Escherichia coli

J Gen Microbiol, 1988 Mar, 134 ( Pt 3), 763 - 9
Construction of cys:lac gene fusions in Escherichia coli and their use in the isolation of constitutive cysBc mutants; Hryniewicz M et al.; Operon fusions of the lacZ gene to two different genes of the cysteine regulon controlled by the cysB regulatory protein were isolated . The fusion strains were used for selection of cysB constitutive mutants . Three cysBc alleles have been characterized and cloned into multicopy plasmids.

J Gen Microbiol, 1988 Mar, 134 ( Pt 3), 599 - 604
Accumulation of LamB-LacZ hybrid proteins in intracytoplasmic membrane-like structures in Escherichia coli K12; Voorhout W et al.; The subcellular location of LamB-LacZ hybrid proteins in the Escherichia coli K12 strains pop3234 and pop3299 was investigated by immunocytochemical detection and protease-accessibility experiments . Induction of the synthesis of the hybrid proteins resulted in the appearance of membrane-like structures within the cytoplasm of the cells . Labelling of ultrathin cryosections of the cells with anti-beta-galactosidase or anti-LamB protein serum and protein-A-gold complexes revealed that the hybrid proteins were associated with these membrane-like structures or accumulated within the cytoplasm . Protease-accessibility experiments confirmed this localization . Moreover, when low quantities of hybrid proteins were produced, i.e . in uninduced pop3234 cells or in induced pop3299 cells, the hybrid proteins were accessible to trypsin from the periplasmic side of the inner membrane, leaving protected fragments with an apparent Mr of 83,000 . Apparently, these hybrid proteins are partly translocated through the inner membrane, resulting in membrane-spanning forms of the proteins.

Plasmid, 1988 Mar, 19(2), 94 - 102
Vectors for expression of truncated coding sequences in Escherichia coli; Simon MN et al.; We describe the construction of vectors for expressing in Escherichia coli DNA fragments obtained by progressive deletions of DNA inserts in single-stranded sequencing vectors as M13 or pTZ according to the methode of Dale et al . (Plasmid 1985, 13, 31-40) . These vectors, pIMS1, pIMS5, and pIMS6, harbor all of the elements required for the regulated expression of any open reading frame flanked by EcoRI restriction sites . The encoded peptides contain only a few vector-derived amino acids . A method is described for direct selection of recombinant clones by in situ RNA hybridization . The properties of the expression vector have been analyzed with a DNA deletion series obtained from the cDNA coding for the regulatory subunit of Dictyostelium discoideum cAMP-dependent protein kinase.

Plasmid, 1988 Mar, 19(2), 121 - 33
A single amino acid difference between Rep proteins of P1 and P7 affects plasmid copy number; Froehlich BJ et al.; P1 and P7 are closely related plasmid prophages which are members of the same incompatibility group . We report the complete DNA sequence of the replication region of P7 and compare it to that of P1 . The sequence predicts a single amino acid difference between the RepA proteins of these two plasmids, no differences in methylation sites or regions where dnaA protein is expected to bind, and no difference in the spacing of the major features of the two replicons . A P1 replicon with a mutation in repA, the gene that encodes an essential replication protein, is complemented for replication by providing either the P1 RepA protein (RepA1) or the P7 RepA protein (RepA7) in trans . Furthermore, when either of these proteins is supplied in trans, the plasmid copy number of P1 cop mutants drops to that of P1 cop+ . However, when RepA7 is supplied, the copy number of P1 cop and P1 cop+ is higher than that when RepA1 is supplied . This indicates that the single amino acid difference between the two versions of the RepA protein plays an important role in determining the plasmid copy number.

Mikrobiologiia, 1988 Mar-Apr, 57(2), 347 - 51
{A rapid method for determining the viability of Escherichia coli cells subjected to the action of low temperatures}; Govorunov IG et al.; When Escherichia coli cells are frozen at a low temperature, various damages appear in them, in particular, in the membranous apparatus . Only stable disorders in the barrier properties of the cytoplasmic membranes are of a critical importance for the cell viability . These disorders should be taken into account when express methods are developed for assaying the viability of bacterial cells . Critical structures (properties) are to be revealed by their analysis after varying the intensity (dose) of the main damaging factors . Provided that the critical feature of each cell has two states (damaged and intact) after the action of extreme factors, its quantitative change correlates in a linear mode with the number of viable cells in the population.

Mol Gen Mikrobiol Virusol, 1988 Mar, (3), 43 - 8
{Effect of phospholipase on cation-induced transmembrane transport of DNA in Escherichia coli}; Sabel'nikov AG et al.; Incubation of bacterial cells in 0.1 M CaCl2 at 0 degrees C considerably increases the amount of phospholipids susceptible to action of a specific enzyme of phospholipid metabolism phospholipase C (hydrolysis to diacylglycerides) . In process of incubation in CaCl2 solutions at 0 degrees C the expressed activity of an endogenous enzyme phospholipase A has been registered in cellular samples . Binding of the enzyme by the cells under conditions unfavourable for phospholipids hydrolysis (0 degrees C) suppresses strongly and reversibly cellular ability to DNA transformation without affecting cellular survival . As calculated, the enzyme molecules cover about 10% of cellular surface while inhibiting 90% of transmembrane transfer . The obtained data are considered to be a solid argument supporting the important role of the membrane phospholipids in the mechanism of cation-induced DNA transfer into the cell.

EMBO J, 1988 Mar, 7(3), 835 - 41
DNA-binding properties of an adenovirus 289R E1A protein; Chatterjee PK et al.; An adenovirus 2 289 amino acid (289R) E1A protein purified from Escherichia coli has been shown to interact with DNA by two independent methods . UV-crosslinking of complexes containing unmodified, uniformly 32P-labelled DNA and purified E1A protein induced efficient labelling of the protein with covalently attached oligonucleotides, indicating that the E1A protein itself contacts DNA . Discrete nucleoprotein species were also observed when E1A protein--DNA complexes were analysed by gel electrophoresis . Although the 289R E1A protein exhibited no significant binding to single-stranded DNA or to RNA, no evidence for its sequence-specific binding to double-stranded DNA was obtained with either assay . Identification of the sites of covalent attachment of 32P-labelled oligonucleotides by partial proteolysis of the crosslinked E1A protein indicated that the interaction of this protein with DNA is mediated via domain(s) in the C-terminal half of the protein . Such previously unrecognized DNA-binding activity is likely to contribute to the regulatory activities of this important adenoviral protein.

