J Virol, 1976 Feb, 17(2), 326 - 34 Bacteriophage T4-induced shut-off of host-specific translation; Svenson SB et al.; To study the mechanism by which bacteriophage T4 inhibits the synthesis of inducible host enzymes we measured the formation of beta-galactosidase from preformed lac mRNA . Beta-Galactosidase was induced with isopropyl-beta-D-thiogalactopyranoside in the presence of 7-azatryptophan, a tryptophan analogue that is incorporated into proteins and renders the beta-galactosidase formed inactive . The accumulated las mRNA was measured by capacity to form active beta-galactosidase after a chase of the analogue with excess tryptophan . After T4 infection the ability to form beta-galactosidase from the preformed lac mRNA was rapidly lost even when T4 infection took place in the presence of rifampin . This restriction was dependent on the multiplicity of infection . At a multiplicity of infection of 8.6, 90% of the ability to express preformed lac mRNA was lost within 30 s . The kinetics of cessation of beta-galactosidase synthesis after T4 infection indicate that infection blocks initiation of lac mRNA translation. J Virol, 1976 Feb, 17(2), 307 - 15 Effect of the "RNA control" locus in Escherichia coli on RNA bacteriophage R23 replication; Ernberg J et al.; The effect of the rel gene of Escherichia coli on the RNA synthesis induced by phage R23 was studied . This RNA phage has the property of inhibiting ribosomal RNA formation and completely dominating the RNA synthesis of the host . Phage-specific RNA formation was found to be dependent on the allelic state of the rel gene . Determinations of RNA synthesis were made by both cumulative and short-term incorporations of uracil and adenine . Variations in labeling of nucleotide pools were compensated for by determining specific activities of ATP and UTP and using these values to obtain true, relative rates of RNA synthesis. Chem Biol Interact, 1976 Feb, 12(2), 197 - 210 The effect of 5-iodouracil on the growth and biosynthetic processes of bacteriophage T4td8 in the absence of light; Byrd DM et al.; 5-Iodouracil (IUra)-substituted progeny bacteriophage T4td8 were grown under conditions such that, upon CsCl equilibrium isopycnic gradient centrifugation, progeny with density distributions about the median similar to that of unsubstituted phage are obtained . In the absence of light a monotonic relationship exists between decreasing progeny viability and increasing percent IUra substitution . IUra is equivalent to thymine as a growth factor on a molar basis, and at concentrations of IUra plus thymine above that required for maximum particle production, the percent IUra substitution in phage DNA is determined by the mole fraction of IUra in the medium . The lethal effects of 5-iodo-2'-deoxyuridine (IdUrd) and IUra are equivalent, and are not produced by a direct effect on the phage particles . At equivalent percent substitution in phage DNA the order of lethality is IUra greater than 5-bromouracil (BrUra) greater than 5-chlorouracil (ClUra) . There is no interference with the transfer of thymine from host cell to progeny phage by the presence of IUra in the medium, and IUra affects neither the time of lysis nor the content of phage DNA in the infected cells. J Virol, 1976 Feb, 17(2), 538 - 49 Level of specific prereplicative mRNA's during bacteriophage T4 regA-, 43- and T4 43- infection of Escherichia coli B; Trimble RB et al.; The role of the T4 bacteriophage regA gene in stabilizing early mRNA was investigated by assaying the level of functional mRNA from eight prereplicative genes (56 {dCMP hydroxymethylase}, cd {dCMP deaminase}, 1 {deoxynucleotide kinase}, rIIA, rIIB, 46 {DNA arrest}, and 45) during extended infection of Escherichia coli B with T4 regA-, 43- and T4 43- bacteriophage . The above gene-specific transcripts in RNA isolated from infected cells were quantitated by translation with an E . coli B cell-free system . Conditions were chosen to insure that the amount of gene product formed in vitro, measured either as an enzyme activity or as a radioactive band in acrylamide gel, was directly proportional to the level of mRNA present . The failure of T4 regA-, 43- phage to terminate prereplicative synthesis (Wiberg et al., 1973) resulted in an enhanced production of many early gene products over those formed during T4 43- infection . This increase did not appear to be associated with an increment in mRNA levels, since in the present study gene-specific early mRNA's were found to be only marginally elevated and slightly more stable in T4 regA-, 43-- than in T4 43--infected cells . Of interest was the observation that significant quantities of all of the mRNA's studied; with the exception of those from genes 45 and 46, could be isolated from T4 43--infected cells after synthesis of the respective gene products had ceased . On termination of normal prereplicative synthesis during infection with T4 43- phage, polyribosomes were found to be dissociated completely, a finding which suggests that the residual mRNA present in these cells is free in the cytoplasm . The persistence in T4 43--infected cells of translatable mRNA for many prereplicative genes after product synthesis ceased indicates that the impairment in protein synthesis is not due solely to regA-mediated messenger degradation or modification . Rather, the results suggest that the regA gene product may act either by interfering with early mRNA polypeptide chain initiation or by promoting prereplicative polysome dissociation. J Virol, 1976 Feb, 17(2), 550 - 67 Bacteriophage T4 head morphogenesis . VII . Terminal stages of head maturation; Hamilton DL et al.; Several aspects of the terminal stages of T4 head maturation were investigated using ts and am mutants blocked at single steps of the assembly pathway . We had previously found that cells infected with mutants of gene 13, e.g., tsN38 and amE609, accumulated both stable (10 to 20%)- and fragile (80%)-filled head precursors (Hamilton and Luftig, 1972) . Here we showed the following for such gene 13-defective, mutant-infected cells . (i) Using thin-section analysis the pool of phage precursor structures observed under nonpermissive conditions was one-third of that observed when the cells were cultured under permissive conditions . (ii) In order for complete conversion of the precursors into viable phage to occur, there were apparent requirements of metabolic energy, protein, and DNA synthesis . (iii) The intracellular DNA pool under nonpermissive conditions exhibited a 50% distribution between 63S (mature size) and 200 S (concatenate size) DNA, with the latter DNA serving as a precursor pool . Further, this DNA pool when spread onto a protein monolayer exhibited a dispersed array of DNA, strands around a core, which was less dense than that found for the greater than 1,000S DNA concatenate isolated from gene 49-defective infected cells . (iv) When precuations were taken to stabilize the head precursors, such as lysis of the cells into glutaraldehyde, there was a 30% increase in the yield of 1,200S filled heads . Correlating these results and previous results concerning gene 49-defective unfilled heads, we propose that there are several forms of gene 13 fragile head precursors which serve as intermediates between gene 49 unfilled heads and gene 13 stable filled heads . We cannot, however, rule out the possibility that all gene 13-defective heads represent a single class of unstable particles, which decay slowly . In either case, we have shown that gene 13-defective particles are unstable to some degree inside the cell and are highly unstable outside the cell; yet all particles can still be efficiently converted to phage in vivo. J Bacteriol, 1976 Feb, 125(2), 409 - 15 Nature of the energy requirement for the irreversible adsorption of bacteriophages T1 and phi80 to Escherichia coli; Hancock RW et al.; The nature of the energy requirement for irreversible adsorption of phages T1 and phi80 was studied by using various specific energy inhibitors and mutants lacking either the Ca2+, Mg2+-adenosine triphosphatase or the ability to produce cytochromes in the absence of added 5-aminolaevulinic acid . It was found that irreversible adsorption could be energized both through the electron transport chain and from adenosine 5'-triphosphate via the Ca2+, Mg2+-adenosine triphosphatase, indicating the involvement of the energized membrane state . These results and the discovery that phages T1 and phi80 adsorb reversibly to the isolated tonA gene product are discussed in terms of the possible involvement of functions expressed by the tonB gene region in irreversible adsorption and the relationship to iron transport. J Virol, 1976 Feb, 17(2), 316 - 25 Isoaccepting species of serine tRNA coded by bacteriophage T5sto; Henckes G et al.; By aminoacyl-tRNA-DNA hybridization and chromatographic analysis, evidence was provided that the bacteriophage T5stO codes for two tRNAser species . Trinucleotide- or polynucleotide-stimulated binding experiments assigned the codons UCC or UCU to these two tRNAser species . They also suggested that the synthesis of these two tRNAser species does not modify the reading capacity for codons less used in Escherichia coli F and corresponds to a different situation compared with the T4-coded tRNA's. Biochemistry, 1976 Jan 27, 15(2), 407 - 14 Nucleotide clusters in deoxyribonucleic acids . Comparison of the sequences of the large pyrimidine oligonucleotides of bacteriophages S13 and phiX174 deoxyribonucleic acids; Harbers B et al.; The large pyrimidine oligonucleotides from the DNAs of the two related bacteriophages phiX174 and S13 have been sequenced . The largest pyrimidine oligonucleotide present is unique to S13 DNA and is the undecanucleotide C5T6, sequence C-T-T-C-C-T-C-T-T-C-T . Considerable sequence homology has been found between the pyrimidine oligonucleotides of the two phage DNAs . Out of 14 oligonucleotide sequences from S13 DNA (120 bases) at least ten are identical with sequences of oligonucleotides from phiX174 DNA (92 bases) and two are closely related (17 bases), the only difference being a single thymine to cytosine transition in each sequence (a total of 107 identical bases) . The pyrimidine oligonucleotides of each phage DNA show extensive internal sequence homology among each other with up to eight bases identical in sequence in pairs of different oligonucleotides . Another interesting observation is the occurrence of symmetrical sequences (true palindromes) which read the same forwards as backwards . The longest symmetrical sequence is the nonanucleotide C4T5 sequence, C-T-C-T-T-T-C-T-C, present in both S13 and phiX174 DNAs . The extensive sequence homology observed between the pyrimidine oligonucleotides of S13 and phiX174 supports the close relationship of the two phages and provides further evidence that they were derived from recent common ancestors. J Biol Chem, 1976 Jan 25, 251(2), 536 - 47 The physical mapping of bacteriophage T5 transfer tRNAs; Chen MJ et al.; Transfer RNAs, isolated from Escherichia coli F cells infected with T5 bacteriophage, were charged with radioactive amino acids and used in RNA-DNA hybridization studies to detect and locate T5 tRNA cistrons in the T5 DNA chromosome . Hybridization of 14 3H-aminoacyl-tRNA species, including purified T5 {35S}Met-tRNAm and {35S}Met-tRNAf, to the separated strands of T5+ DNA indicates that most, if not all, of the T5 tRNAs are transcribed from the continuous heavy strand of T5 DNA . Heteroduplex mapping of eight mutant T5 DNA deletions has enabled us to locate and determine the size of these deleted segments . By correlating this information with the presence and absence of specific tDNA sequences in these mutants, as determined by tRNA-DNA hybridization, we were able to define the physical limits of four tDNA-containing loci along the T5 DNA molecule . A physical map for 15 tRNA species examined indicates that the structural genes for these tRNAs are clustered within a segment length of T5 DNA that represents approximately 11.2% of the total wild type T5 DNA . The existence of the deletion mutants indicates that T5 tRNAs are dispensable for T5 replication under the growth conditions and for the host employed. Biochim Biophys Acta, 1976 Jan 19, 418(2), 175 - 83 The binding site for coat protein on bacteriophage Qbeta RNA; Weber H; The site of interaction of phage Qbeta coat protein with Qbeta RNA was determined by ribonuclease T1 degradation of complexes of coat protein and {32P}-RNA obtained by codialysis of the components from urea into buffer solutions . The degraded complexes were recovered by filtration through nitrocellulose filters, and bound {32P}RNA fragments were extracted and separated by polyacrylamide gel electrophoresis . Fingerprinting and further sequence analysis established that the three main fragments obtained (chain lengths 88, 71 and 27 nucleotides) all consist of sequences extending from the intercistronic region to the beginning of the replicase cistron . These results suggest that in the replication of Qbeta, as in the case of R17, coat protein acts as a translational repressor by binding to the ribosomal initiation