The environmental strain Bacillus amyloliquefaciens FZB42 promotes plant growth and suppresses plant pathogenic organisms present in the rhizosphere . We sampled sequenced the genome of FZB42and identified 2,947 genes with >50% identity on the aminoacid level to the corresponding genes of Bacillus subtilis 168.Six large gene clusters encoding nonribosomal peptide synthetases[NRPS] and polyketide synthases [PKS] occupied 7.5% of the wholegenome . Two of the PKS and one of the NRPS encoding gene clusterswere unique insertions in the FZB42 genome and are not presentin B . subtilis 168 . Matrix-assisted laser desorption ionization-timeof flight mass spectrometry analysis revealed expression ofthe antibiotic lipopeptide products surfactin, fengycin, andbacillomycin D . The fengycin [fen] and the surfactin [srf] operonswere organized and located as in B . subtilis 168 . A large 37.2-kb antibiotic DNA island containing the bmy gene cluster was attributed to the biosynthesis of bacillomycin D . The bmy island was found inserted close to the fen operon . The responsibility of the bmy, fen, and srf gene clusters for the production of the correspondingsecondary metabolites was demonstrated by cassette mutagenesis,which led to the loss of the ability to produce these peptides.Although these single mutants still largely retained their abilityto control fungal spread, a double mutant lacking both bacillomycinD and fengycin was heavily impaired in its ability to inhibitgrowth of phytopathogenic fungi, suggesting that both lipopeptidesact in a synergistic manner.

 
The rhizosphere colonizing Bacillus amyloliquefaciens strain FZB42 is distinguished from the related model organism Bacillus subtilis 168 by its ability to stimulate plant growth and to suppress plant pathogenic organisms [12, 14] . However, the basisfor successful mutualistic colonization of plant rhizosphereby some Bacillus strains is still unknown . We assume that rhizospherecompetence and biocontrol function in bacilli are partly causedby nonribosomally produced cyclic lipopeptides acting againstphytopathogenic viruses, bacteria, fungi, and nematodes . Theselipopeptides are synthesized at modular multienzymatic templates[33] and consist of a ß-amino or ß-hydroxyfatty acid component that is integrated into a peptide moiety.

Some of these lipopeptides have been studied in greater detail, including surfactin, fengycins, and several iturins . Surfactinis a heptapeptide with an LLDLLDL chiral sequence linked, viaa lactone bond, to a ß-hydroxy fatty acid with 13to 15 carbon atoms . Surfactin exerts its antimicrobial and antiviraleffect by altering membrane integrity [30] . Fengycin and theclosely related plipastatin are cyclic lipodecapeptides containinga ß-hydroxy fatty acid with a side chain length of16 to 19 carbon atoms . Four D-amino acids and ornithine [a nonproteinogenic residue] have been identified in the peptide portion of fengycin. It is specifically active against filamentous fungi and inhibits phospholipase A₂ [26] . Members of the iturin family, such asmycosubtilin, bacillomycin D, and iturin A, contain one ß-aminofatty acid and seven -amino acids . The peptide moiety of theiturin lipopeptides contains a tyrosine in the D-configurationat the second amino acid position and two additional D-amino acids at positions 3 and 6 . The members of the iturin familyexhibit strong antifungal and hemolytic activities and a limited antibacterial activity [21].

Previous matrix-assisted laser desorption ionization-time of flight mass spectrometry [MALDI-TOF-MS] analysis of an environmental B . subtilis strain revealed expression of surfactin-, fengycin-, and iturin-like compounds [36] . Parallel production of the lipopeptidesiturin and surfactin by B . subtilis RB14 in a sterilized vermiculite-soilsystem [2] and of viscosinamide, tensin, and amphisin by Pseudomonasfluorescens [25] in bulk soil and the sugar beet rhizosphere were detected and illustrate production of these peptide antibiotics by biocontrol strains in their natural environment . In addition,gene sequences encoding enzymes for mycosubtilin and iturinA biosynthesis have been reported [9, 35] . The antifungal iturinlipopeptide bacillomycin D is produced by several Bacillus strains[24, 28], but the corresponding gene sequences were until nowstill unknown . The model organism B . subtilis 168 contains twogenetic loci coding for large multifunctional peptide synthetases[srf and pps [16]] but does not produce any lipopeptide biosurfactant [20] due to a defect in 4'-phosphopantetheine transfer fromcoenzyme A onto peptidyl carrier proteins caused by a mutation in the sfp gene [23].

Comparison of the whole genome from an environmental strainable to synthesize a wide variety of antibacterial and antifungal metabolites to that of the laboratory model strain should allow identification of additional genetic elements involved in thecomplex network responsible for rhizosphere competence . We presenta preliminary comparison of the B . subtilis 168 genome to sample sequences of the genome of FZB42, primarily focused on biosynthesis of biologically active cyclic lipopeptides . Gene clusters involvedin surfactin, bacillomycin D, and fengycin synthesis were identifiedin the FZB42 genome . We found that bacillomycin D and fengycinact in a synergistic manner, enabling FZB42 to cope with competingorganisms within plant rhizosphere.

[The results of this study were presented in part at the Functional Genomics of Gram-Positive Microorganisms Meeting, 12th International Conference on Bacilli, 22 to 27 June, 2003, Baveno, Italy.]

 
Strains, plasmids, growth conditions. The strains and plasmids used in this study are listed in Table1 . Strains were cultivated routinely on Luria broth [LB] mediumsolidified with 1.5% agar . For biosurfactant production andMALDI-TOF-MS characterization, the bacteria were grown eitherin Landy medium [18] or sucrose-ammonium citrate medium [ACS][10] . To prepare surface cultures, the strains were grown inpetri dishes containing 1.5% Landy agar for 24 h at 37°Cand stored at room temperature prior to MALDI-TOF-MS analysis.Fermentation in liquid media was carried out in 500-ml flasksat 30°C and 180 rpm in a New Brunswick shaker [New BrunswickScientific Co., Edison, N.Y.] . The media and buffer used forDNA transformation of Bacillus cells were prepared accordingto the method of Kunst and Rapoport [15].