Virology, 1988 Mar, 163(1), 93 - 103
Functional and antigenic domains of the dengue-2 virus nonstructural glycoprotein NS-1; Putnak JR et al.; The gene coding for the nonstructural glycoprotein of dengue-2 virus was cloned, sequenced, and expressed in Escherichia coli . There was about 70% conservation at the amino acid level with dengue serotypes 1 and 4 suggesting an important common function for this protein . Conserved hydrophobic domains were found both before the amino-terminus and at the carboxy-terminus, consistent with transmembrane roles . Evidence for at least partial translocation of NS-1 through the inner membrane of E . coli was found . Also conserved were two signals for N-linked glycosylation located near the middle of NS-1 . Various regions of NS-1 were tested for antigenicity with mouse and rabbit polyclonal and mouse monoclonal antibodies . The mouse polyclonal antibodies, made against a crude dengue-infected mouse brain immunogen, reacted most strongly with N-terminal regions of NS-1, whereas, the rabbit antiserum, made against purified NS-1 protein, reacted strongest with C-terminal regions . These findings suggest that immunogen presentation or species differences could be important . Although most of the monoclonals appeared to be unreactive in Western blots with expressed NS-1 proteins, two appeared to react strongly; the region from amino acid (a.a.) 273 to a.a . 346 was required for antibody binding . This region, located adjacent to the two conserved C-terminal hydrophobic domains, is highly charged and contains 5 of the 10 conserved cysteine residues of NS-1.

Microb Pathog, 1988 Mar, 4(3), 231 - 8
Investigation of minor components of Escherichia coli type 1 fimbriae: protein chemical and immunological aspects; Krogfelt KA et al.; Three minor components of type 1 fimbriae, FimF, FimG and FimH have been characterized . These proteins are integrated in the fimbrial structure; are responsible for the adhesive properties of the fimbriae but are not necessary for the production of fimbriae . Fimbriae were purified from different clones harbouring various combinations of the fimF, fimG and fimH genes in addition to the fimA gene . The FimF, FimG and FimH proteins were identified by two dimentional gel electrophoresis . They were found to have molecular weights of 18.0 kDa, 17.0 kDa and 30 kDa, respectively . The ratio of FimF, FimG and FimH components to the major subunit was less than 1:100 . The fimH protein especially was present in very small quantities . Sera raised against fimbriae from two of the clones (HB101/pPKL5 and HB101/pPKL4) were found by immunoblotting to be specific respectively for the major structural protein only (FimA), and for all components.

Mol Cell Probes, 1988 Mar, 2(1), 39 - 46
Synthesis of proteins in Escherichia coli immunoreactive with sera from individuals infected with human T-cell leukemia virus type I; Kitajima T et al.; The env-pX IV fused gene of human T-cell leukemia virus type I (HTLV-I) was inserted into lac promoter-directed expression vectors for production of viral proteins in bacteria . Resulting recombinant plasmids, pK13 and pK15, directed synthesis of fused proteins of 59 kDa (Env-p40x) and 100 kDa (Gag-Env-p40x), respectively . Western blot analysis showed that these proteins were reactive with sera of patients with adult T-cell leukemia (ATL) and retained multiple antigenic determinants of viral proteins . In combination with recombinant Gag protein {S . Itamura, K . Shigesada, M . Imai, N . Kobayashi, T . Hamakado, T . Harada and M . Hatanaka, Gene 38, 57-64 (1985)}, these bacterially synthesized proteins may provide a useful tool for differential diagnosis of ATL by detecting serum antibodies against individual viral proteins and for analysis of viral gene functions.

Mol Microbiol, 1988 Mar, 2(2), 255 - 63
Uropathogenic Escherichia coli can express serologically identical pili of different receptor binding specificities; Lund B et al.; Uropathogenic Escherichia coli frequently express P-pilus adhesins that recognize Gal alpha (1-4)Gal-containing glycoconjugates . The P-pilus adhesin of the E . coli isolate J96 is encoded by the pap gene cluster and has been shown to agglutinate P1-erythrocytes . We now describe a novel gene cluster from J96, prs, which is responsible for the agglutination of sheep erythrocytes . The structurally related gene clusters both expressed pili exhibiting the F13 antigen . Analysis of mutants of cloned prs sequences, together with trans-complementation of pap and prs genes, identified the sheep-specific adhesin as the 37-kD PrsG protein . The prsG gene occupies the equivalent position in prs as occupied by papG, which specifies the Gal alpha (1-4)Gal-specific adhesin of pap . PrsG was shown to be structurally distinct from PapG since PapG-specific antiserum did not cross-react with PrsG . Using a solid phase glycolipid receptor binding assay, PrsG was found to specify preferential binding to the Forssman antigen, a major constituent of sheep erythrocyte membranes . The binding epitope was identified as the GaINAc alpha (1-3)GaINAc moiety . This is the first direct evidence that serologically identical pili may present antigenically distinct adhesins, each capable of binding to a specific receptor.

J Clin Invest, 1988 Mar, 81(3), 860 - 5
Binding sites in the rat brain for Escherichia coli S fimbriae associated with neonatal meningitis; Parkkinen J et al.; Escherichia coli strains that cause sepsis and meningitis in neonatal infants carry S fimbriae that bind to sialyl galactoside units of cell surface glycoproteins . To investigate the possible role of S fimbriae in determining the tissue tropism of neonatal meningitis, we have studied the presence of binding sites for S fimbriae in different tissues of the neonatal rat which is susceptible to meningitis caused by S-fimbriated E . coli . Purified S fimbriae were incubated on cryostat sections of different rat organs and their binding was assessed by indirect immunofluorescence . In the brain of the neonatal rat, S fimbriae specifically bound to the luminal surfaces of the vascular endothelium and of the epithelium lining the choroid plexuses and brain ventricles . The binding was completely inhibited by the trisaccharide NeuAc alpha 2-3Gal beta 1-4Glc, a receptor analogue of S fimbriae, and by a preceding neuraminidase treatment of the sections . A recombinant E . coli strain expressing S fimbriae adhered in large numbers to the same tissue sites in the neonatal brain sections as did the purified fimbriae, whereas the non-fimbriated host strain and a recombinant strain expressing P fimbriae did not adhere to brain tissues . The results suggest that adhesion of S-fimbriated bacteria to the binding sites observed in the neonatal brain has a pathogenetic role during bacterial invasion from circulation into the cerebrospinal fluid.

