - 7
Partial purification and properties of a bacteriophage T7 inhibitor of the host exonuclease V activity; Pacumbaba R et al.; Infection of Escherichia coli with bacteriophage T7 results in an inhibition of the host exonuclease V (recB, C DNase) activity . This inhibition is not observed when cells are infected in the presence of chloramphenicol or with a gene 1 mutant . The protein responsible for the inhibition of exonuclease V has been partially purified from T7-infected cells . The protein which does not possess nuclease or ATPase activity can inhibit all nucleolytic activities associated with exonuclease V . The protein does not, however, inhibit the DNA-dependent ATPase activity associated with exonuclease V . The inhibitory protein has a molecular weight of about 12,000, as determined from sedimentation analysis in glycerol gradients.

J Biol Chem, 1975 Oct 25, 250(20), 8132 - 9
The in vitro translation of a terminating signal by a single Escherichia coli ribosome . The fate of the subunits; Martin J et al.; A complex was isolated containing one 70 S ribosome bound to the RNA of the f2 bacteriophage in the region of the coat gene . Either the f2 RNA and 70 S ribosome or both ribosomal subunits in this complex were differentially labeled with tritiated lysine or phosphorous 32 RNA . Incubation of this complex in a ribosome-free protein-synthesizing system lacking initiating factor and appreciable nuclease activities allowed the synthesis of coat protein and subsequent termination . Using this techique, it was found that termination resulted in the release of ribosome as subunits . Intermediate in this process is a transient 46 S complex composed of the f2 RNA and 30 S ribosomal subunit, presumably the result of the initial release of the 50 S ribosomal subunit . This 46 S complex subsequently breaks down to a free f2 RNA and 30 S ribosomal subunit . The rate of this latter process is faster in the presence of crude initiating factors . These results are discussed in terms of the mechanism of termination and reading of the intercistronic region.

Eur J Biochem, 1975 Oct 15, 58(2), 291 - 6
Structure and synthesis of a lipid-containing bacteriophage . Chemical modifications of bacteriophage PM2 and the resulting alterations in acyl-chain motion in the PM2 membrane; Schafer R et al.; The nucleocapsid proteins of bacteriophage PM2 and the inner lamella of the lipid bilayer, containing most of the phosphatidlethanolamine residues, were selectively cross-linked in the presence of 0.1-0.5% glutaraldehyde, 5 mM dimethylsuberimidate, or 0.05% toluene 2,4-diisocyanate . The biological activity (p.f.u.) of PM2 modified by these reagents decreased 10(6)-fold in all cases . The spike and coat proteins were selectively cross-linked in the presence of 7.5 mM N,N'-p-phenylenedimaleimide . The biological activity of virus modified by this reagen was unaffected . The electron paramagnetic resonance spectra of fatty acid spin labels incorporated into native and chemically modified viral membranes were qualitatively similar but show quantitative differences . Fixation with glutaraldehyde increased the rigidity of the membrane while Triton X-100 induced a more flexible structure . There was no change in the electron paramagnetic resonance spectrum of virus treated with N,N'-p-phenylenedimaleimide, however.

J Bacteriol, 1975 Oct, 124(1), 578 - 81
Bacteriophage Mu-1-induced permeability mutants in Escherichia coli K-12; Aline RF Jr et al.; Apparent permeability mutations were produced in Escherichia coli K-12 by bacteriophage mu-1 mutagenesis . They are pleiotropic mutations showing sensitivity to a number of detergents and unrelated antibiotics, and presumably they affect cell wall or membrane biosynthesis . One of the mutations was genetically mapped at a site in or near the acrA and mtc loci at approximately 10.5 min on the Taylor and Trotter map (1972).

Zh Mikrobiol Epidemiol Immunobiol, 1975 Oct, (10), 47 - 50
{Preliminary electron microscopic and x-ray study of the crystalline protein of diphtheria toxin}; Kushnarev VM et al.; The authors present the results of the electron microscopic and roentgenological study of the crystalline protein of diphtheria toxin . On the basis of direct measurements of the crystal image and diffraction pictures it was possible to calculate the interplane distances of the placement of molecules in the crystal . Examination in polarization microscope showed that the crystals were optically uniaxial with a direct extinction and a positive character of elongation . Molecular aggregates revealed in the protein molecules resembled the caudal part of the bacteriophage by structure.

Zh Mikrobiol Epidemiol Immunobiol, 1975 Oct, (10), 31 - 4
{Morphology of the temperate plague phages 1701 and 1710 and their mutants}; Leshkovich NL et al.; A study was made of the morphology of plague moderate bacteriophages 1701, 1710 and their mutants 1701-1 and 1710-1 . The phages proved to be morphologically identical, were referred to group 5, and were identical to the moderate plague H-phages; when confronted to the commonness of the serological properties and a number of other signs this indicated their affinity.

Biosystems, 1975 Oct, 7(2), 245 - 9
A new aspect of the RNA bacteriophages translation control mechanism; Knijnenburg A et al.; The polarity effect of the coat protein gene of the ribonucleic acid of RNA bacteriophages on the polymerase gene translation will be taken as the basis of the polymerase translation control mechanism . A further condition for this mechanism discussed in this work is the dependence of the phage RNA replication on host cell translation factors . The ribosome binding sites of the phage RNA play a decisive role to realize the control mechanism coding for definite ribosome binding probabilities . The relation between them quantifies the reached polymerase concentration in the early phase of the development of the RNA bacteriophage system in the infected cell.

J Virol, 1975 Oct, 16(4), 974 - 81
Analysis of expression of the rII gene function of bacteriophage T4; Heere LJ et al.; Temperature-sensitive (ts) mutants of the T4 phage rII gene were islated and used in temperature shift experiments that revelaed two different expressions for the normal rII (rII+) gene function in vivo: (i) an early expression (0 to 12 min postinfection at 30 C) that prevents restriction of T4 growth in Escherichia coli hosts lysogenic for gamma phage, and (ii) a later expression (12 to 18 min postinfection at 30 C) that results in restriction of T4 growth when the phage DNA ligase (gene 30) is missing . The earlier expression appeared to coincide with the period of synthesis of the protein product of the T4 rIIA cistron, whereas the later expression occurred after rIIA protein synthesis had stopped . The synthesis of the protein product of the rIIB cistron continues for several minutes after rIIA protein synthesis ceases (O'Farrell and Gold, 1973) . The two rII+ gene expressions might require different molar ratios of the rIIA and rIIB proteins . It is possible that the separate expressions of rII+ gene function are manifestations of different associations between the two rII proteins and other T4-induced proteins that are synthesized or activated at different times after phage infection.

Nucleic Acids Res, 1975 Oct, 2(10), 1811 - 20
Physical mapping of the central terminator for transcription on the bacteriophage M13 genome; Edens L et al.; With the aid of in vitro transcription and translation studies it has been demonstrated that termination of transcription on bacteriophage M13 replicative form DNA occurs at a unique site which is located immediately distal to the 3'-end of gene VIII, the gene which codes for the major capsid protein . The position of this site has been mapped accurately on the enzyme cleavage maps by transcription of restriction fragments of M13 RF DNA . The central termination site was found to be located in restriction fragment Hap-B2 at 450 nucleotides from the 5'-end of its viral strand (0.77 fractional length clockwise from the unique Hind II enzyme cleavage site).

J Virol, 1975 Oct, 16(4), 867 - 71
Phospholipase activity in bacteriophage-infected Escherichia coli . III . Phopholipase A involvement in lysis of T4-infected cells; Hardaway KL et al.; Bacteriophage studies with Escherichia coli K-12 (gamma)DR-DS-, a mutant lacking the major known fatty acyl hydrolases (phospholipases), and its wild-type parent showed equivalent phage infection with regard to phage production and time of phage release . Further examination of the DR-DS- mutant, however, revealed that the progeny bacteriophage were released without complete dissolution of the host cell . Prolonged cell integrity of the infected mutant was noted by spectrophotometry and supported by direct microscope examination . The phage release occurred at normal "lysis" time with phage yields comparable to that of the wild-type bacteria . Inner membrane degradation was indicated by the release of beta-galactosidase, a cytoplasmic enzyme, and of trichloracetic acid-precipitable RNA . Thus, outer membrane degradation is required for dissolution of phage-infected cells, and this degradation is at least partly dependent on activation of host phospholipases.

J Virol, 1975 Oct, 16(4), 854 - 8
Characterization of transduction by bacteriophage T1: time of production and density of transducing particles; Kylberg KJ et al.; The transducing activity of two different kinds of premature lysates of T1-infected cells have been compared to normal lysates . The results show that T1-transducing particles are made early in the maturation period . The average density of T1-transducing particles is slightly greater than the density of plaque-forming T1.

J Bacteriol, 1975 Oct, 124(1), 576 - 7
Recipient ability of bacteriophage-resistant mutants of Escherichia coli K-12; Manning PA et al.; The ability of a wide range of bacteriophage-resistant mutants to act as recipients in conjugation with F'lac pro and R100-1 donors has been studied . A number of mutant types defective in recipient ability with F'lac pro, as well as mutants which were hyperrecptive with R100-1, have been detected.