site of the replicase cistron. Mol Gen Genet, 1976 Jan 16, 143(2), 185 - 96 Isolation and characterization of lambdadargECBH transducing phages and heteroduplex analysis of the argECBH cluster; Mazaitis AJ et al.; Transducing lambda bacteriophages have been isolated which carry the divergently transcribed argECBH operon of E . coli K12 and various portions of the adjacent ppc and bfe chromosomal regions . They were recovered from lysates prepared by the procedure of Schrenk and Weisberg using a Ppc+ Arg+ Bfe+ strain carrying a deletion of the usual attachment site of lambda . Heteroduplex DNA mapping of these lumbdadarg and of the phi 80 darg isolated by B . Konrad indicates that the two kinds of phages carry the arg cluster in opposite orientations, a situation favorable for the isolation of argECBH DNA . A physical map of the ppc argECBH bfe region including 2 unusual attachment sites of lambda has been constructed . The localization of the end points of certain arg deletions provides a useful reference framework for the currently pursued mapping of mutations affecting the control of divergent transcription and for the location of restriction enzyme cleavage sites in the arg region. Biokhimiia, 1976 Jan, 41(1), 192 - 6 {Structure and protein composition of the bacteriophage T2L connector}; Volkova TP et al.; Methods of isolating structural bacteriophage T2 fragments containing: 1 . a fragment consisting of a connector, tail tube and contracted sheath; 2 . a fragment consisting of a free head, a connector and contracted sheath; 3 . a fraction of some free tail tube and some free connectors; 4 . a fraction of some free tail, free connectors and free fibers . The following parameters of connector consisting from a neck and a sleeve, which in its turn consists of a cap and a leg, are determined by means of electrone microscopy: 1) the length and the diameter of a cap and a sleeve being 45 and 145 A respectively; 2) the length and the diameter of a sleeve leg being 45 and 85 A respectively; 3) the length and the diameter of a connector neck being 85 and 70 A respectively . Polyacrylamide gel electrophoresis revealed in connectors proteins having molecular weight of 14 000, 15 000, 26 000 and 35 000 daltons. Arch Immunol Ther Exp (Warsz), 1976, 24(1), 29 - 37 Morphologic homogeneity of bacteriophages and their biological activity; Krzywy T et al.; Lytic activity of morphologically homogeneous phage lysates, obtained from lysates containing morphologically inhomogeneous virions, was studied . Five series of phage lysates found to contain morphologically inhomogeneous virions were investigated . By selecting suitable hosts from each series, two or three lines were obtained which reproduced morphologically homogeneous virions . Morphologic homogeneity of these phage lines was determined by electron microscopy . In the course of this study it was found that phages with different morphologic appearance can produce similar plaques . Hence, appearance of plaques is not an adequate criterion of homogeneity of the phage . The isolated phages differed in biological activity from the original morphologically inhomogeneous bacteriophage . It was concluded that morphology is an important, and the most reliable at present, criterion of homogeneity of bacteriophages. Nucleic Acids Res, 1976 Jan, 3(1), 261 - 76 Induced formation of covalent bonds between nucleoprotein components . V . UV or bisulfite induced polynucleotide-protein crosslinkage in bacteriophage MS2; Budowsky EI et al.; UV (lambda = 254 nm) irradiation of bacteriophage MS2 or its treatment with bisulfite induce covalent crosslinkage of the RNA to the coat protein . epilsonN-(2-oxopyrimidyl-4)-lysine was found in the phage hydrolysates after either type of treatment . An equimolar mixture of 0-methylhydroxylamine and bisulfite causes complete disappearance of the cross-links . This led to the conclusion that one of the factors responsible for the UV-induced polynucleotide-protein crosslinkage and the main factor in treatment with bisulfite is substitution of the exocyclic amino group of the activated cytosine nucleus by the lysine residue epilson-amino group of the protein. Proc Natl Acad Sci U S A, 1976 Jan, 73(1), 49 - 53 A DNA fragment from the origin of single-strand to double-strand DNA replication of bacteriophage fd; Schaller H et al.; A specific complex is formed between fd DNA, Escherichia coli DNA unwinding protein, and RNA polymerase (EC 2.7.7.6; nucleosidetriphosphate:RNA nucleotidyltransferase) during the first steps in the conversion of the single-stranded viral DNA to the double-stranded replicative form . In this complex a unique DNA fragment of about 120 nucleotides is protected against nuclease digestion . Both the requirements for its isolation and its position on the map of the phage genome indicate that the fragment contains the origin of single-strand to double-strand DNA replication . The isolated DNA fragment possesses double-strand-like characteristics, which protect it from being covered by the DNA unwinding protein and thus indirectly positions the RNA polymerase to the origin of replication. J Supramol Struct, 1976, 5(2), 139 - 53 Immunospecific labeling of mouse lymphocytes in the scanning electron microscope; Carter DP et al.; Bone marrow-derived (B) and thymus-derived (T) Balb/c mouse lymphocytes were identified in the scanning electron microscope (SEM) by the immunospecific attachment of one of several kinds of large-molecular-weight markers distinguishable in SEM . These markers (tobacco mosaic virus, keyhole limpet hemocyanin, bushy stunt virus, and bacteriophage T4) could be modified with hapten groups and linked with anti-hapten antibody, in an indirect (sandwich) scheme, to hapten-modified anti-cell-surface antibody bound to the cell surface . Hapten-modified antibodies to B cell antigens (goat anti-mouse-immunoglobulin) or to T cell antigens (rabbit anti-mouse brain) were employed to identify these two lymphoid cell types in unfractionated spleen, mesenteric lymph node, bone marrow, and thymus cell populations . The topography of B cells was always indistinguishable from that of T cells . No surface features were found to be unique to either cell type . In suspension, the majority of B and T cells had one or no microvilli regardless of the tissue source of the labeled cells . Cells in suspension that had microvilli (usually 10% of the total cell population) were always unlabeled . However, after cell contact with a glass surface, approximately half of both the B and T cell population had a villous topography. Scand J Immunol, 1976, 5(3), 213 - 9 The role of B-cell memory in secondary IgG and IgM responses; Seppala I et al.; Mice were primed with the hapten 3-nitro-4-hydroxy-5 iodophenacetic acid (NIP) conjugated to chicken globulin (cg) and were boosted 2, 6, or 12 months later with CG conjugates of the related haptens 3,5-diiodo-4-hydroxyphenacetic acid (DIP) or 3-nitro-4-hydroxphenacetic acid (NP) . Accelerated secondary responses were demonstrated both in the 7S and 19S class . Fine-specificities of secondary-response antibodies were studied by the hapten inhibition method of haptenated bacteriophage inactivation . 7S antibodies were found to have the fine-specificity of anti-NIP antibodies regardless of whether DIP or NP was the booster hapten ('original antigenic sin') . 19S antibodies had the fine-specificity of anti-DIP when DIP was the booster hapten . NP as the booster hapten resulted in 19S antibodies whose fine-specificity was intermediate between anti-NIP and anti-NP . A strong B-cell memory could thus be demonstrated in the 7S antibody response and a weak B-cell memory in the 19S antibody response. Int J Radiat Biol Relat Stud Phys Chem Med, 1976 Jan, 29(1), 51 - 63 Binding of radiation-induced phenylalanine radicals to DNA: influence on the biological activity of the DNA and on its sensitivity to the induction of breaks by gamma-rays; Van der Schans GP et al.; When an aqueous solution of double-stranded DNA of bacteriophage PM2 containing phenylalanine and saturated with N2O is irradiated with gamma-rays, radiation-induced phenylalanine radicals are bound covalently . Under the conditions used, about 25 phenylalanine molecules may be bound per lethal hit . For single-stranded PM2 DNA, most of the phenylalanine radicals bound are non-lethal . Evidence is presented that, in double-stranded DNA, an appreciable fraction of the single-strand breaks is induced by phenylalanine radicals . Radiation products of phenylalanine and the phenylalanine bound to the DNA decrease the sensitivity of the DNA to the induction of single-strand breaks . There are indications that the high efficiency of protection by radiation products of phenylalanine is due to their positive charge, which will result in a relatively high concentrations fo these compounds in the vicinity of the negatively-charged DNA molecules. J Immunol Methods, 1976, 10(1), 39 - 48 Immunology of DNA . II . The effect of size and structure of the antigen on the Farr assay; Arden LA et al.; The Farr assay for the detecton of antibodies to double stranded (ds) DNA is influenced by the DNA preparations used as antigen . To elucidate this the molecular weight of the antigen preparation, contamination with proteins and presence or absence of single stranded (ss) regions were studied with the following conclusions: 1) The degree of DNA binding by antibodies is linearly dependent on the molecular weight of the DNA, provided that this does not exceed 10 X 10(6) . 2) Deproteinization of E . coli DNA by chromatography on methylated albumin-kieselguhr(MAK) columns results in lower binding by most sera . 3) ds DNA preparations sometimes contain ss regions which bind antibodies to ss DNA . The difference in behaviour of different ds DNA preparations may be ascribed entirely to these factors and not to differences in antigenic determinants . We have standardized the Farr assay and enhanced its specificity by the use of circular DNA isolated from bacteriophage PM2. Int Arch Allergy Appl Immunol, 1976, 50(1), 111 - 22 Bacteriophage MS-2 in the immune response; Snippe H et al.; Several aspects of the immune response to bacteriophage MS-2 were studied . In thymectomized, irradiated and bone marrow-reconstituted (TXBM) mice, the response was normal when a high dose of antigen was used . With a 50-fold lower dose of MS-2, the response was impaired, indicating a T-cell involvement in antibody formation . More evidence for the (partial) T-cell dependence of MS-2 was obtained from experiments with anti-thymocyte serum or cyclophosphamide-treated mice . (3H)-thymidine incorporation experiments demonstrated that both B and T cells were active upon in vitro stimulation with MS-2 . The dose of MS-2 which was able to induce a normal response in TXBM mice, proved to be optimal for both sensitization and elicitation of a DH . It is concluded that MS-2 is a thymus-dependent antigen which is only thymus independent in high doses. Gene, 1976, 1(1), 3 - 25 In vitro site-directed mutagenesis: generation and properties of an infectious extracistronic mutant of bacteriophage Qbeta; Domingo E et al.; An infectious extracistronic mutant of phage Qbeta has been prepared by site-directed mutagenesis . Qbeta RNA minus strands containing the mutagenic base analog N4-hydroxy-CMP instead of UMP at position 39 from the 5' end were synthesized in vitro and used as template for Qbeta replicase to synthesize one generation of plus strands . E . coli spheroplasts were infected with the newly synthesized plus strands and phage recovered from single plaques . RNA sequence analysis revealed that four out of the eighteen phage clones analyzed contained RNA with an A leads to G transition at position 40 from the 3' end (which corresponds to position 39 of the minus strand) . Thus, the viability of phage Qbeta does not depend on a unique nucleotide sequence in the 3'-extracistronic RNA segment . Upon in vivo propagation of mutant 40, spontaneous true revertants arose with high frequency and overgrew the parental clone within about 10 passages, indicating a selective disadvantage of the extracistronic mutant . Replication of mixtures of wild type and mutant RNA in vitro resulted in a decrease of the proportion of mutated RNA in the progeny plus strands . The fact that Qbeta RNA containing an A leads to G transition in nucleotide--40 of Qbeta RNA is less efficiently replicated in vitro may explain the selective disadvantage of the mutant phage in vivo . The preparation of an infectious mutated RNA by site-directed mutagenesis shows that the method is suitable to produce specific nucleotide exchanges without impairing the biological competence of the RNA. Genetika, 1976, 12(8), 86 - 90 {Genetic study of bacteriophage phi81 . I . Isolation, study of complementation and preliminary mapping of amber-mutants of bacteriophage phi81}; Sineokii SP et al.; 123 Amber mutants of lambdoid bacteriophage phi81 are isolated and distributed into 19 complementation groups . Deletion mapping made possible to locate 5 gene groups on the genetic map of bacteriophage phi81 and to determine a region of possible location of