Virus Genes, 1988 Mar, 1(2), 175 - 89
Homology of the HSV-2 "a-sequence" to cellular sequences; Kohler E et al.; Bgl-II fragments of the genome of Herpes simplex virus type 2 (HSV-2) HG-52 were cloned into the vector p-Neo and were used to screen the complete HSV-2 genome for regions cross-hybridizing with the genome of HEL cells . Most extensive cross-hybridizing activity was observed with a 530 bp SstII subfragment of the viral BamHI G DNA-fragment (contained in Bgl II F), which spans the joint and the viral a-sequence . From a lambda-L47 library, a cellular 15 kb HindIII DNA fragment was subcloned in pBR 322 which contained a 1920 bp SstII subfragment having strong cross-hybridizing activity with the 530 bp Sst II fragment of HSV-2 BamHI G . Within this 1920 bp Sst II fragment the cross-hybridizing activity was confined to a 230 bp Bgl I/Hpa II subfragment . This 230 bp fragment (including the flanking sequences) was analyzed in comparison to the viral a-sequence . Sequence data revealed a (G + C) content of 66% in the cellular and 81% in the viral DNA fragment, which is mainly determined by an extremely (G + C) rich 16-fold direct repeat (DR2) at the 5'-end . The homology between both DNA-fragments varies between 56% and 79% within the L-S inversion region . Both sequences, furthermore, show homology to the human c-myc protooncogene.

EMBO J, 1988 Mar, 7(3), 867 - 73
A synthetic peptide corresponding to the C-terminal 25 residues of phage MS2 coded lysis protein dissipates the protonmotive force in Escherichia coli membrane vesicles by generating hydrophilic pores; Goessens WH et al.; The RNA phage MS2 encodes a protein, 75 amino acids long, that is necessary and sufficient for lysis of the host cell . DNA deletion analysis has shown that the lytic activity is confined to the C-terminal half of the protein . We have examined the effects of a synthetic peptide, covering the C-terminal 25 amino acids of the lysis protein, on the electrochemical potential, generated in Escherichia coli membrane vesicles and in liposomes reconstituted with cytochrome c oxidase . In all cases the peptide dissipates the electrochemical potential . The peptide also induces the release of carboxyfluorescein (376 daltons), but not of inuline (5500 daltons), from protein-free liposomes . The phenomena are observed at a lipid to peptide molar ratio of approximately 100:1 . The possible connection between the dissipation of the proton-motive force and bacteriolysis is discussed.

EMBO J, 1988 Mar, 7(3), 655 - 64
The matrix attachment regions of the chicken lysozyme gene co-map with the boundaries of the chromatin domain; Loc PV et al.; The matrix attachment regions of the chicken lysozyme domain were studied in an in vitro DNA binding assay by incubating oviduct nuclear matrices with labeled restriction fragments . A strong attachment region was localized between 11.1 and 8.85 kb upstream of the transcription start site and a weaker one between 1.3 and 5.0 kb downstream of the poly(A)+ addition site . Both attachment regions co-map with the previously established boundaries of the chromatin domain . The upstream matrix attachment region is distinguishable from known enhancers and is composed of multiple binding sites . We find specific but weaker binding of the same restriction fragments to matrix preparations from transcriptionally inactive chicken erythrocytes indicating a cell-type and transcription-independent conservation of the sites for specific binding of matrix attachment sequences . We also demonstrate that the matrix attachment regions are located at the base of a chromosomal loop in histone-extracted nuclei . Thus, the lysozyme domain represents a topologically-sequestered functional unit containing the coding region and all known lysozyme-specific, cis-acting regulatory elements.

Mol Biol (Mosk), 1988 Mar-Apr, 22(2), 446 - 53
{Ribosomes with unique breaks in 16S RNA: isolation and biological activity}; Afonina EI et al.; A set of Escherichia coli 16S rRNA having unique breaks were prepared using the method of oligodeoxyribonucleotide-directed fragmentation with RNAse H . 16S RNA remained compact or dissociated to separate fragments, depending on the cleavage site location in the RNA structure . 16S rRNAs which have been split at different sites or their isolated fragments were used for a reconstitution of the 30S ribosomal subunits . These reconstituted 30S subunits carrying unique breaks at positions 301, 772, 1047 have the same sedimentation coefficients and electron microscopy images as the native subunit . They were active in the poly(U)-directed cell-free system of synthesis of polyphenylalanine.

Anal Biochem, 1988 Mar, 169(2), 376 - 82
Nonradioactive labeling of synthetic oligonucleotide probes with terminal deoxynucleotidyl transferase; Kumar A et al.; Synthetic oligonucleotides were tailed at the 3' end using terminal deoxynucleotidyl transferase . Nucleotide triphosphates with free primary amines at the end of side chains were compared for their tailing efficiency and/or detection sensitivity, using biotin-11-dUTP as a reference . Free primary amines were tagged with activated biotin or fluorescein isothiocyanate . The probes were then detected with either streptavidin-alkaline phosphatase complex or anti-fluorescein antibodies and alkaline phosphatase-conjugated secondary antibodies . Tailing conditions were optimized and the probes were tested for detection of Escherichia coli ST1a enterotoxin DNA and rotavirus RNA.

Mol Microbiol, 1988 Mar, 2(2), 265 - 79
Cloned structural genes for the osmotically regulated binding-protein-dependent glycine betaine transport system (ProU) of Escherichia coli K-12; Faatz E et al.; The proU locus of Escherichia coli encodes a high-affinity, binding-protein-dependent transport system (ProU) for the osmoprotectant glycine betaine . We cloned this locus into both low-copy-number lambda vectors and multicopy plasmids and demonstrated that these clones restore osmotically controlled synthesis of the periplasmic glycine betaine binding protein (GBBP) and the transport of glycine betaine in a delta (proU) strain . These clones allowed us to investigate the influence of osmolarity on ProU transport activity independent of the osmotically controlled expression of proU . ProU activity was strongly stimulated by a moderate increase in osmolarity and was partially inhibited by high osmolarity . This activity profile differs from the profile of the osmotically regulated proU expression . The proU locus is organized in an operon and the position of the structural gene (proV) for GBBP is defined using a minicell system . We determined that at least three proteins (in addition to GBBP) are encoded by the proU locus . We also investigated the permeation of glycine betaine across the outer membrane . At low substrate concentration (0.7 microM), permeation of glycine betaine was entirely dependent on the OmpF and OmpC porins.

