|
|
|
J Gen Microbiol, 1988 Mar, 134 ( Pt 3), 763 - 9 Construction of cys:lac gene fusions in Escherichia coli and their use in the isolation of constitutive cysBc mutants; Hryniewicz M et al.; Operon fusions of the lacZ gene to two different genes of the cysteine regulon controlled by the cysB regulatory protein were isolated . The fusion strains were used for selection of cysB constitutive mutants . Three cysBc alleles have been characterized and cloned into multicopy plasmids. J Gen Microbiol, 1988 Mar, 134 ( Pt 3), 599 - 604 Accumulation of LamB-LacZ hybrid proteins in intracytoplasmic membrane-like structures in Escherichia coli K12; Voorhout W et al.; The subcellular location of LamB-LacZ hybrid proteins in the Escherichia coli K12 strains pop3234 and pop3299 was investigated by immunocytochemical detection and protease-accessibility experiments . Induction of the synthesis of the hybrid proteins resulted in the appearance of membrane-like structures within the cytoplasm of the cells . Labelling of ultrathin cryosections of the cells with anti-beta-galactosidase or anti-LamB protein serum and protein-A-gold complexes revealed that the hybrid proteins were associated with these membrane-like structures or accumulated within the cytoplasm . Protease-accessibility experiments confirmed this localization . Moreover, when low quantities of hybrid proteins were produced, i.e . in uninduced pop3234 cells or in induced pop3299 cells, the hybrid proteins were accessible to trypsin from the periplasmic side of the inner membrane, leaving protected fragments with an apparent Mr of 83,000 . Apparently, these hybrid proteins are partly translocated through the inner membrane, resulting in membrane-spanning forms of the proteins. Plasmid, 1988 Mar, 19(2), 94 - 102 Vectors for expression of truncated coding sequences in Escherichia coli; Simon MN et al.; We describe the construction of vectors for expressing in Escherichia coli DNA fragments obtained by progressive deletions of DNA inserts in single-stranded sequencing vectors as M13 or pTZ according to the methode of Dale et al . (Plasmid 1985, 13, 31-40) . These vectors, pIMS1, pIMS5, and pIMS6, harbor all of the elements required for the regulated expression of any open reading frame flanked by EcoRI restriction sites . The encoded peptides contain only a few vector-derived amino acids . A method is described for direct selection of recombinant clones by in situ RNA hybridization . The properties of the expression vector have been analyzed with a DNA deletion series obtained from the cDNA coding for the regulatory subunit of Dictyostelium discoideum cAMP-dependent protein kinase. Plasmid, 1988 Mar, 19(2), 121 - 33 A single amino acid difference between Rep proteins of P1 and P7 affects plasmid copy number; Froehlich BJ et al.; P1 and P7 are closely related plasmid prophages which are members of the same incompatibility group . We report the complete DNA sequence of the replication region of P7 and compare it to that of P1 . The sequence predicts a single amino acid difference between the RepA proteins of these two plasmids, no differences in methylation sites or regions where dnaA protein is expected to bind, and no difference in the spacing of the major features of the two replicons . A P1 replicon with a mutation in repA, the gene that encodes an essential replication protein, is complemented for replication by providing either the P1 RepA protein (RepA1) or the P7 RepA protein (RepA7) in trans . Furthermore, when either of these proteins is supplied in trans, the plasmid copy number of P1 cop mutants drops to that of P1 cop+ . However, when RepA7 is supplied, the copy number of P1 cop and P1 cop+ is higher than that when RepA1 is supplied . This indicates that the single amino acid difference between the two versions of the RepA protein plays an important role in determining the plasmid copy number. Mikrobiologiia, 1988 Mar-Apr, 57(2), 347 - 51 {A rapid method for determining the viability of Escherichia coli cells subjected to the action of low temperatures}; Govorunov IG et al.; When Escherichia coli cells are frozen at a low temperature, various damages appear in them, in particular, in the membranous apparatus . Only stable disorders in the barrier properties of the cytoplasmic membranes are of a critical importance for the cell viability . These disorders should be taken into account when express methods are developed for assaying the viability of bacterial cells . Critical structures (properties) are to be revealed by their analysis after varying the intensity (dose) of the main damaging factors . Provided that the critical feature of each cell has two states (damaged and intact) after the action of extreme factors, its quantitative change correlates in a linear mode with the number of viable cells in the population. Mol Gen Mikrobiol Virusol, 1988 Mar, (3), 43 - 8 {Effect of phospholipase on cation-induced transmembrane transport of DNA in Escherichia coli}; Sabel'nikov AG et al.; Incubation of bacterial cells in 0.1 M CaCl2 at 0 degrees C considerably increases the amount of phospholipids susceptible to action of a specific enzyme of phospholipid metabolism phospholipase C (hydrolysis to diacylglycerides) . In process of incubation in CaCl2 solutions at 0 degrees C the expressed activity of an endogenous enzyme phospholipase A has been registered in cellular samples . Binding of the enzyme by the cells under conditions unfavourable for phospholipids hydrolysis (0 degrees C) suppresses strongly and reversibly cellular ability to DNA transformation without affecting cellular survival . As calculated, the enzyme molecules cover about 10% of cellular surface while inhibiting 90% of transmembrane transfer . The obtained data are considered to be a solid argument supporting the important role of the membrane phospholipids in the mechanism of cation-induced DNA transfer into the cell. EMBO J, 1988 Mar, 7(3), 835 - 41 DNA-binding properties of an adenovirus 289R E1A protein; Chatterjee PK et al.; An adenovirus 2 289 amino acid (289R) E1A protein purified from Escherichia coli has been shown to interact with DNA by two independent methods . UV-crosslinking of complexes containing unmodified, uniformly 32P-labelled DNA and purified E1A protein induced efficient labelling of the protein with covalently attached oligonucleotides, indicating that the E1A protein itself contacts DNA . Discrete nucleoprotein species were also observed when E1A protein--DNA complexes were analysed by gel electrophoresis . Although the 289R E1A protein exhibited no significant binding to single-stranded DNA or to RNA, no evidence for its sequence-specific binding to double-stranded DNA was obtained with either assay . Identification of the sites of covalent attachment of 32P-labelled oligonucleotides by partial proteolysis of the crosslinked E1A protein indicated that the interaction of this protein with DNA is mediated via domain(s) in the C-terminal half of the protein . Such previously unrecognized DNA-binding activity is likely to contribute to the regulatory activities of this important adenoviral protein. Virology, 1988 Mar, 163(1), 93 - 103 Functional and antigenic domains of the dengue-2 virus nonstructural glycoprotein NS-1; Putnak JR et al.; The gene coding for the nonstructural glycoprotein of dengue-2 virus was cloned, sequenced, and expressed in Escherichia coli . There was about 70% conservation at the amino acid level with dengue serotypes 1 and 4 suggesting an important common function for this protein . Conserved hydrophobic domains were found both before the amino-terminus and at the carboxy-terminus, consistent with transmembrane roles . Evidence for at least partial translocation of NS-1 through the inner membrane of E . coli was found . Also conserved were two signals for N-linked glycosylation located near the middle of NS-1 . Various regions of NS-1 were tested for antigenicity with mouse and rabbit polyclonal and mouse monoclonal antibodies . The mouse polyclonal antibodies, made against a crude dengue-infected mouse brain immunogen, reacted most strongly with N-terminal regions of NS-1, whereas, the rabbit antiserum, made against purified NS-1 protein, reacted strongest with C-terminal regions . These findings suggest that immunogen presentation or species differences could be important . Although most of the monoclonals appeared to be unreactive in Western blots with expressed NS-1 proteins, two appeared to react strongly; the region from amino acid (a.a.) 273 to a.a . 346 was required for antibody binding . This region, located adjacent to the two conserved C-terminal hydrophobic domains, is highly charged and contains 5 of the 10 conserved cysteine residues of NS-1. Microb Pathog, 1988 Mar, 4(3), 231 - 8 Investigation of minor components of Escherichia coli type 1 fimbriae: protein chemical and immunological aspects; Krogfelt KA et al.; Three minor components of type 1 fimbriae, FimF, FimG and FimH have been characterized . These proteins are integrated in the fimbrial structure; are responsible for the adhesive properties of the fimbriae but are not necessary for the production of fimbriae . Fimbriae were purified from different clones harbouring various combinations of the fimF, fimG and fimH genes in addition to the fimA gene . The FimF, FimG and FimH proteins were identified by two dimentional gel electrophoresis . They were found to have molecular weights of 18.0 kDa, 17.0 kDa and 30 kDa, respectively . The ratio of FimF, FimG and FimH components to the major subunit was less than 1:100 . The fimH protein especially was present in very small quantities . Sera raised against fimbriae from two of the clones (HB101/pPKL5 and HB101/pPKL4) were found by immunoblotting to be specific respectively for the major structural protein only (FimA), and for all components. Mol Cell Probes, 1988 Mar, 2(1), 39 - 46 Synthesis of proteins in Escherichia coli immunoreactive with sera from individuals infected with human T-cell leukemia virus type I; Kitajima T et al.; The env-pX IV fused gene of human T-cell leukemia virus type I (HTLV-I) was inserted into lac promoter-directed expression vectors for production of viral proteins in bacteria . Resulting recombinant plasmids, pK13 and pK15, directed synthesis of fused proteins of 59 kDa (Env-p40x) and 100 kDa (Gag-Env-p40x), respectively . Western blot analysis showed that these proteins were reactive with sera of patients with adult T-cell leukemia (ATL) and retained multiple antigenic determinants of viral proteins . In combination with recombinant Gag protein {S . Itamura, K . Shigesada, M . Imai, N . Kobayashi, T . Hamakado, T . Harada and M . Hatanaka, Gene 38, 57-64 (1985)}, these bacterially synthesized proteins may provide a useful tool for differential diagnosis of ATL by detecting serum antibodies against individual viral proteins and for analysis of viral gene functions. Mol Microbiol, 1988 Mar, 2(2), 255 - 63 Uropathogenic Escherichia coli can express serologically identical pili of different receptor binding specificities; Lund B et al.; Uropathogenic Escherichia coli frequently express P-pilus adhesins that recognize Gal alpha (1-4)Gal-containing glycoconjugates . The P-pilus adhesin of the E . coli isolate J96 is encoded by the pap gene cluster and has been shown to agglutinate P1-erythrocytes . We now describe a novel gene cluster from J96, prs, which is responsible for the agglutination of sheep erythrocytes . The structurally related gene clusters both expressed pili exhibiting the F13 antigen . Analysis of mutants of cloned prs sequences, together with trans-complementation of pap and prs genes, identified the sheep-specific adhesin as the 37-kD PrsG protein . The prsG gene occupies the equivalent position in prs as occupied by papG, which specifies the Gal alpha (1-4)Gal-specific adhesin of pap . PrsG was shown to be structurally distinct from PapG since PapG-specific antiserum did not cross-react with PrsG . Using a solid phase glycolipid receptor binding assay, PrsG was found to specify preferential binding to the Forssman antigen, a major constituent of sheep erythrocyte membranes . The binding epitope was identified as the GaINAc alpha (1-3)GaINAc moiety . This is the first direct evidence that serologically identical pili may present antigenically distinct adhesins, each capable of binding to a specific receptor. J Clin Invest, 1988 Mar, 81(3), 860 - 5 Binding sites in the rat brain for Escherichia coli S fimbriae associated with neonatal meningitis; Parkkinen J et al.; Escherichia coli strains that cause sepsis and meningitis in neonatal infants carry S fimbriae that bind to sialyl galactoside units of cell surface glycoproteins . To investigate the possible role of S fimbriae in determining the tissue tropism of neonatal meningitis, we have studied the presence of binding sites for S fimbriae in different tissues of the neonatal rat which is susceptible to meningitis caused by S-fimbriated E . coli . Purified S fimbriae were incubated on cryostat sections of different rat organs and their binding was assessed by indirect immunofluorescence . In the brain of the neonatal rat, S fimbriae specifically bound to the luminal surfaces of the vascular endothelium and of the epithelium lining the choroid plexuses and brain ventricles . The binding was completely inhibited by the trisaccharide NeuAc alpha 2-3Gal beta 1-4Glc, a receptor analogue of S fimbriae, and by a preceding neuraminidase treatment of the sections . A recombinant E . coli strain expressing S fimbriae adhered in large numbers to the same tissue sites in the neonatal brain sections as did the purified fimbriae, whereas the non-fimbriated host strain and a recombinant strain expressing P fimbriae did not adhere to brain tissues . The results suggest that adhesion of S-fimbriated bacteria to the binding sites observed in the neonatal brain has a pathogenetic role during bacterial invasion from circulation into the cerebrospinal fluid. Virus Genes, 1988 Mar, 1(2), 175 - 89 Homology of the HSV-2 "a-sequence" to cellular sequences; Kohler E et al.; Bgl-II fragments of the genome of Herpes simplex virus type 2 (HSV-2) HG-52 were cloned into the vector p-Neo and were used to screen the complete HSV-2 genome for regions cross-hybridizing with the genome of HEL cells . Most extensive cross-hybridizing activity was observed with a 530 bp SstII subfragment of the viral BamHI G DNA-fragment (contained in Bgl II F), which spans the joint and the viral a-sequence . From a lambda-L47 library, a cellular 15 kb HindIII DNA fragment was subcloned in pBR 322 which contained a 1920 bp SstII subfragment having strong cross-hybridizing activity with the 530 bp Sst II fragment of HSV-2 BamHI G . Within this 1920 bp Sst II fragment the cross-hybridizing activity was confined to a 230 bp Bgl I/Hpa II subfragment . This 230 bp fragment (including the flanking sequences) was analyzed in comparison to the viral a-sequence . Sequence data revealed a (G + C) content of 66% in the cellular and 81% in the viral DNA fragment, which is mainly determined by an extremely (G + C) rich 16-fold direct repeat (DR2) at the 5'-end . The homology between both DNA-fragments varies between 56% and 79% within the L-S inversion region . Both sequences, furthermore, show homology to the human c-myc protooncogene. EMBO J, 1988 Mar, 7(3), 867 - 73 A synthetic peptide corresponding to the C-terminal 25 residues of phage MS2 coded lysis protein dissipates the protonmotive force in Escherichia coli membrane vesicles by generating hydrophilic pores; Goessens WH et al.; The RNA phage MS2 encodes a protein, 75 amino acids long, that is necessary and sufficient for lysis of the host cell . DNA deletion analysis has shown that the lytic activity is confined to the C-terminal half of the protein . We have examined the effects of a synthetic peptide, covering the C-terminal 25 amino acids of the lysis protein, on the electrochemical potential, generated in Escherichia coli membrane vesicles and in liposomes reconstituted with cytochrome c oxidase . In all cases the peptide dissipates the electrochemical potential . The peptide also induces the release of carboxyfluorescein (376 daltons), but not of inuline (5500 daltons), from protein-free liposomes . The phenomena are observed at a lipid to peptide molar ratio of approximately 100:1 . The possible connection between the dissipation of the proton-motive force and bacteriolysis is discussed. EMBO J, 1988 Mar, 7(3), 655 - 64 The matrix attachment regions of the chicken lysozyme gene co-map with the boundaries of the chromatin domain; Loc PV et al.; The matrix attachment regions of the chicken lysozyme domain were studied in an in vitro DNA binding assay by incubating oviduct nuclear matrices with labeled restriction fragments . A strong attachment region was localized between 11.1 and 8.85 kb upstream of the transcription start site and a weaker one between 1.3 and 5.0 kb downstream of the poly(A)+ addition site . Both attachment regions co-map with the previously established boundaries of the chromatin domain . The upstream matrix attachment region is distinguishable from known enhancers and is composed of multiple binding sites . We find specific but weaker binding of the same restriction fragments to matrix preparations from transcriptionally inactive chicken erythrocytes indicating a cell-type and transcription-independent conservation of the sites for specific binding of matrix attachment sequences . We also demonstrate that the matrix attachment regions are located at the base of a chromosomal loop in histone-extracted nuclei . Thus, the lysozyme domain represents a topologically-sequestered functional unit containing the coding region and all known lysozyme-specific, cis-acting regulatory elements. Mol Biol (Mosk), 1988 Mar-Apr, 22(2), 446 - 53 {Ribosomes with unique breaks in 16S RNA: isolation and biological activity}; Afonina EI et al.; A set of Escherichia coli 16S rRNA having unique breaks were prepared using the method of oligodeoxyribonucleotide-directed fragmentation with RNAse H . 16S RNA remained compact or dissociated to separate fragments, depending on the cleavage site location in the RNA structure . 16S rRNAs which have been split at different sites or their isolated fragments were used for a reconstitution of the 30S ribosomal subunits . These reconstituted 30S subunits carrying unique breaks at positions 301, 772, 1047 have the same sedimentation coefficients and electron microscopy images as the native subunit . They were active in the poly(U)-directed cell-free system of synthesis of polyphenylalanine. Anal Biochem, 1988 Mar, 169(2), 376 - 82 Nonradioactive labeling of synthetic oligonucleotide probes with terminal deoxynucleotidyl transferase; Kumar A et al.; Synthetic oligonucleotides were tailed at the 3' end using terminal deoxynucleotidyl transferase . Nucleotide triphosphates with free primary amines at the end of side chains were compared for their tailing efficiency and/or detection sensitivity, using biotin-11-dUTP as a reference . Free primary amines were tagged with activated biotin or fluorescein isothiocyanate . The probes were then detected with either streptavidin-alkaline phosphatase complex or anti-fluorescein antibodies and alkaline phosphatase-conjugated secondary antibodies . Tailing conditions were optimized and the probes were tested for detection of Escherichia coli ST1a enterotoxin DNA and rotavirus RNA. Mol Microbiol, 1988 Mar, 2(2), 265 - 79 Cloned structural genes for the osmotically regulated binding-protein-dependent glycine betaine transport system (ProU) of Escherichia coli K-12; Faatz E et al.; The proU locus of Escherichia coli encodes a high-affinity, binding-protein-dependent transport system (ProU) for the osmoprotectant glycine betaine . We cloned this locus into both low-copy-number lambda vectors and multicopy plasmids and demonstrated that these clones restore osmotically controlled synthesis of the periplasmic glycine betaine binding protein (GBBP) and the transport of glycine betaine in a delta (proU) strain . These clones allowed us to investigate the influence of osmolarity on ProU transport activity independent of the osmotically controlled expression of proU . ProU activity was strongly stimulated by a moderate increase in osmolarity and was partially inhibited by high osmolarity . This activity profile differs from the profile of the osmotically regulated proU expression . The proU locus is organized in an operon and the position of the structural gene (proV) for GBBP is defined using a minicell system . We determined that at least three proteins (in addition to GBBP) are encoded by the proU locus . We also investigated the permeation of glycine betaine across the outer membrane . At low substrate concentration (0.7 microM), permeation of glycine betaine was entirely dependent on the OmpF and OmpC porins. Genetika, 1988 Mar, 24(3), 443 - 51 {Effect of mutations in the uvrA and recA genes on the photoreactivity of Escherichia coli cells irradiated by UV light (250 and 313 nm)}; Malinova IV et al.; The relative contribution of photo- and non-photoreactivable damages to the lethal effect of far-(250 nm) and mid-(313 nm) wave UV in isogenic bacterial cells Escherichia coli WP2 (wild type, uvrA and recA mutants) was estimated . It has been demonstrated that the value of non-photoreactivable damages increases with lambda of UV (250----313 nm) and depends on the genotype (uvrA and recA). Respir Physiol, 1988 Mar, 71(3), 259 - 68 The role of leukotriene B4 in endotoxin-induced lung injury in unanesthetized sheep; Fujimoto K et al.; In order to examine the role of LTB4, a potent neutrophil chemokinetic and chemotactic factor, in the lung injury induced by Escherichia coli endotoxin, we measured LTB4 in systemic arterial blood plasma and lung lymph in unanesthetized sheep with chronic lung lymph fistulas . E . coli endotoxin (1 microgram/kg) infusion produced a biphasic response . The early period (Phase 1) was a transient pulmonary hypertension . The late period (Phase 2) was a more prolonged period characterized by an increase flow of lung lymph with a high concentration of protein, suggesting increased pulmonary vascular permeability . Peripheral leukocyte counts rapidly decreased during Phase 1 and leukopenia persisted for approximately 5 h . The concentration of LTB4 in arterial plasma and lung lymph significantly increased during Phase 1, and then decreased with a rebound significant increase during Phase 2 . That is, LTB4 in plasma and lung lymph showed a biphasic increase after endotoxin infusion . Our data suggest that the elevation of LTB4 is related to the pulmonary leukocyte sequestration in the lung and may contribute to the lung vascular injury induced by endotoxin in unanesthetized sheep. Mol Gen Genet, 1988 Mar, 211(3), 531 - 7 Analysis of the regulatory elements of the Escherichia coli uvrC gene by construction of operon fusions; Forster JW et al.; The regulatory region of the Escherichia coli uvrC gene has been analysed by the subcloning of appropriate restriction fragments into the promoter probe vector pPV502 . A series of plasmids carrying operon fusions to the gene for chloramphenicol acetyltransferase (cat) has been constructed . Three promoters capable of controlling uvrC have been identified (P1, P2 and P3), the majority of transcription being derived from the most distal of these promoters (P1) . Transcription termination apparently plays some role in the control of the gene through premature termination of the P1-, but not the P2- or P3-derived transcripts . In addition, a promoter acting in the opposite direction to uvrC transcription has been detected . The activity of each of the promoters has been assayed under normal and SOS-inducing conditions . The uvrC gene is not apparently under the control of the recA-lexA regulatory circuit, unlike uvrA and uvrB . A series of recombinant plasmids carrying a 1.9 kb Bg/II fragment encoding most of the uvrC gene has been constructed . The properties of these plasmids suggest that the six amino acids at the carboxy-terminus of the uvrC gene product are not critical for DNA repair activity. Mol Gen Genet, 1988 Mar, 211(3), 515 - 9 Genetic mapping of the Escherichia coli gene for the stringent starvation protein and its dispensability for normal cell growth; Fukuda R et al.; To determine its map position, the sSP gene was cloned into plasmid pBR322 and the recombinant plasmid was integrated into the chromosome of a polA mutant at the site of the sSP gene by homologous recombination . The chromosomal location of Ampr was then determined by P1 phage-mediated transduction . Thus, the sSP gene was mapped between gltB and glnF at min 69.5 on the Escherichia coli chromosome . Strains were constructed in which the sSP gene was brought under the control of the lac regulatory system . This indicated that the stringent starvation protein (SSP) is dispensable for growth, at least under normal culture conditions. Genetics, 1988 Mar, 118(3), 537 - 41 Why do unrelated insertion sequences occur together in the genome of Escherichia coli? Hartl DL, Sawyer SA. Natural isolates of Escherichia coli are polymorphic for the presence or absence of insertion sequences . Among the ECOR reference collection of 71 natural isolates studied for the number of copies of the insertion sequences IS1, IS2, IS3, IS4, IS5 and IS30, the number of strains containing no copies of the insertion sequences were 11, 28, 23, 43, 46 and 36, respectively . Significant correlations occur in the ECOR strains in the presence or absence of unrelated insertion sequences in the chromosome and plasmid complements . Strains containing any insertion sequence are more likely to contain additional, unrelated insertion sequences than would be expected by chance . We suggest that the positive correlations result from horizontal transfer mediated by plasmids . A branching-process model for the plasmid-mediated transmission of insertion sequences among hosts yields such a correlation, even in the absence of interactions affecting transposition or fitness . The predictions of the model are quantitatively in agreement with the observed correlations among insertion sequences. J Gen Virol, 1988 Mar, 69 ( Pt 3), 739 - 43 An analysis of restriction endonuclease sites in cyanophages infecting the heterocystous cyanobacteria Anabaena and Nostoc; Bancroft I et al.; An analysis of restriction endonuclease cleavage of DNA isolated from cyanophages that infect Anabaena and Nostoc species of cyanobacteria has provided evidence for counter-selection of restriction endonuclease sites . These include sites containing subsequences which are methylated by host (Anabaena PCC 7120) methylase(s) akin to the dam and dcm enzymes of Escherichia coli . Other sites which are counter-selected have no common sequence structure . The latter include those of the endogenous restriction endonucleases of the host, but other absent sequences are not attributable to isoschizomers of any known Anabaena or Nostoc restriction endonuclease . The cyanophages differ in their tolerance to DNA methylation . Isolates A-4L, AN-13 and AN-23 do not tolerate adenosine methylation in the GATC sequence whereas two cyanophages, A-1L and AN-10 (which are related) do tolerate dam-like methylation of this sequence . In addition, A-1L allows cytosine methylation at GGCC sequences, but AN-10 has counter-selected these sequences and the remaining sites are not methylated . Analysis of native and cloned A-4L DNA suggests that counter-selection has occurred against all sequences which would be methylated by the host at either adenosine or cytosine nucleotides. Eur J Biochem, 1988 Mar 1, 172(2), 299 - 305 Lipoamide dehydrogenase from Azotobacter vinelandii . Molecular cloning, organization and sequence analysis of the gene; Westphal AH et al.; The gene encoding lipoamide dehydrogenase from Azotobacter vinelandii has been cloned in Escherichia coli . Fragments of 9-23 kb from Azotobacter vinelandii chromosomal DNA obtained by partial digestion with Sau3A were ligated into the BamHI site of plasmid pUC9 . E . coli TG2 cells were transformed with the resulting recombinant plasmids . Screening for clones which produced A . vinelandii lipoamide dehydrogenase was performed with antibodies raised against the purified enzyme . A positive colony was found which produced complete chains of lipoamide dehydrogenase as concluded form SDS gel electrophoresis of the cell-free extract, stained for protein or used for Western blotting . After subcloning of the 14.7-kb insert of this plasmid the structural gene could be located on a 3.2-kb DNA fragment . The nucleotide sequence of this subcloned fragment (3134 bp) has been determined . The protein-coding sequence of the gene consists of 1434 bp (478 codons, including the AUG start codon and the UAA stop codon) . It is preceded by an intracistronic region of 85 bp and the structural gene for succinyltransferase . A putative ribosome-binding site and promoter sequence are given . The derived amino acid composition is in excellent agreement with that previously published for the isolated enzyme . The predicted relative molecular mass is 50223, including the FAD . The overall homology with the E . coli enzyme is high with 40% conserved amino acid residues . From a comparison with the three-dimensional structure of the related enzyme glutathione reductase {Rice, D . W., Schultz, G . E . & Guest, J . R . (1984) J . Mol . Biol . 