mm' sticky ends on the prophage genetic map . A gene of phage phi81 is localized, which controls the adsorption specificity, and which functional similarity to a respective gene of phage phi80 is demonstrated. Genetika, 1976, 12(7), 109 - 18 {Lethal and mutagenic photodynamic effect of acridine orange on bacteriophage cd}; Kriviskii AS et al.; Both acridine-sensitized inactivation and mutagenesis in phage sd have been studied and compared with the effect of other mutagens . Inactivation curve was not stictly exponential, with a small shoulder at short light doses and deviation of survival lower than 10(-5) . The lethal effect was not reactivated by multiplicity reactivation . Photodynamic damage in phage sd was accompanied by the increase of the rise (but not of the latent) period in the one-step curve of phage multiplication and increase of the burst size . Experiments were carried out at dye concentration of 1-10(-5) M or lower; a strong dark effect of the dye being observed under 2-fold increase of the dye concentration . Plaque-type mutants were formed up to the maximum approximately 1% at the survival approximately 2--10(-5); in comparison with other mutagens photo-sensitized mutagenesis in phage sd was lower . The significant increase in the number of plaque mutants was observed after the illumination of phage fraction surviving the pre-treatment with higher acridine orange concentration (greater than or equal to 2-10(-5)M). Acta Microbiol Pol A, 1976, 8(1), 3 - 16 Effect of ts mutation in gene 43 of bacteriophage T4 on recombination of the bacteriophage; Klimuszko D et al.; Certain ts mutations in gene 43 of bacteriophage T4 are known to exhibit mutator or antimutator activities with respect to different rII mutations of this phage . The effect of these mutations on recombination frequencies of double mutant strains of phage T4 with genotype rII ts--homoallelic with respect to the ts trait--was examined . The results implicate the essential role of the genetic background in the investigated process. J Nutr Sci Vitaminol (Tokyo), 1976, 22(5), 347 - 54 Mechanism of inactivation of bacteriophage MS2 containing single-stranded RNA by ascorbic acid; Murata A et al.; The mechanism of inactivation of a single-stranded RNA phage, MS2, by AsA was investigated as a part of the studies on the mechanism of inactivation of viruses by AsA . Investigations on the effects of oxygen, oxidizing or reducing agents, metals or chelating agents, and free radical scavengers on the inactivation of the RNA phage by AsA indicated that the free radical intermediates formed during the course of oxidation of AsA are responsible for the inactivation of the phage . Hydrogen peroxide and DAsA themselves had no effect on the infectivity of the phage . Sucrose density gradient centrifugation analyses indicated that the reactive radicals react with the phage RNA to cause strand scissions in the RNA. J Gen Virol, 1976 Jan, 30(1), 99 - 112 Bacteriophage MX-1: properties of the phage and its structural proteins; Tsopanakis C et al.; Bacteriophage MX-1 is a virulent DNA phage for Myxococcus . The host range includes strains of Myxococcus xanthus, M . fulvus and M . virescens . The phage has a sedimentation coefficient (S degrees 20,w) of 1145S and a density of 1-531 g/ml . By using SDS-polyacrylamide gel electrophoresis, 23 phage proteins with apparent mol . wt . between 10000 and 150000 were resolved . Gel filtration in the presence of non-ionic detergent partially resolved the proteins . The fraction excluded from Sephadex G-100, fraction 1, contains two glycoproteins . Fraction 1 was resolved into three fractions (1-1, 1-2 and 1-3) by chromatography on Sephadex G-200 . The glycoproteins were present in fraction 1-2; all the proteins from this fraction were derived from the phage tail . Comparison of the amino-acid, hexosamine and neutral-sugar compositions of the two glycoproteins showed that they are distinct molecular species; the smaller molecule is not a subunit of the larger . The significance of these findings is discussed and compared with the proteins of the tails of T-even phage of Escherichia coli. J Gen Virol, 1976 Jan, 30(1), 141 - 3 A lack of inhibitory action of bacteriophage T4 ghosts in the presence of EDTA; Okamoto K et al.; Adsorption of bacteriophage T4 ghosts on to Escherichia coli cells has been known to cause a dramatic change in the cellular metabolism, the effect being similar to that of colicin K . It is shown here that the inhibitory activity of ghosts is not expressed either at 0 degrees C in the ordinary media (like colicin K) or even at 30 degrees C in a medium containing EDTA, in contrast to colicin K . Since the process of sheath contraction of T4 phage is blocked by EDTA, it is suggested that the adsorbed ghosts may not exert their inhibitory activity until sheath extraction occurs. Gene, 1976, 1(1), 93 - 106 In vitro construction of bacteriophage lambda and plasmid DNA molecules containing DNA fragments from bacteriophage T4; Velten J et al.; Restriction endonucleases EcoRI and HindIII generated fragments of T4 cytosine-containing DNA were inserted into bacteriophage vector lambdagtSuIII and plasmid vectors pMB9 and pBR313 . Resulting clones were screened for hybridization with 32P labeled T4 tRNA . Recombinant bacteriophages and plasmids were isolated which contained a T4 fragment coding for T4 RNA species 1 and 2 and T4 tRNA Arg . Selected lambda-T4 hybrid bacteriophages were grown to high titer and their DNA analyzed by gel electrophoresis. Gene, 1976, 1(1), 49 - 63 Propagation in E . coli of bacteriophage lambda with integrated fragments of adenovirus 2 DNA; Tiollais P et al.; Hybrid genomes of bacteriophage lambda with integrated fragments of adenovirus type 2 (Ad2) DNA have been constructed in vitro and propagated in E . coli . DNA from a derivative of bacteriophage lambdaplac5 (Rambach and Tiollais, 1974) was used as a vector . The two fragments of the vector DNA contain all the essential genes for the replication of the lambda DNA but are too short to be encapsidated . Insertion of DNA is therefore essential for plaque formation which constitutes a selection method for phages containing hybrid genomes . Fragments EcoRI-B and EcoRI-F of Ad2 DNA were purified, and separately ligated with the vector fragments . Clones of hybrid phage could readily be isolated . Two clones of hybrid phage containing fragment EcoRI-B inserted in opposite directions were used to study the transcription of adenovirus-specific sequences . Hybridization experiments showed that transcripts from both strands of fragment Ad2-Eco RI-B could be detected and that transcription probably was controlled by the "early" leftward and the "late" rightward promoters on the lambda genome . No polypeptides specified by the adenovirus fragment have so far been identified. Intervirology, 1976, 7(6), 351 - 5 A correlation between the genome compositions of bacteriophages and their hosts; Gibbs A et al.; The base composition of the genomes of bacteriophages and other viruses is, in a very general way, related to the base composition of the genomes of their hosts by the statistically significant linear regression: (phage GC%)=9.12 + 0.74 (host GC%) . The significance and possible use of this relationship is discussed. Biochimie, 1976, 58(11-12), 1321 - 7 Lysogenization by bacteriophage lambda IV inhibition of phage DNA synthesis by the products of genes cII and cIII; Kourilsky P et al.; In direct measurements of phage lambda DNA synthesis, we have detected an inhibition caused by the cII and cIII gene products . This inhibition was more clearly observed when P amber phages were grown in a permissive host, presumably because of the limitation in DNA synthesis due to uncomplete suppression . The inhibition takes place in cells infected at high multiplicity, but not in cells infected at low multiplicity . To explain these findings, we propose a model in which the bacterial population is heterogeneous with respect to its ability to support phage DNA synthesis . An initial limitation caused by host factors would be amplified by the action of the cII and cIII products, at high multiplicity only, and the resulting inhibition would be essential in the "choice" towards lysogeny. Genetika, 1976, 12(9), 79 - 85 {Allele specificity of the mutator action of bacteriophage T4 genes 43 and 32}; Kobets NS et al.; The substitution of tester mutant ri31 (fs-type) for transition mutants rUV30 and rUV48 allowed to reveal new mutator alleles of DNA polymerase gene of phage T4 . In these conditions about 70% alleles of this gene were found to be mutators . Unlike experiments carried out with mutant-tester ri31, in experiments with mutants rUV30 and rUV48 the presence of mutator alleles in gene 32 was demonstrated . The transition pathway AT leads to GC is the preferential direction of the mutation alteration under the action of suppressed amber alleles of genes 43 and 32 . The data obtained suggest allele specificity of the mutator effect in bacteriophage T4. Genetika, 1976, 12(9), 71 - 8 {Mutator effect of suppressed amber-alleles of early genes of bacteriophage T4}; Alikhanian SI et al.; The mutator effect of amber alleles of three early genes (43, 32, 47), which were suppressed by the bacterial suppressor gene, was studied . There are some advantages in using the suppressed amber alleles instead of ts, because in this case definite amino acid substitutions take place in the protein due to certain suppressor gene effect . For example, in Escherichia coli CR63(Su+-1) the replacement of the original amino acid by serine takes place . Studying the mutator effect of 43 alleles of DNA polymerase gene of phage T4 with tester mutant r131 showed that in condition of suppression by the gene Su+ -1 only 13,9% of alleles possessed the mutator activity . In the same experiments with mutants of genes 32 and 47 the mutator effect was not observed. Z Allg Mikrobiol, 1976, 16(4), 283 - 7 Mutagenesis in bacteriophage T7 . II . UV induced mutagenesis; Meyer M et al.; UV induced mutagenesis of bacteriophage T7 was investigated by using a forward mutation system (host range system) and a back mutation system (amber system) . The results indicate a dependence of mutation of T7 after UV irradiation only on the rec gene controlled functions of the bacterial host . The functions controlled by pol and uvr genes have no influence . Among other types of mutations UV irradiation leads to transitions from AT to GC. Z Allg Mikrobiol, 1976, 16(4), 279 - 82 Mutagenesis in bacteriophage T7 . I . Chemically induced mutagenesis; Meyer M; The mutagenesis in phage T7 after MMS-, HNO2-, hydroxylamine-, 5-BUdR-, and 2-AP-treatment in relation to host controlled functions is investigated . There was no dependence of the induction of mutations on the character of the host strains (rec, hcr) . A back mutation system (amber system) and a forward mutation system (host range system) have been used . Substances which cause mainly transitions from GC to AT do not lead or only rarely lead to reversions of the amber system; but chemicals producing transitions from AT to GC do so. Mol Biol (Mosk), 1976 Jan-Feb, 10(1), 64 - 9 {Influence of proteins bound to single-stranded DNA on RNA and poly(A) synthesis . II . Protein--product of T4 phage gene 32}; Polonskii IS et al.; It has been shown that the protein product of T4 bacteriophage gene 32 (protein 32) completely prevents RNA and poly(A) synthesis on the denatured DNA as a template at the protein/DNA ratio about 13:1 . Under the same conditions protein 32 has no effect on these syntheses on the native DNA and inhibit poly(A) synthesis with oligo(dT)9 and oligo(dT)12 as a template, preventing binding of enzyme with oligonucleotide . It is possible that the unwinded regions of double-stranded DNA within transcription complexes are too small to allow cooperative binding of protein 32 or are unavailable for this protein . We suppose that the protein 32 and other "unwinding" protein plays not only "protective" and "structural" roles but also participates in the regulation of template activity of single-stranded DNA regions in the replicative forks. Genetika, 1976, 12(4), 109 - 20 {Isolation and study of bacteriophage T4B mutants according to genes functioning at an early stage of the infectious process}; Krylov VN et al.; In previous study irreversible inactivation of rII(ts)-infected lambda-lysogenic bacteria at 42 degrees C was revealed . The inactivationprocess depended on active protein synthesis... Biochimie, 1976, 58(4), 417 - 25 Attempts to purify a membrane attached chromoid of bacteriophage lambda; Firshein W et al.; Using methods which proved successful for the isolation of E . coli chromosome in a folded form (the E . coli chromoid), we have attempted to purity the "native" form of bacteriophage gamma chromosome from gamma infected cells . Upon sedimentation of lysates we find that phage DNA separates into two fractions, one of which cosediments with the bacterial chromoid ; the other sediments nearer to the top of gradient . Both fractions probably contain membrane-bound phage DNA, and both support the in vivo synthesis of phage DNA . The heavier