J Bacteriol, 1975 Oct, 124(1), 317 - 24
Mapping and characterization of a mutation in Escherichia coli that reduces the level of ribonuclease III specific for double-stranded ribonucleic acid; Apirion D et al.; Localization of a mutation affecting ribonuclease III activity (an enzyme specific for double-stranded ribonucleic acid) in Escherichia coli was attempted . By a series of matings and transduction experiments, the mutation rnc-105 was mapped near the nadB gene . In strains carrying this mutation, another mutation (ranA2074) was also found . Based on available data, their order on the E . coli chromosome appears to be tyrA, ranA, nadB, rnc, purI . Strains carrying either the ranA2074 or the rnc-105 mutation fail to grow at 45 C in enriched medium, whereas strains carrying only the rnc-105 mutation are defective in ribonuclease III activity . Strains carrying either of these mutations grow more slowly than corresponding wild-type strains in all media tested at all temperatures; the rnc-105 mutation reduces the growth rate more than the ranA2074 mutation . T4 and T7 bacteriophages form plaques with a lower efficiency on strains carrying the rnc-105 mutation than on other strains . Thus we suggest that ribonuclease III is beneficial for normal growth of E . Coli and that at higher temperatures it becomes indispensable.

J Bacteriol, 1975 Oct, 124(1), 307 - 16
Genetic mapping of a mutation that causes ribonucleases III deficiency in Escherichia coli; Studier FW; the mutation that causes ribonuclease III (RNase III) deficiency in strain AB301-105 of Kindler et al . (1973) has been mapped by use of F' merodiploids, Hfr matings, and P1 transduction . This mutation, rnc-105, lies close to nadB, near 49 min on the genetic map of Escherichia coli . The rnc-105 mutation has been transferred from its original genetic background by transduction and conjugation, and these new strains have the same defects in ribonucleic acid processing reported previously for AB301-105 . Strains that carry rnc-105 grow more slowly than parental rnc+ strains, but the difference in growth rate seems to depend on the genetic background of each strain . Bacteriophage T7 grows about equally well in RNase III+ and III- female strains of E . coli, even though the specific cuts that RNase III makes in T7 ribonucleic acid are not made in the RNase III- strains . A low-phosphate defined medium in which most E . coli strains seem to grow well was developed . This medium is equally useful for labeling ribonucleic acids with 32PO4 and as a selective medium for genetic manipulations . It was used to determine the growth requirements of strain AB301-105, which are biotin and succinate in addition to the methionine and histidine requirements of the parental strain . The biotin mutation lies near the position expected from known mutations of E . coli, but the succinate mutation apparently does not . The possibility that the succinate requirement could be due to the RNase III deficiency is discussed . A uraP mutation was isolated for use in transferring rnc-105 between strains by conjugation . It lies near 47 min, somewhat removed from the commonly accepted position for uraP.

J Bacteriol, 1975 Oct, 124(1), 167 - 75
Escherichia coli deoxyribonucleic acid synthesis mutants: their effect upon bacteriophage P2 and satellite bacteriophage P4 deoxyribonucleic acid synthesis; Bowden DW et al.; Escherichia coli C strains containing different deoxyribonucleic acid (DNA) synthesis mutations have been tested for their support of the DNA synthesis of bacteriophage P2 and its satellite phage P4 . Bacteriophage P2 requires functional dnaB, dnaE, and dnaG E . coli gene products for DNA synthesis, whereas it does not require the products of the dnaA, dnaC, or dnaH genes . In contrast, the satellite virus P4 requires functional dnaE and dnaH gene products for DNA synthesis and does not need the products of the dnaA, dnaB, dnaC, and dnaG genes . Thus the P2 and P4 genomes are replicated differently, even though they are packaged in heads made of the same protein.

J Bacteriol, 1975 Oct, 124(1), 119 - 26
Role of the receptor for bacteriophage lambda in the functioning of the maltose chemoreceptor of Escherichia coli; Hazelbauer GL; Chemotaxis towards maltose is specifically defective in many strains of Escherichia coli carrying mutations affecting lamB, the gene coding for the outer membrane receptor for bacteriophage lambda . However, with one exception, the most extreme effect of lamB mutants on the maltose response as determined in the capillary assay is a shift to higher sugar concentrations and a reduction in the number of bacteria accumulated to about 25% of the wild-type level . The severity of the taxis defect is strongly correlated with reduced ability of the cells to take up the maltose present at 1 and 10 muM . Evidence presented here and in the accompanying paper indicates that the lambda receptor is involved in the transport of maltose at these concentrations . The effects of lamB mutations on maltose taxis can be explained by postulating that the high-affinity maltose transport system in which the lambda receptor participates transfers maltose from the surrounding medium across the outer membrane and into the periplasmic space . If the maltose chemoreceptor detects sugar present in the periplasmic space, and not molecules external to the outer membrane, then defective transport of low concentrations of maltose into the periplasm would result in the observed apparent reduction in the sensitivity of the maltose receptor . Thus, the lambda receptor protein would participate in maltose chemorecepton only indirectly through its role in maltose transport.

J Bacteriol, 1975 Oct, 124(1), 112 - 8
Maltose transport in Escherichia coli K-12: involvement of the bacteriophage lambda receptor; Szmelcman S et al.; Mutants affected in lamB, the structural gene for phage lambda receptor, are unable to utilize maltose when it is present at low concentrations (less than or equal 10 muM) . During growth in a chemostat at limiting maltose concentrations, the lamB mutants tested were selected against in the presence of the wild-type strain . Transport studies demonstrate that most lamB mutants have deficient maltose transport capacities at low maltose concentrations . When antibodies against purified phage lambda receptor are added to a wild-type strain, transport of maltose at low concentrations is significantly reduced . These results strongly suggest that the phage lambda receptor molecule is involved in maltose transport.

Eur J Biochem, 1975 Oct 1, 58(1), 81 - 5
Structure and synthesis of a lipid-containing bacteriophage . A polynucleotide-dependent polynucleotide-pyrophosphorylase activity in bacteriophage PM2; Schafer R et al.; A polymerase activity is associated with protein IV, a protein which is associated with the DNA in bacteriophage PM2 . The native enzyme unit is probably a dimer . Manganese ions are required for the polymerisation reaction and there is a well-defined Mn2+ optimum at 2.5 mM . The pH optimum is at 8.1, the temperature optimum at 28 degrees C . The activity is a polynucleotide-pyrophosphorylating reaction in the presence of ribo- or deoxyribonucleoside triphosphates . The polymerisation reaction is stimulated in the presence of nuclei- acids or polynucleotides as effectors . The product is not covalently linked to the effector.

Proc Natl Acad Sci U S A, 1975 Oct, 72(10), 4071 - 5
Restoration of ultraviolet-induced unscheduled DNA synthesis of xeroderma pigmentosum cells by the concomitant treatment with bacteriophage T4 endonuclease V and HVJ (Sendai virus); Tanaka K et al.; Ultraviolet (UV)-induced unscheduled DNA synthesis of xeroderma pigmentosum cells, belonging to complementation groups A, B, C, D, and E, was restored to the normal level by concomitant treatment of the cells with T4 endonuclease V and UV-inactivated HVJ (Sendai virus) . The present results suggest that (1) T4 endonuclease molecules were inserted effectively into the cells by the interaction of HVJ with the cell membranes, (2) the enzyme was functional on human chromosomal DNA which had been damaged by UV irradiation in the viable cells, (3) all the studied groups of xeroderma pigmentosum ("variant" was not tested) were defective in the first step (incision) of excision repair.

Nucleic Acids Res, 1975 Oct, 2(10), 1967 - 74
Studies on the biological role of DNA methylation: inhibition of methylation and maturation of the bacteriophage phichi174 by nicotinamide; Razin A et al.; Nicotinamide was found to be a potent inhibitor of DNA methylation in vivo without interfering with protein or DNA synthesis . The inhibition of DNA methylation in a phage-infected cell resulted in a parallel decrease in the production of viable virus particles . In vitro experiments revealed that nicotinamide inhibits DNA methylase activity in a competitive fashion with respect to S-adenosylmethionine and non-competitively with respect to DNA . These results were interpreted to mean that DNA methylation is an essential step in the process of maturation of the bacteriophage phichi174.

J Bacteriol, 1975 Oct, 124(1), 1 - 6
Mu-induced polarity in the Escherichia coli K-12 ent gene cluster: evidence for a gene (entG) involved in the biosynthesis of enterochelin; Woodrow GC et al.; A strain of Escherichia coli K-12 has been isolated that carries a Mu bacteriophage-induced mutation in the ent gene cluster . Nutritional tests together with examination of the compounds accumulated by the mutant strain indicated that the mutant was blocked both in the synthesis of 2,3-dihydroxy-benzoate and its subsequent conversion into enterochelin . Enzymic complementation assays of the mutant with several mutants each affected in one of the ent genes showed that the Mu-induced mutant was entA-, entB-, entC+, entD+, entE+, and entF+ . Since the mutant produced the entD, entE, and entF gene products but was unable to produce enterochelin from 2,3-dihydroxybenzoate, it must therefore be affected in an additional protein concerned with this conversion . It is therefore postulated that the Mu-induced mutation affects a previously unrecognized gene, entG . Genetic experiments indicate that the mutation in strain AN462 which affects the three ent genes is the result of a single insertion of Mu in the ent gene cluster . This polarity mutant therefore provides evidence that three of the ent genes are part of an operon.

Mol Gen Genet, 1975 Sep 29, 140(2), 101 - 10
Characterization of the DNA from bacteriophage P2-186 hybrids and physical mapping of the 186 chromosome; Younghusband HB et al.; The DNA from two P2-186 hybrid phages and three 186 Insertion mutants have been characterized by heteroduplex analysis and denaturation mapping . The results allow the orientation of the physical and genetic maps of bacteriophage 186 DNA and put physical limits on the chromosomal locations of the phage attachment sites, immunity genes and tail genees.