174, 483-496}, it appears that essential residues in all four domains have been conserved . The enzyme is strongly expressed, although expression does not depend on the vector-encoded lacZ promoter . The cloned enzyme is, in all the respects tested, identical with the native enzyme. Proc Natl Acad Sci U S A, 1988 Mar, 85(6), 1826 - 30 DNA bending is induced in an enhancer by the DNA-binding domain of the bovine papillomavirus E2 protein; Moskaluk C et al.; The E2 gene of bovine papillomavirus type 1 has been shown to encode a DNA-binding protein and to trans-activate the viral enhancer . We have localized the DNA-binding domain of the E2 protein to the carboxyl-terminal 126 amino acids of the E2 open reading frame . The DNA-binding domain has been expressed in Escherichia coli and partially purified . Gel retardation and DNase I "footprinting" on the bovine papillomavirus type 1 enhancer identify the sequence motif ACCN6GGT (in which N = any nucleotide) as the E2 binding site . Using electrophoretic methods we have shown that the DNA-binding domain changes conformation of the enhancer by inducing significant DNA bending. Mutat Res, 1988 Mar, 193(2), 97 - 108 Enhanced transforming activity of pSV2 plasmids in human cells depends upon the type of damage introduced into the plasmid; Spivak G et al.; When pSV2-gpt or pSV2-neo plasmids are introduced into human cells by calcium phosphate coprecipitation, the yield of stable transformants (Gpt+ or Neo+) is increased by irradiating the respective plasmid DNA in vitro with UV (254 nm) . To identify specific lesions that can increase the transforming activity of plasmids in human cells we examined pSV2 plasmids containing different types of damage . Of the lesions tested, cyclobutane pyrimidine dimers produced the greatest increase, and can nearly fully account for the effect of 254 nm UV on transformation . The enhancement of transformation produced by UV was not altered by the additional treatment of the plasmid DNA with T4 endonuclease V, an enzyme that nicks DNA specifically at pyrimidine dimers . Treatment of plasmid DNA with osmium tetroxide to produce thymine glycols, or with acid and heat to produce apurinic sites did not affect transformation frequency . The enhancement occurred in all the human cell lines tested, whether they contained or not sequences homologous to those in the plasmids, and was independent of the repair capacity of the recipient cells. Biochem Pharmacol, 1988 Mar 1, 37(5), 843 - 8 Studies on the mechanism of action of the omeprazole-derived cyclic sulphenamide; Beil W et al.; The inhibitory effects of omeprazole and omeprazole-derived metabolites were studied on Escherichia coli glutaminase activity at pH 2.5 which might represent the conditions present at the target enzyme (K+/H+-ATPase) in the secretory membrane of the intact parietal cell . Omeprazole and the omeprazole-derived cyclic sulphenamide inhibited glutaminase at pH 2.5 with identical potency (IC50 36 microM) . The substrate, glutamine as well as the mercaptane, dithiothreitol, protect the enzyme . Furthermore, dithioerythritol was found to reverse inhibition . This indicates that an SH-group localized in the substrate binding center of glutaminase is most likely involved in the reaction leading to enzyme inhibition . Glutaminase inhibition by both compounds was less pronounced at pH 5.0 . Omeprazole radical, the metabolite generated from the cyclic sulphenamide at more neutral pH values, failed to affect the enzyme . These findings were in contrast with the properties of the omeprazole-derived cyclic sulphenamide and radical at the K+/H+-ATPase preparation . This enzyme was inhibited by both compounds at pH 7.5 with a high potency, and reversal experiments with dithiothreitol demonstrate that these agents interfere with SH-groups of the K+/H+-ATPase . From these data it is suggested that the cyclic sulphenamide and the radical interfere by different reaction pathways with enzymatic SH-groups. J Infect Dis, 1988 Mar, 157(3), 557 - 64 Modulation of enterotoxin binding and function in vitro and in vivo; Donta ST et al.; The use of the nontoxic B subunits of cholera and Escherichia coli enterotoxins in vitro and in vivo led to a decrease in toxin binding to target cells and a decrease in toxin-induced effects (i.e., morphological effects, adenylate cyclase activation, and fluid secretion) . The reduction in toxin binding involves a process of down-regulation of cellular receptors for the toxin and not toxin occupancy of receptors . The extent of inhibition was dependent on the amount of B subunit used and on the duration of time after its use . Thus, in vivo exposure to a single bolus of B subunit was sufficient to block toxin binding and activity for up to 18 h . Because the B subunit binds extensively to the esophagus and the stomach, peroral administration will require a preparation that allows the subunit to reach the small bowel in a protected form . Our data provide a rationale for using B subunit therapy for short-term protection against the effects of enterotoxins, before the development of an immune response. J Bacteriol, 1988 Mar, 170(3), 1350 - 3 Analysis of the variable endpoints generated by one-ended transposition of Tn21; Avila P et al.; One-ended transposition of Tn21 generates recombinants usually containing a whole copy of the donor replicon plus a short duplication of it (S . Motsch, R . Schmitt, P . Avila, F . de la Crue, E . Ward, and J . Grinsted, Nucleic Acids Res . 13:3335-3342, 1985) . This work shows that recombinants containing less than a whole copy of the donor replicon (hereafter called short recombinants) could also be detected when plasmid donors which contained two selectable genetic markers were used . Short recombinants were produced at the same frequency from TnpR+ donor molecules as from TnpR- donor molecules in a RecA- background . Therefore, they were not resolution products of larger recombinants . This result invalidates a previous hypothesis to explain one-ended transposition, that is, that one-ended transposition arises from the use of secondary ends by the transposition apparatus . On the other hand, it suggests that one-ended transposition of Tn21 occurs via a simple insertion mechanism. J Bacteriol, 1988 Mar, 170(3), 1346 - 9 Regulation of ubiG gene expression in Escherichia coli; Gibert I et al.; To study the regulation of the expression in Escherichia coli of the ubiG gene, which codes for the last enzyme in the pathway of ubiquinone biosynthesis, a fusion between the ubiG and lacZ genes was constructed in vitro . The results showed that (i) the expression of the ubiG gene was higher under aerobic conditions than under anaerobic growth conditions, (ii) the presence of glucose in the culture medium decreased the transcription of the ubiG gene, and (iii) cya and crp mutants exhibited lower levels of ubiG gene expression than the wild-type strain . The addition of cyclic AMP increased the expression of the ubiG gene in both cya and wild-type strains but not in a crp mutant . This fact suggests that the cyclic AMP receptor protein-cyclic AMP complex positively modulates ubiG gene transcription . It was also determined that the transcription of the ubiG gene was in the counterclockwise direction on the E . coli map. J Bacteriol, 1988 Mar, 170(3), 1305 - 10 Common organization of gene clusters for production of different capsular polysaccharides (K antigens) in Escherichia coli; Roberts IS et al.; Southern blot analysis of cloned K5- and K7-antigen genes, using DNA fragments from cloned K1 genes as radiolabeled probes, demonstrated that each K-antigen gene cluster is organized in a manner similar to that shown for the K1 antigen . That is, a central DNA segment unique for a given antigen type is flanked by DNA sequences that encode common functions for the management of intracellular polymer . This has been confirmed by transposon and deletion mutagenesis of plasmids carrying the K5 and K7 genes . We also describe a series of complementation experiments in which transport or postpolymerizational modification functions for one K antigen are used to complement mutations in the corresponding regions of a different K-antigen gene cluster . Thus, postpolymerizational modification of polysaccharide and transport of mature polysaccharide from the periplasmic space are common mechanisms and are independent of polysaccharide structure. J Bacteriol, 1988 Mar, 170(3), 1069 - 75 Lethality of a dut (deoxyuridine triphosphatase) mutation in Escherichia coli; el-Hajj HH et al.; A chloramphenicol resistance gene was cloned into a plasmid-borne dut gene, producing an insertion mutation that was then transferred to the chromosome by allelic exchange . The mutation could not be acquired by haploid strains through substitutive recombination, even when two flanking markers were simultaneously transduced . The insertion was easily transferred, via generalized transduction, into the chromosomal dut region of strains harboring a lambda dut + transducing phage; however, the resulting dut mutant/lambda dut + merodiploid could not then be cured of the prophage . This apparent lethality of the mutation could not be explained by effects on adjacent genes; the dfp gene retained complementing activity, and a ttk insertion mutant was viable . The dut gene product, deoxyuridine triphosphatase, is known to reduce incorporation of uracil into DNA and to be required in the de novo synthesis of thymidylate . Therefore, an attempt was made to determine whether the dut insertion would be tolerated in strains carrying the following compensatory mutations: dcd (dCTP deaminase) and cdd (deoxycytidine deaminase), which should reduce dUTP formation; ung (uracil-DNA glycosylase), which should reduce fatally excessive excision repair; deoA (thymidine phosphorylase), which should enhance the utilization of exogenous thymidine; and sulA, which should reduce the lethal side effects of SOS regulon induction . These mutations, either alone or in various combinations, did not permit the survival of a haploid dut insertion mutant, suggesting that the dut gene product might have an essential function apart from its deoxyuridine triphosphatase activity. J Virol, 1988 Mar, 62(3), 978 - 86 Insertional mutagenesis of the Abelson murine leukemia virus genome: identification of mutants with altered kinase activity and defective transformation ability; Rees-Jones RW et al.; A library of Abelson murine leukemia virus (A-MuLV) proviral DNAs with 12- or 6-base-pair (bp) insertional mutations was constructed . The 29 mutations characterized spanned the entire protein-coding region of the provirus . We tested the effects of these mutations both on the kinase activity of the gag-abl fusion protein encoded by the provirus and on the ability of the provirus to transform NIH 3T3 fibroblasts . To simplify assessment of the mutant kinases, we expressed the A-MuLV-encoded kinase in the bacterial expression vector pATH2, resulting in production of a trpE-gag-abl fusion protein in Escherichia coli . We used an immunoprecipitation kinase assay to measure both autophosphorylation and artificial substrate phosphorylation by the mutant kinases . To assay transformation ability of the mutant proviruses, we transfected NIH 3T3 fibroblasts with the mutants and with helper virus (Moloney MuLV) by the DEAE-dextran method . Our analysis of these A-MuLV insertional mutants allows the division of the protein-coding region of the provirus into four domains: domain A (proviral bp 1068 to 1685), in which insertions have no effect on the bacterially expressed kinase, but diminish both kinase activity and transformation efficiency in fibroblasts; domain B (bp 1750 to 2078), in which insertions have no effect on the provirus; domain C (bp 2181 to 2878), the critical kinase domain, in which 12-bp or even 6-bp insertions completely inactivate the A-MuLV kinase and result in transformation-defective proviruses; and domain D (bp 2956 to 4610), the large C-terminal domain in which mutations are silent. J Virol, 1988 Mar, 62(3), 1084 - 7 Birnavirus precursor polyprotein is processed in Escherichia coli by its own virus-encoded polypeptide; Jagadish MN et al.; The cDNA fragment of the large RNA segment of infectious bursal disease virus 002-73, when expressed in Escherichia coli, produces precursor polyprotein (N-VP2-VP4-VP3-C), most of which is then processed to generate constituent polypeptides . Using cDNA fragments containing site-specific mutations and two monoclonal antibodies that are specific to VP2 and VP3 of mature virus particles, we demonstrated that the VP4 protein is involved in