 
DNA transformation. Competent cells were prepared according to the method of Kunstand Rapoport [15], with slight modifications, as follows . FZB42cells were grown in 10 ml of glucose-casein hydrolysate-potassiumphosphate buffer [GCHE] medium under vigorous shaking [220 rpm]at 37°C until an optical density at 600 nm of 1.4 was reached.Then, 10 ml of GC medium without casein hydrolysate was added,and the culture was incubated under the same conditions for1 h . The cells were harvested, and the pellet was resuspendedin 1 ml of supernatant containing 0.5% glucose . Subsequently,100 ng of DNA was added to 0.2 ml of cell suspension and incubatedfor 20 min . Finally, the cells were cultivated in LB mediumwith inducing [sublethal] concentrations of the appropriate antibiotics for 90 min before they were plated on selective agar.

Sequencing strategy. The genome of B . amyloliquefaciens FZB42 was sequenced by usingthe random shotgun approach . Total genomic DNA was sheared randomlyor partially digested with Sau3AI, and DNA fragments 1 to 3kb in size were cloned into pTZ19R or pCR2.1 TOPO [Invitrogen]to establish a shotgun library . The inserts of the recombinantplasmids were sequenced from both ends by using MegaBACE DNASequencing Systems 1000 and 4000 [Amersham Biosciences] and ABI Prism 377 sequencers [Applied Biosystems] with dye terminator chemistry.

Approximately 39,500 sequences were processed with PHRED, assembled into contigs by using the PHRAP assembling tool [11], and editedwith GAP4, which is part of the STADEN package software [32]. The resulting contigs of B . amyloliquefaciens FZB42 were sorted by using the genome of B . subtilis 168 as a scaffold . PCR-based techniques and primer walking on recombinant plasmids were applied in order to close remaining sequence gaps.

MS analysis. For the detection of the lipopeptide products from whole cells,B . amyloliquefaciens FZB42 was grown on agar plates with theLandy medium . To record mass spectra, cell material was pickedfrom the agar plate, spotted onto the target, and covered withmatrix medium, i.e., a saturated solution of -cyanocinnamic acid in 40% acetonitrile-0.1% trifluoroacetic acid, air dried, and analyzed by MALDI-TOF-MS as previously described [20] . Alternatively,a small sample of the freeze-dried culture filtrate was extractedwith 70% acetonitrile-0.1% trifluoroacetic acid . The extractwas mixed 1:1 [vol/vol] in a vial with matrix medium . A 1-µl aliquot was spotted onto the target . The samples were air dried prior to MS measurement [36] . Postsource decay [PSD] mass spectrawere obtained with the same samples . Monoisotopic mass numberswere recorded.

SSH. Suppression subtractive hybridization [SSH] was performed essentiallyas described elsewhere [1, 8] . B . amyloliquefaciens FZB42 genomicDNA was used as the tester, and B . subtilis 168 was used asthe driver . The PCR-Select bacterial genome subtraction kit[Clontech Laboratories, Heidelberg, Germany] was used accordingto the manufacturer's instructions . Basically, genomic DNAsfrom the two strains were digested separately by RsaI, yieldingfragments of 100 to 1,000 bp . The tester DNA was subdividedinto two lots, each of which was ligated with a different adaptor.A large excess of driver DNA was then hybridized to each adaptor-ligatedtester lot, resulting mainly in hybridized double-stranded DNAenriched for tester DNA sequences . The two hybridized lots werethen mixed together without denaturating, allowing hybridizationof tester DNA with different adaptors on each end . The sampleswere then amplified by PCR primers Ssh1 and Ssh2 in order toenrich for tester-specific sequences . Finally, the subtractedDNAs were cloned into pGEM-T vector and sequenced . The followingadaptor-specific oligonucleotide primers were used: Ssh1 [5'-TCGAGCGGCCGCCCGGGCAGGT],Ssh2 [5'-AGCGTGGTCGCGGCCGAGGT], Adaptor 1 [5'- CTAATACGACTCACTATAGGGCTCGAGCGGCGCCCGGGCAGGTGGCCCGTCCA],Adaptor 2 [5'- CACTATAGGGCAGCGTGGTCGCGGCCGAGGTGCCGGCTCCA], Gem1 [5'-CCCGACGTCGCATGCTCCCG], and Gem 2 [5'-CCCATATGGTCGACCTGCAGGCG].

Construction of mutants deficient in lipopeptide synthesis. B . amyloliquefaciens FZB42 mutants were generated accordingto a modified protocol originally developed for B . subtilis168 [15] . The bmyA gene was disrupted by insertion of an erythromycin cassette . In detail, a 1.2-kb fragment was amplified by PCRby using the primers BmyAa [5'-AAAGCGGCTCAAGAAGCGAAACCC] andBmyab [5'- CGATTCAGCTCATCGACCAGGTAGGC] and cloned into vectorpGEM-T, generating pAK1 . The latter was digested with AvaI,which cuts in the middle of the PCR fragment . Simultaneously,pMX39 was digested with the same enzyme to obtain the erythromycincassette [1.5 kb], which was then ligated to pAK1, resultingin pAK2 . This was subsequently cut by ApaI, and the linearizedplasmid was transformed into the naturally competent B . amyloliquefaciensFZB42, where it was introduced into the genome via double-crossoverhomologous recombination [7] . The disruption of bmyA was demonstratedin the resistant colonies obtained by PCR with appropriate primersBmyAa and BmyaB and by Southern hybridization.