J Biol Chem, 1975 Sep 25, 250(18), 7450 - 5
Ribonucleoside diphosphate reductase induced by bacteriophage T4 . III . Isolation and characterization of proteins B1 and B2; Berglund O; Ribonucleoside diphosphate reductase determined by bacteriophage T4 consists of a tight complex (alpha2beta2) of the polypeptide chains alpha (Mr = 80,000 to 85,000) and beta (Mr = 35,000) . The alpha2 dimer (= protein B1) was purified from Escherichia coli B infected with T4 mutant nrdB55 (Yeh, Y.C., and Tessman, I . (1972) Virology 47, 767-772) which carries an amber mutation in the gene coding for the beta polypeptide chain . Protein B1 contained binding sites for dATP, an allosteric effector of the reductase . The beta2 dimer (= protein B2) was purified by selective desorption with 1 M guanidine HCl from a dATP-Sepharose affinity column containing adsorbed native T4 ribonucleotide reductase . Protein B2, isolated this way, was enzymatically inactive due to partial loss of its iron but it could be reactivated by treatment with ferrous iron . Active protein B2 contained two atoms of non-heme iron per molecule and exhibited the optical and electron spin resonance spectra previously demonstrated in the native enzyme . The T4-induced proteins B1 and B2 were unable to reduce ribonucleotides when assayed separately but were active in combination . The proteins did not form catalytically functional hybrids with proteins B1 and B2 of Escherichia coli ribonucleotide reductase, neither did they cross-react immunologically with the latter . 5-Hydroxymethyl-dCTP, at concentrations above 10 muM, was a positive allosteric effector of T4 ribonucleotide reductase promoting the reduction of the pyrimidine ribonucleotides CDP and UDP . The nucleotide had little effect on E . coli ribonucleotide reductase.

J Biol Chem, 1975 Sep 25, 250(18), 7377 - 87
The gamma protein specified by bacteriophage gamma . Structure and inhibitory activity for the recBC enzyme of Escherichia coli; Karu AE et al.; The protein encoded by the gam gene of bacteriophage lambda ("gamma protein") is a specific inhibitor of the recBC enzyme of Escherichia coli . The lambda protein has been purified approximately 2,000-fold, and its structure and inhibitory activity have been characterized . It appears to be composed of two identical subunits of 16,500 daltons, inhibits all of the catalytic activities of the recBC enzyme with apparently equal efficiency, but has no effect upon any other E . coli or lambda-DNase tested . Inhibition does not occur unless recBC enzyme is exposed to gamma protein prior to reaction of the enzyme with DNA . The inhibitory activity is independent of temperature, and no catalytic activity has been detected that might fulfill the inhibitory function . It appears instead that the inhibition involves a stoichiometric, rather than a catalytic interaction between gamma protein and the enzyme . Reaction kinetics for the recBC enzyme inhibited by gamma protein show no anomalous protein--only a depressed rate . Inhibition is not competitive and does not appear to affect the enzyme's affinity for DNA . The enzyme remains inhibited after it is separated from "excess" gamma protein by gel filtration or sedimentation in a glycerol gradient, and inhibited enzyme has a reduced electrophoretic mobility compared to that of uninhibited enzyme . Gamma Protein inhibits recBC enzyme which has been reconstituted from cell-free extracts by complementation in vitro, but at least one of the complementing factors present in extracts from recB- cells does not by itself form a complex with gamma protein . The mechanism of inhibition and the implications of these results from gamma replication and recombination are discussed.

Mol Gen Genet, 1975 Sep 15, 140(1), 29 - 37
Rec-mediated recombinational hot spot activity in bacteriophage lambda . IV . Effect of heterology on Chi-stimulated crossing over; Stahl FW et al.; A Chi mutation in phage lambda stimulates Rec-mediated crossing over more to one side of itself than to the other; stimulation, which is maximal near Chi, can occur at some distance from the Chi site as well . A gross heterology differentiating the two recombining parents does not interfere with the distant Chi-stimulated crossover whether the heterology is at the Chi site or between the Chi site and the distant interval in which recombination is monitored . These conclusions hold whether recombination is measured "genetically" in standard crosses or "physically" in density-labeled crosses conducted in the absence of DNA replication.

Biochim Biophys Acta, 1975 Sep 12, 407(1), 73 - 82
Effect of chloramphenicol on early mRNA synthesis in bacteriophage lambda; Takeda Y; The N gene product induces lambda-delayed early mRNA synthesis . This transcription was sensitive to chloramphenicol at the very early stage of phage development, but became resistant within 2-4 min after infection . However, the same transcription was sensitive to the antibiotic throughout phage development if lambda tof- mutant was used as the infecting phage . The results suggest involvement of the tof gene in lambda early transcription; the tof product may act as a stabilizer of the N gene function.

Genetics, 1975 Sep, 81(1), 33 - 50
Genetic heterozygosity in unreplicated bacteriophage lambda recombinants; White R et al.; Bacteriophage crosses using density-labeled parents have been carried out under conditions restricting DNA synthesis . The parental material and genetic contributions to progeny manifesting recombination within a genetic interval sufficiently short to exhibit high negative interference have been examined . The unreplicated products of recombination isolated as phage particles appear to contain long continuous heteroduplex regions which are heterozygous for the closely linked markers . Recombination between closely linked markers seems to be the consequence of the removal of base-pair mismatches that are present within the heteroduplex regions . This localized reduction of heterozygosity within the heteroduplex regions that join the parental components of recombinant DNA molecules can account for high negative interference.

Zh Mikrobiol Epidemiol Immunobiol, 1975 Sep, 0(9), 52 - 4
{Morphology of Newcastle bacteriophages}; Voroshilova NN et al.; A study was made of morphology of 6 clones of Newcastle bacteriophages of different origin divided into 3 types . Bacteriophage H-18 referred to the III morphological type by the Tikhonenko classification was characterized by a comparatively short process and a head in the form of an isometric polyhedron; H-1, H-5, H-10 and H-17 bacteriophages referred to type V, despite their antigenic difference were morphologically identical: they had a comparatively large head in the form of an elongated polyhedron and a process with a complicated structure ending by a besal plate with 3 indentions originating from it . Bacteriophage H-4 was referred to the IV type and was characterized by a head in the form of an elongated polyhedron and a long curved noncontracting process; in difference from the others it had no basal plate on the end of the process . The revealed morphological peculiarities of the particles of the Newcastle bacteriophages only partially correlated with their division on the basis of serolological properties and the size of the negative colonies.

Nucleic Acids Res, 1975 Sep, 2(9), 1441 - 58
Sequence of the promoter-operator proximal region of the major leftward RNA of bacteriophage lambda; Dahlberg JE et al.; The sequence of the first 149 nucleotides of the major leftward RNA of bacteriophage lambda has been determined . Preliminary sequence information was also obtained for a portion of the untranscribed area immediately upstream of the point on the template when RNA synthesis normally starts . Several restriction endonuclease sites, deletion endpoints, and single base changes have been localized within the sequence . The first potential translation initiation codon which is not followed by an in-phase termination codon is a GUG located 90 nucleotides from the transcription startpoint.

J Gen Virol, 1975 Sep, 28(3), 415 - 9
Structure and position of a complex chromosomal aberration in bacteriophage P2; Hyde JM et al.; The P2 phage mutation vir56, like the previously studied vir22, is the result of an unequal replacement of a chromosome segment with non-homologous DNA . The end positions of the replacements are essentially the same in the two mutants, whereas the lengths of the replacements are quite different . A third chromosomal aberration, del3, has similar structure and position . These results strengthen the suggestion that the left ends of these three aberrations coincide with the point of exchange in integrative recombination.

J Gen Virol, 1975 Sep, 28(3), 329 - 40
Studies of temperature sensitive mutants of bacteriophage Qbeta, defective in both replication and translation; Gupta P et al.; Temperature sensitive mutants of bacteriophage Qbeta have been isolated which fail in the synthesis of their virus RNA at the non-permissive temperature (42 degrees C) . Nine mutants have been studied in some detail . Cells infected with these mutants at 37 degrees C and incubated long enough to produce substantial amounts of Qbeta RNA cease Qbeta RNA replication when shifted to 42 degrees C . The mutants can be classified into 3 groups according to the amount of Qbeta RNA replicase activity exhibited in extracts from infected cells isolated at various times after shift to 42 degrees C: in group 1 mutants, enzyme activity is the same, regardless of the time of isolation after shift; in group 2 mutants enzyme activity increases with time of isolation after shift; in group 3 mutants, enzyme activity decreases with time of isolation after shift . Synthesis of all virus proteins is suppressed at 42 degrees C in cells infected with group 2 of group 3 mutants . In cells infected with group 2 mutants, synthesis of Qbeta RNA replicase subunit beta is increased, but synthesis of other virus proteins is depressed at 42 degrees C . The inhibition of virus RNA and protein synthesis is reversible . A detailed analysis of these experiments suggests that a defective Qbeta RNA replicase is involved in the inhibition of both virus RNA and protein synthesis.

J Virol, 1975 Sep, 16(3), 674 - 84
Endonuclease R-EcoRII restriction of bacteriophage f1 DNA in vitro: ordering of genes V and VII, location of an RNA promotor for gene VIII; Vovis GF et al.; Replicative form DNA of bacteriophage f1 was found to be sensitive in vitro to restriction by endonuclease R-EcoRII if the DNA was isolated from an Escherichia coli strain deficient in cytosine methylase activity . A similar observation was previously made with DNA from the closely related bacteriophage fd (S . Schlagman, S . Hattman, M . S . May, and L . Berger, submitted for publication) . The two DNA fragments produced by the endo R-EcoRII digestion of f1 DNA were localized on the f1 cleavage map and their genetic content was determined . The polypeptides synthesized in a "coupled" transcription-translation system under the direction of each RII fragment were examined . The results of such experiments allow the ordering of genes V and VII and indicate the location of a RNA promotor for gene VIII.