fraction contains more closed circular parental DNA molecules than the lighter fraction . Formation of the latter is blocked by certain phage mutations . Being relatively free of bacterial DNA, the lighter fraction is suitable for further analysis. Biokhimiia, 1976 Jan, 41(1), 3 - 13 {Functions of bacteriophage T4 rII genes . Preparatory isolation and several properties of rIIB protein}; Shevchenko NA et al.; A method of preparative isolation of membrane rIIB protein from bacteriophage T4 is worked out . Conditions are found to maximal rIIB protein accumulation in membranes of E . coli cells infected with bacteriophage T4 . The membrane isolation by ultracentrifugation is substituted with their sedimentation from polyethyleneglycol solutions by low-speed centrifugation . A fraction, enriched with rIIB protein, is obtained using the treatment of cell walls with detergents . Preparative polyacrylamide gel electrophoresis in the presence of sodium dodecylsulphate was used for further rIIB protein purification . The method described can be applied for the purification and preparative isolation of memorane and poor-soluble proteins . The problem on location and ufunctioning of rIIB protein is discussed. Ann Microbiol (Paris), 1976 Jan, 127A(1), 143 - 52 Functional possibilities for aminoacylation of viral RNA in transcription and translation; Hall TC et al.; RNA from at least ten viruses, representing more than four different group, is known to specifically bind in amino acid in a tRNA-like manner . The biological function of aminoacylation of RNA from these viruses and of tRNA association with tumor viruses and bacteriophage, is discussed . Hypothetical schemes are presented for a role for aminoacylation in viral translational and transcriptional mechanisms, and the current evidence relating to these models is presented. J Immunol Methods, 1976, 11(2), 165 - 70 An improved quantitative plaque assay for lymphocytes bearing antigen-specific cell receptors; Kleinman R et al.; An improved method for the determination of the number of lymphoid cells bearing antigen-specific receptors is described . The method is based on the use of hapten-coupled bacteriophage (dinitrophenyl-T4) and detection of lytic plaques formed by the action of DNP-T4 on a target E . coli strain . The method is highly specific (up to 90% specific binding) and can be adapted for use with other antigenic determinants chemically attached to an active bacteriophage. Mol Gen Genet, 1975 Dec 30, 143(1), 101 - 4 Genetic map of the beginning of the rIIB cistron of bacteriophage T4; Katz ER et al.; In this report the herefore uncharacterized mutants at the beginning of the rIIB cistron of bacteriophage T4 have been connected to the main part of the map and have been shown not to be in any way unusual . The temperature sensitive mutant HD263 appears to be the earliest mutant in the cistron. J Biol Chem, 1975 Dec 25, 250(24), 9262 - 9 Gene V protein of fd bacteriophage . Dimer formation and the role of tyrosyl groups in DNA binding; Pretorius HT et al.; Gene V protein exists principally as a dimer in neutral buffers which are 0.15 M in NaCl, NaF, or NaClO4 . Higher concentrations of NaClO4 or NaCl disrupt the dimers, but higher concentrations of NaF do not . There is a single sulfhydryl group per gene V protein monomer in native monomers, dimers, and DNA-protein complexes . Disulfide formation leads to loss of protein solubility and DNA binding capacity . The fluorescence of tyrosyl groups is the same for monomers and dimers in NaCl and NaClO4 solutions, but it is extensively quenched on binding to poly(dT) and fd-DNA . Complexes of gene V protein and fd-DNA isolated from lysates of infected cells were found to contain 4.70- +/- 0.13 nucleotides per monomer of gene V protein whereas complexes formed in vitro contain 4.05 +/- 0.17 nucleotides/monomer . It is postulated that tyrosyl groups are not involved in the protein-protein interactions of the monomer-dimer equilibrium, that tyrosyl groups stack with DNA bases in the complexes, and that each subunit of gene V protein in the intracellular complexes with fd-DNA is replaced by exactly two subunits of major coat protein during final assembly of the virus. Mol Gen Genet, 1975 Dec 23, 142(1), 57 - 66 Gene expression of bacteriophage SPP1 . II . Regulatory aspects; Esche H; The expression of late SPP1 genes depends on preceding SPP1 DNA replication . This is shown in nonpermissive infection with a mutant defective in DNA replication and after inhibition of DNA synthesis by HPUra . The potential for host gene expression is not significantly influenced by SPP1 infection, as evidenced by the continuation of host protein synthesis and the inducibility of glycerolphosphate dehydrogenase after infection . The involvement of a positive control element in the regulation of SPP1 gene expression is deduced from the observation that chloramphenicol prevents the synthesis of the only class of mRNA which is transcribed from the L-strand. Biochemistry, 1975 Dec 16, 14(25), 5485 - 91 Physiochemical properties of DNA binding proteins: gene 32 protein of T4 and Escherichia coli unwinding protein; Anderson RA et al.; The single-stranded DNA binding protein coded for by gene 32 of bacteriophage T4 and a similar protein isolated from uninfected Escherichia coli both induce characteristic changes in the circular dichroism (CD) of single-stranded nucleic acids . These CD changes have been adapted as an assay of protein-DNA complex formation . Far-ultraviolet CD spectra show the secondary structure of the two proteins to be similar with approximately 20% alpha helix, approximately 20% beta structure, and 60% random coil . Both proteins show prominent Cotton effects arising from their aromatic chromophores . Nitration of five of the nine tyrosyl residues of gene 32 protein prevents DNA binding, while prior formation of the DNA complex protects all tyrosyl residues from nitration . The tyrosyl residues may participate in gene 32 protein-DNA binding by intercalation between bases of the single strand . In contrast, no tyrosyl residues can be nitrated in the E . coli protein suggesting that surface tyrosyls do not play a part in binding of E . coli protein to DNA . Approximately 50 amino acids can be cleaved from the gene 32 protein with trypsin . This cleavage also occurs spontaneously in infected cell extracts . The remaining protein of mol wt 30000 has the same CD spectra and DNA binding properties as the native protein . The physicochemical properties can be correlated with previous work on the structures and functions of the group of DNA "unwinding proteins". J Virol, 1975 Dec, 16(6), 1375 - 9 Alkali lability of bacteriophage phi W-14 DNA; Lewis HA et al.; The molecular weight of bacteriophage phi W-14 DNA, determined by velocity sedimentation in neutral sucrose gradients, was 92 +/- 6 X 10(6) . The DNA showed marked fragmentation in alkaline sucrose gradients . This fragmentation was not a consequence of preexisting single-strand interruptions in the DNA, since thermal denaturation of DNA yielded intact single strands . The alpha-putrescinylthymine groups in phi W-14 DNA appeared to be labile; some, or parts of some, of these groups were cleaved from the DNA in alkali. J Biol Chem, 1975 Dec 10, 250(23), 8973 - 7 Template properties of bacteriophage T4 vegetative DNA . II . Effect of maturation and DNA-arrest mutations; Cox GS et al.; The DNA in gently lysates of T4-infected Escherichia coli cells sediments in sucrose gradients as two major components; the slower sedimenting component is designated as the S-5 fraction and the faster sedimenting component as the pad fraction . The distribution of these fractions in lysates of cells infected with T4 maturation-defective and DNA-arrest mutants was determined, and their template activities were compared in a DNA-dependent amino acid-incorporating system . The S-5 DNA template was found to be completely absent in E . coli B cells infected with a T4 maturation-defective mutant (gene 55) . On the other hand, DNA sedimenting as the S-5 component is greatly increased, while that sedimenting as the pad component is virtually absent in nonpermissive cells infected with a DNA-arrest mutant (gene 46) . The S-5 fractions prepared from cells infected with a DNA ligase mutant (gene 30) and a gene 30 gene 46 double mutant are reduced in their ability to stimulate amino acid incorporation compared to similar preparations from cells infected with wild type T4 or a gene 46 mutant . Moreover, the template activity of partially purified replicative DNA prepared from cells infected with phage-carrying mutations either on gene 30 or in both genes 46 and 56 (dCTPase) is lower than that of DNA obtained from cells infected with wild type phage . The polypeptide products of reaction mixtures programmed with several of the mutant DNAs were found to be qualitatively different from polypeptides synthesized in response to either mature DNA or replicative DNA prepared from cells infected with wild type phage . These data suggest that the expression of phage DNA may be significantly influenced by physical changes in the DNA arising from abnormal replication. J Biol Chem, 1975 Dec 10, 250(23), 8963 - 72 Template properties of bacteriophage T4 vegetative DNA . I . Isolation and characterization of two template fractions from gently lysed T4-infected bacteria; Cox GS et al.; The synthesis and template properties of T4 vegetative DNA were studied . The DNA-containing material in lysates of cells taken 20 min past T4 infection sediments in sucrose gradients as two major components . Both fractions function as templates for amino acid incorporation in a DNA-dependent in vitro system (coupled transcription-translation) . The slower sedimenting activity is not present in uninfected cells and appears in wild type T4-infected cells only after 12 min at 30 degrees, shortly after DNA synthesis starts . It is dependent for its activity on an added S-30 fraction from either uninfected or T4-infected cells and is completely inhibited by deoxyribonuclease or rifampin . On a weight basis the slower sedimenting template is about 30 to 70% as active as mature T4 DNA when supplemented with S-30 extracts from uninfected cells . The spectrum of proteins synthesized in response to the slower sedimenting template is different from that produced in response to mature T4 DNA . In contrast to mature DNA, this template is capable of directing the synthesis of material that precipitates with antiserum directed against whole T4 particles . Thus, it appears capable of directing the synthesis of mRNA for phage structural proteins, i.e . late proteins . The faster sedimenting component is about 8-fold less active for stimulating amino acid incorporation than mature DNA . Significant amounts of RNA polymerase are associated with this DNA in active transcription complexes, yet polyacrylamide gel electrophoresis of the proteins synthesized in response to this fraction show a pattern that resembles the early proteins made from mature T4 DNA in extracts from uninfected cells. Mol Gen Genet, 1975 Dec 9, 141(4), 357 - 66 Isolation and properties of a conditionally lethal bacteriophage lambda mutated in the chi region; Nishimoto T et al.; A thermosensitive lambda phage mutant was isolated which can grow at high temperature only in the presence of the lambda chi gene product supplied in trans . This mutation tn was mapped within the chi region, and lambda tn phage expressed the pRoR-OP operon only poorly at high temperature . Effects of the tn mutation on expression of other operons were also examined and compared with those observed with cro27 or some tof mutations. Mol Gen Genet, 1975 Dec 9, 141(4), 277 - 84 Specificity of the stimulation of in vitro ribonucleic acid synthesis by guanosine 5'-diphosphate 3'-diphosphate; Smolin DE et al.; The in vitro synthesis of ribonucleic acid (RNA) by S-30 extracts of Escherichia coli K-12 is stimulated from two-to fourfold by 0.16 mM to 0.32 mM guanosine 5'-diphosphate 3'-diphosphate (ppGpp) when either gammacI857St68h80 deoxyribonucleic acid (gammah80 DNA), gammah80dilv DNA or gammah80dlac DNA are employed as templates . Hybridization analysis of the 3H-RNA product transcribed from gammah80dilv DNA in the presence of ppGpp indicates that both bacteriophage- and bacterial-specific transcription is stimulated to an equivalent degree . In the absence of cyclic 3'-5'-adenosine monophosphate (cyclic AMP), correct lac-specifci RNA synthesis from gammah80dlac DNA is not stimulated by 0.32 mM ppGpp although total RNA synthesis is increased nearly twofold . In the presence of 0.5 mM cyclic AMP, correct lacspecific RNA synthesis is stimulated preferentially by ppGpp . These data suggest that ppGpp is capable of stimulating in vitro transcription in both a general and selective manner. J Virol, 1975 Dec, 16(6), 1391 - 400 Bacteriophage T4 baseplate components . I . Binding and location of the folic acid; Kozloff LM et al.; Two different proteins with high affinities for the pteridine ring of folic acid have been used to determine the location of this portion of the folate molecule in the tail plate of T4D