Gene disruption into the fenA gene was achieved by insertion of a chloramphenicol cassette . A PCR product of 1.4 kb, obtained with the primers FenAa [5'-AAGAGATTCAGTAAGTGGCCCATCCAG] and FenAb [5'-CGCCCTTTGGGAAGAGGTGC], was cloned into pGEM-T, resultingin pAK3 . The central 100-bp HindIII KpnI fragment was removed. Simultaneously, the chloramphenicol cassette was PCR amplified from plasmid pDG364 by using the primers Cm1KpnI [5'-TGAGGTACCATGTTTGACAGCTTATCATCGGC]and Cm2HindIII [5'-TATGCCAAGCTTTTCTTCAACTAACGGGGCAGG] . The cassettewas digested by HindIII/KpnI and ligated to pAK3, resulting in pAK4 . The latter was linearized by PstI and transformed into FZB42 . After selection of chloramphenicol-resistant colonies and confirmation of the desired insertion by PCR and Southern hybridization, the mutant AK2 was selected . To obtain a bacillomycin fengycin double mutant, the linearized plasmid pAK4 was transformed into the bmyA::Em^r mutant AK1 . The desired mutant genotype wasconfirmed by PCR with appropriate primers and by Southern hybridization.

The srfAA gene was disrupted by insertion mutagenesis with an erythromycin cassette derived from pMX39 as described above.A 2.3-kb PCR product from the srfAA gene region was amplified with the primers Srfkn-1 [5'-AGCCGTCCTGTCTGACGACG] and Srfkn-2 [5'-TCTGCTGCCATACCGCATAGTC] and inserted into a pGEM-T vector.After digestion with HindIII, the erythromycin cassette wasinserted into the 2.3-kb PCR fragment . The ApaI-linearized construct was transformed into competent B . amyloliquefaciens FZB42 cells. Chromosomal DNAs obtained from erythromycin-resistant colonies were proved for correct integration of the gene cassette byPCR with the primers Srfkn-1 and Srfkn-2 and by Southern hybridization.

Nucleotide sequence accession number. The nucleotide sequences of two contigs containing the surfactin,fengycin, and bacillomycin D operon of FZB42 have been depositedin the EMBL nucleotide sequence database under accession numbers AJ575417 and AJ575642.

 
Analysis of the sampled genome of B . amyloliquefaciens FZB42. We obtained 411 contigs by assembling the 39,850 sequence reads[5.76 x coverage] from our shot gun approach [see Materialsand Methods] . The total length of the nonredundant sequence formed by all contigs was 3,818 kb, which is slightly less than the size of the B . subtilis 168 genome of 4,214 kb [16] . Weidentified 2,980 genes [72.7%] on the FZB42 genome encoding proteins with more than 50% amino acid identity to B . subtilis 168 . However, 194 of these genes had been rearranged on the chromosome compared to B . subtilis 168 during divergent evolution of both genomes . A weak homology of between 30 and 50% was revealed for additional 174 FZB42 genes . A total of 970 B . subtilis genes, most of them without an assigned function, were not detectedin the FZB42 genome sample . Many of the missing genes were foundto be substituted for by genes not present in B . subtilis 168.Based on an analysis of FZB42 genomic macrorestriction digestseparated by pulsed-field gel electrophoresis [12], we conclude that our genome sample contained at least 90% of the whole FZB42 genome . Given this at least 20% of the B . subtilis genes are missing in B . amyloliquefaciens . The presence of orthologs of all genes involved in the development of competence in B . subtilis 168 in our genome sample indicated a high degree of completeness in our data collection [data not shown] . However, in light of the present state of sequencing, it cannot be ruled out thatsome genome parts that are not easily clonable are still missing.Large parts of the FZB42 genome, ca . 60 to 70%, were colinearwith B . subtilis 168 . However, regions with high structuralsimilarity are frequently interrupted by regions with a lowdegree of similarity or FZB42-specific regions [Fig . 1] . A preliminary analysis of these variable regions revealed that some of themare due to phage or prophage sequences distributed over theB . amyloliquefaciens genome . A similar result was recently reported for the B . licheniformis genome [19].

 
SSH. A rapid screening for genes without homology to B . subtilis168 was performed by SSH [8] . This method is a powerful toolfor the rapid identification of gene differences between closelyrelated bacterial strains [1] . Chromosomal DNA from B . amyloliquefaciensFZB42 [tester] and from B . subtilis 168 [driver] were digestedto fragments of between 100 and 1,000 bp . The majority of theclones obtained after subtraction did not hybridize with chromosomalDNA of B . subtilis 168 in subsequent Southern blot analyses.A total of 65 clones were selected for sequence analysis . Sequenceswere validated with the sampled genome of FZB42, and their putativefunction was deduced by basic local alignment search tool [BLAST]analysis . The results are presented in Table 2 . Homology totransposases was found in two clones . Four insertions with IS-likesequences were detected, and the positions of the respectivegenes on the FZB42 genome corresponded to the B . subtilis 168genome kilobase positions 2017, 2580, 3910, and 4066 . The sequencesdisplayed similarity to an IS231-type transposase from B . thuringiensis [IS sequence between proH and yxoD; P12249], to an IS1627-related transposase from B . anthracis [IS sequences between yqgG and yqgH and between yxeB and yxeA; NC_003980.1 [22]], and to aputative IS3-like transposase recently identified in B . licheniformis[IS sequence inserted in ywcH; AF459921.1 [18]] . B . subtilis168 does not contain transposases, and it is assumed that horizontalgene transfer is mainly achieved by bacteriophages . This isobviously not the case for B . amyloliquefaciens. Three SSH clonesharboring phage-like sequences were also detected in our library[Table 2].

 
Sequence analysis revealed that 9 of 65 SSH clones were similarto genes involved in synthesis of cyclic lipopeptides and polyketides. Two of them were assigned to the 37.2-kb gene cluster bmy in the sampled genome, displaying the highest degree of homologyto the iturin A operon of B . subtilis RB14 [35] . No similar sequences were detected in B . subtilis 168 . The other seven clones were assigned to three different gene clusters—pks1, pks2, and pks3—encoding modular type I polyketide synthases [PKS] . The B . subtilis 168 genome contains only one pks operon,which displays some similarity to the pks1 . In summary, thegenome of FZB42 contains three large gene clusters—pks2, pks3, and bmy—involved in polyketide and peptide synthesis, which are not present in the B . subtilis 168 genome.