processing of the precursor polyprotein to generate VP2 and VP3 and excluded the possibility of internal initiation for the generation of VP3. Mol Biol (Mosk), 1988 Mar-Apr, 22(2), 357 - 61 {mRNA-binding site of ribosomes at different stages of translation . II . Affinity modification of Escherichia coli ribosomes bya benzylidene derivative of AUGU6 in pre- and post-translation complexes}; Babkina GT et al.; Affinity labeling of E . coli ribosomes with the 2',3'-O-{4-(N-2-chloroethyl)-N-methyl-amino}benzylidene derivative of AUGU6 (AUGU6-{14C}CHRCl) was studied within the pretranslocational complex ribosome.AUGU6{14C}CHRCl.tRNA(fMet)(P-site).fMetPhe-tR NA(Phe)(A-site) and posttranslocational complex ribosome.AUGU6{14C}CHRCl.fMetPhe-tRNA(Phe)(P-site) . Both 30S and 50S subunits were labeled within these complexes, but the extent of 30S subunit modification was 6-8-fold higher than those for 50S subunit . Ribosomal proteins of both subunits were found to be labeled preferentially . Proteins S1, S5, S11, L1 were identified to be crosslinked with AUGU6{14C}CHRCl within the pretranslocational complex and S7--within the posttranslocational complex from the data of two-dimensional electrophoresis in the polyacrylamide gel. J Gen Virol, 1988 Mar, 69 ( Pt 3), 525 - 35 An antigenic analysis of the adenovirus type 2 fibre polypeptide; Watson G et al.; Twenty-seven monoclonal antisera were generated against the SDS-denatured fibre of adenovirus type 2 . The antisera were characterized using radioimmune assay, fluorescent antibody tests, immune precipitation, Western blotting, haemagglutination and neutralization, and formed six groups as follows: A, type-specific neutralizing antisera which exhibited haemagglutination inhibition (Hi+); B, type-specific non-neutralizing antisera which did not exhibit haemagglutination inhibition (Hi-); C, subgroup-specific neutralizing antisera Hi+; D, a subgroup-specific neutralizing antiserum Hi-; E, subgroup-specific non-neutralizing antisera Hi-; F, a subgroup-specific neutralizing antiserum Hi- which did not react in Western blotting tests . The C-terminal 201 amino acids of the fibre were expressed in Escherichia coli and a total of six antisera from groups A, B and C recognized five epitopes carried on this region which in several models is thought to form the knob of the fibre . At least eight epitopes were expressed by the entire native fibre . The five epitopes of the C-terminal end of the fibre formed three antigenic sites . Two sites each consisted of a neutralizing type-specific and a neutralizing group-specific epitope which overlapped in position . The remaining site consisted of a type-specific, non-neutralizing epitope. Eur J Biochem, 1988 Mar 1, 172(2), 349 - 53 Differential inhibition of various deoxyribonucleic and ribonucleic acid polymerases by suramin; Ono K et al.; The inhibitory effects of hexasodium sym-bis(m-aminobenzoyl-m-amino-p-methylbenzoyl-1-naphthylamino-4,6, 8-trisulfonate)carbamide (trivial name: suramin) on the activities of various deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) polymerases from mammalian cells, bacteria and retrovirus were examined and compared with each other . Among the various DNA and RNA polymerases tested, the activities of DNA primase, DNA polymerase alpha, reverse transcriptase and Escherichia coli RNA polymerase were strongly inhibited by suramin, while the activities of other enzymes including DNA polymerases beta and gamma, terminal deoxynucleotidyl-transferase and DNA polymerase I were relatively resistant to inhibition by this drug . The inhibition by suramin of DNA polymerase alpha from KB cells and Rauscher murine leukemia virus (RLV) reverse transcriptase was due to competition with the respective template primer (activated DNA for alpha polymerase and (rA)n.(dT)12-18 for reverse transcriptase) for the template.primer-binding site of the enzyme, while the inhibition of DNA primase and E.coli RNA polymerase was due to competition with the ribonucleoside triphosphate substrate . The inhibition constants (Ki) of suramin were determined to be 2.6 microM, 0.35 microM, 0.54 microM and 0.70 microM for DNA primase, DNA polymerase alpha, RLV reverse transcriptase and E . coli RNA polymerase respectively . The observed inhibitions of these polynucleotide-synthesizing enzymes by suramin seem to explain, at least in part, an as yet unknown mechanism of trypanocidal action of this drug. J Bacteriol, 1988 Mar, 170(3), 1311 - 8 Analysis of the incompatibility determinants of I-complex plasmids; Nikoletti S et al.; The isolation and characterization of minireplicons corresponding to group B and I-complex plasmids are reported . The molecular structures of the small RNAs that may play a major role in the replication control and incompatibility reactions of the plasmids are compared . A mutant plasmid with changed copy number and incompatibility specificity is described . This mutant had a single-base-pair substitution in the DNA region that codes for the small RNA. Crit Care Med, 1988 Mar, 16(3), 266 - 71 Comparison of effects of dextran-70 and Ringer's acetate on pulmonary function, hemodynamics, and survival in experimental septic shock; Modig J; The effects of dextran-70 with NaCl vs . Ringer's acetate on hemodynamics, gas exchange, oxygen transport, and survival were evaluated in a porcine model of pulmonary and circulatory insufficiency induced by a continuous iv endotoxin infusion over 6 h . Dextran and Ringer's acetate were infused continuously to maintain baseline mean left atrial pressure (LAP) throughout the endotoxin period . Twelve pigs receiving endotoxin + Ringer's acetate displayed a progressive 45% decline in cardiac output (Qt) and a two-peaked increase in pulmonary vascular resistance (PVR) with a late increase of 250% . Venous admixture (Qva/Qt) increased progressively more than six-fold and extravascular lung water (EVLW) increased by 55% . Mean arterial BP (MAP) fell by 25%, oxygen delivery by 40%, base excess (BE) ranged between -4.5 and -9 mmol/L at the end of the endotoxin period and four of 12 animals died . Polymorphonuclear cell count (PMN) fell rapidly by 90% and was decreased severely throughout the endotoxin period . By contrast, the 12 pigs that received endotoxin + dextran maintained Qt near baseline and PVR was significantly lower in this group . Qva/Qt increased progressively more than four-fold, but it was significantly lower than in the Ringer's acetate group as was the increase in EVLW (23%) . MAP only decreased by 10%, oxygen delivery only decreased by 20% . BE ranged between -1.0 and -3.0 mmol/L at the end of the endotoxin period and all animals survived . PMN fell by 90% at 0.5 h but subsequently tended to return toward baseline, and PMN were significantly increased compared with the Ringer's acetate group.(ABSTRACT TRUNCATED AT 250 WORDS) FEBS Lett, 1988 Feb 29, 229(1), 73 - 6 Psoralen photofootprinting of protein-binding sites on DNA; Zhen WP et al.; Using a BAL31 exonuclease assay to determine the sites of 4,5',8-trimethylpsoralen photocrosslinking in DNA we have shown that 5'-TA sites which are accessible to psoralen DNA interstrand photocrosslinking in naked DNA become inaccessible when protein, in casu, lambda-repressor E . coli or RNA polymerase are bound at their recognition DNA sequences (OR1 operator or deo1 promoter, respectively) . These results show that psoralens can be used as photofootprinting reagents to study specific protein-DNA interactions. FEBS Lett, 1988 Feb 29, 229(1), 127 - 30 The fluorescence intensity of the lipophilic probe N-phenyl-1-naphthylamine responds to the oxidation-reduction state of purified Escherichia coli cytochrome o incorporated into phospholipid vesicles; Sedgwick EG et al.; N-Phenyl-1-naphthylamine (NPN), a reagent which has been used previously to probe the fluidity or microviscosity of the membrane lipids of intact cells of Escherichia coli, was found to respond to the redox state of purified cytochrome o incorporated into lipid vesicles formed from purified or E . coli phospholipids . NPN was bound to the proteoliposomes to produce a steady-state level of fluorescence intensity . Addition of the substrate ascorbate, in the presence of phenazine methosulfate as an electron donor, did not alter the fluorescence . However, following complete removal of oxygen from the medium by oxidation of the substrate by molecular oxygen catalyzed by cytochrome o, there was an increase in the fluorescence of NPN . This coincided with the reduction of cytochrome o . Reoxidation of the cytochrome by addition of oxygen decreased the fluorescence to steady-state levels until the oxidant had been completely reduced . The fluorescence changes were dependent on the incorporation of cytochrome o into phospholipid vesicles but were insensitive to the state of energization of the vesicle membrane. Biochem Biophys Res Commun, 1988 Feb 29, 151(1), 236 - 41 Purification and analysis of the structure of alpha-galactosidase from Escherichia coli; Nagao Y et al.; Alpha-Galactosidase, the product of the melA gene, was purified from a strain of Escherichia coli harboring a plasmid carrying melA, which over-produced the alpha-galactosidase . An apparent molecular weight was determined to be 50 kDa . The amino acid composition of this enzyme was determined . The result indicates that this enzyme is a hydrophilic and acidic protein . We have subjected the purified enzyme to 20 cycles of N-terminal sequence analysis . This verified the translation start site of the melA gene and the predicted N-terminal sequence. Biochim Biophys Acta, 1988 Feb 28, 949(2), 247 - 51 Purification of duck growth hormone and cloning of the complementary DNA; Chen HT et al.; Duck growth hormone (GH) was isolated and purified from duck pituitaries by salt precipitation and HPLC on reverse-phase C18 columns . The duck GH was homogeneous as shown by SDS-polyacrylamide gel electrophoresis with a molecular weight of 22,000 . The cDNA was synthesized and cloned in Escherichia coli using EcoRI linkers and pBR322 as vector . The positive clones were selected and sequenced . The full-length duck GH cDNA contains 820 nucleotide pairs with an open reading frame coding for the precursor form duck GH of 216 amino-acid residues . The partial amino-acid sequence from the protein completely agrees with that derived from the cDNA, with Phe as the first residue in mature duck GH preceded by a 27-residue hydrophobic signal peptide . The duck GH is almost completely homologous to the chicken GH, with only three conservative substitutions (Ser for Thr, His for Tyr and Lys for Arg) and one deletion (Ala) in the duck GH sequence . Comparison of amino-acid sequence of duck GH with that of various species reveals 56%, 73% and 40% homologies with GHs of human, rat and salmon, respectively. Biochim Biophys Acta, 1988 Feb 28, 949(2), 169 - 80 Characterization of a cDNA for human glutathione-insulin transhydrogenase (protein-disulfide isomerase/oxidoreductase); Morris JI et al.; A human liver cDNA expression library in lambda-phage gt11 was screened with monoclonal antibodies to rat liver protein-disulfide isomerase/oxidoreductase (EC 5.3.4.1/1.8.4.2), also known as glutathione-insulin transhydrogenase (GIT) . The nucleotide sequence of the largest cDNA insert (hgit-1) was determined . It contained approx . 1500 basepairs, representing an estimated 65% of the glutathione-insulin transhydrogenase message . The amino-acid sequence deduced from this cDNA insert contains a 7-amino-acid long polypeptide determined by sequencing the active-site fragment isolated from the rat GIT protein . A comparison of the nucleotide sequence of hgit-1 and a previously reported nucleotide sequence of rat glutathione-insulin transhydrogenase cDNA shows that the human hgit-1 clone corresponds to the middle of the transhydrogenase message at amino-acid residue number 275 of the rat protein, and codes for 206 amino-acid residues, including one of the two active-site regions of glutathione-insulin transhydrogenase, a stop codon (TAA), a long 3'-noncoding region of over 800 bases, a polyadenylation signal (AATAA), and a 29 base poly(A) tail . There exists high homology between the human and rat enzymes (94% in the overall amino-acid sequence, with 100% in the active site region and 81% in the nucleotide sequence within the coding portion of hgit-1) . As with the rat enzyme, the human enzyme shows some identity with another dithiol-disulfide-exchange protein, Escherichia coli thioredoxin . Like rat cDNA, the human hgit-1 cDNA hybridized to rat mRNA of 2500 bases on a Northern blot . The relative quantitative abundance of GIT mRNA in nine rat tissues studied using hgit-1 as a hybridization probe was found to be in the same order as previously found with the rat cDNA . Thus, the above studies indicate that glutathione-insulin transhydrogenase is a highly conserved protein and that the human hgit-1 cDNA is suitable for use as a probe for further studies on gene regulation of this enzyme. Biochim Biophys Acta, 1988 Feb 28, 949(2), 195 - 205 Gene response upon illumination in forming mRNA encoding peroxisomal glycollate oxidase; Gerdes HH et al.; Glycollate oxidase is a constituent of leaf peroxisomes . Its biosynthesis is, like the biosynthesis of many chloroplastic proteins, controlled by light, via phytochrome . The level of mRNA coding for glycollate oxidase was determined at different stages of greening of etiolated plant cells . The appearance of glycollate oxidase mRNA in the cytoplasm was measured by hybridization with cDNA containing part of the coding sequence for glycollate oxidase . cDNA was prepared from enriched mRNA, inserted into the Pst I site of pBR 322, and cloned in Escherichia coli DH-1 . By differential colony hybridization and hybrid selection, a clone containing a 670 bp sequence complementary to mRNA encoding glycollate oxidase was selected and identified . Northern blot hybridization was used to investigate mRNA levels induced by light . It was found that continuous light affected the formation of