Genetika, 1988 Mar, 24(3), 443 - 51
{Effect of mutations in the uvrA and recA genes on the photoreactivity of Escherichia coli cells irradiated by UV light (250 and 313 nm)}; Malinova IV et al.; The relative contribution of photo- and non-photoreactivable damages to the lethal effect of far-(250 nm) and mid-(313 nm) wave UV in isogenic bacterial cells Escherichia coli WP2 (wild type, uvrA and recA mutants) was estimated . It has been demonstrated that the value of non-photoreactivable damages increases with lambda of UV (250----313 nm) and depends on the genotype (uvrA and recA).

Respir Physiol, 1988 Mar, 71(3), 259 - 68
The role of leukotriene B4 in endotoxin-induced lung injury in unanesthetized sheep; Fujimoto K et al.; In order to examine the role of LTB4, a potent neutrophil chemokinetic and chemotactic factor, in the lung injury induced by Escherichia coli endotoxin, we measured LTB4 in systemic arterial blood plasma and lung lymph in unanesthetized sheep with chronic lung lymph fistulas . E . coli endotoxin (1 microgram/kg) infusion produced a biphasic response . The early period (Phase 1) was a transient pulmonary hypertension . The late period (Phase 2) was a more prolonged period characterized by an increase flow of lung lymph with a high concentration of protein, suggesting increased pulmonary vascular permeability . Peripheral leukocyte counts rapidly decreased during Phase 1 and leukopenia persisted for approximately 5 h . The concentration of LTB4 in arterial plasma and lung lymph significantly increased during Phase 1, and then decreased with a rebound significant increase during Phase 2 . That is, LTB4 in plasma and lung lymph showed a biphasic increase after endotoxin infusion . Our data suggest that the elevation of LTB4 is related to the pulmonary leukocyte sequestration in the lung and may contribute to the lung vascular injury induced by endotoxin in unanesthetized sheep.

Mol Gen Genet, 1988 Mar, 211(3), 531 - 7
Analysis of the regulatory elements of the Escherichia coli uvrC gene by construction of operon fusions; Forster JW et al.; The regulatory region of the Escherichia coli uvrC gene has been analysed by the subcloning of appropriate restriction fragments into the promoter probe vector pPV502 . A series of plasmids carrying operon fusions to the gene for chloramphenicol acetyltransferase (cat) has been constructed . Three promoters capable of controlling uvrC have been identified (P1, P2 and P3), the majority of transcription being derived from the most distal of these promoters (P1) . Transcription termination apparently plays some role in the control of the gene through premature termination of the P1-, but not the P2- or P3-derived transcripts . In addition, a promoter acting in the opposite direction to uvrC transcription has been detected . The activity of each of the promoters has been assayed under normal and SOS-inducing conditions . The uvrC gene is not apparently under the control of the recA-lexA regulatory circuit, unlike uvrA and uvrB . A series of recombinant plasmids carrying a 1.9 kb Bg/II fragment encoding most of the uvrC gene has been constructed . The properties of these plasmids suggest that the six amino acids at the carboxy-terminus of the uvrC gene product are not critical for DNA repair activity.

Mol Gen Genet, 1988 Mar, 211(3), 515 - 9
Genetic mapping of the Escherichia coli gene for the stringent starvation protein and its dispensability for normal cell growth; Fukuda R et al.; To determine its map position, the sSP gene was cloned into plasmid pBR322 and the recombinant plasmid was integrated into the chromosome of a polA mutant at the site of the sSP gene by homologous recombination . The chromosomal location of Ampr was then determined by P1 phage-mediated transduction . Thus, the sSP gene was mapped between gltB and glnF at min 69.5 on the Escherichia coli chromosome . Strains were constructed in which the sSP gene was brought under the control of the lac regulatory system . This indicated that the stringent starvation protein (SSP) is dispensable for growth, at least under normal culture conditions.

Genetics, 1988 Mar, 118(3), 537 - 41
Why do unrelated insertion sequences occur together in the genome of Escherichia coli?
Hartl DL, Sawyer SA.
Natural isolates of Escherichia coli are polymorphic for the presence or absence of insertion sequences . Among the ECOR reference collection of 71 natural isolates studied for the number of copies of the insertion sequences IS1, IS2, IS3, IS4, IS5 and IS30, the number of strains containing no copies of the insertion sequences were 11, 28, 23, 43, 46 and 36, respectively . Significant correlations occur in the ECOR strains in the presence or absence of unrelated insertion sequences in the chromosome and plasmid complements . Strains containing any insertion sequence are more likely to contain additional, unrelated insertion sequences than would be expected by chance . We suggest that the positive correlations result from horizontal transfer mediated by plasmids . A branching-process model for the plasmid-mediated transmission of insertion sequences among hosts yields such a correlation, even in the absence of interactions affecting transposition or fitness . The predictions of the model are quantitatively in agreement with the observed correlations among insertion sequences.

J Gen Virol, 1988 Mar, 69 ( Pt 3), 739 - 43
An analysis of restriction endonuclease sites in cyanophages infecting the heterocystous cyanobacteria Anabaena and Nostoc; Bancroft I et al.; An analysis of restriction endonuclease cleavage of DNA isolated from cyanophages that infect Anabaena and Nostoc species of cyanobacteria has provided evidence for counter-selection of restriction endonuclease sites . These include sites containing subsequences which are methylated by host (Anabaena PCC 7120) methylase(s) akin to the dam and dcm enzymes of Escherichia coli . Other sites which are counter-selected have no common sequence structure . The latter include those of the endogenous restriction endonucleases of the host, but other absent sequences are not attributable to isoschizomers of any known Anabaena or Nostoc restriction endonuclease . The cyanophages differ in their tolerance to DNA methylation . Isolates A-4L, AN-13 and AN-23 do not tolerate adenosine methylation in the GATC sequence whereas two cyanophages, A-1L and AN-10 (which are related) do tolerate dam-like methylation of this sequence . In addition, A-1L allows cytosine methylation at GGCC sequences, but AN-10 has counter-selected these sequences and the remaining sites are not methylated . Analysis of native and cloned A-4L DNA suggests that counter-selection has occurred against all sequences which would be methylated by the host at either adenosine or cytosine nucleotides.