Overall, the six FZB42 gene clusters involved in nonribosomal peptide and polyketide synthesis—bmy, fen, srf, pks1, pks2, and pks3—span more than 306 kb, representing ca. 7.5% of the total genome [Fig . 1] . This accentuates the potentialof FZB42 to produce an array of bioactive compounds by processesnot based on conventional translation.

MS identification of the lipopeptide products of B . amyloliquefaciens FZB42. In order to functionally characterize the gene clusters involvedin lipopeptide synthesis, the lipopeptide products of B . amyloliquefaciensFZB42 were investigated by MALDI-TOF-MS of culture filtrateextracts and of whole cells of this organism as described previously[20, 36] . The spectra obtained by both methods were found identicaland three groups of mass peaks were detected [Fig. 2A, B, and D].Their mass numbers are summarized in Table 3 . The lipopeptidespecies of ensembles 1 and 3 have been identified as surfactinsand fengycins by comparing their mass data with those previouslyobtained by MS analysis of the lipopeptide products of numerousB . subtilis strains [36]. B . amyloliquefaciens produces C₁₃to C₁₅ surfactins and fengycins with fatty acid side chainsof 15 to 17 carbon atoms . The known Ala/Val dimorphy in position6 of the fengycin isoforms [36] was confirmed, but we did not observe in FZB42 cultivated in Landy or ACS medium an Ala/Val dimorphy exchange as described for [Ala4]surfactin producedby B . subtilis cells grown in L-Ala-containing medium withoutsupplemented amino acids [29] . This pattern of lipopeptidescorresponds to the metabolite spectra found for most of thesurfactin- and fengycin-producing B . subtilis strains [20, 36].

 
The lipopeptide products of ensemble 2 were identified as bacillomycin D by evaluation of the fragment spectra obtained from PSD-MALDI-TOF-MS [36] . In the mass spectra obtained for whole cells and surfaceextracts the mass peaks of the sodium and potassium adducts dominate, whereas the protonated species always appeared with minor intensities . However, they are preferred for sequenceanalysis because they decompose into fragments more readilythan the alkali adducts . For example, the lipopeptide with amass number of m/z 1,031.5 produced by B . amyloliquefaciensFZB42 was identified as the protonated form of a bacillomycinD isoform with a fatty chain side chain of 14 carbon atoms.Its sequence [Fig . 3] was determined from series of b_n1-, Y_n"[-H₂O]-, and proline-directed b_n2 fragment ions . The peptide ring ofthis bacillomycin D was cleaved both at the peptide bond betweenits amino fatty acid residue and threonine at position 7 aswell as at the N terminus of proline-5 . In the first case series of b_n1 and Y_n"[-H₂O] fragment ions were detected . In addition,b_n2 ions of high intensity were observed . Based on all of thesedata, this lipopeptide was identified as the protonated formof a C14-bacillomycin D . The obtained sequence was corroboratedby b_n1 ions of dipeptide fragments at m/z values of 171.4, 212.3, 226.8, and 278.4, indicating nearest-neighbor relationshipsin the peptide ring of this lipopeptide for ES[-H₂O], NP, PE,and NY, respectively.

 
Appearance of lipopeptides during growth of FZB42. The appearance of lipopeptide species during growth in liquidculture [ACS medium] was followed by MALDI-TOF-MS [Table 4]. Since MALDI-TOF-MS is not suitable for determining the exact concentration of the lipopeptide products of B . amyloliquefaciens, mainly because of inhomogeneities in the analytical distribution in the crystalline matrix and different ionization efficiencies of the investigated compounds, the ratio of the different species using intensity values can be estimated . Surfactins and bacillomycins were present at similar intensities but peaked in differentstages of growth . Whereas maximum levels of surfactin appearedin samples obtained after 10 to 40 h of growth and dropped after60 h, bacillomycin D lipopeptide species displayed maximum intensityafter 40 and 60 h of culture . The time course of fengycin production resembled that of surfactin, but its intensity level was clearlyless than in both other lipopeptides.

 
Presence and organization of nonribosomal peptide synthetases [NRPS] and PKS gene clusters on the FZB42 chromosome. The FZB42 genome contained operons srf, fen, and bmy, whichare responsible for the synthesis of the three lipopeptide typessurfactin, fengycin, and bacillomycin D, respectively, and threelarge gene clusters involved in synthesis of hitherto-unidentifiedpolyketides [pks1, pks2, and pks3] . The sequences of all sixgene clusters are completely available in the FZB42 sample sequence.Three of the six gene clusters [bmy, pks2, and pks3] are FZB42-specific DNA islands . The fengycin and bacillomycin D operons are close to each other on the chromosome [Fig . 4] . Regions flanking the large gene clusters are characterized by DNA rearrangements joining the antibiotic DNA islands with sequences originallypresent in different regions of the Bacillus chromosome . Interestingly, the 37.2-kb bmy gene cluster was inserted, together with two rearranged gene clusters yxjCDEF, located at kilobase position 4000000, and bioIBDFAW, located at kilobase positions 3088278 to 3094507 in B . subtilis 168, at the same position [kilobase position 1943 according to B . subtilis 168] as the iturin A gene cluster in B . subtilis RB14 [Fig . 4] . Many DNA rearrangementswere detected left from the bmy insertion site in which theDNA regions located in B . subtilis 168 at kilobase positions1910 to 1943 [yndG, bglC, ynfJ, and xynD] are shuffled withsequences occurring in B . subtilis 168 at kilobase positions3405 to 3407 [yvrGH], 1303 to 1306 [yjmD, uxuA, and exuT], and2322 to 2323 [kdgKA], indicating high variability within thisarea [a 122,883-bp sequence under GenBank accession number AJ575417].