glycollate oxidase mRNA . When a large population of microbodies was present in the cells being induced, the immediate mRNA increase was very pronounced, and was detectable as little as 20 min after the beginning of the light treatment . In contrast, a lag period in the mRNA increase was observed when the induction was performed with etiolated leaves which are characterized by the occurrence of a rather small population of microbodies . For comparison, we measured the time-course of formation of mRNA coding for a light-induced chloroplastic protein, i.e., a protein of the light-harvesting complex . The time-courses of levels of the two mRNAs indicate that the program of gene expression differs between the two particular proteins destined either for chloroplasts or for peroxisomes . The formation of glycollate oxidase mRNA could also be stimulated by a short pulse of light, a treatment of 15 s being a sufficient trigger. Biochim Biophys Acta, 1988 Feb 28, 949(2), 206 - 12 An EBV-based mammalian cell expression vector for efficient expression of cloned coding sequences; Jalanko A et al.; The construction of a mammalian cell expression vector using human cytomegalovirus immediate early gene enhancer to initiate transcription of inserted coding sequences is described . The vector also carries Epstein-Barr virus EBNA-1 nuclear antigen gene, ori-P sequences and hygromycin B resistance gene hph from E . coli . The expression capacity of this construct was tested by inserting the chloramphenicol acetyltransferase (CAT) gene into the vector . The EBV-CAT construct was transfected into various cell lines and high levels of CAT activity were obtained in human and monkey cells . In these cells, the vector DNA also replicates as an extrachromosomal element having 1 to 20 copies per cell . In most cases, the vector copy number and the expression level of inserted gene was in positive correlation in different cell clones. J Chromatogr, 1988 Feb 26, 424(2), 243 - 53 Synthesis of high-capacity immunoaffinity sorbents with oriented immobilized immunoglobulins or their Fab' fragments for isolation of proteins; Prisyazhnoy VS et al.; Two methods for synthesizing high-capacity immunoaffinity sorbents on Sepharose and Separon HEMA E-1000 are described . The first is the oriented immobilization of monovalent immunoglobulin Fab fragments on a maleimide derivative of Sepharose via the formation of a covalent bond between the SH group of the Fab fragment at the C-terminus of the molecule and the maleimide covalently coupled to Sepharose . The second method is based on the oxidation of the immunoglobulin carbohydrate component, located in the Fc fragment, by periodate with subsequent immobilization of the derivatives on hydrazide derivatives of Sepharose or Separon . Sorbents for the isolation of monoclonal antibodies from the culture supernatants and the elongation factor EF-G from a crude extract of Escherichia coli cells were obtained . These sorbents are characterized by a high capacity, minimal non-specific sorption and high stability. Science, 1988 Feb 26, 239(4843), 1033 - 5 Modulation of folding pathways of exported proteins by the leader sequence; Park S et al.; Leader peptides that function to direct export of proteins through membranes have some common features but exhibit a remarkable sequence diversity . Thus there is some question whether leader peptides exert their function through conventional stereospecific protein-protein interaction . Here it is shown that the leader peptides retarded the folding of precursor maltose-binding protein and ribose-binding protein from Escherichia coli . This kinetic effect may be crucial in allowing precursors to enter the export pathway. Cell, 1988 Feb 26, 52(4), 551 - 7 Mini-P1 plasmid replication: the autoregulation-sequestration paradox; Chattoraj DK et al.; It has been proposed that the initiator protein RepA is rate limiting for mini-P1 plasmid replication, and that the role of the plasmid copy number control locus is to sequester the initiator and thus reduce replication . This proposal appears inconsistent with the observation that RepA is autoregulated, since the protein lost by sequestration should be replenished . A resolution of this autoregulation-sequestration paradox is possible if the sequestered RepA, unavailable for replication, is still available for promoter repression . We demonstrate that RepA binds to the control locus and to the promoter region simultaneously, causing the intervening DNA to loop . DNA looping could provide the requisite mechanism by which RepA bound to the control locus might exert repression. Nucleic Acids Res, 1988 Feb 25, 16(4), 1541 - 9 Nucleotide sequencing of the ruv region of Escherichia coli K-12 reveals a LexA regulated operon encoding two genes; Benson FE et al.; The nucleotide sequence of a 2505 bp region of the Escherichia coli chromosome containing the LexA regulated ruv gene has been determined . A sequence of 1631 bp encoding two non-overlapping open reading frames that constitute a single operon and which specify polypeptides with predicted molecular weights of 22172 daltons and 37177 daltons respectively, was identified as the most probable sequence for ruv . Each of the two open reading frames, designated ruvA and ruvB, is preceded by a reasonable Shine-Dalgarno sequence . Two 16 bp sequences (SOS boxes) that match the consensus sequence for binding LexA protein are located 5' to ruvA in a region that provides a possible single promoter for expression of both ruvA and ruvB, with the second SOS box overlapping the putative -35 region . A possible transcriptional terminator is located 137 bp downstream of ruvB . The amino acid sequence predicted for RuvB contains a region that matches a highly conserved sequence found in several DNA repair and recombination proteins that bind ATP. Nucleic Acids Res, 1988 Feb 25, 16(4), 1333 - 48 A heat shock element in the phosphoglycerate kinase gene promoter of yeast; Piper PW et al.; The phosphoglycerate kinase (PGK) promoter is often employed in yeast expression vectors due to its very high efficiency . Its activity in unstressed cells has been shown to be due to an upstream activator site (UASPGK) at -402 to -479 . Since levels of PGK mRNA can sometimes be elevated by heat shock of yeast cultures this investigation determined how specific deletions of PGK promoter sequences effect levels of PGK mRNA both before and after heat shock . A series of PGK promoter deletions was inserted on a high copy plasmid into cells having a TRP1 gene disruption of the solitary chromosomal PGK locus . This enabled PGK transcripts of plasmid and chromosomal origin to be distinguished by virtue of their different sizes . Certain deletions lacking UASPGK displayed activities that were very low in unstressed cells, but which increased fifty to one-hundred fold after heat shock . With UASPGK present heat shock had only a relatively small or negligible effect on PGK mRNA levels . Heat shock activation was abolished when the -256 to -377 region with homology to the heat shock element consensus of eukaryotes was deleted in addition to UASPGK, but was unaffected by the deletion of regions further downstream containing TATA- and CAAT- sequence motifs . This is the first demonstration of a heat shock element, an activator site normally found upstream of eukaryotic heat shock protein genes, as a natural constituent of a high efficiency glycolytic promoter . It is proposed that PGK may be one member of a small subset of yeast genes that are highly expressed in unstressed cells yet possess a heat shock element to ensure their continued transcription after heat shock. Nucleic Acids Res, 1988 Feb 25, 16(4), 1233 - 50 Protein binding sites on Escherichia coli 16S ribosomal RNA; RNA regions that are protected by proteins S7, S9 and S19, and by proteins S8, S15 and S17; Wiener L et al.; Selected groups of isolated 14C-labelled proteins from E . coli 30S ribosomal subunits were reconstituted with 32P-labelled 16S RNA, and the reconstituted complexes were partially digested with ribonuclease A . RNA fragments protected by the proteins were separated by gel electrophoresis and subjected to sequence analysis . Complexes containing proteins S7 and S19 protected an RNA region comprising helices 29 to 32, part of helix 41, and helices 42 and 43 of the 16S RNA secondary structure . Addition of protein S9 had no effect . When compared with previous data for proteins S7, S9, S14 and S19, these results suggest that S14 interacts with helix 33, and that S9 and S14 together interact with the loop-end of helix 41 . Complexes containing proteins S8, S15 and S17 protected helices 7 to 10 as well as the "S8-S15 binding site" (helices 20, 22 and parts of helices 21 and 23) . When protein S15 was omitted, S8 and S18 showed protection of part of helix 44 in addition to the latter regions . The results are discussed in terms of our model for the detailed arrangement of proteins and RNA in the 30S subunit. J Biol Chem, 1988 Feb 25, 263(6), 2761 - 7 The primary structure of the mitochondrial energy-linked nicotinamide nucleotide transhydrogenase deduced from the sequence of cDNA clones; Yamaguchi M et al.; The amino acid sequence of the bovine mitochondrial nicotinamide nucleotide transhydrogenase, which catalyzes hydride ion transfer between NAD(H) and NADP(H) coupled to proton translocation across the mitochondrial inner membrane, has been deduced from the corresponding cDNA . Two clones were isolated by screening a bovine lambda gt10 cDNA library, using two synthetic oligonucleotides and a cDNA restriction fragment as probes . The inserts together covered 3,105 base pairs of coding sequence, corresponding to 1.035 amino acid residues . However, the reading frame at the 5' end was still open . N-terminal sequence analysis of the isolated enzyme indicated the presence of 8 additional residues . Thus, the mature transhydrogenase appeared to have 1,043 amino acid residues and a calculated molecular weight of 109,212 . The deduced amino acid sequence of the transhydrogenase contained the sequences of four tryptic peptides that had been isolated from the enzyme . Two of these were the peptides that had been used for construction of the oligonucleotide probes . The other two were tryptic peptides isolated after labeling the NAD-binding site of the transhydrogenase once with {3H}p-fluorosulfonylbenzoyl-5'-adenosine (FSBA), and another time with {14C}N,N'-dicyclohexylcarbodiimide . The FSBA-labeled peptide was found to be located immediately upstream of the {14C}N,N'-dicyclohexylcarbodiimide-labeled peptide, about 230 residues from the N terminus . One of the tryptic peptides used for oligonucleotide probe construction was the same as that labeled with {3H}FSBA when the NAD-binding site was protected from FSBA attack . This peptide, which might be at the NADP-binding site of the transhydrogenase, was located very near the C terminus of the enzyme . The central region of the transhydrogenase (residues 420-850) is highly hydrophobic and appears to comprise about 14 membrane-spanning segments . By comparison, the N- and the C-terminal regions of the enzyme, which contain the NAD- and the putative NADP-binding sites, respectively, are relatively hydrophilic and are probably located outside the mitochondrial inner membrane on the matrix side . There is considerable homology between the bovine enzyme and the Escherichia coli transhydrogenase (two subunits, alpha with Mr = 54,000 and beta with Mr = 48,700), whose amino acid sequence has been determined from the genes (Clarke, D.M., Loo, T.W., Gillam, S., and Bragg, P.D . (1986) Eur . J . Biochem . 158, 647-653). J Biol Chem, 1988 Feb 25, 263(6), 2638 - 43 Uridine diphosphate galactose 4-epimerase . pH dependence of the reduction of NAD+ by a substrate analog; Arabshahi A et al.; Neutron activation analysis of UDP-galactose 4-epimerase from Escherichia coli for 53 metals shows that the enzyme does not contain any of these metals at significant levels . The substrate analog P1-5'-uridine-P2-glucose-6-yl pyrophosphate (UGP), a structural isomer of UDP-glucose with the sugar linked to UDP through the C-6 hydroxyl group, is an inactivator that irreversibly reduces epimerase.NAD+ to epimerase.NADH . The pH dependence of kobs reveals the essential involvement of an acidic group, kinetically measured pKa = 5.48 +/- 0.08, in unprotonated form and two weakly acidic or basic groups, apparent pKa values of 10.03 +/- 0.43, in protonated forms . Measurements of kobs as a function of {UGP} show that it is given by kobs = k{UGP}/(K + {UGP}) at a given pH, where K = 0.19 +/- 0.04 mM throughout the pH range 4.8-10.4 . The pH-dependent first order rate constants range from 0.28 to 1.94 s-1, with the maximum value at pH 7.6 and decreasing at acidic and basic pH values . Reaction of {glucose-1-2H}UGP proceeds with kinetic isotope effects of 5.0, 2.1, 2.0, 1.9, and 3.5 at pH values 5.0, 6.2, 7.6, 9.0, and 10.0, respectively . Therefore, hydride transfer becomes rate-limiting at pH extremes but is not limiting at neutral pH, although deuteride transfer is significantly limiting at all pH values . The isotope effects facilitated correction of the kinetic pK values to the thermodynamic values 6.1-6.2 on the acid side and 9.0-9.6 on the alkaline side . We postulate that the group with pK1 = 5.5 (6.1-6.2 corrected) functions as an enzymic general base that abstracts the glucosyl C-1 hydroxyl proton in concert with transfer of the C-1 hydrogen and two electrons to NAD+ . The pH dependence on the alkaline side may be related to the uridine nucleotide-dependent conformational transition that is an essential step in the reduction of epimerase.NAD+ to epimerase.NADH by sugars. J Biol Chem, 1988 Feb 25, 263(6), 2848 - 52 A 3' splice site mutation in a nuclear gene encoding a mitochondrial ribosomal protein in Neurospora crassa; Kuiper MT et al.; We showed previously that the cyt-21+ gene of Neurospora crassa encodes a mitochondrial ribosomal protein homologous to Escherichia coli ribosomal protein S-16 (Kuiper, M . T . R., Akins, R . A., Holtrop, M., de Vries, H., and Lambowitz, A . M . (1988) J . Biol . Chem . 