and other T-even bacteriophage particles . The two proteins used were (i) antibody specific for folic acid and (ii) the folate-binding protein from bovine milk . Both proteins were examined for their effect on various intact and incomplete phage particles . Intact T2H was weakly inactivated by the antiserum but not by the milk protein . No other intact T-even phage, including T4D, was affected by these two proteins . When incomplete T4D particles were exposed in an in vitro morphogenesis system, it was found that neither of the two proteins affected either the addition of the long tail fibers to fiberless particles or the addition of tail cores to tail plates . On the other hand, these two proteins specifically blocked the addition of T4D gene 11 product to the bottom of T4D baseplates . After the addition of the gene 11 protein, these two reagents did not inhibit the further addition of the gene 12 protein to the baseplate . It can be concluded that the phage folic acid is a tightly bound baseplate constituent and that the pteridine portion of the folic acid is largely covered by the gene 11 protein. J Virol, 1975 Dec, 16(6), 1669 - 77 Identification of P48 and P54 as components of bacteriophage T4 baseplates; Berget PB et al.; The involvement of two bacteriophage T4 gene products in the initiation of T4 tail tube and sheath polymerization on mature baseplates has been studied by radioautography of acrylamide gels of various partially completed tail structures . The products of genes 48 and 54 (P48{the nomenclature P48 refers to the protein product of bacteriophage T4 gene 48} and P54), which are known to be required for the synthesis of mature baseplates, have been shown to be structural components of the baseplate . These gene products have molecular weights of 42,000 and 33,000, respectively . The addition of P54 to the baseplate not only permits the polymerization of the core protein, P19, onto the baseplate, but also caused the disappearance of a polypeptide of molecular weight about 15,000 from the supernatant fraction of infected cells . Another gene product, P27, has been identified in the crude extracts of infected cells . This gene product, which is required for the synthesis of baseplate structures, has the same mobility as one of the unidentified structural polypeptides of the baseplate and is therefore probably also a baseplate component. J Virol, 1975 Dec, 16(6), 1409 - 19 Bacteriophage T4 baseplate components . III . Location and properties of the bacteriophage structural thymidylate synthetase; Kozloff LM et al.; Two T4D thymidylate synthetase (td) temperature-sensitive mutants have been isolated and characterized . Both mutants produce heat-labile phage particles . This observation supports the view that this viral-induced protein is a phage structural component . Further, antiserum to td has been shown to block a specific step in tail plate morphogenesis . The results indicated that the td protein is largely covered by the T4D tail plate gene 11 protein . Since the phageinduced dihydrofolate reductase (dfr) also is partially covered by the gene 11 protein, it appears that td was adjacent to the tail plate dfr . This location has been confirmed by constructing a T4D mutant which is dfrtstdts and showing that these two tail plate constituents interact and give altered physical properties to the phage particles produced . A structural relationship for the tail plate folate, dfr, and td has been reported. Proc Natl Acad Sci U S A, 1975 Dec, 72(12), 4754 - 8 Promoter-dependent transcription of tRNAITyr genes using DNA fragments produced by restriction enzymes; Kupper H et al.; Two DNA fragments prepared from the transducing bacteriophage strains o80psuIII+ and o80hpsuIII+,- by digestion with restriction enzymes contain one tyrosine tRNA gene (suIII+) and two tyrosine tRNA genes (suIII+, su-) in tandem, respectively, a single promoter in both cases, and some additional DNA regions at the two ends of both . Using these fragments, we have studied characteristics of the promoter-dependent transcription of the tyrosine tRNA genes . The promoter-dependent transcripts were shown to correspond to the expected tRNA precursors . Exposure of the transcript from the single gene fragment to an S100 extract from Escherichia coli gave, via intermediates, 4S material which was active in enzymatically accepting tyrosine and contained some modified bases. Proc Natl Acad Sci U S A, 1975 Dec, 72(12), 4734 - 8 How ribosomes select initiator regions in mRNA: base pair formation between the 3' terminus of 16S rRNA and the mRNA during initiation of protein synthesis in Escherichia coli; Steitz JA et al.; Initiation complexes formed by E . coli ribosomes in the presence of 32P-labeled A protein initiator region from R17 bacteriophage Rna have been treated with colicin E3 and disassembled by exposure to 1% sodium dodecyl sulfate . Electrophoresis on 9% polyacrylamide gels reveals a dissociable complex containing the 30-nucleotide-long messenger fragment and the 50-nucleotide-long colicin fragment, which arises from the 3' terminus of the 16S RNA . The complex is a pure RNA-RNA hybird; it is apparently maintained by a seven-base complementarity between the two RNA fragments . Detection of this mRNA-rRNA complex strongly supports the hypothesis that during the initiation step of protein biosynthesis the 3' end of 16S RNA base pairs with the polypurine stretch common to initiator regions in E . coli and bacteriophage mRNAs . The implications of our findings with respect to the molecular mechanism of initiation site selection and mRNA binding to ribosomes, the role of rRNA in ribosome function, and species specificity in translation are explored. Mol Gen Genet, 1975 Dec 1, 141(3), 213 - 232 Studies on bacteriophage T7 DNA synthesis in vitro . I . Resolution of the T7 replication system into its components; Scherzinger E et al.; A soluble extract prepared from T7-infected E . coli is able to initiate DNA synthesis on an exogenous T7 DNA template . We have developed a fractionation procedure to resolve and identify the proteins required for T7 DNA synthesis . By this method we have purified the following T7 replication-related proteins (each greater than 50% pure as judged by sodium dodecyl sulfate gel electrophoresis): T7 DNA-binding protein (27,000 daltons), T7 RNA polymerase (105,000 daltons), T7 DNA polymerase (gene 5-protein, 85,000 daltons, plus host-factor), T7 DNA ligase (40,000 daltons), and T7 DNA-priming protein (65,000 daltons) . The T7 DNA-priming protein, synthesized between 7.5 and 15 min following infection, was not detectable if the infecting phage carried an amber mutation in gene 4 . Using an in vitro complementation assay which specifically measures the stimulation of DNA synthesis in an extract prepared from T7 gene 4-mutant infected cells, we have purified the DNA-priming protein about 2,000-fold . The purified priming protein preparations are essentially free of endonuclease, exonuclease, DNA ligase and DNA polymerase activity, but they do contain measurable DNA-dependent RNA synthetic acitvity . The enzyme is rapidly inactivated by heating to 46 degrees C and by treatment with N-ethylmalemide . In the presence of T7 DNA-binding protein and all four ribonucleoside triphosphates, the DNA-priming protein enables T7 DNA polymerase to initiate DNA synthesis on intact duplex T7 DNA . Closer studies of its enzymatic function as well as of the possible roles of the other proteins in the T7 replication system will be presented in the accompanying paper. J Virol, 1975 Dec, 16(6), 1683 - 7 Chemical stability of bacteriophage T7 early mRNA; Yamada Y et al.; T7 early mRNA produced by a gene 1 amber mutant phage, T7 am27, is chemically stable interms of acid insolubility and T7 DNA hybridizability . However, the messenger activity of individual T7 early mRNA species, transcripts of gene 1, gene 0.7, and gene 1.3, decay with a half-life of about 6.5 min at 30 C . An extensive secondary structure is present in all T7 early mRNA species and is probably responsible for the chemical stability of the RNAs after the loss of functional activity . It is unlikely that ribosomes protect T7 early mRNA from nucleolytic degradation. J Virol, 1975 Dec, 16(6), 1547 - 59 Bacteriophage P22 virion protein which performs an essential early function . II . Characterization of the gene 16 function; Hoffman B et al.; P16 is a virion protein and, as such, is incorporated into the phage head as a step in morphogenesis . The role of P16 in assembly is not essential since particles are formed without this protein which appear normal by electron microscopy . P16 is essential when the particle infects a cell in the following cycle of infection . In the absence of functional P16, the infection does not appear to proceed beyond release of phage DNA from the capsid . No known genes are expressed, no DNA is transcribed, and the host cell survives the infection, continuing to grow and divide normally . The P16 function is required only during infection for the expression of phage functions . Induction in the absence of P16 proceeds with the expression of early and late genes and results in particle formation . P16 must be incorporated during morphogenesis into progeny particles after both infection and induction for the progeny to be infectious . The P16 function is necessary for transduction as well as for infection . Its activity is independent of new protein synthesis and it is not under immunity control . P16 can act in trans, but appears to act preferentially on the phage or phage DNA with which it is packaged . The data from complementation studies are compatible with P16 release from the capsid with the phage DNA . In the absence of P16 the infection is blocked, but the phage genome is not degraded . The various roles which have been ruled out for P16 are: (i) an early regulatory function, (ii) an enzymatic activity necessary for phage production, (iii) protection of phage DNA from host degradation enzymes, (iv) any generalized alteration of the host cell, (v) binding parental DNA to the replication complex, and (vi) any direct involvement in the replication of P22 DNA . P16 can be responsible for: (i) complete release of the DNA and disengagement from the capsid, (ii) bringing the released DNA to some necessary cell site or compartment such as the cytoplasm, (iii) removal of other virion proteins from the injected DNA, and (iv) alterations of the structure of the injected DNA. J Virol, 1975 Dec, 16(6), 1536 - 46 Bacteriophage P22 virion protein which performs an essential early function . I . Analysis of 16-ts mutants; Hoffman B et al.; The product of gene 16 of phage P22, P16, is a head protein . P16 does not play an essential role in phage assembly since particles formed without this protein appear normal by electron microscopy examination (Botstein et al., 1973) . P16 is essential when the particle infects a cell in the following cycle of infection (Botstein et al., 1973; King et al., 1973) . We have characterized a mutant of P22 carrying a temperature-sensitive allele of gene 16 . This mutant has previously been referred to as P22 25-ts (Levine et al., 1970, 1972) and P22 X-ts (Bezdek and Soska, 1970, 1973) . P22 16-ts behaves as an early mutant at the nonpermissive temperature . Temperature shift experiments show that P16 of the infecting virion acts within the first 10 min at 25 C and that gene 16 product is required late in the latent period for incorporation into infectious phage . Induction does not require P16 for the production of particles . Particles produced either in a P22 16-ts thermal shift-up infection or after induction of 16-ts lysogens at 41 C are missing P16 and are, therefore, defective . P16 in P22 16-ts virions formed at the permissive temperature appears to be heat labile; it is inactivated after infection at 41 C . A simple assay for defective particles based on a complementation test is described. J Virol, 1975 Dec, 16(6), 1483 - 91 F-Factor-mediated restriction of bacteriophage T7: protein synthesis in cell-free systems from T7-infected Escherichia coli F- and F+ cells; Yamada Y et al.; A characteristic phenomenon in the F-factor-mediated inhibition of T7 phage is a virtual absence of T7 late protein synthesis in T7-infected Escherichia coli male cells, in spite of the presence of T7 late mRNA which is translatable in vitro when isolated from the cell . To determine whether the translational defect in T7-infected F+ cells is due to a T7 late mRNA-specific translational block, or to a general decrease of F+ cell translational activity, we compared the activities of cell-free, protein-synthesizing systems prepared from isogenic F- and F+ cells harvested at different times of T7 infection . The cell-free systems from uninfected F- and F+ cells translated T7late mRNA equally as well as MS2 RNA and T7early mRNA . The activity of cell-free systems from T7-infected F+ cells to translate MS2 RAN, T7 early mRNA, and T7 late mRNA decreased concomitantly at a much faster rate than that of T7-infected F- cells . Therefore, the abortive infection of F+ cells by T7 does not result from a T7 late mRNA-specific