 
The fen locus in FZB42 was related to the pps operon in B . subtilis168 and corresponded to the region from kb 1959 to 1998 kb,which was about 25 kb distant from the bmy gene cluster [Fig.4] . The pps gene cluster encodes a peptide-forming multienzymesystem [16] . Because of its similarity to the fen gene clusterof the fengycin producer B . subtilis F29-3 [6], the pps operon was assigned to fengycin biosynthesis, although B . subtilis does not produce this lipopeptide . A five-gene cluster [fen1 to fen5] homologous to the fen and pps operons was also detectedin the B . subtilis A1/3 genome [34] . Interestingly, in the genomeof B . subtilis ATCC 6633, the mycosubtilin biosynthesis genecluster devoted to synthesis of an iturin-like compound, isfound in exactly the same location [9] [Fig . 4], suggestingthat additional NRPS operons could be integrated in differentways in this area either as an insertion or as a substitutionof existing NRPS operons.

The 41,884-bp sequence AJ575642 present in our genome sample contained the srfA operon of FZB42 . The 26.5-kb surfactin region is located between kb 376 and 402 of the B . subtilis 168 chromosome and is flanked by sequences partially conserved in both bacilli. The srf genes exhibited between 72% [srfAA] and 83% [srfAC] identity on an amino acid level to the respective B . subtilis 168 genes . As in B . subtilis 168, the comS gene, encoding a competence signal molecule, is embedded within the srfAB sequence. On the right flank of the srfA gene cluster, the B . subtilis 168 ycxAB genes were substituted by two open reading frames [ORFs] with unknown function . The sfp gene, located 4 kb downstream of the srfA operon, is essential for the production of surfactin. Sfp is a 4'-phosphopantetheinyl transferase that functions asa primer of nonribosomal peptide synthesis via phosphopantetheinylation of thiotemplates [23] . The amino acid homology of sfp-FZB42 to the B . subtilis 168 sfp gene was 70%.

Disruption of bmyA, fenA, and srfA genes yielded a lipopeptide-deficient phenotype. To confirm that the bmy, fen, and srf gene cluster is directingbacillomycin D, fengycin, and surfactin biosynthesis, we disruptedthe bmyA, fenA, and srfA genes by cassette mutagenesis taking advantage of the natural competence of FZB42 [see Materialsand Methods] . PCR control by using primers flanking the expected integration sites and Southern hybridization confirmed correct insertion of the antibiotic cassettes within the target gene sequences [data not shown] . Analysis of the mutant strains by MALDI-TOF-MS confirmed that strain bmyA::Em^r was deficient inbacillomycin D production, that strain fenA::Cm^r was deficientin fengycin production, and that the double mutant bmyA::Em^r fenA::Cm^r failed to produce both lipopeptides . Disruption ofthe srfA gene in mutant srfA::Em^r lead to inability to producesurfactin [Fig . 2C, E, and F] . Based on these results, we concludedthat the gene clusters are responsible for biosynthesis of therespective lipopeptides in FZB42.

Analysis of functional domains in the bmy operon. The assembly of the multifunctional proteins of the peptidesynthetases involved in surfactin, fengycin, mycosubtilin, iturinA, or bacillomycin D biosynthesis is reflected in its geneticorganization following the colinearity rule [9, 35] . The firstORF of the bmy operon, bmyD, encodes a putative malonyl coenzymeA transacylase, similar to FabD, which participates in fattyacid synthesis . BmyD is nearly identical to FenF of B . subtilisATCC 6633 and B . subtilis RB14 . It has been shown that thisenzyme is indispensable for iturin production [35] . The ORFsencoding BmyA [3,982 amino acids], BmyB [5,633 amino acids], and BmyC [2,619 amino acids] are organized like their respective counterparts in the iturin A and mycosubtilin operons . They showed strong sequence similarity with these components andconsist of an ordered arrangement of domains involved in condensation, adenylation, and thiolation [Fig . 5] . Seven amino acid-activatingmodules can be distinguished: A1, located in BmyA; BmyB1, BmyB2,BmyB3, and BmyB4, located in BmyB; and C1 and C2, located inBmyC . The modules B1, B2, and C1 also contain epimerizationdomains, directing conversion of amino acids 2, 3, and 6 ina D-configuration . The last domain of this multienzyme systemis a thioesterase domain, which is presumably required for releaseand circularization of the synthesized lipopeptide molecule.This structure is identical to the one described for iturinA and mycosubtilin biosynthesis operons [9, 35] in B . subtilisisolates, Therefore, biosynthesis of bacillomycin D also followsthe multiple carrier thiotemplate mechanism of nonribosomalsynthesis, as first proposed for gramicidin S [17, 33] and meanwhile specified for nonribosomal biosynthesis of many bioactive lipopeptides [4, 13] including mycosubtilin [9] . The adenylation domainsresponsible for activation of the amino acid chosen to be linkedwith the nascent peptide moiety play an important role in thisprocess . Sequence comparison of bacillomycin D with the otheriturins shows that sequence variations begin with amino acid 4, although iturin A and mycosubtilin proteins differ only bya reversion at position 6 and 7 [9] . We found that adenylation domains within the first three modules of the bacillomycin D operon showed >97% amino acid identity to the iturin A operon[Table 5] . Homology to the respective domains in the mycosubtilin operon was less pronounced but still >70% . However, homologies were less pronounced for the adenylation domains responsiblefor activation of the amino acids 4 to 7, a finding that correspondsto the variability in the sequence order of the synthesizedpeptide . The best homology among the last four adenylation domainswas obtained between Bmy_C1, the putative Ser_6-activating domain,and the corresponding domain of the mycosubtilin operon, whichalso activates Ser in position 6 . The other adenylation domainspossibly involved in activating amino acids Pro-4, Glu-5, andThr-7, which are unique for bacillomycin D, displayed less homology[Table 5] . Prediction of adenylation domain specificity determiningresidues revealed that Pro-4, Glu-5, Ser-6, and Thr-7 are activatedby the adenylation domains in modules B3, B4, C1, and C2, respectively. These domains contained the corresponding selectivity determining amino acids [Table 5].