263, 2840-2847) . A mutation in this gene, cyt-21-1, results in deficiency of mitochondrial small ribosomal subunits and small rRNA (Collins, R . A., Bertrand, H., LaPolla, R . J., and Lambowitz, A . M . (1979) Mol . Gen . Genet . 177, 73-84) . In the present work, cloning and sequencing of the cyt-21-1 mutant allele show that it contains a single dG to dA transition at the 3' splice site AG of the first intron in the protein coding region . This mutation leads to inactivation of the normal 3' splice site and activation of a cryptic 3' splice site, 15 nucleotides downstream . The use of this cryptic splice site results in an in-frame deletion of 5 amino acids from the cyt-21 protein . Comparison of mutant and wild-type mitochondrial small ribosomal subunit proteins showed one protein, S-24, with an altered electrophoretic mobility, consistent with the predicted deletion . The mutant ribosomal protein is still capable of binding to mitochondrial small ribosomal subunits, but results in abnormal mitochondrial ribosome assembly. J Biol Chem, 1988 Feb 25, 263(6), 2840 - 7 Isolation and analysis of the Neurospora crassa Cyt-21 gene . A nuclear gene encoding a mitochondrial ribosomal protein; Kuiper MT et al.; The Neurospora crassa nuclear mutant cyt-21-1 (originally 297-24; Pittenger, T.H., and West, D.J . (1979) Genetics 93, 539-555) has a defect leading to gross deficiency of mitochondrial small ribosomal subunits . Here, we have cloned the cyt-21+ gene from a N . crassa genomic library, using the sib selection procedure (Akins, R . A., and Lambowitz, A . M . (1985) Mol . Cell Biol . 5, 2272-2278) . The genomic clone contains a short split gene encoding a basic protein of 107 amino acid residues . This protein shows strong homology to Escherichia coli ribosomal protein S-16 . Comparison of mutant and wild-type mitochondrial ribosomal proteins (Kuiper, M . T . R., Holtrop, M., Vennema, H., Lambowitz, A . M., and de Vries, H . (1988) J . Biol . Chem . 263, 2848-2852) indicates that the cyt-21 gene encodes N . crassa mitochondrial ribosomal protein S-24 . The expression of the cyt-21+ gene is regulated such that the level of the putative cyt-21+ mRNA is increased about 5-fold when mitochondrial protein synthesis is inhibited . We suggest that this reflects part of a general mechanism for coordinately activating Neurospora nuclear genes that encode mitochondrial constituents in response to impaired mitochondrial function . This is the first report of the cloning and characterization of a mitochondrial ribosomal protein gene from N . crassa. J Biol Chem, 1988 Feb 25, 263(6), 2830 - 9 RPA190, the gene coding for the largest subunit of yeast RNA polymerase A; Memet S et al.; Yeast RNA polymerases are being extensively studied at the gene level . The entire gene encoding the largest subunit of RNA polymerase A, A190, was isolated and characterized in detail . Southern hybridization and gene disruption experiments showed that the RPA190 gene is unique in the haploid yeast genome and essential for cell viability . Nuclease S1 mapping was used to identify mRNA 5' and 3' termini . RPA190 encodes a polypeptide chain of 186,270 daltons in a large uninterrupted reading frame . A dot matrix comparison of the deduced amino acid sequence of subunit A190 with Escherichia coli beta' and cognate subunits B220 and C160 from yeast RNA polymerases B and C showed a conserved pattern of homology regions (I-VI) . A potential DNA-binding site (zinc-binding motif) is conserved in the N-terminal region I . Remarkably, the A190 subunit does not harbor the heptapeptide repeated sequence present in the B220 subunit . The sequence of the A190 subunit diverges from B220 and C160 by the presence of two hydrophilic domains inserted between homology regions I and II, and V and VI . From their codon usage and third base pyrimidine bias, RNA polymerase genes RPA190, RPB220, RPC160, and RPC40 fall among yeast genes expressed at an average level . The RPA190 5'-flanking region contains features present in other polymerase genes that might function in regulation. J Biol Chem, 1988 Feb 25, 263(6), 2719 - 23 Functionality of the dnaA protein binding site in DNA replication is orientation-dependent; Seufert W et al.; We analyzed the functionality of different dnaA protein binding sites by assaying in vitro dnaA-dependent replication of pBR322 derivatives . Single dnaA sites from oriC and from the mioC and dnaA gene promoters were active when combined with the primer generating element of pBR322 in a proper distance . Prereplisome assembly did not require sequences in addition to the 9-base pair consensus dnaA binding site . Inversion of the structurally asymmetric dnaA site relative to its orientation in wild type pBR322 resulted in a marked reduction in replication efficiency, as observed with five different dnaA sites studied . The direction of DNA replication was not affected. J Biol Chem, 1988 Feb 25, 263(6), 2597 - 602 Stringent and growth control of rRNA synthesis in Escherichia coli are both mediated by ppGpp; Baracchini E et al.; Weak stringent or relaxed responses were induced in Escherichia coli (relA+), using mild amino acid starvation or treatment with chloramphenicol at low concentrations, respectively, such that the growth rate was barely reduced . In this manner, the intracellular concentration of the nucleotide guanosine tetraphosphate, ppGpp, could be varied in any desired range between 0 and 1000 pmol of ppGpp per OD460 unit of culture mass . At the same time, the rate of synthesis of stable RNA (rs; rRNA and tRNA) was measured, relative to the total instantaneous rate of RNA synthesis (rt) . The correlation between the cytoplasmic concentration of ppGpp and stable RNA gene activity (rs/rt) was the same as that observed previously with relA+ and relA strains growing exponentially at different rates in different media . This suggests that the distinction between growth control and stringent control of stable RNA synthesis is arbitrary, and that both kinds of control reflect the same ppGpp-dependent phenomenon . By increasing the stable RNA gene dosage, using high copy number plasmids carrying an rrn gene, we have tested the idea that ppGpp partitions the bacterial RNA polymerase into two forms with different probabilities to initiate at stable RNA and mRNA promoters . The relaxed response was not significantly altered, but the extent of the stringent response was reduced by the presence of extra rrn genes . The results agree with quantitative predictions derived from the RNA polymerase partitioning hypothesis. J Immunol Methods, 1988 Feb 24, 107(1), 67 - 72 Detection of alpha 1-antitrypsin from recombinant Escherichia coli lysates utilizing the particle concentration fluorescence immunoassay; Del Tito BJ Jr et al.; A particle concentration fluorescence immunoassay for the quantitative determination of human alpha 1-antitrypsin in Escherichia coli is described . The principle advantages of this system are speed, automation and a high level of sensitivity compared with enzyme assays and Western blot analysis . Two monoclonal antibodies recognizing different epitopes on the protein are used for the detection and quantitation of alpha 1-antitrypsin . This method has a measured range of 30-2500 ng/ml with a mean accuracy of 5.5% and a precision of 5.1%. Biochemistry, 1988 Feb 23, 27(4), 1205 - 12 Properties of the high-affinity single-stranded DNA binding state of the Escherichia coli recA protein; Menetski JP et al.; The properties of the high-affinity single-stranded DNA (ssDNA) binding state of Escherichia coli recA protein have been studied . We find that all of the nucleoside triphosphates that are hydrolyzed by recA protein induce a high-affinity ssDNA binding state . The effect of ATP binding to recA protein was partially separated from the ATP hydrolytic event by substituting calcium chloride for magnesium chloride in the binding buffer . Under these conditions, the rate of ATP hydrolysis is greatly inhibited . ATP increases the affinity of recA protein for ssDNA in a concentration-dependent manner in the presence of both calcium and magnesium chloride with apparent Kd values of 375 and 500 microM ATP, respectively . Under nonhydrolytic conditions, the molar ratio of ATP to ADP has an effect on the recA protein ssDNA binding affinity . Over an ATP/ADP molar ratio of 2-3, the affinity of recA protein for ssDNA shifts cooperatively from a low-to a high-affinity state. Biochemistry, 1988 Feb 23, 27(4), 1086 - 94 A description of conformational transitions in the Pribnow box of the trp promoter of Escherichia coli; Lefevre JF et al.; Selective changes in the NMR parameters of the sequence of CGTACTAGTTAACTAGTACG, which corresponds to the trp operator of Escherichia coli, were observed as a function of temperature . The changes were localized to the sequence TTAA in the Pribnow box (underlined) . Differential changes in chemical shift were analyzed in terms of a three-state model (states I, II, and III) to give the equilibrium constants, enthalpy changes, and populations . The midpoints of the first and second transitions were 9 and 30 degrees C, with enthalpy changes of 58 and 35 kcal/mol, respectively . Measurement of the spin-lattice and cross-relaxation rate constants at different temperatures allowed some structural conclusions to be drawn about the nature of the transitions . The line width of the H2 of A11 goes through a maximum at about 30 degrees C, indicating moderately fast exchange between the states . The rate constants for exchange at the midpoints were about 200 (I----II) and 250 (II----III) s-1 . Taking these findings into account, we propose a mechanism for the interaction between RNA polymerase and the promoter . This mechanism can explain the temperature dependence observed for the initiation of transcription. Biochemistry, 1988 Feb 23, 27(4), 1094 - 104 Dynamics of repressor-operator recognition: the Tn10-encoded tetracycline resistance control; Kleinschmidt C et al.; Binding of the Tet repressor to nonspecific and specific DNA leads to quenching of the Tet fluorescence by approximately 22% and approximately 35%, respectively . This effect is used for a direct, quantitative characterization of the binding equilibria and dynamics involved in the recognition of the operator by its repressor . From the dependence of the nonspecific binding constant on the ion concentration, it is concluded that nonspecific binding is almost completely driven by the entropy change resulting from the release of three to four Na+ ions from the double helix upon protein binding . Formation of the specific complex is driven by a higher entropy term resulting from the release of seven to eight Na+ ions and in addition by a free energy term of -33 kJ/mol from nonelectrostatic interactions, which are attributed to the specific contacts . The dynamics of the repressor-operator recognition are resolved by stopped-flow measurements at various salt concentrations and for different DNA chain lengths into two separate steps . The first step follows a second-order mechanism and results in an intermediate complex associated with formation of about three to four electrostatic contacts between protein and DNA; apparently, this complex is equivalent to the nonspecific complex . The existence of an intermediate is also indicated by experiments in mixed Na+-Mg2+ buffers, which can be described with high accuracy by competition of Mg2+ and protein . The intermediate complex is formed at a rate of 3 X 10(8) M-1 s-1 and is converted in the second reaction step to the specific complex with a rate constant of 6 X 10(4) s-1, which is almost independent of the salt concentration . Our interpretation and the parameters obtained from our model are confirmed by competition of nonspecific DNA with operator DNA for repressor binding . The observed maximal rate constant of 3 X 10(8) M-1 s-1 is very close to theoretical predictions for the association without a sliding mechanism . The very small dependence of the observed rate constants on the chain length shows that the Tet repressor is not able to slide over any substantial distance even at low salt concentrations . The question of a potential contribution from sliding under our experimental conditions is critically discussed . The absence of sliding in the case of the Tet repressor under physiological conditions is compared with the high sliding efficiency of the lac repressor and is discussed with respect to possible molecular mechanisms of sliding in relation to biological function. J Mol Biol, 1988 Feb 20, 199(4), 559 - 73 SUF12 suppressor protein of yeast . A fusion protein related to the EF-1 family of elongation factors; Wilson PG et al.; Mutations at the suf12 locus were isolated in Saccharomyces cerevisiae as extragenic suppressors of +1 frameshift mutations in glycine (GGX) and proline (CCX) codons, as well as UGA and UAG nonsense mutations . To identify the SUF12 function in translation and to understand the relationship between suf12-mediated misreading and translational frameshifting, we have isolated an SUF12+ clone from a centromeric plasmid library by complementation . SUF12+ is an essential, single-copy gene that is identical with the omnipotent suppressor gene SUP35+ . The 2.3 x 10(3) base SUF12+ transcript contains an open reading frame sufficient to encode a 88 x 10(3) Mr protein . The pattern of codon usage and transcript abundance suggests that SUF12+ is not a highly expressed gene . The linear SUF12 amino acid sequence suggests that SUF12 has evolved as a fusion protein of unique N-terminal domains fused to domains that exhibit essentially co-linear homology to the EF-1 family of elongation factors . Beginning internally at amino acid 254, homology is more extensive between the SUF12 protein and EF-1 alpha of yeast (36% identity; 65% with conservative substitutions) than between EF-1 alpha of yeast and EF-Tu of Escherichia coli . The most extensive