Vopr Virusol, 1975 Sep-Oct, (5), 620 - 5
{Physicochemical characteristics and macromolecular organization of bacteriophage FI-5 (author's transl)}; Andriashvili IA et al.; Physico-chemical parameters and features of macromolecular orgnization of FI-5 phage were studied . This virus was shown to contain a molecule of double-strander DNA with the standard set of nitrous bases (37.8 mol% GC) . The molecule of this DNA in situ is characterized by partial disorder of the second structure . Phage virions contain about 47% of DNA and 53% of protein . The genome of the phage is represented by a DNA molecule with molecular weight 65X10(6) daltons and is capable of coding for a least 15 different proteins.

Proc Natl Acad Sci U S A, 1975 Sep, 72(9), 3428 - 32
Characterization of a novel, low-molecular-weight DNA-binding protein from Escherichia coli; Rouviere-Yaniv J et al.; A low-molecular-weight (7000), heat-stable protein--HU--that stimulates transcription of bacteriophage lambda DNA by E . coli RNA polymerase was purified from E . coli extracts using affinity chromatography on DNA-cellulose . HU binds to native DNA, resulting in an apparent thickening of the DNA chains as revealed by electron microscopy . Contrary to DNA unwinding proteins, it causes no destabilization of the double helix . HU differs from previously described transcription factors (H1, D, etc.) and from the low-molecular-weight omega subunit of the RNA polymerase . By its amino-acid composition and characteristics, HU displays an interesting resemblance to some eukaryotic histones, such as H2B and H1.

Proc Natl Acad Sci U S A, 1975 Sep, 72(9), 3416 - 20
In vitro construction of bacteriophage lambda carrying segments of the Escherichia coli chromosome: selection of hybrids containing the gene for DNA ligase; Cameron JR et al.; DNA from lambdagt-lambdaB bacteriophage was cleaved with EcoRI endonuclease and fragments from EcoRI-digested E . coli DNA were inserted . This DNA was used to infect E . coli, and phages containing the gene for DNA ligase were isolated by genetic selection . Two different hybrids were found with the same E . coli segment inserted in opposite orientations . Both hybrids produced similar levels of ligase as measured in crude extracts of infected cells.

J Virol, 1975 Sep, 16(3), 741 - 4
Identification of bacteriophage T4-specific precursor tRNA by using a host mutant defective in the methylation of tRNA; Bjork GR; A mutant of Escherichia coli K-12 that is defective in the synthesis of 5-methyluridine (ribothymidine) in tRNA was used to identify precursors to phage T4-specific tRNA . The precursor molecules, isolated by gel filtration, were more than twice the size of tRNA . This method is suitable for isolation of rather large amounts of such precursor molecules.

J Virol, 1975 Sep, 16(3), 575 - 80
Rifampin inhibition of bacteriophage phiX174 parental replicative-form DNA synthesis in an Escherichia coli dnaC mutant; Dumas LB et al.; The Escherichia coli dnaC protein is not absolutely required in vivo for bacteriophage phiX174 parental replicative-form synthesis (Kranias and Dumas, 1974) . However, when rifampin is present at a concentration that inhibits DNA-dependent RNA polymerase, phiX174 parental replicative-form synthesis is dependent on the dnaC protein activity . We conclude that E . coli DNA-dependent RNA polymerase can substitute for the dnaC protein in phiX174 parental replicative-form DNA synthesis, presumably in its initiation . The implications of this result with respect to the in vitro synthesis of the complementary strand of phiX174 DNA are discussed.

J Virol, 1975 Sep, 16(3), 463 - 9
Regulation of early mRNA synthesis after bacteriophage T4 infection of Escherichia coli; Linder CH et al.; Regulation of T4-specific mRNA synthesis was studied during leucine starvation of a leucine-requiring stringent Escherichia coli B strain . This was done by imposing starvation prior to T4 infection and then letting RNA synthesis proceed for different time periods . Rifampin or streptolydigin was added to stop further RNA synthesis, and protein synthesis was restored by addition of leucine . Samples were withdrawn at different times, and the enzyme-forming capacities found that, during conditions which elicit the stringent response in uninfected bacteria, immediate early mRNA is not stringently regulated . This conclusion contradicts the earlier conclusion of others, obtained by measuring incorporation of radioactive uracil; this is explained by the observation of Edlin and Neuhard (1967), confirmed and extended by us to the T4-infected cell, that the incorporation of uracil into RNA of a stringent strain is virtually blocked by amino acid starvation, whereas that of adenine continues at 30 to 50% of the rate seen in the presence of the required amino acid.

J Bacteriol, 1975 Sep, 123(3), 1043 - 54
Isolation of specialized transducing bacteriophage lambda carrying genes of the L-arabinose operon of Escherichia coli B/r; Boulter J et al.; A heat-inducible lysis-defective phage lambda (lambdacI857S7) has been integrated at multiple sites within the L-arabinose region (araCOIBAD) of a strain of Escherichia coli K-12 deleted for the normal lambda attachment site (lambdaattdelta) . The lambda phage has become integrated with opposite orientations at two different loci within the aratb gene and with the "normal" orientation (clockwise N-RA-J) at a single site in the araC gene . The burst size, spontaneous-curing frequencies, and number of prophage harbored by each of the ara secondary-site lysogens have been determined . From these secondary-site lysogens it has been possible to generate plaque-forming ara-transducing phage (lambdapara) and defective ara-transducing phage (lambdadara), as well as defective leucine-transducing particles (lambdadleu) . The construction and characterization of these lambdaara-transducing phage and their derivatives which carry genetically defined portions of the L-arabinose region are presented.

Proc Natl Acad Sci U S A, 1975 Sep, 72(9), 3642 - 6
Mutants of T7 bacteriophage inhibited by lambda prophage; Pao CC et al.; Mutants in gene 20, a new T7 gene, cannot grow on rex+ lambda lysogens . Gene 20-- mutants suppress in double mutants the phenotype of T7 ligase negative mutations, but not vice versa . Amber 20- mutants have been obtained . There are differences between these T7 mutations and the similar T4 rII mutations . There are host mutations which permit T7 20- mutants to grow on lambda+ lysogens . T7 DNA synthesis on normal lambda+ lysogens infected with 20- mutants is essentially normal, but the DNA is not packaged . The gene 20 protein is active in in vitro complementation and probably used late in infection for DNA packaging into phage heads.

Proc Natl Acad Sci U S A, 1975 Sep, 72(9), 3628 - 32
Transposition of R factor genes to bacteriophage lambda; Berg DE et al.; Transpositions of segments of R factor (antibiotic resistance plasmids) to bacteriophage lambda have been selected and characterized . Cells of Escherichia coli harboring R factors that determine kanamycin resistance were infected with phage lambda, and lambdakan transducing lines were obtained . Each of the three examined is unusual when compared to lambda transducing phages containing E . coli chromosomal genes: the kan insertions (a) occur at several sites, each well removed from the integration region POP', (b) are not associated with deletion of lambda phage DNA, and (c) are separable from the lambda genome during transduction or during lytic growth . Two insertions from the same R factor contain 1.5 kilobase sequences repeated in inverted order . The properties of the lambdakan phage suggest that R factors contain systems capable of mediating genetic exchange in the absence of extensive DNA homology . It is suggested that such systems of exchange may have played important roles in R factor evolution.

Proc Natl Acad Sci U S A, 1975 Sep, 72(9), 3300 - 4
Transcription termination and late control in phage lambda; Roberts JW; A transcription termination site occurs between the promoter for late gene expression of bacteriophage lambda and the late genes themselves . It is proposed that the lambda Q gene product controls late gene expression by over-coming this termination barrier.

Biokhimiia, 1975 Sep-Oct, 40(5), 1081 - 6
{Idnetification of DNA methylases in Escherichia coli CK cells}; Nikol'skaia II et al.; E . coli CK cell are found to contain metylase which catalyses the incorporation of CH33-groups into tissue and phage DNAs in vitro in the presence of S-adenosyl-L-methionine, the donor of methyl groups . The enzyme was precipitated by (NH4)2SO4 of 30-60% saturation, which increased its specific activity in 1.9 times . Metylase was active both in phosphate and Tris . HCl buffers, pH 6.5-7.5 and did not require Mg2+, EDTA and dithiotreithol . The enzyme recognises certain nucleotide sequences in all the DNAs studied and has more wide specificity as compared with the enzyme from E . coli B . Methylase from E . coli CK developed the highest activity with thymus DNA . Methylase from rat liver nuclei turned to be inactive with bacteriophage DNA.

Proc Natl Acad Sci U S A, 1975 Sep, 72(9), 3701 - 5
Bacteriophage T4 whiskers: a rudimentary environment-sensing device; Conley MP et al.; The 400 A filaments or "whiskers," which extend outward from the collar region of the phage, control retraction and extension of the tail fibers in response to certain environmental conditions . The tail fibers of normal phage retract in the absence of a required adsorption cofactor, at low pH, at low ionic strength, at low temperature, and at high concentrations of polyethylene glycol . The tail fibers of mutant whiskerless (wac) phage still retract under the first two conditions, but not the last three . Antibodies to whiskers neutralize T4, probably by fixing tail fibers in the retracted configuration . Phage with retracted tail fibers adsorb poorly to host bacterial cells, and their adsorption rate increases as the fibers become extended . These results suggest that one function of the whiskers is to retract the tail fibers and thereby prevent adsorption to host cells under certain conditions that might be unfavorable for production of phage progeny following infection.