translational inhibition, although a general reduction of the translational activity appears to be a major factor for the inability of the F+ cells to produce a sufficient amount of T7 late proteins. J Virol, 1975 Dec, 16(6), 1380 - 90 F-Factor-mediated restriction of bacteriophage T7: synthesis of RNA and protein in T7-infected Escherichia coli F- and F+ cells; Whitaker PA et al.; Bacteriophage T7 is unable to productively infect Escherichia coli strains carrying the sex factor F . T7 phage development, in terms of RNA and protein synthesis, was compared in T7-infected isogenic F- and F+ strains of E . coli . Slightly less T7 early mRNA and early protein were synthesized in F+ cells . In addition to the defect in T7 late protein production in F+ cells reported by others, significantly less T7 late mRNA was synthesized, about one-half of that produced in T7-infected F- cells . Moreover, host RNA synthesis was not completely inhibited . The protein-synthesizing ability of T7-infected F+ cells decayed much faster than that of F- cells both in vivo and in vitro . This faster decay appears to explain the failure of F+ cells to produce T7 late protein in vivo, even in the presence of a considerable amount of translatable T7 late mRNA . Therefore, it may not be necessary to postulate the involvement of specific translational discrimination against T7 late mRNA, although it appears that F-factor-mediated restriction of T7 involves changes in transcription as well as translation. J Bacteriol, 1975 Dec, 124(3), 1403 - 10 Excision of bacteriophage lambda from a site in the arabinose B gene; Kaplan S et al.; A lambda lysogen with the prophage inserted into the arabinose B gene of Escherichia coli strain K-12 has been prepared . Induction of the phage from this lysogen yields viable phage at a frequency 4 X 10(-6) that found for induction of lysogens with phage inserted at the normal attachment site . Over 30% of the phage particles induced from the insertion in ara are arabinose-transducing phage . The excision end points of 62 independently isolated, nondefective araC-transducing phage containing less than the entire araC gene were genetically determined and were found to be randomly distributed through the araC gene . The amount of arabinose deoxyribonucleic acid contained on four selected transducing phage was determined by electron microscopy of deoxyribonucleic acid heteroduplexes, providing a physical map of the araC gene . The efficiency with which these phage transduce araC and araB point mutations was found to be approximately proportional to the homology length available for recombination. J Bacteriol, 1975 Dec, 124(3), 1395 - 402 Deoxyribonucleic acid modification by intermediate-type modification mutants of Escherichia coli K-12 and B; Bulkacz J et al.; The modification of bacteriophages grown on r-m+/- restriction and modification mutants of Escherichia coli K-12 or B appears to be related to the number of restriction-specific sites in the viral genome . Bacteriophage fd and its mutant U1 fd, which carry two and one B-specific sites, respectively, are not modified in vivo by rB-mB+/- mutant strains . In vitro treatment of fd RF-B+/- deoxyribonucleic acid (DNA) or U1 fd RF-B+/- DNA by endo R-Eco B results in cleavage of the substrate DNA . Lambda bacteriophage, after growth in r-m+/- mutant host strains (lambda-K+/- or lambda-B+/-), is partially protected from in vivo degradation by wild-type homospecific strains . Its efficiency of plating on these strains is approximately 10(-2) . However, a hybrid phi80-lambda phage which carries only one K-specific site (sklambda-1) is not modified by rK-mK+/- strains . Labeled DNAs from lambda-B+/- and lambda-K+/- phages were used as substrates for endo R-Eco B and endo R-Eco K nucleases . Zonal centrifugation analysis of the products of the reactions indicate that rK-mK+/- mutants do not protect lambda DNA from in vitro degradation by endo R-Eco K . In contrast, rB-mB+/- mutants appear to partially protect lambda DNA from attack by endo R-Eco B. Proc Natl Acad Sci U S A, 1975 Dec, 72(12), 4800 - 4 Reconstruction of bacteriophage T4 DNA replication apparatus from purified components: rolling circle replication following de novo chain initiation on a single-stranded circular DNA template; Morris CF et al.; The protein products of T4 bacteriophage genes 41, 43, 45, 44, and 62 have been purified to near homogeneity using an assay which measures their stimulation of DNA synthesis in a crude lysate of Escherichia coli cells in fected by an appropriate mutant phage . When all of these proteins and T4 gene 32 protein are incubated in the presence of deoxyribonucleoside and ribonucleoside triphosphates, extensive DNA synthesis occurs on both single and double-stranded DNA templates . Analysis of this in vitro system reveals most of the features attributed to in vivo DNA replication: (1) De novo DNA chain initiation is found on a single-stranded DNA template only if ribonucleoside triphosphates are present (as expected for RNA priming of Okazaki pieces on the "lagging" strand of a replication fork) . (2) With single-stranded circular DNA as template, synthesis continues for many doublings . The products after extensive synthesis resemble a rolling circle as visualized in the electron microscope, with discontinuous "lagging" strand synthesis generating a long, unbranched double-stranded tail . The fact that all six mutationally identified T4 replication gene products are required for these syntheses suggests the existence of a large multienzyme complex, constituting the T4 replication apparatus. Proc Natl Acad Sci U S A, 1975 Dec, 72(12), 4810 - 4 Human papillomavirus DNA: physical map; Favre M et al.; Human papillomavirus (HPV) DNA form I (supercoiled) was prepared from plantar warts . HPV DNA was cleaved with restriction enzymes obtained from the following sources: escherichia coli (EcoRI), Hemophilus influenzae strain Rd (both unfractionated Hind and aeparated HindII and HindIII enzymes) and Hemophilus parainfluenzae (HpaI) . The cleavage products were analyzed by polyacrylamide gradient slab gel electrophoresis and electron microscopy . HPV DNA was cleaved into two fragments by EcoRI (87% and 13% of the genome) and into six fragments, ranging in size from 33.5 to 1.2% of the genome, by Hind endonucleases . The six Hind fragments result from the cleavage of three sequences recognized by HindII, two of which are also cleaved by HpaI, and of three sequence recognized by HindIII . The order of these fragments was determined by comparing their size with that of the fragments obtained with HindII, HindIII, HpaI, and the mixture of HindIII + Hpal . The two EcoRI cleavage sites were located on two adjacent Hind fragments and one of these sites has been taken for the zero point to construct a physical map . The treatment of superhelical HPV DNA with bacteriophage T4 gene 32 protein yields circular structures with a denaturation loop . The cleavage of these complexes with EcoRI and HindIII has shown two easily denatured regions which were located on the cleavage map. Eur J Biochem, 1975 Dec 1, 60(1), 227 - 38 ADP-ribosylation of DNA-dependent RNA polymerase of Escherichia coli by an NAD+: protein ADP-ribosyltransferase from bacteriophage T4; Rohrer H et al.; A protein from bacteriophage T4 responsible for the alteration of host DNA-dependent RNA polymerase and absent in T4 alt- phage was purified from T4 phage and enriched from T4-infected cells . It is injected during infection together with the known internal proteins . It has a molecular weight of about 70000 and catalyses the release of nicotinamide and the transfer of the ADP-ribosyl moiety from NAD+ to arginyl residues of various proteins including itself . RNA polymerase from Escherichia coli accepts ADP-ribosyl residues in all four subunits; the alpha subunit reacts with very high specificity . Only half of the alpha subunits are labelled, 45% with one, 5% with two residues . The main product shows the same electrophoretic mobility as alpha subunits altered or modified in vivo . The alpha subunit in modified RNA polymerase is no acceptor. Chem Biol Interact, 1975 Dec, 11(6), 575 - 88 Assays for phosphotriester formation in the reaction of bacteriophage R17 with a group of alkylating agents; Shooter KV; The interaction of bacteriophage R17 with 8 compounds has been studied, comparing the contribution of degradation of ribonucleic acid to the total toxicity . Breaks in the RNA chain result from the hydrolysis of phosphotriesters and thus are a measure of the extent of O-alkylation and of the SN1-type mechanism of the reaction . With many alkylating agents mutagenicity and carcinogencity increase with increasing SN1 character of the reaction . In experiments with methyl methanesulphonate no evidence of degradation was observed at up to 19 times the mean lethal dose (620 methylations/RNA molecule) . Breaks in the RNA chain accounted for 1 in 10 of the lethal lesions with beta-hydroxyethyl methanesulphonate, 1 in 60 with bis-(2-chloromethyl)methylamine (nitrogen mustard, HN2), less than 1 in 125 with 2,2-dichlorvinyl dimethyl phospate (dichlorovos, DDVP), and 1 in 200 with propylene oxide . The hydrolysis rate of bis-(2 chloroethyl)ether was too slow for any reaction to be detected . In reactions with the carcinogen bis-(2-chloromethyl)ether the toxicity observed could be accounted for by the formaldehyde produced on hydrolysis . Cross-linking of the bacteriophage components by formaldehyde reduced the survival range over which the physical state of the RNA could be studied . No evidence of RNA degradation was observed . Reaction of the formaldehyde led to a progressive loss of biological activity over 24 h, a loss which was partially reversed by dialysis. Chem Biol Interact, 1975 Dec, 11(6), 563 - 73 The inactivation of bacteriophage R17 by ethylating agents: the lethal lesions; Shooter KV et al.; The biological inactivation of bacteriophage R17 by ethyl methanesulphonate (EMS) and N-ethyl-N-nitrosourea (ENUA) has been studied . At the mean lethal dose for the first compound 8 moles ethyl are bound/mole RNA and with the nitroso compound 3.5 moles ethyl are bound . Analysis of the amounts of the different ethylated derivatives formed shows that the toxicity of the sulphonate can be accounted for by the formation of 3-ethylcytosine, O6-ethylguanine, 1-ethyladenine and chain breaks produced on the hydrolysis of ethyl phosphotriesters . With the nitroso derivative on the other hand, the sum of chain breaks and of bases alkylated on a position involved in specific hydrogen bonding between base pairs only accounts for 65% of the observed toxicity . The possibility that 3-ethyladenine may constitute a lethal lesion is discussed. Arch Int Physiol Biochim, 1975 Dec, 83(5), 909 - 48 Structure and function of RNA replicase of bacteriophage Qbeta; Kondo M; (1) The RNA replicase induced by bacteriophage Qbeta consists of four non-identical subunits designated as alpha (mol . wt . 74000), beta (mol . wt . 64000), gamma (mol . wt . 47000) and delta (mol . wt . 33000), only one (subunit beta) of which is specified by the phage genome . (2) Subunit alpha (30 S ribosomal protein "S1" as well as translational interference factor "i") is required only for (+) strand-directed RNA synthesis in the presence of the host factor . (3) Qbeta replicase lacking subunit alpha (R-alpha) is capable of replicating templates other than (+) strand, such as (--), "6S" RNA, poly(C) etc., in the absence of the host factor . (4) Subunit beta is suggested to be the nucleotide-polymerizing enzyme, but is unable to initiate RNA synthesis by itself . (5) Subunits gamma and delta are identical to the protein synthesis elongation factors, EF-Tu and EF-Ts, respectively, and are required only for initiation of RNA synthesis, but not for elongation . (6) A model of Qbeta replicase is presented in order to discuss observed template-enzyme interactions. Mol Gen Genet, 1975 Dec 1, 141(3), 233 - 49 Studies on bacteriophage T7 DNA synthesis in vitro . II . Reconstitution of the T7 replication system using purified proteins; Scherzinger E et al.; DNA synthesis in vitro using intact duplex T7 DNA as template is dependent on a novel group of three phage T7-induced proteins: DNA-priming protein (activity which complements a cell extract lacking the T7 gene 4-protein), T7 DNA polymerase (gene 5-protein plus host factor), and T7 DNA-binding protein . The reaction requires, in addition to the four deoxyribonucleoside triphosphates, all four ribonucleoside triphosphates and is inhibited by low concentrations of actinomycin D . Evidence is presented that the priming protein serves as a novel RNA polymerase to form a priming segment which is subsequently extended by T7 DNA polymerase . T7 RNA polymerase (gene 1-protein) can only partially substitute for the DNA-priming protein . At 30 degrees C, deoxyribonucleotide incorporation proceeds for more than 2 hours and the amount of newly synthesized DNA can exceed the amount of template DNA by 10-fold . The products of synthesis are not covalently attached to the template and sediment as short (12S) DNA chains in alkaline sucrose