regions of SUF12/EF-1 alpha homology are those regions that have been conserved in the EF-1 family, including domains involved in GTP and tRNA binding . It is clear that SUF12 and EF-1 alpha are not functionally equivalent, since both are essential in vivo . The N-terminal domains of SUF12 are unique and may reflect, in part, the functional distinction between these proteins . These domains exhibit unusual amino acid composition and extensive repeated structure . The behavior of suf12-null/SUF12+ heterozygotes indicates that suf12 is co-dominantly expressed and suggests that suf12 allele-specific suppression may result from functionally distinct mutant proteins rather than variation in residual wild-type SUF12+ activity . We propose a model of suf12-mediated frameshift and nonsense suppression that is based on a primary defect in the normal process of codon recognition. J Mol Biol, 1988 Feb 20, 199(4), 623 - 35 Interactions of Escherichia coli transcription termination factor rho with RNA . II . Electron microscopy and nuclease protection experiments; Bear DG et al.; Structural aspects of the interaction between Escherichia coli transcription termination factor rho and RNA have been investigated, using nuclease protection assays and electron microscopy . A synthetic RNA, poly(rC), has been used as a substrate for these studies, since it binds tightly to rho and acts as a strong activator of the ATPase activity of rho . Digestion of oligo(rC)-rho complexes with ribonuclease A yields oligo(rC) fragments with a maximum length of 70 to 80 nucleotide residues . Electron micrographs demonstrate that rho binds to poly(rC) as a toroid-shaped oligomer with an outside diameter of approximately 120 A . Taken together with data from the accompanying paper, which shows that the RNA binding site size per rho monomer is 13(+/- 1) nucleotide residues, we infer that rho binds RNA as a hexamer with an oligomeric site size of 72 to 84 residues . Further analysis of the electron micrographs has revealed that the polynucleotide chain is wrapped around, or condensed within, the protein oligomer . rho hexamers bind to poly(rC) with moderate co-operativity (omega = 380 +/- 60), displaying no significant preference for binding to chain ends versus internal sites on the polynucleotide chain . These findings and those of the companion paper are discussed in terms of various models for the structure of the rho-RNA complex in transcription termination. J Mol Biol, 1988 Feb 20, 199(4), 609 - 22 Interactions of Escherichia coli transcription termination factor rho with RNA . I . Binding stoichiometries and free energies; McSwiggen JA et al.; In this paper we examine the binding of Escherichia coli transcription termination factor rho to single-stranded RNA . Random polyribonucleotide copolymers containing low ratios of the fluorescent base 1,N6-ethenoadenosine have been synthesized using polynucleotide phosphorylase . Binding of rho to these polynucleotides elicits a significant increase in fluorescence, thus allowing either the direct monitoring of the titration of these polynucleotides with rho or measurement of the competitive displacement of the protein from these probes with other nucleic acids, even in the presence of biologically significant concentrations of ATP . By these techniques, it is shown that the binding site size (n) of rho protein to polynucleotides is 13(+/- 1) nucleotide residues per rho monomer (or 78(+/- 6) nucleotide residues per rho hexamer) . Binding constants (K) and co-operativity parameters (omega) for the binding of rho to these polynucleotides have been measured as a function of nucleotide composition and of salt concentration . The results show that the affinity of rho for cytosine residues is quite strong and salt concentration independent, whilst binding to uridine residues is somewhat weaker and very salt concentration dependent . Poly(rC) and poly(dC) bind to rho competitively and with equal affinity and site size, although poly(rC) is the strongest cofactor for activating rho-dependent ATPase and poly(dC) has no ATPase cofactor activity at all . It is also shown that ATP (or ADP or ATP-gamma-S) binding does not change the binding site size of rho on RNA nor decrease its affinity for RNA binding . Circular dichroism measurements of rho binding to phage R17 RNA suggest that the affinity (K omega) of rho for RNA may be increased by ATP . The possible significance of these results for models of rho-dependent transcription termination is discussed in the companion paper. Science, 1988 Feb 19, 239(4842), 888 - 93 Three-dimensional structure of an oncogene protein: catalytic domain of human c-H-ras p21; de Vos AM et al.; The crystal structure at 2.7 A resolution of the normal human c-H-ras oncogene protein lacking a flexible carboxyl-terminal 18 residue reveals that the protein consists of a six-stranded beta sheet, four alpha helices, and nine connecting loops . Four loops are involved in interactions with bound guanosine diphosphate: one with the phosphates, another with the ribose, and two with the guanine base . Most of the transforming proteins (in vivo and in vitro) have single amino acid substitutions at one of a few key positions in three of these four loops plus one additional loop . The biological functions of the remaining five loops and other exposed regions are at present unknown . However, one loop corresponds to the binding site for a neutralizing monoclonal antibody and another to a putative "effector region"; mutations in the latter region do not alter guanine nucleotide binding or guanosine triphosphatase activity but they do reduce the transforming activity of activated proteins . The data provide a structural basis for understanding the known biochemical properties of normal as well as activated ras oncogene proteins and indicate additional regions in the molecule that may possibly participate in other cellular functions. Biochem J, 1988 Feb 15, 250(1), 25 - 31 Purification and regulatory properties of isocitrate lyase from Escherichia coli ML308; MacKintosh C et al.; Isocitrate lyase was purified to homogeneity from Escherichia coli ML308 . Its subunit Mr and native Mr were 44,670 +/- 460 and 17,000-180,000 respectively . The kinetic mechanism of the enzyme was investigated by using product and dead-end inhibitors of the cleavage and condensation reactions . The data indicated a random-order equilibrium mechanism, with formation of a ternary enzyme-isocitrate-succinate complex . In an attempt to predict the properties of isocitrate lyase in intact cells, the effects of pH, inorganic anions and potential regulatory metabolites on the enzyme were studied . The Km of the enzyme for isocitrate was 63 microM at physiological pH and in the absence of competing anions . Chloride, phosphate and sulphate ions inhibited competitively with respect to isocitrate . Phosphoenolpyruvate inhibited non-competitively with respect to isocitrate, but the Ki value suggested that this effect was unlikely to be significant in intact cells . 3-Phosphoglycerate was a competitive inhibitor . At the concentration reported to occur in intact cells, this metabolite would have a significant effect on the activity of isocitrate lyase . The available data suggest that the Km of isocitrate lyase for isocitrate is similar to the concentration of isocitrate in E . coli cells growing on acetate, about one order of magnitude higher than the Km determined in vitro in the absence of competing anions. Eur J Biochem, 1988 Feb 15, 172(1), 155 - 9 Excision of apurinic and/or apyrimidinic sites from DNA by nucleolytical enzymes from rat brain; Ivanov VA et al.; Apurinic and/or apyrimidinic (AP) sites were excised from PM2 phage DNA by two enzymes: an AP endodeoxyribonuclease isolated from rat neocortex chromatin and a rat brain exodeoxyribonuclease, DNase B III . The resulting gap was filled with DNA polymerase beta prepared from rat liver and finally ligated by Escherichia coli DNA ligase. FEBS Lett, 1988 Feb 15, 228(2), 263 - 7 Electron microscopy study of Q beta replicase; Berestowskaya NH et al.; Purified preparations of Q beta replicase have been studied by electron microscopy using a negative staining technique, and a three-dimensional model of the enzyme molecule has been constructed . The molecule of this four-subunit protein appears to be a compact structure having a size of 100 +/- 10 A; it is subdivided into two unequal bipartite subparticles . The conclusion has been made that all the constituent subunits, including the ribosomal protein Sl, acquire a globular conformation when associated in the replicase complex. FEBS Lett, 1988 Feb 15, 228(2), 254 - 8 Structural differences between oxidized and reduced thioredoxin monitored by two-dimensional 1H NMR spectroscopy; Dyson HJ et al.; Two-dimensional high resolution NMR techniques have been applied to study the structural differences between the oxidized and reduced forms of Escherichia coli thioredoxin in solution . Sequential proton resonance assignments indicate only limited conformational changes; major chemical shift differences are found for a few residues in a beta-strand immediately preceding the active site S-S bridge and the active site itself . Additional resonance shifts are observed for several residues distant in the primary sequence . The X-ray structure of oxidized thioredoxin shows that these residues form a flat hydrophobic surface, close to the active site S-S bridge, which is probably involved in interactions with other protein molecules. Biochem Biophys Res Commun, 1988 Feb 15, 150(3), 1115 - 21 Effect of phorbol ester on contractile response of aorta from endotoxic rats; Wakabayashi I et al.; The influence of phorbol ester on the isometric contractile response of aorta from endotoxic rats was examined . In endotoxic rat aorta, the contractile responses to KCl and phorbol 12,13-dibutyrate (PDBu) were both remarkably diminished, compared to those in control rat aorta . Preincubation with PDBu augmented the aortic contractile response to KCl in both control and endotoxic rats . This augmentative effect of PDBu was significantly more pronounced in endotoxic rats than in controls . When the contractile response to 80 mM KCl reached a plateau after PDBu pretreatment, addition of 5 mM CaCl2 (final concentration) to the organ bath completely reversed the diminished contractile response of endotoxic rat aorta to the control level . These results suggest that the hyporesponsiveness of endotoxic rat aorta to KCl may be caused by decreases in both protein kinase C mediated response and calcium sensitivity of vascular smooth muscle cells. J Biol Chem, 1988 Feb 15, 263(5), 2571 - 4 Structure determination of a monoclonal Fab fragment specific for histidine-containing protein of the phosphoenolpyruvate: sugar phosphotransferase system of Escherichia coli; Prasad L et al.; Jel 42 is a monoclonal antibody specific for histidine-containing protein, a small phosphocarrier protein required for sugar transport in Escherichia coli . Fab fragments prepared from this antibody by papain digestion consisted of three major isoelectric forms which were separated on a chromatofocusing column . Two of these forms produced large crystals in space group P21 and unit cell dimensions a = 117.48 A, b = 66.56 A, c = 67.31 A, and beta = 118.7 degrees, with two Fab fragments per asymmetric unit . Data were collected to 3.5-A resolution . The structure of Fab Jel 42 was solved by the Molecular Replacement method (least-squares refined to R = 0.282) using the known structure of Fab HED 10 (12) as the search model; the amino acid residues of the hypervariable and elbow regions of Fab HED 10 were omitted from the starting model . A Fourier map calculated at this stage revealed electron density which corresponded to the hypervariable loops forming the antigen-binding crevice and the elbow region of Fab Jel 42 . The elbow angles for the two independent Fab molecules are 159 and 167 degrees, similar to that of the Fab HED 10 search model which has an elbow angle of 162 degrees . There is no local noncrystallographic axis of symmetry relating the two molecules in the asymmetric unit. J Biol Chem, 1988 Feb 15, 263(5), 2477 - 82 Evidence of histidine phosphorylation in isocitrate lyase from Escherichia coli; Robertson EF et al.; Escherichia coli isocitrate lyase (EC 4.1.3.1.) can be phosphorylated in vitro by an ATP-dependent reaction . The enzyme becomes phosphorylated by an endogenous kinase when partially purified sonic extracts are incubated with {gamma-32P}ATP . Treatment of isocitrate lyase with diethyl pyrocarbonate, a histidine-modifying reagent, blocked incorporation of {32P}phosphate from {gamma-32P}ATP . The isoelectric point of the enzyme was altered by treatment with phosphoramidate, a histidine phosphorylating agent, which suggests that isocitrate lyase can be phosphorylated at a histidine residue(s) . Immunoprecipitated 32P-labeled isocitrate lyase was subjected to alkaline hydrolysis, mixed with chemically synthesized phosphohistidine standards, and analyzed by anion exchange chromatography . Characterization of the phosphoamino acid was based on the demonstration that the 32P-labeled product from alkali-hydrolyzed isocitrate lyase comigrated with synthetic 1-phosphohistidine . In addition, loss of catalytic activity after treatment with potato acid phosphatase indicates that catalytically active isocitrate lyase is the phosphorylated form of the enzyme. J Biol Chem, 1988 Feb 15, 263(5), 2163 - 9 In vitro mutagenesis of Escherichia coli citrate synthase to clarify the locations of ligand binding sites; Anderson DH et al.; In vitro mutagenesis techniques have been used to investigate two structure-function questions relating to the allosteric citrate synthase of Escherichia coli . The first question concerns the binding site of alpha-keto-glutarate, which is a structural analogue of the substrate oxaloacetate and yet has been suggested to be an allosteric inhibitor of the enzyme . Using oligonucleotide-directed mutagenesis of the cloned E . coli citrate synthase gene, we prepared missense mutants, designated CS226H----Q and CS229H----Q, in which histidine residues at positions 226 and 229, respectively, were replaced by glutamine . In the homologous pig heart citrate synthase it is known (Wiegand, G., and Remington, S . J . (1986) Annu . Rev . Biophys . Biophys . Chem . 