Eur J Biochem, 1988 Mar 1, 172(2), 299 - 305
Lipoamide dehydrogenase from Azotobacter vinelandii . Molecular cloning, organization and sequence analysis of the gene; Westphal AH et al.; The gene encoding lipoamide dehydrogenase from Azotobacter vinelandii has been cloned in Escherichia coli . Fragments of 9-23 kb from Azotobacter vinelandii chromosomal DNA obtained by partial digestion with Sau3A were ligated into the BamHI site of plasmid pUC9 . E . coli TG2 cells were transformed with the resulting recombinant plasmids . Screening for clones which produced A . vinelandii lipoamide dehydrogenase was performed with antibodies raised against the purified enzyme . A positive colony was found which produced complete chains of lipoamide dehydrogenase as concluded form SDS gel electrophoresis of the cell-free extract, stained for protein or used for Western blotting . After subcloning of the 14.7-kb insert of this plasmid the structural gene could be located on a 3.2-kb DNA fragment . The nucleotide sequence of this subcloned fragment (3134 bp) has been determined . The protein-coding sequence of the gene consists of 1434 bp (478 codons, including the AUG start codon and the UAA stop codon) . It is preceded by an intracistronic region of 85 bp and the structural gene for succinyltransferase . A putative ribosome-binding site and promoter sequence are given . The derived amino acid composition is in excellent agreement with that previously published for the isolated enzyme . The predicted relative molecular mass is 50223, including the FAD . The overall homology with the E . coli enzyme is high with 40% conserved amino acid residues . From a comparison with the three-dimensional structure of the related enzyme glutathione reductase {Rice, D . W., Schultz, G . E . & Guest, J . R . (1984) J . Mol . Biol . 174, 483-496}, it appears that essential residues in all four domains have been conserved . The enzyme is strongly expressed, although expression does not depend on the vector-encoded lacZ promoter . The cloned enzyme is, in all the respects tested, identical with the native enzyme.

Proc Natl Acad Sci U S A, 1988 Mar, 85(6), 1826 - 30
DNA bending is induced in an enhancer by the DNA-binding domain of the bovine papillomavirus E2 protein; Moskaluk C et al.; The E2 gene of bovine papillomavirus type 1 has been shown to encode a DNA-binding protein and to trans-activate the viral enhancer . We have localized the DNA-binding domain of the E2 protein to the carboxyl-terminal 126 amino acids of the E2 open reading frame . The DNA-binding domain has been expressed in Escherichia coli and partially purified . Gel retardation and DNase I "footprinting" on the bovine papillomavirus type 1 enhancer identify the sequence motif ACCN6GGT (in which N = any nucleotide) as the E2 binding site . Using electrophoretic methods we have shown that the DNA-binding domain changes conformation of the enhancer by inducing significant DNA bending.

Mutat Res, 1988 Mar, 193(2), 97 - 108
Enhanced transforming activity of pSV2 plasmids in human cells depends upon the type of damage introduced into the plasmid; Spivak G et al.; When pSV2-gpt or pSV2-neo plasmids are introduced into human cells by calcium phosphate coprecipitation, the yield of stable transformants (Gpt+ or Neo+) is increased by irradiating the respective plasmid DNA in vitro with UV (254 nm) . To identify specific lesions that can increase the transforming activity of plasmids in human cells we examined pSV2 plasmids containing different types of damage . Of the lesions tested, cyclobutane pyrimidine dimers produced the greatest increase, and can nearly fully account for the effect of 254 nm UV on transformation . The enhancement of transformation produced by UV was not altered by the additional treatment of the plasmid DNA with T4 endonuclease V, an enzyme that nicks DNA specifically at pyrimidine dimers . Treatment of plasmid DNA with osmium tetroxide to produce thymine glycols, or with acid and heat to produce apurinic sites did not affect transformation frequency . The enhancement occurred in all the human cell lines tested, whether they contained or not sequences homologous to those in the plasmids, and was independent of the repair capacity of the recipient cells.

Biochem Pharmacol, 1988 Mar 1, 37(5), 843 - 8
Studies on the mechanism of action of the omeprazole-derived cyclic sulphenamide; Beil W et al.; The inhibitory effects of omeprazole and omeprazole-derived metabolites were studied on Escherichia coli glutaminase activity at pH 2.5 which might represent the conditions present at the target enzyme (K+/H+-ATPase) in the secretory membrane of the intact parietal cell . Omeprazole and the omeprazole-derived cyclic sulphenamide inhibited glutaminase at pH 2.5 with identical potency (IC50 36 microM) . The substrate, glutamine as well as the mercaptane, dithiothreitol, protect the enzyme . Furthermore, dithioerythritol was found to reverse inhibition . This indicates that an SH-group localized in the substrate binding center of glutaminase is most likely involved in the reaction leading to enzyme inhibition . Glutaminase inhibition by both compounds was less pronounced at pH 5.0 . Omeprazole radical, the metabolite generated from the cyclic sulphenamide at more neutral pH values, failed to affect the enzyme . These findings were in contrast with the properties of the omeprazole-derived cyclic sulphenamide and radical at the K+/H+-ATPase preparation . This enzyme was inhibited by both compounds at pH 7.5 with a high potency, and reversal experiments with dithiothreitol demonstrate that these agents interfere with SH-groups of the K+/H+-ATPase . From these data it is suggested that the cyclic sulphenamide and the radical interfere by different reaction pathways with enzymatic SH-groups.

J Infect Dis, 1988 Mar, 157(3), 557 - 64
Modulation of enterotoxin binding and function in vitro and in vivo; Donta ST et al.; The use of the nontoxic B subunits of cholera and Escherichia coli enterotoxins in vitro and in vivo led to a decrease in toxin binding to target cells and a decrease in toxin-induced effects (i.e., morphological effects, adenylate cyclase activation, and fluid secretion) . The reduction in toxin binding involves a process of down-regulation of cellular receptors for the toxin and not toxin occupancy of receptors . The extent of inhibition was dependent on the amount of B subunit used and on the duration of time after its use . Thus, in vivo exposure to a single bolus of B subunit was sufficient to block toxin binding and activity for up to 18 h . Because the B subunit binds extensively to the esophagus and the stomach, peroral administration will require a preparation that allows the subunit to reach the small bowel in a protected form . Our data provide a rationale for using B subunit therapy for short-term protection against the effects of enterotoxins, before the development of an immune response.