gradients . Sealing of these fragments into DNA of higher molecular weight requires the presence of E.coli DNA polymerase I and T7 ligase . Examination of the products in the electron microscope reveals many large, forked molecules and a few "eye"-shaped structures resembling the early replicative intermediates normally observed in vivo. J Immunol, 1975 Dec, 115(6), 1549 - 54 Determinants of the hierarchy of humoral immune responsiveness during ontogeny; Sherwin WK et al.; A model system of ontogeny was utilized to investigate the development of humoral immunity in both AKR and BALB/c mice . Lethally irradiated adult mice were reconstituted with syngeneic fetal or neonatal liver . These mice were immunized at various times after reconstitution with a series of eight antigens: the bacteriophages F2, phiX-174, and T4; the hapten carrier complexes 2,4 dinitrophenyl-bovine serum albumin and fluorescein-bovine serum albumin; and the small proteins: hen egg lysozyme, sperm whale myoglobin, and bovine pancreatic ribonuclease . Subsequent antibody production to the antigens was assayed with either a direct or a modified bacteriophage neutralization technique . Individual mice responded to the various antigens in a sequential pattern which was basically the same for all mice within each strain . However, there was a marked difference between the two strains in the time at which they developed responsiveness to myoglobin . In order to begin to delineate the separate roles played by B and T cells in the generation of this hierarchical response pattern during ontogeny, the development of anti-DNP and anti-FTC activity was examined in carrier-primed mice . Results of this experiment indicated that functional B cell specificities for the two haptens arise at different times during ontogeny . Further studies are needed to determine whether the hierarchical pattern of immune responsiveness observed for the other antigens is a function of sequential appearance of B cell specificities, T cell specificities, or both. J Gen Virol, 1975 Dec, 29(3), 267 - 80 Disruption of Vi bacteriophage III and localization of its deacetylase activity; Kwiatkowski B et al.; It has been shown that particles of Vi bacteriophage III catalyse deacetylation of O-acetyl pectic (polygalacturonic) acid, a structural analogue of Vi polysaccharide (Vi antigen) . Using this substrate, and determining the acetic acid liberated by gas-liquid chromatogrphy, a method for the estimation of Vi phage deacetylase activity has been developed . Purified particles of Vi phage III were exposed to a variety of mildly dissociative reagents and conditions, and then tested for plaque-forming and for deacetylase activity . They have also been inspected under the electron microscope . Osmotic shock, and incubation in the presence of ethylenediamine tetraacetic acid (greater than or equil 0-01 M), or of L-arginine (0-25 M), were found to cause disintegration of the virions into empty head capsids, deoxyribonucleic acid, and base plates still carrying the spikes . The mixtures of viral fragments exhibited an increased deacetylase activity . Using zonal sedimentation and ion exchange chromatography, the phage fragments obtained by treatment with ethylenediaminetetraacetic acid have been fractionated and the base plates isolated . Amongst the viral components, these structures showed the highest specific deacetylase activity . They had the shape of six-pointed stars (about 9-5 nm inner, and 14-5 nm outer diam.) with a central hole or plug (approximately 3 nm), carrying six spikes, roughly cylindrical organelles of approx . 11 X 4 nm, one at each of the points . Of the polypeptides of six sizes (P.1, about 153,000 daltons; P.2, 91,000; P.3, 71,000; P.4 56,500; P.6, 22,000), detected in whole Vi phage III virions by sodium dodecyl sulphate-polyacrylamide gel electrophoresis, only two, P.2 and P.3 were found in the base plates. J Virol, 1975 Dec, 16(6), 1401 - 8 Bacteriophage T4 baseplate components . II . Binding and location of bacteriophage-induced dihydrofolate reductase; Kozloff LM et al.; The location of T4D phage-induced dihydrofolate reductase (dfr) has been determined in intact and incomplete phage particles . It has been found that phage mutants inducing a temperature-sensitive dfr (dfrts) procude heat-labile phage particles . The structural dfr produced by these ts mutants was shown to assume different configurations depending on the temperature at which the phage is assembled . Morphogenesis of incomplete phage particles lacking the gene 11 protein on their baseplates was found to be inhibited by reagents binding to dfr, such as antibodies to dfr . Further, cofactor molecules for dfr, such as reduced nicotinamide adenine dinucleotide phosphate and reduced nicotinamide adenine dinucleotide, also inhibited the step in morphogenesis involving the addition of gene 11 product . On the other hand, inhibitors of dfr, such as adenosine dephosphoribose, stimulated the addition of the gene 11 protein . It has been concluded that the phage-induced dfr is a baseplate component which is partially covered by the gene 11 protein . The properties of phage particles produced after infection of the nonpermissive host with the one known T4D mutant containing a nonsense mutation in its dfr gene suggested that these progeny particles contained a partial polypeptide, which was large enough to serve as a structural element. J Biol Chem, 1975 Nov 25, 250(22), 8748 - 52 Action of bacteriophage T4 ultraviolet endonuclease on duplex DNA containing one ultraviolet-irradiated strand; Simon TJ et al.; Previous studies have indicated that the ultraviolet endonuclease of bacteriophage T4 acts specifically at pyrimidine dimer sites in ultraviolet-irradiated DNA . At such sites the enzyme could conceivably catalyze endonucleolytic incision of the DNA either on the dimer-containing strand or on the strand directly opposite to the dimer . In the present work, a direct test of these alternatives was made . Substrate molecules containing one irradiated and one unirradiated strand were prepared from differentially isotopically labeled purified complementary strands of bacteriophage lambdaDNA . Following incubation with the enzyme, the sedimentation profiles of the DNA strands in alkaline sucrose density gradients were compared . The results show that the enzyme selectively nicks the irradiated strand. J Biol Chem, 1975 Nov 25, 250(22), 8696 - 703 Isolation and characterization of a bacteriophage polysaccharide; Oeltmann TN et al.; A high molecular weight heteropolysaccharide, composed of glucose, glucuronic acid, N-acetylglucosamine, and mannose in an approximate molar ratio of 1:2:2:5, respectively, was isolated from phage K-2 and from the soluble fraction of phage-infected Aerobacter aerogenes lysates . Treatment of pure phage with 8 M urea at 4 degrees quantitatively solubilizes the bound polysaccharide and capsular polysaccharide (Yurewicz, E.C., Ghalambor, M.A., Duckworth, D.H., and Heath, E.C . (1971) J . Biol . Chem . 246, 5607-5616) with the release of only traces of other phage constituents; on this basis, it was concluded that the polysaccharide, like the the glycanohydrolase, is externally localized in the phage structure . Phage polysaccharide and glycanohydrolase fractionate similarly on ion exchange resins and gel electrophoresis in sodium dodecyl sulfate, but each may be purified to homogeneity by the procedures employed . The biosynthesis of the polysaccharide was shown to be uniquely dependent upon phage K-2 infection by: (a) absence of the polysaccharide in cells, the culture filtrate, or sonicated extracts of uninfected cells; (b) kinetics of polysaccharide synthesis following phage infection; and (c) isotopic double-labeling experiments that demonstrated the synthesis of polysaccharide only after initiation of phage replication in infected cells. J Biol Chem, 1975 Nov 25, 250(22), 8848 - 55 Specificity of the S1 nuclease from Aspergillus oryzae; Wiegand RC et al.; Conditions are described for digesting single-stranded DNA by S1 nuclease without introducing breaks in double-stranded DNA . The enzyme is inhibited by low concentrations of various compounds of phosphate . Under certain conditions S1 nuclease cleaves the strand opposite a nick in bacteriophage T5 DNA; under other conditions, the enzyme cleaves a loop in one strand of heteroduplex lambdaDNA while leaving the opposite strand intact . S1 nuclease makes many single strand breaks in ultraviolet-irradiated duplex lambdaDNA . Superhelical DNA of phiX174 (Form I) is converted first to a relaxed circular molecule (Form II), and then to a linear molecule (Form III) by cleavage at one site per molecule . Since the cleavage occurs at many sites in the population of molecules, the partially single-stranded regions in phiX174 superhelical DNA are not determined by specific nucleotide sequences. Mol Gen Genet, 1975 Nov 24, 141(2), 163 - 71 Genetic consequences of transfection with heterduplex bacteriophage lambda DNA; White RL et al.; The role of rectification of heteroduplex heterozygotes in the formation of recombinant genotypes involving closely linked markers has been examined . Heteroduplex molecules of bacteriophage lambda DNA, heterozygous at several alleles, have been constructed and the genetic composition of phage present in infective centers derived by transfection with such molecules has been determined . Allele loss and concomitant recombinant formation is frequent, and appears to reflect marker specificity as well as specificities imposed by whether or not the transfection recipient is permissive or nonpermissive for DNA duplication of the transfecting genome . The observations support the proposal that many, perhaps most, of the events involving separation of closely linked markers occur by rectification of non-recombinant heterozygotes. Eur J Biochem, 1975 Nov 15, 59(2), 387 - 94 Immunochemical studies on tyrosinase induction in Neurospora; Katan T et al.; An immunoassay for tyrosinase, using the modified bacteriophage technique, was developed: Tyrosinase of Neurospora was conjugated to bacteriophage T4 using glutaraldehyde as a cross-linking agent . The conjugated phage that survived the coupling process could be inactivated by antiserum raised in rabbits against pure tyrosinase, but not by normal serum . This inactivation was specifically inhibited by pure Neurospora tyrosinase, and the degree of inhibition was proportional to the concentration of tyrosinase within the range of 30-150 ng/ml . Crude mycelial extract possessing tyrosinase activity could similarly inhibit the inactivation of the conjugated phage by the antiserum . To evaluate the tyrosinase content of crude extracts their inhibitory capacity was compared to that of known amounts of pure tyrosinase, and the amounts thus calculated agreed with those predicted from an enzymatic assay . The tyrosinase-bacteriophage immunoassay was used for the quantitation of tyrosinase-antigen in crude extracts of Neurospora cultures that had been induced to form tyrosinase by the addition of ethionine . Enzymatic activity appeared after a lag of several hours, increased for 2-3days and then declined . Immunological assays of these cultures showed: (a) serologically reactive protein started to accumulate upon culture starvation and was evident during the lag period; (b) specific activity (units per mg antigen) was constant throughout induction; (c) at the phase of decrease in mycelial enzyme content, increasing amounts of serologically reactive protein were detected in the medium, indicating that some enzyme was eventually excreted . These results show that the lag is not a qualitatively distinct period, and support the previously forwarded notion that tyrosinase is synthesized de novo upon induction. Arch Microbiol, 1975 Nov 7, 105(3), 217 - 24 Gene transfer agents, bacteriophages, and bacteriocins of Rhodopseudomonas capsulata; Wall JD et al.; Thirty-three wild type strains of Rhodopseudomonas capsulata were examined for ability to engage in genetic recombination through mediation by "gene transfer agent" (GTA) particles . The genetic exchange assays were based on capacity of strains to produce or receive GTA required for restoration of photosynthetic growth competence to a non-photosynthetic "white" mutant or for acquisition of resistance to rifampicin . A majority of the strains could either produce or receive GTA, and it was demonstrated that the agent is species specific . Possible relations between GTA and bacteriophages or bacteriocins were investigated . Sixteen types of virulent phages active on Rps . capsulata were isolated and their host ranges determined . Tests for transduction by the phages gave uniformly negative results . The viruses showed strict species specificity, but there was no apparent correlation between capacity of the Rps . capsulata strains to donate or receive GTA and susceptibility to the phages . A comparable survey disclosed that most of the bacterial strains were sensitive to or capable of producing bacteriocins; the latter also appear to be unrelated to GTA activity . The collection of bacterial strains was also screened for detection