J Virol, 1975 Sep, 16(3), 652 - 61
Polyacrylamide gel electrophoresis of intact bacteriophage T4D particles; Childs JD et al.; A method for the electrophoresis of intact bacteriophage T4D particles through polyacrylamide gels has been developed . It was found that phage particles will migrate through dilute polyacrylamide gels (less than 2.1%) in the presence of a low concentration of MgCl2 . As few as 5 x 10(9) phage particles can be seen directly as a light-scattering band during the course of electrophoresis . The band can also be detected by scanning gels at 260 to 265 nm or by eluting viable phage particles from gel slices . A new mutant (eph1) has been identified on the basis of its decreased electrophoretic mobility compared with that of the wild type; mutant particles migrated 14% slower than the wild type particles at pH 8.3 and 35% slower at pH 5.0 . The isoelectric points of both the wild type and eph1 mutant were found to be between pH 4.0 and 5.0 . Particles of T4 with different head lengths were also studied . Petite particles (heads 20% shorter than normal) migrated at the same rate as normal-size particles . Giant particles, heterogenous with respect to head length (two to nine times normal), migrated faster than normal-size particles as a diffuse band . This diffuseness was due to separation within the band of particles having mobilities ranging from 8 to 35% faster than those of normal-size particles . These observations extend the useful range of polyacrylamide gel electrophoresis to include much larger particles than have previously been studied, including most viruses.

J Virol, 1975 Sep, 16(3), 581 - 90
Escherichia coli capsule bacteriophages . IV . Primary structure of the bacteriophage 29 receptor, the E . coli serotype 29 capsular polysaccharide; Choy YM et al.; Using periodate oxidation, methylation analysis, characterization of oligosaccharides by Smith degradation or partial acid hydrolysis, as well as proton magnetic resonance, the primary structure of the Escherichia coli serotype 29 capsular polysaccharide (the receptor of E . coli K phage 29) was reinvestigated . The polymer was found to consist of hexasaccharide repeating units of the following structure: (see article).

J Antibiot (Tokyo), 1975 Sep, 28(9), 676 - 80
Action of bleomycin on the bacteriophate T7 infection; Shishido K et al.; A decrease in production of bacteriophage T7 was observed in bleomycin-treated Escherichia coli B cells . Bleomycin was found to shorten the eclipse in phage growth . A T7 early gene product, the T7-specific RNA polymerase which catalyzed the transcription of late gene appeared more rapidly in the bleomycin-treated cells than in the non-treated cells . The rate of phage adsorption increased to some extent in drug-treated cells . A possible mechanism to explain the mode of action of bleomycin is discussed.

Biochemistry, 1975 Aug 26, 14(17), 3787 - 94
Chain length determination of small double- and single-stranded DNA molecules by polyacrylamide gel electrophoresis; Maniatis T et al.; We describe the use of polyacrylamide gel electrophoresis to estimate chain lengths of double- and single-stranded DNA molecules in the size range 20-1000 base pairs (or nucleotides) . Double-stranded DNA molecules of known length produced either by organic synthesis or by restriction endonuclease digestion of viral DNAs were used as standards . The relative electrophoretic mobilities of these standards were examined on both nondenaturing (aqueous) polyacrylamide gels and on denaturing gels containing 7 M urea or 98% formamide . Electrophoretic mobility of DNA is a linear function of the log of molecular weight if appropriate conditions are used, although exceptions are noted . Chain lengths can be conveniently estimated by using as standards bacteriophage gamma DNA restriction fragments or commercially available tracking dyes.

Science, 1975 Aug 22, 189(4203), 637 - 9
High-resolution scanning electron microscopy of bacteriophages 3C and T4; Broers AN et al.; An account is presented of the design and operation of a new scanning electron microscopic, and its first application to the study of biological samples . Bacteriophages were chosen because much of their ultrastructure is beyond the resolution of the conventional scanning electron microscope . The new instrument permits examination of bulk samples with a resolution that exceeds, by at least a factor of 2.5, the resolution obtained in the best secondary electron scanning electron microscopes using high brightness guns, and exceeds by an order of magnitude the resolution of standard scanning electron microscopes using tungsten filament guns . It also permits examination of biological samples in scanning transmission mode at resolutions similar to conventional transmission electron microscopes.

Biochim Biophys Acta, 1975 Aug 21, 402(2), 150 - 60
Iolation and charcterization of a DNA-binding non-histone protein from Tetrahymena pyriformis; Donnelly TE Jr et al.; Three proteins (A, B and C) that bind specifically to single-stranded DNA have been isolated from the eukaryotic organism Tetrahymena pyriformis . Their molecular weights are 47 000, 41 000 and 32 000 . The amino acid composition of the A protein indicates that it is a non-histone protein and sucrose gradient centrifugation shows that it binds to bacteriophage M13 DNA and to oligo (dT)100 in a cooperative manner . The exonucleolytic degradation of oligo (dT)100 is prevented when it is bound to the A protein . The effect of A protein on the exonucleolytic reaction confirms the cooperative manner of binding of A protein binding to oligo (dT)100 and shows that this process may be prevented by high ionic strength . The A protein seems to be without enzymatic activity.

Biochim Biophys Acta, 1975 Aug 21, 402(2), 133 - 41
Inactivation of biologically active DNA by gamma-ray-induced superoxide radicals and their dismutation products singlet molecular oxygen and hydrogen peroxide; Van Hemmen JJ et al.; Since superoxide radicals are involved in many metabolically important as well as in some other, detrimental cellular processes, the reactivity of gamma-ray-induced superoxide radicals and its dismutation products singlet molecular oxygen and hydrogen peroxide with DNA have been studied . Superoxide dismutase which removes superoxide radicals and inhibits the formation of singlet oxygen in the solution protects the biologically active replicative form of DNA (from bacteriophage theta X174) against inactivation by ionizing radiation . Catalase which removes hydrogen peroxide also protects the DNA . Attempts with various chemical sources of singlet oxygen to determine whether this species inactivates DNA did not give an unequivocal answer . It is concluded from the presented experiments that a combination of the protonated form of the superoxide radical (HO-2) and H2O2 do inactivate DNA.

Eur J Biochem, 1975 Aug 15, 56(2), 563 - 9
Stabilization of promoter complexes with a single ribonucleoside triphosphate; Nusslein C et al.; Under specific binding conditions RNA polymerase forms complexes at several sites of the replicative form DNA of bacteriophage fd . One of these complexes becomes stable to both high salt and low temperature after incubation with GTP . None of the complexes is stabilized by ATP . The stabilization by GTP results from the synthesis of an oligo(G) chain, which is bound in the complex . Size and pyrimidine fingerprints of the DNA segment protected by the enzyme against digestion with DNase are not changed upon initiation of oligo(G) synthesis . This result indicates that binding site and initiation site are identical parts of a promoter region.

Can J Microbiol, 1975 Aug, 21(8), 1217 - 23
Isolation and characterization of a bacteriophage infective for a UDP-galactose-4-epimeraseless mutant of Escherichia coli; Pazoles CJ et al.; A DNA bacteriophage, designated CP13, was isolated against Escherichia coli J5, a UDP-galactose-4-epimeraseless mutant of E . coli 0111:B4 . Bacteriophage CP13 appears to be specific for rough bacterial strains . Adsorption studies with E . coli J5 grown with galactose show that the bacteriophage will not adsorb when complete lipopolysaccharide is present in the cell membrane . This indicates that lipopolysaccharide may be directly or indirectly involved with the receptor site for bacteriophage CP13 . The bacteriophage DNA has a G + C content of 52%.

J Biol Chem, 1975 Aug 10, 250(15), 5749 - 55
Translational repression of a viral messenger RNA by a host protein; Jay G et al.; It is shown that factor i, a bacterial protein, specifically inhibits that step in the initiation of R17 bacteriophage RNA translation that involves the attachment of native R17 RNA to 30 S ribosomal subunits carrying fMet-tRNA . This inhibition by factor i is relieved by the addition of excess R17 RNA, but not by the addition of excess 30 S subunits . That R17 RNA is the only target of the inhibition is demonstrated further by the fact that in a cell-free extract containing all components for protein synthesis, factor i-mediated inhibition of exogenous R17 RNA translation can be overcome only by the addition of excess R17 RNA and not by excess cell-free extract . Upon relief of inhibition, phage coat protein synthesis is restored; enhancement of formation of other cistron products is not seen . While initiation of R17 RNA translation is blocked by factor i, chain elongation is not affected . Although foactor i inhibits the IF-3-dependent binding of R17 RNA to fMet-tRNA-30 S complexes, under conditions of initiation of protein synthesis formation of stable complexes between factor i and IF-3 could not be detected, and factor i did not interfere with the binding of IF-3 to free, native R17 RNA . Instead of affecting the function of IF-3 or ribosomes, factor i exerts its inhibition by binding to R17 RNA and acting as a translational repressor . Factor i prefers intact R17 RNA to fragments generated by autoradiolysis; its binding to R17 RNA is specific in that little competition is observed by transfer RNA, ribosomal RNA or poly(A) . However, factor i has a high affinity for poly(U) sequences.