 
Biological activity of wild-type and mutant strains. B . amyloliquefaciens FZB42 is able to inhibit growth of phytopathogenic fungi such as Fusarium oxysporum . The mutants deficient in productionof bacillomycin D [bmyA] and fengycin [fenA] were affected differentlyin their biocontrol capacity . Although the bacillomycin D producerstrain fenA suppressed growth of F . oxysporum in a manner similarto that of the wild type, strain bmyA was less efficient infungus growth inhibition, suggesting that bacillomycin D iscontributing to the antifungal activity of B . amyloliquefaciensFZB42 . In contrast, abolishing surfactin synthesis in the srfA mutant did not affect the capacity of FZB42 to suppress fungal growth [Fig . 6A] . Surprisingly, the bmyA fenA double mutantdid not repress F . oxysporum grown on Waksman agar [Fig . 6B],indicating a synergistic action of both antibiotics againstthe target microorganism, a phenomenon until now only describedfor secondary metabolites produced by actinomycetes . The effecthas been interpreted as an adaptation evolved due to the "sessile"lifestyle of the production organism in order to compete withother microorganisms [5] . Due to low concentration of fengycincompared to bacillomycin D [Table 4], the observed synergisticaction of both antifungal iturin-like compounds that producedhere by a motile soil bacterium is unexpected.

 
Here we present evidence for two adjacent gene clusters directing biosynthesis of the synergistically acting but chemically different lipopeptides, fengycin and bacillomycin D in FZB42, suggestingthat this phenomenon might also occur in motile bacteria, suchas bacilli.

The ability of the bmyA::Em^r fenA::Cm^r mutant to suppress thegrowth of F . oxysporum was restored by the addition 10 µgof bacillomycin D/ml, purified from B . amyloliquefaciens DSM10273 [kindly provided by FZB Biotech, Berlin, Germany [resultsnot shown]] . The inhibitory activity of FZB42 against Streptomycesspp . was not impaired in the mutant strains [Fig . 6C], suggestingthat antibiotics different from the nonribosomal lipopeptidesanalyzed in the present study are important for the antibacterialactivity of FZB42.

Conclusions. By combining whole-genome sampling and SSH, we were able tocharacterize the genetic capacity of rhizobacterium B . amyloliquefaciensFZB42 to deal with competing soil microorganisms . Genetic differencesbetween the model B . subtilis 168, cultivated in the laboratoryfor decades, and the related environmental B . amyloliquefaciensstrain, recently isolated from the rhizosphere [14], were detectedby SSH . The results obtained by SSH were subsequently validatedby comparison of the B . subtilis genome with the sampled genomeof B . amyloliquefaciens FZB42 . Both strains share a common genomic scaffold that is interrupted by variable regions due to numerous events of rearrangements, deletions, substitutions, and insertions during the divergent evolution of both genomes . In contrastto B . subtilis 168, the genome of FZB42 contained several transposases belonging to IS structures previously described in other bacilli[19, 22] . In addition to the phages, the IS elements present in B . amyloliquefaciens FZB42 may also be involved in events of horizontal gene transfer.

The most striking property of the genome of FZB42 is that a significant part of the genome [7.5%, 306 kb, organized in sixoperons] is devoted to the biosynthesis of polyketides and peptides,enabling this bacterium to cope with competing organisms withinthe plant rhizosphere . Two gene clusters encoding PKS and onelarge gene cluster involved in nonribosomal peptide synthesis[bmy] have been identified . The impressive genetic capacityof environmental FZB42 for the production of secondary metabolites,such as lipopeptides and polyketides, exceeds twice that ofthe laboratory model organisms B . subtilis 168 [37] and Streptomycescoelicolor [4] and has been until now comparable only to Streptomycesavermitilis, which is well known for its production of a widerange of secondary metabolites and in which 6.4% of the entiregenome is devoted to the production of secondary metabolites[27].

Strain FZB42 is naturally competent for DNA uptake and homologous recombination ideally suitable for genetic approaches in analyzing its metabolic capacity e.g., by targeted construction of mutants impaired in the synthesis of cyclic lipopeptides . Here we demonstrated that disruption of one of the bmy, fen, and srf genes preventedproduction of the respective lipopeptides, providing evidencethat these gene clusters are involved in their biosynthesis. A double mutant that was unable to produce bacillomycin D and fengycin retained its antibacterial activity directed against Streptomyces spp . but did not develop antifungal activity, suggesting that both lipopeptides might act synergistically in order to intensify suppression of fungal growth . A phenomenon until nowonly described in actinomycetes . Microcosm experiments withwild-type and mutant strains are necessary to clarify role ofthe cyclic lipopeptides in biocontrol function within plantrhizosphere.

The present study characterized the production of the threecyclic lipopeptides surfactin, fengycin, and bacillomycin Dby B . amyloliquefaciens FZB42 . The sequence obtained for thefirst time for a gene cluster involved in bacillomycin D biosynthesisreflects perfectly colinearity in nonribosomal PKS domain orderand its peptide synthesis function . Adenylation domains specifyingamino acids different from other iturin-like peptides displayeda high degree of variability, but their functional amino acidslining the substrate binding pocket matched perfectly with theknown selectivity code of the respective amino acids compiledfor NRPS [4, 31] . The description of the putative polyketide products directed by the three gene clusters pks1, pks2, and pks3 awaits further investigation.

 
This study was done within the GenoMik program of the BMBF,the German ministry for education and research.