J Bacteriol, 1988 Mar, 170(3), 1350 - 3
Analysis of the variable endpoints generated by one-ended transposition of Tn21; Avila P et al.; One-ended transposition of Tn21 generates recombinants usually containing a whole copy of the donor replicon plus a short duplication of it (S . Motsch, R . Schmitt, P . Avila, F . de la Crue, E . Ward, and J . Grinsted, Nucleic Acids Res . 13:3335-3342, 1985) . This work shows that recombinants containing less than a whole copy of the donor replicon (hereafter called short recombinants) could also be detected when plasmid donors which contained two selectable genetic markers were used . Short recombinants were produced at the same frequency from TnpR+ donor molecules as from TnpR- donor molecules in a RecA- background . Therefore, they were not resolution products of larger recombinants . This result invalidates a previous hypothesis to explain one-ended transposition, that is, that one-ended transposition arises from the use of secondary ends by the transposition apparatus . On the other hand, it suggests that one-ended transposition of Tn21 occurs via a simple insertion mechanism.

J Bacteriol, 1988 Mar, 170(3), 1346 - 9
Regulation of ubiG gene expression in Escherichia coli; Gibert I et al.; To study the regulation of the expression in Escherichia coli of the ubiG gene, which codes for the last enzyme in the pathway of ubiquinone biosynthesis, a fusion between the ubiG and lacZ genes was constructed in vitro . The results showed that (i) the expression of the ubiG gene was higher under aerobic conditions than under anaerobic growth conditions, (ii) the presence of glucose in the culture medium decreased the transcription of the ubiG gene, and (iii) cya and crp mutants exhibited lower levels of ubiG gene expression than the wild-type strain . The addition of cyclic AMP increased the expression of the ubiG gene in both cya and wild-type strains but not in a crp mutant . This fact suggests that the cyclic AMP receptor protein-cyclic AMP complex positively modulates ubiG gene transcription . It was also determined that the transcription of the ubiG gene was in the counterclockwise direction on the E . coli map.

J Bacteriol, 1988 Mar, 170(3), 1305 - 10
Common organization of gene clusters for production of different capsular polysaccharides (K antigens) in Escherichia coli; Roberts IS et al.; Southern blot analysis of cloned K5- and K7-antigen genes, using DNA fragments from cloned K1 genes as radiolabeled probes, demonstrated that each K-antigen gene cluster is organized in a manner similar to that shown for the K1 antigen . That is, a central DNA segment unique for a given antigen type is flanked by DNA sequences that encode common functions for the management of intracellular polymer . This has been confirmed by transposon and deletion mutagenesis of plasmids carrying the K5 and K7 genes . We also describe a series of complementation experiments in which transport or postpolymerizational modification functions for one K antigen are used to complement mutations in the corresponding regions of a different K-antigen gene cluster . Thus, postpolymerizational modification of polysaccharide and transport of mature polysaccharide from the periplasmic space are common mechanisms and are independent of polysaccharide structure.

J Bacteriol, 1988 Mar, 170(3), 1069 - 75
Lethality of a dut (deoxyuridine triphosphatase) mutation in Escherichia coli; el-Hajj HH et al.; A chloramphenicol resistance gene was cloned into a plasmid-borne dut gene, producing an insertion mutation that was then transferred to the chromosome by allelic exchange . The mutation could not be acquired by haploid strains through substitutive recombination, even when two flanking markers were simultaneously transduced . The insertion was easily transferred, via generalized transduction, into the chromosomal dut region of strains harboring a lambda dut + transducing phage; however, the resulting dut mutant/lambda dut + merodiploid could not then be cured of the prophage . This apparent lethality of the mutation could not be explained by effects on adjacent genes; the dfp gene retained complementing activity, and a ttk insertion mutant was viable . The dut gene product, deoxyuridine triphosphatase, is known to reduce incorporation of uracil into DNA and to be required in the de novo synthesis of thymidylate . Therefore, an attempt was made to determine whether the dut insertion would be tolerated in strains carrying the following compensatory mutations: dcd (dCTP deaminase) and cdd (deoxycytidine deaminase), which should reduce dUTP formation; ung (uracil-DNA glycosylase), which should reduce fatally excessive excision repair; deoA (thymidine phosphorylase), which should enhance the utilization of exogenous thymidine; and sulA, which should reduce the lethal side effects of SOS regulon induction . These mutations, either alone or in various combinations, did not permit the survival of a haploid dut insertion mutant, suggesting that the dut gene product might have an essential function apart from its deoxyuridine triphosphatase activity.

J Virol, 1988 Mar, 62(3), 978 - 86
Insertional mutagenesis of the Abelson murine leukemia virus genome: identification of mutants with altered kinase activity and defective transformation ability; Rees-Jones RW et al.; A library of Abelson murine leukemia virus (A-MuLV) proviral DNAs with 12- or 6-base-pair (bp) insertional mutations was constructed . The 29 mutations characterized spanned the entire protein-coding region of the provirus . We tested the effects of these mutations both on the kinase activity of the gag-abl fusion protein encoded by the provirus and on the ability of the provirus to transform NIH 3T3 fibroblasts . To simplify assessment of the mutant kinases, we expressed the A-MuLV-encoded kinase in the bacterial expression vector pATH2, resulting in production of a trpE-gag-abl fusion protein in Escherichia coli . We used an immunoprecipitation kinase assay to measure both autophosphorylation and artificial substrate phosphorylation by the mutant kinases . To assay transformation ability of the mutant proviruses, we transfected NIH 3T3 fibroblasts with the mutants and with helper virus (Moloney MuLV) by the DEAE-dextran method . Our analysis of these A-MuLV insertional mutants allows the division of the protein-coding region of the provirus into four domains: domain A (proviral bp 1068 to 1685), in which insertions have no effect on the bacterially expressed kinase, but diminish both kinase activity and transformation efficiency in fibroblasts; domain B (bp 1750 to 2078), in which insertions have no effect on the provirus; domain C (bp 2181 to 2878), the critical kinase domain, in which 12-bp or even 6-bp insertions completely inactivate the A-MuLV kinase and result in transformation-defective proviruses; and domain D (bp 2956 to 4610), the large C-terminal domain in which mutations are silent.