J Biol Chem, 1975 Aug 10, 250(15), 5742 - 8
Initiation of protein synthesis . Binding of messenger RNA; Jay G et al.; Complexes between 30 S ribosomal subunits and fMet-tRNA are formed during incubation of 30 S subunits with fMet-tRNA and all other components for initiation of protein synthesis, except R17 bacteriophage RNA . That these complexes serve as intermediates in the binding of messenger RNA is demonstrated directly by the finding that upon addition of R17 RNA, fMet-tRNA in preformed fMet-RNA-30 S complexes preferentially enters fMet-tRNA-30 S-R17 RNA complexes . On the other hand, incubation of 30 S ribosomal subunits with R17 RNA and all other components for initiation except fMet-tRNA does not yield 30 S-R17 RNA complexes that can act subsequently as functional intermediates in the binding of fMet-tRNA: formation of fMet-tRNA-30 S-R17 RNA complexes does not occur when fMet-tRNA is added and further binding of R17 RNA to 30 S subunits is prevented by specific inhibitors . These experiments lead to an unambiguous order of events in the sequence of initiation, in which binding of fMet-tRNA to the small ribosomal subunit must occur before messenger RNA can be bound and phased correctly . Complexes between fMet-tRNA and 60 S subunits are in rapid equilibrium with the free components, and have a half-life of less than 2 min at 37 degrees . This explains why such complexes are not detected in sucrose gradients, unless they are first fixed with glutaraldehyde . Attachment of R17 RNA, however, results in formation of an fMet-tRNA-30 S-R17 RNA complex that is stabilized greatly; fMet-tRNA in this complex exchanges only very slowly with free fMet-tRNA . Initiation factor IF-3 has two functions in initiation . The first is to direct the binding of messenger RNA to the 30 S-fMet-tRNA complex . This function is not needed when initiation complex formation occurs on ApUpG triplets, in which case the second function of IF-3 is detected, that of providing free 30 S subunits for initiation . The ability of IF-3 to bind directly to R17 RNA may be related to its requirement in messenger RNA recognition . However, since IF-3 exhibits a greater affinity for the 30 S subunit than for R17 RNA, it appears that the recognition function of IF-3 is expressed while IF-3 is associated with the 30 S subunit.

J Biol Chem, 1975 Aug 10, 250(15), 6015 - 21
Binding of glucocorticoid receptors to DNA; Rousseau GG et al.; DNA has been implicated as the nuclear acceptor for receptor-glucocorticoid complexes . The present study concerns the interaction of these complexes, isolated from cultured rat hepatoma cells, with purified DNA . This association is rapid, reaching a maximum within a few minutes at 0 degrees, whereas dissociation requires several hours . DNA binds neither free glucocorticoids nor those complexed with transcortin or cytosol proteins different from the receptor . Receptors which are not complexed by steroid have little or no affinity for DNA . "Activation," necessary for the binding of receptor-steroid complexes to isolated nuclei, also enhances DNA binding . The capacity of DNA for binding receptor-steroid complexes is large; saturation was not observed at the complex concentrations studied, using either crude or partially purified receptor preparations . The association of complexes with DNA is inhibited by divalent cations, at increasing ionic strengths, and by mercurial reagents . Complexes bind equally well to bacterial, bacteriophage, or rat DNA; however, there was either no or substantially reduced binding by bacterial 23 S rRNA . The binding of complexes to native DNA is roughly 3-fold greater than to denatured DNA . These characteristics are consistent with the possibility that DNA is the nuclear acceptor for receptor-glucocorticoid complexes; however, the actual composition of the acceptor sites remains unknown.

Biochim Biophys Acta, 1975 Aug 6, 402(1), 31 - 4
The binding of fd gene-5 protein to single-stranded nucleic acid; Dunker AK et al.; The gene-5 protein of the fd filamentous bacterial virus binds to single-stranded DNA over a pH range of 2-10.3 . Binding to fd DNA is several hundred-fold stronger than to bacteriophage R17 RNA or to DNA tetranucleotides.

Mol Gen Genet, 1975 Aug 5, 139(1), 19 - 31
The synthetase gene of the RNA phages R17, MS2 and f2 has a single UAG terminator codon; Atkins JF et al.; Translation of the RNA from the wild-type bacteriophages R17, MS2, and f2 in bacterial cell-free extracts containing an amber suppressor yields 30-40% of the synthetase with an approximate molecular weight of 63 500, slightly larger than the major synthetase product (63 000 daltons) . The occurrence of the 63 500 dalton in vitro product is dependent on the presence of an amber suppressor, and we predict that it is due to read-through of a UAG termination codon at the end of the synthetase gene . Previous results of Capecchi and Klein (Nature, 226, 1029-1033, 1070) showed that antibodies to both release factors RF1 and RF2 are required to block release of synthetase, suggesting that synthetase is released at a UAA codon . If the interpretations of both experiments are correct, the termination and release may not be synonomous and may be spatially separated . In addition there is the unexplained fact that 7% of the synthetase made in vitro in both su+ and su- extracts with either R17, MS2 or f2 as template has an apparent molecular weight of 66 000.

J Med Microbiol, 1975 Aug, 8(3), 389 - 95
Ultrastructure of L-phase variants isolated from a culture of Mycobacterium phlei; Imaeda T; Relatively stable L-phase colonies were isolated from old cultures of a selected clone of Mycobacterium phlei . The colonies grew at 52 degrees C and were composed of rod-shaped, oval or spherical cells . Large amoeba-like cells were occasionally present . These were usually limited by a double-layered membrane and devoid of normal cell-wall components such as bacteriophage receptors . The large amoeba-like bodies sometimes showed both outer and inner double-layered membranes, especially in pseudopodium-like cellular extensions . An unusual feature of rod-shaped cells was retention of the original shape despite the loss of their cell walls . Two types of walled cells occurred during successive transfers of L colonies . One was the true revertant which had characteristics in common with the wild-type M . phlei, such as growth at 52 degrees C and ultrastructural organisation . The other, designated as the "atypical-cell-wall variant", was characterised by growth at 52 degrees C, thick cell walls, and disordered septation . Wild-type M . phlei, L variants, revertants and atypical-cell-wall variants released mycobacteriophage particles . These bacteriophages were almost identical in respect to morphology, host range, and neutralisation by antiserum . The results obtained suggest strongly that all types of cells examined were derived from M . phlei.

Proc Natl Acad Sci U S A, 1975 Aug, 72(8), 3024 - 8
Visualization of a novel junction in bacteriophage lambda DNA; Valenzuela MS et al.; At early times after infection of a recA derivative of Escherichia coli with lambdab221c126red270a42 phage, a low but significant proportion of intracellular lambda molecules show a novel junction . These junctions are also present, although in reduced numbers, in a lysate obtained at late times after infection of a recA+ host with lambdacIIcIII phage . Fine structure and denaturation mapping analyses showed that these junctions occur at homologous positions and that they are compatible with the occurrence of a cross-strand exchange between lambda DNA duplexes similar to the type proposed in most molecular models for genetic recombination . However, the results are also consistent with the structures expected if a replicating growing point undergoes branch migration.

Lipids, 1975 Aug, 10(8), 497 - 500
Effects of bacteriophage M13 infection upon phospholipid and fatty acid compositions of Escherichia coli; Chattopadhyay PK et al.; Escherichia coli K38 were grown and infected with wild type and amber mutants of bacteriophage M13 in the early log phase . Lipid compositions of the infected and healthy cultures, grown under identical conditions, were determined 2 hr after infection . From the results, it was observed that total lipid and total phospholipid content remained nearly constant, suggesting that the cell membrane which contained the maximum phospholipids was not damaged by the infection . Moreover, the percentage of diphosphatidylglycerol and lyso- compounds corresponding to phosphatidylethanolamine and phosphatidylglycerol increased, while phosphatidylethanolamine and phosphatidylglycerol decreased . The increase in lyso- compounds may be due to the relase of phospholipase A2 (a periplasmic enzyme) from the cell wall after damage by the infection . Bacteriophage M13 infection had no effect on the fatty acid compostion of the phospholipids.

Cell, 1975 Aug, 5(4), 389 - 400
A mutant of escherichia coli defective in removing 3' terminal nucleotides from some transfer RNA precursor molecules; Seidman JG et al.; The conversion of precursor RNA into bacteriophage T4 proline and serine transfer RNAs includes two steps for the enzymatic removal of nucleotides from the 3' ends of RNA chains . Neither of these steps occur following infection of a mutant of Escherichia coli that was previously shown to block the suppressor function of T4 serine transfer RNA . Cell-free extracts of this mutant are furthermore deficient in a wild type enzyme activity that removes nucleotides from the 3' ends of one of the RNA chains described above . The relation of this enzyme to other 3' ribonucleases is not known . We subsequently examined the mutant for its ability to support the biosynthesis of other bacteriophage transfer RNAs . In one instance that is analogous to the proline-serine precursor RNA, maturation of the precursor RNA was blocked during infection of mutant cells . In another instance, precursor RNA maturation was normal, even though this involved the removal of 3'nucleotides . These observations point to the possible existence of at least two 3' ribonucleases for the biosynthesis of transfer RNAs.

J Virol, 1975 Aug, 16(2), 459 - 61
Lysozymes from bacteriophages T3 and T5; DeMartini M et al.; Lysozymes produced in host cells infected with bacteriophages T3 and T5 were found to have the same enzymatic specificity toward the peptidoglycan from Escherichia coli as T7 phage lysozyme, which has been shown to be an N-acetylmuramyl-L-alanine amidase.

J Virol, 1975 Aug, 16(2), 453 - 5
Biological functions of the bacteriophage T3 SAMase gene; Krueger DH et al.; Certain differences between phage T3 on the one hand and T3sam- and T7 on the other hand indicate that the T3-coded SAMase function is responsible (i) for the development of the pseudolysogenic state by preventing T3 DNA methylation, and (ii) for the partial protection of the phage DNA against restriction by the P system.

J Virol, 1975 Aug, 16(2), 412 - 9
Synthesis of complex forms of bacteriophage phiX174 double-stranded DNA in a temperature-sensitive dnaC mutant of Escherichia coli C; Kranias EG et al.; Fast-sedimenting forms of bacteriophage phiX174 double-stranded replicative-form DNA observed in normal infections continued to accumulate at the nonpermissive temperature in a temperature-sensitive dnaC mutant of Escherichia coli . These complex molecules accounted for up to half of the DNA synthesized during short pulses at the nonpermissive temperature . They were the dead-end products of DNA synthesis, not intermediates in normal replicative-form replication . The data suggest that these higher-than-normal-molecular-weight DNA molecules result from abnormal initiation of phiX174 replicative-form DNA replication.