We thank the Göttingen Genomics Laboratory and especiallyG . Gottschalk for continuous support of this project . We arevery grateful to M . Meixner, B . Krebs, and B . Hoeding from FZBBerlin for advice and support in performing the SSH experimentsand biological activity tests . We are indebted to Nicolas Grammeland Ariane Zwintscher of the ActinoDrug GmbH for the intensivecooperation in MALDI-TOF-MS analysis . We also thank SteffenPorwollik, San Diego, Calif., and the unknown referees for improvingthe manuscript by many corrections and suggestions.

 
* Corresponding author . Mailing address: Institute of Biology, Humboldt University, Chaussee-Strasse 117, D-10115 Berlin, Germany . Phone: 49-30-2093-8137 . Fax: 49-30-2093-8127 . E-mail: rainer.borriss@rz.hu-berlin.de.

1. Akopyants, N . S., A . Fradkov, L . Diatchenko, J . E . Hill, P . D . Siebert, S . A . Lukyanov, E . D . Sverdlov, and D . E . Berg. 1998 . PCR-based subtractive hybridization and differences in gene content among strains of Helicobacter pylori. Proc . Natl . Acad . Sci . USA 95:13108-13113 .
2. Asaka, O., and M . Shoda. 1996 . Biocontrol of Rhizoctonia solani damping-off of tomato with Bacillus subtilis RB14 . Appl . Environ . Microbiol . 62:4081-4085.
3. Ceglowski, P., and J . C . Alonso. 1994 . Gene organization of the Streptococcus pyogenes plasmid pDB101: sequence analysis of the ORF eta-copS region . Gene 145:33-39.
4. Challis, G . L., J . Ravel, and C . A . Townsend. 2000 . Predictive, structure-based model of amino acid recognition by nonribosomal peptide synthetase adenylation domains . Chem . Biol . 7:211-224.
5. Challis, G . L., and D . A . Hopwood. 2003 . Synergy and contingency as driving forces for the evolution of multiple secondary metabolite production by Streptomyces species . Proc . Natl . Acad . Sci . USA 100[Suppl . 2]:14555-14561 .
6. Chen, C.-L., L.-K . Chang, Y.-S . Chang, S.-T . Liu, and J . S.-M . Tschen. 1995 . Transposon mutagenesis and cloning of the genes encoding the enzymes of fengycin biosynthesis in Bacillus subtilis. Mol . Gen . Genet . 248:121-125.
7. Cutting, S . M., and P . B . van der Horn. 1990 . Genetic analysis, p . 27-74 . In C . R . Harwood and S . M . Cutting [ed.], Molecular biological methods for Bacillus . Wiley Interscience, Chichester, United Kingdom.
8. Diatchenko, L., Y.-F . Ch . Lau, A . P . Campbell, A . Chenchik, F . Moqadam, B . Huang, S . Lukyanov, K . Lukyanov, N . Gurskaya, E . D . Sverdlov, and P . D . Siebert. 1996 . Suppression subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes and libraries . Proc . Natl . Acad . Sci . USA 93:6025-6030 .
9. Duitman, E . H., L . W . Hamoen, M . Rembold, G . Venema, H . Seitz, W . Saenger, F . Bernhard, R . Reinhardt, M . Schmidt, C . Ulrich, T . Stein, F . Leenders, and J . Vater. 1999 . The mycosubtilin synthetase of Bacillus subtilis ATCC 6633: a multifunctional hybrid between a peptide synthetase, an amino transferase, and a fatty acid synthase . Proc . Natl . Acad . Sci . USA 96:13294-13299 .
10. Ebata, M., K . Miyazaki, and Y . Takahashi. 1969 . Studies on subsporin . I . Isolation and characterization of subsporins A, B, and C . J . Antibiot . 22:467-472.
11. Ewing, B., L . Hillier, and P . Green. 1998 . Base-calling of automated sequencer traces using phred . 1 . Accuracy assessment . Genome Res. 8:175-185 .
12. Idriss, E . S . E., O . Makarewicz, A . Farouk, K . Rosner, R . Greiner, H . Bochow, T . Richter, and R . Borriss. 2002 . Extracellular phytase activity of Bacillus amyloliquefaciens FZB45 contributes to its plant-growth-promoting effect . Microbiology 148:2097-2109 .
13. Kallow, W., M . Pavela-Vrancic, R . Dieckmann, and H . von Döhren. 2002 . Nonribosomal peptide synthetases: evidence for a second ATP binding site . Biochim . Biophys . Acta 1601:93-99.
14. Krebs, B., B . Höding, S . M . Kübart, A . Workie, H . Junge, G . Schmiedeknecht, P . Grosch, H . Bochow, and M . Heves. 1998 . Use of Bacillus subtilis as biocontrol agent . 1 . Activities and characterization of Bacillus subtilis strains . J . Plant Dis . Prot . 105:181-197.
15. Kunst, F., and G . Rapoport. 1995 . Salt stress is an environmental signal affecting degradative enzyme synthesis in Bacillus subtilis. J . Bacteriol . 177:2403-2407.
16. Kunst, F., N . Ogasawara, I . Moszer, et al. 1997 . The complete genome sequence of the gram-positive bacterium Bacillus subtilis. Nature 390:249-256.
17. Laland, S . G., and T . L . Zimmer. 1973 . The protein thiotemplate mechanism of synthesis for the peptide antibiotics produced by Bacillus brevis. Essays Biochem . 9:31-57.
18. Landy, M., G . H . Warren, S . B . Roseman, and L . G . Colio. 1948 . Bacillomycin, an antibiotic from Bacillus subtilis active against pathogenic fungi . Proc . Soc . Exp . Biol . Med . 67:539-541.
19. Lapidus, A., N . Galleron, J . T . Andersen, P . L . Jorgensen, S . D . Ehrlich, and A . Sorokin. 2002 . Co-linear scaffold of the Bacillus licheniformis and Bacillus subtilis genomes and its use to compare their competence genes . FEMS Microbiol . Lett . 209:23-30.