J Virol, 1988 Mar, 62(3), 1084 - 7
Birnavirus precursor polyprotein is processed in Escherichia coli by its own virus-encoded polypeptide; Jagadish MN et al.; The cDNA fragment of the large RNA segment of infectious bursal disease virus 002-73, when expressed in Escherichia coli, produces precursor polyprotein (N-VP2-VP4-VP3-C), most of which is then processed to generate constituent polypeptides . Using cDNA fragments containing site-specific mutations and two monoclonal antibodies that are specific to VP2 and VP3 of mature virus particles, we demonstrated that the VP4 protein is involved in processing of the precursor polyprotein to generate VP2 and VP3 and excluded the possibility of internal initiation for the generation of VP3.

Mol Biol (Mosk), 1988 Mar-Apr, 22(2), 357 - 61
{mRNA-binding site of ribosomes at different stages of translation . II . Affinity modification of Escherichia coli ribosomes bya benzylidene derivative of AUGU6 in pre- and post-translation complexes}; Babkina GT et al.; Affinity labeling of E . coli ribosomes with the 2',3'-O-{4-(N-2-chloroethyl)-N-methyl-amino}benzylidene derivative of AUGU6 (AUGU6-{14C}CHRCl) was studied within the pretranslocational complex ribosome.AUGU6{14C}CHRCl.tRNA(fMet)(P-site).fMetPhe-tR NA(Phe)(A-site) and posttranslocational complex ribosome.AUGU6{14C}CHRCl.fMetPhe-tRNA(Phe)(P-site) . Both 30S and 50S subunits were labeled within these complexes, but the extent of 30S subunit modification was 6-8-fold higher than those for 50S subunit . Ribosomal proteins of both subunits were found to be labeled preferentially . Proteins S1, S5, S11, L1 were identified to be crosslinked with AUGU6{14C}CHRCl within the pretranslocational complex and S7--within the posttranslocational complex from the data of two-dimensional electrophoresis in the polyacrylamide gel.

J Gen Virol, 1988 Mar, 69 ( Pt 3), 525 - 35
An antigenic analysis of the adenovirus type 2 fibre polypeptide; Watson G et al.; Twenty-seven monoclonal antisera were generated against the SDS-denatured fibre of adenovirus type 2 . The antisera were characterized using radioimmune assay, fluorescent antibody tests, immune precipitation, Western blotting, haemagglutination and neutralization, and formed six groups as follows: A, type-specific neutralizing antisera which exhibited haemagglutination inhibition (Hi+); B, type-specific non-neutralizing antisera which did not exhibit haemagglutination inhibition (Hi-); C, subgroup-specific neutralizing antisera Hi+; D, a subgroup-specific neutralizing antiserum Hi-; E, subgroup-specific non-neutralizing antisera Hi-; F, a subgroup-specific neutralizing antiserum Hi- which did not react in Western blotting tests . The C-terminal 201 amino acids of the fibre were expressed in Escherichia coli and a total of six antisera from groups A, B and C recognized five epitopes carried on this region which in several models is thought to form the knob of the fibre . At least eight epitopes were expressed by the entire native fibre . The five epitopes of the C-terminal end of the fibre formed three antigenic sites . Two sites each consisted of a neutralizing type-specific and a neutralizing group-specific epitope which overlapped in position . The remaining site consisted of a type-specific, non-neutralizing epitope.

Eur J Biochem, 1988 Mar 1, 172(2), 349 - 53
Differential inhibition of various deoxyribonucleic and ribonucleic acid polymerases by suramin; Ono K et al.; The inhibitory effects of hexasodium sym-bis(m-aminobenzoyl-m-amino-p-methylbenzoyl-1-naphthylamino-4,6, 8-trisulfonate)carbamide (trivial name: suramin) on the activities of various deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) polymerases from mammalian cells, bacteria and retrovirus were examined and compared with each other . Among the various DNA and RNA polymerases tested, the activities of DNA primase, DNA polymerase alpha, reverse transcriptase and Escherichia coli RNA polymerase were strongly inhibited by suramin, while the activities of other enzymes including DNA polymerases beta and gamma, terminal deoxynucleotidyl-transferase and DNA polymerase I were relatively resistant to inhibition by this drug . The inhibition by suramin of DNA polymerase alpha from KB cells and Rauscher murine leukemia virus (RLV) reverse transcriptase was due to competition with the respective template primer (activated DNA for alpha polymerase and (rA)n.(dT)12-18 for reverse transcriptase) for the template.primer-binding site of the enzyme, while the inhibition of DNA primase and E.coli RNA polymerase was due to competition with the ribonucleoside triphosphate substrate . The inhibition constants (Ki) of suramin were determined to be 2.6 microM, 0.35 microM, 0.54 microM and 0.70 microM for DNA primase, DNA polymerase alpha, RLV reverse transcriptase and E . coli RNA polymerase respectively . The observed inhibitions of these polynucleotide-synthesizing enzymes by suramin seem to explain, at least in part, an as yet unknown mechanism of trypanocidal action of this drug.

J Bacteriol, 1988 Mar, 170(3), 1311 - 8
Analysis of the incompatibility determinants of I-complex plasmids; Nikoletti S et al.; The isolation and characterization of minireplicons corresponding to group B and I-complex plasmids are reported . The molecular structures of the small RNAs that may play a major role in the replication control and incompatibility reactions of the plasmids are compared . A mutant plasmid with changed copy number and incompatibility specificity is described . This mutant had a single-base-pair substitution in the DNA region that codes for the small RNA.