of lysogenic properties . None of the isolates is a "true" lysogen, but phages were detected in cultures of two strains, which may be "phage carriers" or pseudolysogens. Arch Microbiol, 1975 Nov 7, 105(3), 207 - 16 Characterization of Rhodopseudomonas capsulata; Weaver PF et al.; Thirty-three strains of Rhodopseudomonas capsulata have been studied in order to develop a more comprehensive characterization of the species . On the basis of morphological, nutritional, physiological and other properties, the characteristics of an "ideal biotype" have been defined, which can be used to distinguish Rps . capsulata from similar purple bacteria . In this connection, two properties of Rps . capsulata are of particular note: a) sensitivity to penicillin G is 10(3)-10(5) times greater than that shown by closely related species, and b) all strains examined are susceptible to lysis by one or more strains of host species-specific virulent bacteriophages . It appears that members of the species Rps . capsulata form a stringent taxonomic grouping. Mol Gen Genet, 1975 Nov 3, 141(1), 23 - 40 Transversion mutagenesis in bacteriophage T4; Ripley LS; Transversion mutations can be distinguished from transition mutations by the use of special tauII mutants of bacteriophage T4 . Methyl methanesulfonate did not induce reversion of the tester mutants along transversion or transition pathways from A:T1 base pair sites, nor along transversion pathways from G:C base pair sites . Ethyl methanesulfonate and N-methyl-N-nitrosourea, however, induced both transversions and transitions at an A:T base pair site; no transversions were detected at G:C-sites . Mn++ induced transversions and transitions at both A:T-and G:C-sites . The influence of temperature-sensitive gene-43 DNA polymerase mutator and antimutator mutations on the reversion of the tauII tester mutants was measured: some gene-43 mutants differentially influenced different pathways of reversion . Studies of thymineless mutagenesis demonstrated A:T-site transversion mutations . A synergistic interaction between thymineless mutagenesis and the gene-43 mutator, tsL56, was used to demonstrate thymineless mutagenesis at one site where it was not detected in the presence of the wild type polymerase. Chem Biol Interact, 1975 Nov, 11(5), 365 - 75 Inactivation of bacteriophages with cis-platinum(II) diamminedichloride; Drobnik J et al.; The ability of the cis-plantinum(II) diamminedichloride and its hydrolytic products to inactive DNA bacteriophages was examined on the models T2, T4, T4BO1, T3, and lambda . The inactivation of all bacteriophages under study increases gradually during the first 40-90 min of the action of neutral cis-Pt(II) and later passes into an exponential phase . The extent of the region of slower inactviation is larger for osmotically sensitive strains T2 and T4 . Inactivation with the hydrolytic products for cis-Pt(II) proceeds exponentially starting from the very beginning and their inactivating effect is higher by 40-80 times than for a comparable concentration of the original complex . The extent of inactivation is not affected with the HCR marker of the host bacteria . The sensitivity to cis-Pt(II) is higher for bacteriophages with a head permeable to salts . An additional inactivation ("after-effect") was observed after dilution of the complex; it can be removed by adding S-aminoisothiuronium dihydrobromide (AET) . The results obtained are in good accord with the assumption that inactivation is due to the hydrolytic products arising in the head of bacteriophage. J Virol, 1975 Nov, 16(5), 1348 - 50 das Mutation in bacteriophage T4D does not suppress an amber mutation in T4 gene 59; Wiberg JS et al.; Mutations termed das were isolated originally (Hercules and Wiberg, 1971) as partial suppressors of mutants in phage T4 genes 46 and 47 . Since mutants in genes 46, 47, and 59 exhibit both an early arrest of phage DNA synthesis and the loss of this arrest in the presence of chloramphenicol or of mutations of T4 genes 33 and 55, we asked whether a das mutation can also suppress a gene 59 mutant . We find that it cannot--either at the level of phage production or DNA synthesis. J Virol, 1975 Nov, 16(5), 1273 - 81 Structural aberrations in T-even bacteriophage . VII . In vitro analysis of the canavanine-mediated inhibition of proteolytic cleavage; Bolin RW et al.; Canavanine arrests a critical function in head morphogenesis and the potential for forming giant T-even phage particles termed lollipops is induced . Formation of the particles requires the addition of arginine and the restoration of normal functions . We now report on an investigation into the effects of canavanine on both the T4-induced proteolytic activity and on the substrate proteins . Using an in vitro cleavage assay we have shown that the gene 21-dependent proteolytic activity from canavanine-treated extracts is markedly inhibited, whereas the substrate proteins retain a high susceptibility for cleavage . The proteolytic activity in extracts treated with canavanine followed by arginine is readily detectable, and proteins previously synthesized in the presence of canavanine can be cleaved . Protein synthesis is apparently required for the appearance of the proteolytic activity after the canavanine-arginine treatment . Mixing experiments suggest the requirement for a component of the gene 21-dependent proteolytic activity that is not coded for by gene 21. J Toxicol Environ Health, 1975 Nov, 1(2), 243 - 70 Genetic activity spectra of some antischistosomal compounds, with particular emphasis on thioxanthenones and benzothiopyranoindazoles; Hartman PE et al.; In this review we note that hycanthone (Etrenol) is mutagenic for bacteriophage, bacteria, yeast, Neurospora, Drosophila, and for mammalian tissue culture cells, and we point out other genetic activities of this thioxanthenone and of related compounds . One alarming genetic activity is the ability of hycanthone to cause transformation of tissue culture cells in vitro in a test designed to detect carcinogens, results that parallel the direct demonstration of carcinogenic activity of hycanthone in the mouse in vivo . These and other results are compatible with the somatic mutation theory of cancer induction . Factors likely to affect the quantitative genetic activity of hycanthone and its congeners are summarized . Attempts are made to weave the more critical experimental evidence into a molecular model that accounts for the genetic activities of this series of compounds . We conclude that hycanthone is a directly acting mutagen that intercalates into DNA and preferentially alkylates deoxyguanosine residues via formation of a strongly electrophilic molecular species, the carbonium ion . Finally, we show that genetic activity can be dissociated from schistosomicidal activity by appropriate modifications in the thioxanthenone molecule . Preliminary experiments on a newly synthesized piperazinyl N-oxide derivative demonstrate no detectable mutagenic activity; yet considerable schistosomicidal activity is retained. J Immunol, 1975 Nov, 115(5), 1432 - 7 In vitro immunogenicity of trinitrophenylated bacteriophage T4 . I . Lack of helper cell cooperation; Jennings JJ et al.; A primary immune response was obtained in vitro to trinitrophenylated bacteriophate T4 (TNP-T4) by using normal BALB/c spleen cells challenged in vitro . The primary response was limited to anti-TNP; we failed to find evidence of a primary anti-T4 response in spleen cell cultures challenged with either TNP-T4 or native T4 . In vivo priming with the carrier T4 failed to enhance the subsequent in vitro response to TNP-T4 although such priming sometimes caused suppression of the anti-hapten response . The addition of excess free carrier to spleen cell cultures challenged with TNP-T4 failed to suppress the anti-tnp response . Spleen cells treated with anti-theta plus complement were unaffected in their ability to respond to TNP-T4 . We conclude that TNP-T4 should be classified among the thymus independent antigens. Proc Natl Acad Sci U S A, 1975 Nov, 72(11), 4399 - 403 Influence of insertions on packaging of host sequences covalently linked to bacteriophage Mu DNA; Bukhari AI et al.; Insertions in bacteriophage Mu DNA have been identified . These insertions are responsible for at least seven X mutations, all of which eliminate essential Mu functions . The insertions are about 800 base pairs long and are located to the left of the cleavage site of restriction endonuclease EcoRI, near the immunity end of Mu DNA . We have found that such insertions cause a reduction in the length of nonhomologous terminal sequences which are seen as split ends in denatured and renatured Mu DNA molecules . These heterogeneous sequences apparently arise from packaging of host DNA from maturation precursors in which Mu and host DNA are covalently linked . We infer that a single Mu genome length is too short to be cut during morphogenesis, and thus some host DNA is packaged into mature virions . Since the insertions increase the length of Mu DNA, they decrease the amount of host DNA needed for packaging. Proc Natl Acad Sci U S A, 1975 Nov, 72(11), 4288 - 92 Characterization of DNA condensates induced by poly(ethylene oxide) and polylysine; Laemmli UK; High-molecular-weight DNA is known to collapse into very compact particles in a salt solution containing polymers like poly(ethylene oxide) {(EO)n} or polyacrylate . The biological relevance of this phenomenon is suggested by our recent finding that high concentrations of the highly acidic internal peptides found in the mature T4 bacteriophage head, as well as poly(glutamic acid) and poly(aspartic acid), can collapse DNA in a similar manner . The structure of DNAs collapsed by various methods has been studied with electron microscope . We find (EO)n collapses T4 or T7 bacteriophage DNA into compact particles only slightly larger than the size of the T4 and T7 head, respectively . In contrast, polylysine collapses DNA into different types of structures . Double-stranded DNA collapsed with (EO)n is cut by the single-strand specific Neurospora crassa endonuclease (EC 3.1.4.21) into small fragments . Extensive digestion only occurs above the critical concentration of polymer required for DNA collapse, demonstrating the (EO)n-collapsed DNA contains enzyme-vulnerable regions (probably at each fold), which are preferentially attacked . The size of the DNA fragments produced by limit-digestion with the nuclease ranges between 200 and 400 base pairs when DNA is collapsed by (EO)n . Only fragments of DNA which are larger than 600 base pairs are cut by the endonuclease in (EO)n-containing solution. Nucleic Acids Res, 1975 Nov, 2(11), 2091 - 100 Studies on bacteriophage fd DNA . III . Nucleotide sequence preceding the RNA start-site on a promoter-containing fragment; Sugimoto K et al.; A short DNA fragment containing a strong promoter was isolated from phage fd replicative form DNA with the use of restriction endonucleases, and the sequence of 110 nucleotides in the region preceding the RNA start-site was determined . The sequence was : (5') CGGTCTGGTTCGCTTTGAGGCTCGAATTAAAACGCGATATTTGAAGTCTTTCGGGCTTCCTCTTAATCTTTTTGATCGAATTCGCTTTGCTTCTGACTATAATAGACAGG (3'). Nucleic Acids Res, 1975 Nov, 2(11), 2037 - 48 In vitro synthesis of large peptide molecules using glucosylated single-stranded bacteriophage T4D DNA template; Hulen C et al.; Denatured Bacteriophage T4D DNA is able to stimulate aminoacid incorporation into TCA-precipitable material in an in vitro protein synthesis system according to base DNA sequences . Newly synthesized polypeptides remain associated with ribosomes and have a molecular weight in range of 15,000 to 45,000 Daltons. Nucleic Acids Res, 1975 Nov, 2(11), 2021 - 36 Specific binding of the first enzyme for histidine biosynthesis to the DNA of histidine operon; Meyers M et al.; Studies were done to examine direct binding of the first enzyme of the histidine biosynthetic pathway (phosphoribosyltransferase) to 32P-labeled phi80dhis DNA and competition of this binding by unlabeled homologous DNA and by various preparations of unlabeled heterologous DNA, including that from a defective phi80 bacteriophage carrying the histidine operon with a deletion of part of its operator region . Our findings show that phosphoribosyltransferase binds specifically to site in or near the regulatory region of the histidine operon . The stability of the complex formed by interaction of the enzyme with the DNA was markedly decreased by the substrates of the enzyme and was slightly increased by the allosteric inhibitor, histidine . These findings are consistent with previous data that indicate that phosphoribosyltransferase plays a role in regulating expression of the histidine operon. Cell, 1975 Nov, 6(3), 269 - 77 Yeast super-suppressors are altered tRNAs capable of translating a nonsense codon in vitro; Capecchi MR et al.; tRNA isolated from two different yeast super-suppressor strains translates a known nonsense mutation in vitro, whereas tRNA from a closely related nonsuppressing strain does not . Suppression was assayed by translation of RNA isolated from an amber coat mutan