15, 97-117) that the equivalent of His-229 helps to bind oxaloacetate, while the equivalent of His-226 is nearby . Kinetic and ligand binding measurements showed that CS226H----Q had a reduced affinity for oxaloacetate and alpha-ketoglutarate, while CS229H----Q bound oxaloacetate even less effectively, and was not inhibited by alpha-ketoglutarate at all under our conditions . This parallel loss of binding affinities for oxaloacetate and alpha-ketoglutarate, in two mutants altered in residues at the active site of E . coli citrate synthase, strongly suggests that inhibition of this enzyme by alpha-ketoglutarate is not allosteric but occurs by competitive inhibition at the active site . The second question investigated was whether the known inhibition by acetyl-CoA of binding of NADH, an allosteric inhibitor of E . coli citrate synthase, occurs heterotropically, as an indirect result of acetyl-CoA binding at the active site, or directly, by competition at the allosteric NADH binding site . Using existing restriction sites in the cloned E . coli citrate synthase gene, we prepared a deletion mutant which lacked 24 amino acids near what is predicted to the acetyl-CoA-binding portion of the active site . The mutant protein was inactive, and acetyl-CoA did not bind to the active site but still inhibited NADH binding . Thus acetyl-CoA can interact with both the allosteric and the active sites of this enzyme. J Biol Chem, 1988 Feb 15, 263(5), 2152 - 8 Native-like intermediate on the folding pathway of Escherichia coli succinyl-CoA synthetase; Khan IA et al.; The transition between the native and denatured states of the tetrameric succinyl-CoA synthetase from Escherichia coli has been investigated by circular dichroism, fluorescence spectroscopy, cross-linking by glutaraldehyde and activity measurements . At pH 7.4 and 25 degrees C, both denaturation of succinyl-CoA synthetase by guanidine hydrochloride and refolding of the denatured enzyme have been characterized as reversible reactions . In the presence of its substrate ATP, the denatured enzyme could be successfully reconstituted into the active enzyme with a yield of 71-100% . Kinetically, reacquisition of secondary structure by the denatured enzyme was rapid and occurred within 1 min after refolding was initiated . On the other hand, its reactivation was a slow process which continued up to 25 min before 90% of the native activity could be restored . Both secondary and quaternary structures of the enzyme, reconstituted in the absence of ATP, were indistinguishable from those of the native enzyme but the renatured protein was catalytically inactive . This observation indicates the presence of catalytically inactive tetramer as an intermediate in the reconstitution process . The reconstituted protein could be reactivated by ATP even 10 min after the reacquisition of the native secondary structure by the refolding protein . However, reactivation of the protein by ATP 60 min after the regain of secondary structure was significantly less, suggesting that rapid refolding and reassociation of the monomers into a native-like tetramer and reactivation of the tetramer are sequential events; the latter involving slow and small conformational rearrangements in the refolded enzyme that are likely to be associated with phosphorylation. J Biol Chem, 1988 Feb 15, 263(5), 2344 - 51 The recognition by RNase P of precursor tRNAs; Baer MF et al.; We have generated mutants of M1 RNA, the catalytic subunit of Escherichia coli RNaseP, and have analyzed their properties in vitro and in vivo . The mutations, A333----C333, A334----U334, and A333 A334----C333 U334 are within the sequence UGAAU which is complementary to the GT psi CR sequence found in loop IV of all E . coli tRNAs . We have examined: 1) whether the mutant M1 RNAs are active in processing wild type tRNA precursors and 2) whether they can restore the processing defect in mutant tRNA precursors with changes within the GT psi CR sequence . As substrates for in vitro studies we used wild type E . coli SuIII tRNA(Tyr) precursor, and pTyrA54, a mutant tRNA precursor with a base change that could potentially complement the U334 mutation in M1 RNA . The C333 mutation had no effect on activity of M1 RNA on wild type pTyr . The U334 mutant M1 RNA, on the other hand, had a much lower activity on wild type pTyr . However, use of pTyrA54 as substrate instead of wild type pTyr did not restore the activity of the U334 mutant M1 RNA . These results suggest that interactions via base pairing between nucleotides 331-335 of M1 RNA and the GT psi CG of pTyr are probably not essential for cleavage of these tRNA precursors by M1 RNA . For assays of in vivo function, we examined the ability of mutant M1 RNAs to complement a ts mutation in the protein component of RNaseP in FS101, a recA- derivative of E . coli strain A49 . In contrast to wild type M1 RNA, which complements the ts mutation when it is overproduced, neither the C333 nor the U334 mutant M1 RNAs was able to do so. J Biol Chem, 1988 Feb 15, 263(5), 2146 - 51 Structure of the yeast HOM3 gene which encodes aspartokinase; Rafalski JA et al.; The yeast HOM3 gene has been cloned molecularly by complementation of a HOM3 mutant . The gene is located about 8 kilobase pairs from HIS1 and is present as a single copy in the yeast genome . Mutations in HOM3 result in a requirement for threonine and methionine (or homoserine) for growth and a lack of detectable aspartokinase activity . The nucleotide sequence of HOM3 predicts an enzyme 414 amino acids long that shows homology to the three Escherichia coli aspartokinases, indicating that it is the structural gene for yeast aspartokinase . An approximately 1800-base pair mRNA is transcribed from the HOM3 gene, initiating at several start sites, 80 and 70 base pairs downstream, respectively, from two TATA boxes . Upstream of the TATA boxes is a single TGACTC sequence . This sequence has been shown to be essential for regulation of several genes that encode amino acid biosynthetic enzymes by the general control system . However, no increase in aspartokinase mRNA is observed under general control derepressing conditions. Biochem Biophys Res Commun, 1988 Feb 15, 150(3), 1106 - 14 Site-specific mutagenesis of the human interleukin-1 beta gene: structure-function analysis of the cysteine residues; Kamogashira T et al.; Human interleukin-1 beta (IL-1 beta) has two cysteines located at amino acid residues 8 and 71 of the mature protein consisting 153 amino acids . To clarify the role of these characteristic cysteine residues in IL-1 beta, at first, an expression plasmid for site-specific mutagenesis has been constructed by inserting the ori and intergenic region of phage f1 into the IL-1 beta expression vector . The plasmid can be used not only for isolation of the modified IL-1 beta gene but for expression of the mutant protein in Escherichia coli . Using this plasmid, each of the cysteine codons in IL-1 beta gene was changed to serine or alanine codon, or deleted . The modified IL-1 beta showed that the two cysteine residues in IL-1 beta are not essential for biological activity but not to be eliminated for the maintenance of the functional structure of IL-1 beta. J Biol Chem, 1988 Feb 15, 263(5), 2409 - 16 The sulfate activation locus of Escherichia coli K12: cloning, genetic, and enzymatic characterization; Leyh TS et al.; The sulfate activation locus of Escherichia coli K12 has been cloned by complementation . The genes and gene products of this locus have been characterized by correlating the enzyme activity, complementation patterns, and polypeptides associated with subclones of the cloned DNA . The enzymes of the sulfate activation pathway, ATP sulfurylase (ATP:sulfate adenylyltransferase, EC 2.7.7.4) and APS kinase (ATP:adenosine-5'-phosphosulfate 3'-phosphotransferase, EC 2.7.1.25) have been overproduced approximately 100-fold . Overproduction of ATP sulfurylase requires the expression of both the cysD gene, encoding a 27-kDa polypeptide, and a previously unidentified gene, denoted cysN, which encodes a 62-kDa polypeptide . Purification of ATP sulfurylase to homogeneity reveals that the enzyme is composed of two types of subunits which are encoded by cysD and cysN . Insertion of a kanamycin resistance gene into plasmid or chromosomal cysN prevents sulfate activation and decreases expression of the downstream cysC gene . cysC appears to be the APS kinase structural gene and encodes a 21-kDa polypeptide . The genes are adjacent and are transcribed counterclockwise on the E . coli chromosome in the order cysDNC . cysN and cysC are within the same operon and cysDNC are not in an operon containing cysHIJ. J Biol Chem, 1988 Feb 15, 263(5), 2364 - 70 All four repeating domains of the endogenous inhibitor for calcium-dependent protease independently retain inhibitory activity . Expression of the cDNA fragments in Escherichia coli; Emori Y et al.; We have already determined the primary structure of the endogenous inhibitor for calcium-dependent protease (CANP inhibitor, calpastatin) from the cDNA sequence and revealed that the CANP inhibitor contains four internally repeating units which could be responsible for its multiple reactive sites (Emori, Y., Kawasaki, H., Imajoh, S., Imahori, K., and Suzuki, K . (1987) Proc . Natl . Acad . Sci . U.S.A . 84, 3590-3594) . Restriction fragments of the cDNA corresponding to each of the four domains (encoding 104-156 amino acid residues of the total 718 residues) were subcloned into the multicloning site of pUC9 or pUC18 in a direction and frame matched to the lacZ' open reading frame of the vector . Under the lac operator-promoter system, we succeeded in producing truncated fragments of the CANP inhibitor in Escherichia coli . The CANP inhibitor fragments were partially purified, and the inhibitory activities toward calcium-dependent protease (CANP) were examined . All fragments containing well conserved regions of about 30 amino acid residues (domains I-IV) located in the middle of the four units exhibited the inhibitory activity . However, their inhibitory activities varied considerably . Further truncation experiments revealed that small fragments containing 30-70 amino acid residues of the CANP inhibitor still retained inhibitory activity . From these experimental results the following conclusions can be drawn: 1) each of the four repeating units of the CANP inhibitor (about 140 amino acid residues) is a real functional unit and can inhibit CANP activity independently; and 2) domains corresponding to well conserved sequences of about 30 amino acid residues containing a consensus Thr-Ile-Pro-Pro-X-Tyr-Arg sequence are essential for the inhibitory activity, and the bordering regions are important for its modulation. Anal Biochem, 1988 Feb 15, 169(1), 132 - 7 Agarose gel electrophoresis of denatured RNA with silver staining; Skopp RN et al.; This paper describes agarose gel electrophoresis and silver staining of denatured RNAs . Glyoxal- or formaldehyde-denatured RNAs are electrophoresed in an agarose gel cast on a plastic support using an inert, low conductivity buffer . Following electrophoresis, the gel is stained with a sensitive silver stain . The method produces sharp, well-resolved bands and yields accurate RNA size estimates . Because of its sensitivity and simplicity, it is suitable for routine laboratory use. FEBS Lett, 1988 Feb 15, 228(2), 245 - 8 Bioenergetics of dihydrostreptomycin transport by Escherichia coli; Goss SR et al.; Previous demonstrations of the irreversibility of dihydrostreptomycin transport across the cytoplasmic membrane of Escherichia coli were not due to decreases in the magnitude of the cytoplasmic membrane potential (delta psi) . Irreversibility was probably not due to ATP hydrolysis being coupled to transport, because the rate of energy-dependent dihydrostreptomycin uptake was unaffected by 10-fold reduction in the cellular ATP level. Biochem Biophys Res Commun, 1988 Feb 15, 150(3), 979 - 86 tRNAPhe and tRNAPro are the near-ultraviolet molecular targets triggering the growth delay effect; Blondel MO et al.; The illumination of Escherichia coli cells with UVA light, 320 nm less than or equal to lambda less than or equal to 380 nm, triggers a transient growth and division delay . The built-in 4-thiouridine chromophore which absorbs light at 340 nm leads to the quantitative 8-13 crosslinking of a number of tRNA species corresponding to 50% of the bulk tRNA molecules . Determination of the tRNA acylation level by the various aminoacids shows that only the tRNA species acylated by Phe and Pro are strikingly affected in vivo . Both acylation levels decrease to less than 10% of their initial value during the illumination period, remain stable all along the growth lag and increase concomitantly with cell mass when growth resumes . Hence tRNA(Phe) and tRNA(Pro) are the UVA light molecular targets triggering growth delay and related effects of biological significance such as cell volume reduction, photoprotection and protection against UV mutagenesis (antiphotomutagenesis). Cell, 1988 Feb 12, 52(3), 355 - 65 Murine genomic DNA sequences replicating autonomously in mouse L cells; Holst A et al.; Plasmids that replicate autonomously in mouse L cells were constructed by inserting random genomic DNA fragments from Ltk- cells into a plasmid containing the HSV-1 thymidine kinase gene with a truncated low-efficiency promoter . HAT resistance was used as a selective marker . The presence of free plasmids in the DNA of transformants was demonstrated by hybridization with a specific plasmid probe, by electron microscopic visualization of circular DNA, and by recovering these plasmids by E . coli transformation . Nineteen differe |