J Virol, 1975 Aug, 16(2), 348 - 55
Replication of bacteriophage M13 IX . Requirement of the Escherichia coli dnaG function for M13 duplex DNA replication; Ray DS et al.; Temperature-shift experiments with an Escherichia coli dnaG strain indicate a requirement for the dnaG function for M13 phage production only at an early stage of infection . Mutant cells infected at nonpermissive temperature form the parental RF (SS leads to RF) but do not replicate further . A shift to nonpermissive temperature after infection inhibits RF leads to RF replication but not RF leads to SS synthesis . The synthesis of both strands of the duplex RF was inhibited equally after a temperature shift during RF leads to RF replication . We infer that the dnaG protein is required for M13 production only during RF replication and that it is required for the synthesis of both strands of the RF.

J Virol, 1975 Aug, 16(2), 340 - 7
Discriminative effect of rifampin of RNA replication of various RNA bacteriophages; Engelberg H et al.; Rifampin interferes exclusively with RNA replication in vivo of the group I phages MS2, f2, and R17, whereas QbetaRNA replication is unaffected by the drug . In addition, rifampin has a discriminative effect of group I phage RNA replication . In the experimental system employed by us the antibiotic differentially interferes with the synthesis of minus RNA strands in f2, whereas it has almost no effect on the synthesis of progeny plus strands . In MS2, the drug differentially arrests the synthesis of progeny plus strands and almost fails to affect the synthesis of minus RNA strands . In R17 both steps of its RNA replication are affected by rifampin, although each step is only partially (approximately 50%) inhibited . The relation of the present results to the possible role of bacterial proteins and tertiary structure of phage RNA in the process of template recognition is discussed.

J Virol, 1975 Aug, 16(2), 284 - 9
Interaction of P2 bacteriophage with the dnaB gene of Escherichia coli; Sunshine M et al.; The dnaB gene product of Escherischia coli is required for multiplication of temperate phage P2 . At 37 C in dnaB-ts mutnats, P2 will not plaque and gives a very small burst of progeny . P2 mutants have been isolated which can grow well enough to plaque under these conditions . This type of phage mutant is cis dominant, and one such mutant (P2rlb1) has been mapped near the left end of the early gene B and to the right of the cox4 (excision) mutation . The rlb1 mutation does not lie at the replication origin, but may affect transcription in the early region, which includes the replication origin . It may also represent a site on the P2 DNA which interacts with the dnaB gene product.

J Virol, 1975 Aug, 16(2), 222 - 7
Polyamines in bacteriophage R17 and its RNA; Fukuma I et al.; Bacteriophage R17 and its RNA were found to contain significant amounts of spermidine but not of putrescine . When isolated at 0.01 M KCl, up to 1,000 molecules of spermidine were associated with the virion . The phage RNA isolated with phenol plus sodium lauryl sulfate contained approximately 70 to 90 molecules of spermidine . The association appeared to be ionic because the bound spermidine could be dissociated by KCl, MgCl2, or both . Effects of polyamines on in vitro translation were studied using both poly(U) and phage R17-RNA as mRNA . Addition of spermidine to the system at suboptimal concentrations of Mg2+ resulted in marked stimulations of the rate of protein synthesis . Putrescine alone had no effect but stimulated the incorporation in the presence of suboptimal concentrations of spermidine plus Mg2+ . The isolated amino acid-incorporating system contained suboptimal soluble and bound polyamines . A comparison of incorporation was made in this system using R17-RNA with and without bound spermidine . No effects of these bound cations were detected on the rate or extent of incorporation of valine . The ratio of incorporation of histidine (present in non-coat proteins) to valine (total protein) revealed little difference as a functions of cation in the system or a function of the spermidine present in R17-RNA.

J Bacteriol, 1975 Aug, 123(2), 768 - 70
Analysis of bacteriophage deoxyribonucleic acid sequences methylated by host- and R-factor-controlled enzymes; May MS et al.; Phages lambda and fd were propagated in Escherichia coli strains that have either host K-12 or the N-3 R-factor deoxyribonucleic acid-cytosine methylase activity . Pyrimidine tracts containing 3H-labeled 5-methylcytosine (MeC) were analyzed; in all cases, the major methylated sequence was 5' .. . C-MeC-T .. . 3'.

J Virol, 1975 Aug, 16(2), 228 - 36
Hexamer of bacteriophage f2 coat protein as a repressor of bacteriophage RNA polymerase synthesis; Chroboczek J et al.; Formation of complex I between phage f2 RNA and coat protein, leading to repression of phage RNA polymerase synthesis, depends nonlinearly upon the concentration of the coat protein . Maximum formation of complex I was observed when six molecules of coat protein were bound to one molecule of RNA . RNase digestion of a glutaraldehyde-fixed complex left, as the products, coat protein oligomers . The heaviest, hexamers, predominated in the mixture . It was also shown that, in an ionic environment required for phage protein synthesis, coat protein at a concentration optimum for complex I formation exists in solution as a dimer . The results indicate that the translational repression of the RNA polymerase cistron is due to a cooperative attachment to phage template of three dimers of coat protein, forming a hexameric cluster on an RNA strand.

J Virol, 1975 Aug, 16(2), 330 - 9
Synthesis of functional bacteriophage T4-delayed early mRNA in the absence of protein synthesis; Morse JW et al.; When Escherichia coli B207 is grown either aerobically or under limited aerobic conditions, pretreated with chloramphenicol to block protein synthesis, and then infected with bacteriophage T4, the phage RNA which accumulates, termed "immediately early" (IE), contains the transcripts of a limited number of prereplicative genes . Among the transcripts which accumulate is the mRNA which serves as a template for deoxycytidylate hydroxymethylase (HMase) synthesis . Among the prereplicative gene transcripts which do not accumulate under these conditions are deoxycytidine triphosphatase (dCTPase), alpha-glucosyl transferase (alphg-gt), and deoxynucleotide kinase (kinase); these genes have been termed "delayed early" (DE) . In contrast, when protein synthesis is inhibited by depleting aerobically grown E . coli B207 of K+, both IE and DE T4 RNA accumulate, but these transcripts do not contain functional HMase, dCTPase, alpha-gt, or kinase mRNA's . However, if E . coli is grown under conditions of limited aeration and then depleted of K+ prior to T4 infection, the T4 RNA which accumulates contains both IE and DE transcripts and functional HMase, dCTPase, and alpha-gt mRNA's . Functional kinase mRNA does not accumulate under these conditions . The results of these experiments indicate that the synthesis of functional DE RNA in the absence of simultaneous protein synthesis, depends on the physiological condition of the cells and the way in which protein synthesis is inhibited . In addition, data is presented which suggests that extensive transcription of DE genes in the absence of protein synthesis results in the inhibition of transcription of certain IE genes.

J Biol Chem, 1975 Jul 25, 250(14), 5563 - 73
The synthesis of a DNA duplex corresponding to the icosanucleotide sequence at the 5' end of messenger RNA from the gene N of bacteriophage lambda; Agarwal KL et al.; In connection with work on the nucleotide sequence of the promoter for the gene N of bacteriophage lambda as well as a study of the mechanism of transcription, a 20-unit long DNA duplex corresponding to the known sequence at the 5' end of the above gene transcript has been synthesized . For synthesis, the required duplex was divided into the following deoxyribooligonucleotides: a) the dodecanucleotide, d-A-T-C-A-G-C-A-G-G-A-C-G (II); b) the octanucleotide, d-C-A-C-T-G-A-C-C- (IV); c) the hexanucleotide, d-G-C-T-G-A-rU (I); and d) dodecanucleotide, d-T-C-A-G-T-G-C-G-T-C-C-T (III) . All of the four olignucleotides were chemically synthesized and characterized by extensive chromatographic and fingerprinting methods (after labeling the 5' ends with{32P}phosphate group) . Longer polynucleotides (an icosa- and an octadecanucleotide) were prepared by polynucleotide ligase-catalyzed joining of segments I and III and by joining segments II and IV . The use of the octadecanucleotide, d-T-C-A-G-T-G-C-G-T-C-C-T-G-C-T-G-A-rU, in work on the sequence analysis of the promoter is described in the accompanying paper . The octadecanucleotide and icosanucleotide were hybridized together to give the double-stranded duplex.

J Biol Chem, 1975 Jul 25, 250(14), 5523 - 9
Bacteriophage T7 deoxyribonucleic acid replication in vitro . Purification and properties of the gene 4 protein of bacteriophage T7; Hinkle DC et al.; The T7 gene 4 protein, a protein known from genetic analysis to participate in phage DNA replication in vivo, has been purified approximately 500-fold with an in vitro complementation assay . The protein, purified from cells infected with a T7 gene 4 temperature-sensitive mutant, is thermolabile, establishing that the complementation activity is in the protein product of the phage gene 4 . The purified protein has no detectable nuclease, DNA polymerase, or RNA polymerase activity . However, in addition to stimulating the rate of DNA replication in crude extracts of T7 gene 4 mutant-infected cells, the gene 4 protein effects a marked stimulation of DNA synthesis by the purified T7 DNA polymerase when duplex T7 DNA is used as template . This effect is not observed when denatured T7 DNA is used as template, or when phage T4 DNA polymerase or Escherichia coli DNA polymerase I, II, OR III is substituted for the T4 enzyme . Analysis of the DNA synthesized by the T7 DNA polymerase in the presence of the gene 4 protein indicates that much of the product is in short DNA chains which are not covalently attached to the template . This result suggests a novel mechanism for the initiation of DNA chains in this reaction.