20. Leenders, F., T . H . Stein, B . Kablitz, P . Franke, and J . Vater. 1999 . Rapid typing of Bacillus subtilis strains by their secondary metabolites using matrix-assisted laser desorption/ionisation mass spectrometry of intact cells . Rapid Commun . Mass Spectrom . 13:943-949.
21. Maget-Dana, R., and F . Peypoux. 1994 . Iturins, a special class of pore-forming lipopeptides: biological and physicochemical properties . Toxicology 87:151-174.
22. Mahillon, J., R . Rezsohazy, B . Hallet, and J . Delcour. 1994 . IS231 and other Bacillus thuringiensis transposable elements: a review . Genetica 93:13-26.
23. Mootz, H . D., R . Finking, and M . Marahiel. 2001 . 4'-Phosphopantetheine transfer in primary and secondary metabolism of Bacillus subtilis. J . Biol . Chem . 276:37289-37298 .
24. Moyne, A.-L., R . Shelby, T . E . Cleveland, and S . Tuzun. 2001 . Bacillomycin D: an iturin with antifungal activity against Aspergillus flavus. J . Appl . Microbiol . 90:622-629.
25. Nielsen, T . H., and J . Sorensen. 2003 . Production of cyclic lipopeptides by Pseudomonas fluorescens strains in bulk soil and in the sugar beet rhizosphere . Appl . Environ . Microbiol . 69:861-868 .
26. Nishikori, T., H . Naganawa, Y . Muraoka, T . Aoyagi, and H . Umezawa. 1986 . Plipastatins; new inhibitors of phospholipase A2, produced by Bacillus cereus BMG302-fF67 . III . Structural elucidation of plipastatins . J . Antibiot . 39:755-761.
27. Omura, S., H . Ikeda, J . Ishikawa, A . Hanamoto, C . Takahashi, M . Shinose, Y . Takahashi, H . Horikawa, H . Nakazawa, T . Osonoe, H . Kikuchi, T . Shiba, Y . Sakaki, and M . Hattori. 2001 . Genome sequence of an industrial microorganism Streptomyces avermitilis: deducing the ability of producing secondary metabolites . Proc . Natl . Acad . Sci . USA 98:12215-12220 .
28. Peypoux, F., M . T . Pommier, B . C . Das, F . Besson, L . Delcambe, and G . Michel. 1984 . Structures of bacillomycin D and bacillomycin L peptidolipide antibiotics from Bacillus subtilis. J . Antibiot . 37:1600-1604.
29. Peypoux, F., J . M . Bonmatin, H . Labbe, I . Grangemard, B . C . Das, M . Ptak, J . Wallach, and G . Michel. 1994 . [Ala4]surfactin, a novel isoform from Bacillus subtilis studied by mass and NMR spectroscopies . Eur . J . Biochem . 224:89-96.
30. Peypoux, F., J . M . Bonmatin, and J . Wallach. 1999 . Recent trends in the biochemistry of surfactin . Appl . Microbiol . Biotechnol. 51:553-563.
31. Stachelhaus, T., H . D . Mootz, and M . A . Marahiel. 1999 . The specificity-conferring code of adenylation domains in nonribosomal peptide synthetases . Chem . Biol . 6:493-505.
32. Staden, R., K . F . Beal, and J . K . Bonfield. 2000 . The Staden package, 1998 . Methods Mol . Biol . 132:115-130.
33. Stein, T., J . Vater, V . Krufts, A . Otto, B . Wittmann-Liebold, P . Franke, M . Panico, R . McDowell, and H . R . Morriss. 1996 . The multiple carrier model of nonribosomal peptide biosynthesis at modular multienzymatic templates . J . Biol . Chem . 271:15428-15435 .
34. Steller, S., D . Vollenbroich, F . Leenders, T . Stein, B . Conrad, J . Hofemeister, P . Jacques, P . Thonaert, and J . Vater. 1999 . Structural and functional organization of the fengycin synthetase multienzyme system from Bacillus subtilis b213 and A1/3 . Chem . Biol . 6:31-41.
35. Tsuge, T., T . Akiyama, and M . Shoda. 2001 . Cloning, sequencing, and characterization of the iturin A operon . J . Bacteriol . 183:6265-6273 .
36. Vater, J., B . Kablitz, C . Wilde, P . Franke, N . Mehta, and S . S . Cameotra. 2002 . Matrix assisted laser desorption ionization-time of flight mass spectrometry of lipopeptide biosurfactants in whole cells and culture filtrates of Bacillus subtilis C-1 isolated from petroleum sludge . Appl . Environ . Microbiol . 68:6210-6219 .
37. Wipat, A., and C . R . Harwood. 1999 . The Bacillus subtilis genome sequence: the molecular blueprint of a soil bacterium . FEMS Microbiol . Ecol . 28:1-9.

Free Online Full-text Article

What Is Botulism?, What Is Functional Genomics?, What Is Staphylococcus Aureus?, What is Food Microbiology?, What Is Pcr?, s, Bacterium, e, Bacteria, c, Microorganisms, o, Bacteriology, r, Microbes, e, Antibiotic prophylaxis, o, Yeasts, s, Beta lactamase, i, Escherichia coli, o, Prokaryotes, a, S. cerevisiae, s, Neisseria, i, Antibiotic resistance, i, Vibriosis, c, Microorganisms, n, Minimal inhibiting concentration, o, Microorganism, a, Micrococci, i, Water treatment, s, Bacillus, n, Neisseria, r, Staphylococcus aureus, e, Cell cultures, i, Bacillus anthracis, a, S. cerevisiae, r, Microbiological




 

© 2005 Transgalactic Ltd (manufacturer of Bioscreen C software) | Privacy Statement | P.O. Box 1393, 00101 Helsinki, Finland, phone: +358 9 85172920, fax: +358 9 8749481, e-mail: microbiology@bionewsonline.com
 

Last modified: May 25, 2005