J Biol Chem, 1975 Jul 25, 250(14), 5515 - 22
Bacteriophage T7 deoxyribonucleic acid replication invitro . Bacteriophage T7 DNA polymerase: an an emzyme composed of phage- and host-specific subunits; Modrich P et al.; The DNA polymerase induced after infection of Escherichia coli by phage T7 has been purified 500-fold to near homogeneity as judged by polyacrylamide gel electrophoresis in the presence of sodium dodecyl sulfate . The purified enzyme complements extracts of cells infected with a T7 gene 5 mutant to permit cell-free replication of duplex T7 DNA . In contrast, purified T4 DNA polymerase or E . coli DNA polymerase I is unable to do so, thus suggesting a specific requirement for the T7 enzyme in the replication of the viral DNA . E . coli TsnC protein is present in purified T7 DNA polymerase in one-to-one stoichiometry with T7 gene 5 protein, and can be isolated in homogeneous form from heat-denatured enzyme by chromatography on DEAE-cellulose . The inactive form of T7 gene 5 protein that accumulates in tsnC hosts has been partially purified . When partially purified gene 5 protein is mixed with purified TsnC protein, DNA polymerase activity is restored, and formation of a one-to-one complex between the two proteins occurs . These results indicate that the functional form ofT7 DNA polymerase is a complex composed of phage- and host-specified subunits.

J Biol Chem, 1975 Jul 25, 250(14), 5508 - 14
Bacteriophage T7 Deoxyribonucleic acid replication in vitro . A protein of Escherichia coli required for bacteriophage T7 DNA polymerase activity; Modrich P et al.; In vivo, replication of T7 DNA does not occur after infection of Escherchia coli tsnC mutants (CHAMBERLIN, M . (1974) J . Virol . 14, 509-516) . In vitro, extracts of tsnC mutant E . coli infected with T7 hage are incapable of replicating duplex T7 DNA, although extracts of wild type E . coli infected with T7 phage support replication of T7 DNA . In addition, extracts of the infected tsnC mutant are deficient in T7 DNA polymerase activity . Extracts prepared from uninfected E.coli tsnC-+ cells restore the ability of the infected tsnC extracts to replicate duplex T7 DNA, and also restore normal levels of the phage DNA polymerase activity . A 12,000-dalton heat-stable protein responsible for this complementation has been purified to near homogeneity from uninfected tsnC+ extracts and it is designated "TsnC protein."

J Biol Chem, 1975 Jul 25, 250(14), 5688 - 95
Enhanced differential synthesis of proteins in a mammalian cell-free system by addition of polyamines; Atkins JF et al.; Addition of the polyamines spermidine, spermine, or putrescine to a fractionated mammalian cell-free protein-synthesis system programmed by a variety of mRNAs results in a 3- to 5-fold stimulation of amino acid incorporation over that found in the absence of added polyamine . The mRNAs used as template were adenovirus mRNA, globin 9s mRNA, and RNA from the bacteriophages R17, Qbeta, and MS2 . The relative amounts of 10 adenovirus polypeptides synthesized in vitro are altered by the addition of polyamines to the translation system to reflect more closely the relative amounts of these polypeptides synthesized in vivo . This qualititive improvement in translation products on addition of polyamines allow the analysis of a number of products which are at best only marginally synthesized in the absence of added polyamines . The low level of synthesis due to endogenous mRNA is stimulated by spermidine and spermine but a lesser extent by putrescine.

J Biol Chem, 1975 Jul 25, 250(14), 5574 - 82
The nucleotide sequence in the promoter region of the gene N in bacteriophage lambda; Kleid DG et al.; The sequence of 18 nucleotides in the region preceding the initiation of transcription of the gene N of bacteriophage lambda has been determined to be as follows (see article) . The basic approach used for the sequence determination involved Escherichia coli DNA polymerase I-catalyzed elongation of the octadecanucleotide primer, dT-C-A-G-T-G-C-G-T-C-C-T-G-C-T-G-A-rU, possessing the appropriate polarity and nucleotide sequence corresponding to the 5' end of the gene N transcript . Following hybridization of the primer to the r-stand of bacteriophage lambda CI85657, sequences of the newly grown ollgonucleotide chains were determined by a) partial exonuclease digestion followed by two-dimensional fingerprinting; b) determination of pyrimidine tracts; and c) nearest neighbor analyses . Primer elongation was carried out in a controlled manner, the size of the newly grown chains being kept short by the following techniques: a) insertion of a ribonucleotide unit as the 3' terminus of the primer; b) use of a limited number of deoxynucleoside 5'-triphosphates in the elongation reaction; and c) enlongation of the primer using all the four nucleoside triphosphates with one of the triphosphates being supplied in a limiting concentration.

J Biol Chem, 1975 Jul 25, 250(14), 5530 - 41
Nucleotide sequence studies of normal and genetically altered glycine transfer ribonucleic acids from Escherichia coli; Roberts JW et al.; The total nucleotide sequence of tRNAGGA/G -Gly2 from Escherichia coli is pG-C-G-G-G-C-A-U-C-G-U-A-U-A-A-U-G-G-C-U-A-U-U-A-C-C-U-C-A-G-C-C-U-N-C-C-A-A-G-C-U-G-A-U-G-A-U-G-C-G-G-G-T-psi-C-G-A-U-U-C-C-C-G-C-U-G-C-C-C-G-C-U-C-C-AOH, where T- at position 53 is ribothymidylic acid, and psi- at position 54 is pseudouridylic acid; N- at position 36 is an unidentified derivative of uridylic acid, and is present in modified form in a portion of tRNAGGA/G -Gly 2 molecules isolated from E . coli cells . The missense suppressor mutation, glyTsuA36(HA), results in a C yields U base substitution at the 3' end of the anticodon of tRNAGGA/G -Gly 2 (nucleotide position 38) . A secondary effect of this base substitution is the modification of the A residue directly adjacent to the 3' end of the anticodon of tRNAsuA36(HA), -Gly 2 suggesting that the enzymes responsible for this modification recognize the anticodon sequences of prospective tRNA substrates . The creation of a missense-suppressing tRNA, tRNAsuA36(HA), -Gly 2 by an alteration of the anticodon sequence of tRNAGGA/G -Gly 2 is analogous to mechanisms whereby other suppressor tRNAs have arisen . The high degree of nucleotide sequence homology between the amino acid acceptor stems and anticodon regions of four glycine isoaccepting tRNAs specified by E . coli and bacteriophage T4 suggests that these regions may be recognized by the glycyl-tRNA synthetase; the involvement of the anticodon region in the synthetase recognition process is supported by the greatly decreased rate of aminoacylation of tRNAsuA36(HA) -Gly 2.

Biochim Biophys Acta, 1975 Jul 23, 395(4), 433 - 45
Bacteriophage phi X174 DNA synthesis in Escherichia coli HF4704S (dnaHts) cells; Sakai H et al.; The DNA synthesis of bacteriophage phiX174 in Escherichia coli HF470S, a mutant temperature sensitive in the initiation of DNA replication (dnaHts), has been examined . In HF4704S cells, phiX174 can grow normally at 27 degree C whereas the phage cannot grow after the cessation of DNA synthesis of the host cells at 42 degrees C . Upon infection, phiX174 DNA can be injected into the host cell and the parental replicative form can be formed, but the progency replicative form cannot be synthesized at 43 degrees C in the absence of host DNA synthesis . The progency replicative form cannot be synthesized at 27 degrees C in the presence of 30 mug chloramphenicol/ml in the host cell which has been incubated for 74 min at 43 degrees C followed by transfer to 27 degrees C in the presence of 30 mug chloramphenicol/ml . When 30 mug chloramphenicol/ml is added later than 5 min after the temperature shift-down to 27 degrees C, the progency replicative form synthesis is not inhibited . Thus, the host cell function, for which the gene dnaH is responsible, has been shown to be essential to the progency replicative form production.






What Is Growth Medium?, What Is Amino Acid?, What Is Salmonella?, What Is Dna?, What Is Genome?, e, Microorganisms, r, Microbes, n, Bacteria, r, Bacterium, i, Bacteriology, n, S. cerevisiae, o, Yeasts, r, Culture medium, c, Staphylococcus, o, Candida albicans, c, Bacillus, e, Lactococci, c, Botulin, c, Candida albicans, i, Beta lactamase, e, Clostridia, s, Antimicrobials, a, Neisseria, a, Salmonella, e, Yeasts, i, Escherichia coli, e, Penicillin, n, Staphylococcus, s, Botulin, r, Cell cultures, c, Antimicrobials




 

   Scientific Publications - Work Done by Microbiology Reader Bioscreen C

Agricultural Microbiology
Anaerobic Microbiology
Antimicrobial Susceptibility
Artificial Atmosphere
Bioassay of Antibiotics
Biofilm Microbiology
Bioreactor Technology
Biotechnology
Cell Biology
Clinical Microbiology
Environmental Microbiology
Experiments with Yeast
Fermentation
Food Microbiology
Functional Genomics
Gene Technology
Growth Media Development
Growth Rate and Lag Time
Industrial Microbiology
Medical/Pharmaceutical Field
Microbiological Assay
Microbiological Research
Microbiology of Cosmetics

go to a specific theme...

Military Microbiology
Molecular Microbiology
Mutagenicity and Genotoxicity
Oral Microbiology
Patents
Postantibiotic Studies
Soil Microbiology
Spore Microbiology
Veterinary Microbiology
Waste/Wastewater Treatment
Water Microbiology
Wine Microbiology

 


 

© 2005 Transgalactic Ltd (manufacturer of Bioscreen C software) | Privacy Statement | P.O. Box 1393, 00101 Helsinki, Finland, phone: +358 9 85172920, fax: +358 9 8749481, e-mail: microbiology@bionewsonline.com
 

 

 

Last modified: May 25, 2005