Crit Care Med, 1988 Mar, 16(3), 266 - 71
Comparison of effects of dextran-70 and Ringer's acetate on pulmonary function, hemodynamics, and survival in experimental septic shock; Modig J; The effects of dextran-70 with NaCl vs . Ringer's acetate on hemodynamics, gas exchange, oxygen transport, and survival were evaluated in a porcine model of pulmonary and circulatory insufficiency induced by a continuous iv endotoxin infusion over 6 h . Dextran and Ringer's acetate were infused continuously to maintain baseline mean left atrial pressure (LAP) throughout the endotoxin period . Twelve pigs receiving endotoxin + Ringer's acetate displayed a progressive 45% decline in cardiac output (Qt) and a two-peaked increase in pulmonary vascular resistance (PVR) with a late increase of 250% . Venous admixture (Qva/Qt) increased progressively more than six-fold and extravascular lung water (EVLW) increased by 55% . Mean arterial BP (MAP) fell by 25%, oxygen delivery by 40%, base excess (BE) ranged between -4.5 and -9 mmol/L at the end of the endotoxin period and four of 12 animals died . Polymorphonuclear cell count (PMN) fell rapidly by 90% and was decreased severely throughout the endotoxin period . By contrast, the 12 pigs that received endotoxin + dextran maintained Qt near baseline and PVR was significantly lower in this group . Qva/Qt increased progressively more than four-fold, but it was significantly lower than in the Ringer's acetate group as was the increase in EVLW (23%) . MAP only decreased by 10%, oxygen delivery only decreased by 20% . BE ranged between -1.0 and -3.0 mmol/L at the end of the endotoxin period and all animals survived . PMN fell by 90% at 0.5 h but subsequently tended to return toward baseline, and PMN were significantly increased compared with the Ringer's acetate group.(ABSTRACT TRUNCATED AT 250 WORDS)

FEBS Lett, 1988 Feb 29, 229(1), 73 - 6
Psoralen photofootprinting of protein-binding sites on DNA; Zhen WP et al.; Using a BAL31 exonuclease assay to determine the sites of 4,5',8-trimethylpsoralen photocrosslinking in DNA we have shown that 5'-TA sites which are accessible to psoralen DNA interstrand photocrosslinking in naked DNA become inaccessible when protein, in casu, lambda-repressor E . coli or RNA polymerase are bound at their recognition DNA sequences (OR1 operator or deo1 promoter, respectively) . These results show that psoralens can be used as photofootprinting reagents to study specific protein-DNA interactions.

FEBS Lett, 1988 Feb 29, 229(1), 127 - 30
The fluorescence intensity of the lipophilic probe N-phenyl-1-naphthylamine responds to the oxidation-reduction state of purified Escherichia coli cytochrome o incorporated into phospholipid vesicles; Sedgwick EG et al.; N-Phenyl-1-naphthylamine (NPN), a reagent which has been used previously to probe the fluidity or microviscosity of the membrane lipids of intact cells of Escherichia coli, was found to respond to the redox state of purified cytochrome o incorporated into lipid vesicles formed from purified or E . coli phospholipids . NPN was bound to the proteoliposomes to produce a steady-state level of fluorescence intensity . Addition of the substrate ascorbate, in the presence of phenazine methosulfate as an electron donor, did not alter the fluorescence . However, following complete removal of oxygen from the medium by oxidation of the substrate by molecular oxygen catalyzed by cytochrome o, there was an increase in the fluorescence of NPN . This coincided with the reduction of cytochrome o . Reoxidation of the cytochrome by addition of oxygen decreased the fluorescence to steady-state levels until the oxidant had been completely reduced . The fluorescence changes were dependent on the incorporation of cytochrome o into phospholipid vesicles but were insensitive to the state of energization of the vesicle membrane.

Biochem Biophys Res Commun, 1988 Feb 29, 151(1), 236 - 41
Purification and analysis of the structure of alpha-galactosidase from Escherichia coli; Nagao Y et al.; Alpha-Galactosidase, the product of the melA gene, was purified from a strain of Escherichia coli harboring a plasmid carrying melA, which over-produced the alpha-galactosidase . An apparent molecular weight was determined to be 50 kDa . The amino acid composition of this enzyme was determined . The result indicates that this enzyme is a hydrophilic and acidic protein . We have subjected the purified enzyme to 20 cycles of N-terminal sequence analysis . This verified the translation start site of the melA gene and the predicted N-terminal sequence.

Biochim Biophys Acta, 1988 Feb 28, 949(2), 247 - 51
Purification of duck growth hormone and cloning of the complementary DNA; Chen HT et al.; Duck growth hormone (GH) was isolated and purified from duck pituitaries by salt precipitation and HPLC on reverse-phase C18 columns . The duck GH was homogeneous as shown by SDS-polyacrylamide gel electrophoresis with a molecular weight of 22,000 . The cDNA was synthesized and cloned in Escherichia coli using EcoRI linkers and pBR322 as vector . The positive clones were selected and sequenced . The full-length duck GH cDNA contains 820 nucleotide pairs with an open reading frame coding for the precursor form duck GH of 216 amino-acid residues . The partial amino-acid sequence from the protein completely agrees with that derived from the cDNA, with Phe as the first residue in mature duck GH preceded by a 27-residue hydrophobic signal peptide . The duck GH is almost completely homologous to the chicken GH, with only three conservative substitutions (Ser for Thr, His for Tyr and Lys for Arg) and one deletion (Ala) in the duck GH sequence . Comparison of amino-acid sequence of duck GH with that of various species reveals 56%, 73% and 40% homologies with GHs of human, rat and salmon, respectively.

Biochim Biophys Acta, 1988 Feb 28, 949(2), 169 - 80
Characterization of a cDNA for human glutathione-insulin transhydrogenase (protein-disulfide isomerase/oxidoreductase); Morris JI et al.; A human liver cDNA expression library in lambda-phage gt11 was screened with monoclonal antibodies to rat liver protein-disulfide isomerase/oxidoreductase (EC 5.3.4.1/1.8.4.2), also known as glutathione-insulin transhydrogenase (GIT) . The nucleotide sequence of the largest cDNA insert (hgit-1) was determined . It contained approx . 1500 basepairs, representing an estimated 65% of the glutathione-insulin transhydrogenase message . The amino-acid sequence deduced from this cDNA insert contains a 7-amino-acid long polypeptide determined by sequencing the active-site fragment isolated from the rat GIT protein . A comparison of the nucleotide sequence of hgit-1 and a previously reported nucleotide sequence of rat glutathione-insulin transhydrogenase cDNA shows that the human hgit-1 clone corresponds to the middle of the transhydrogenase message at amino-acid residue number 275 of the rat protein, and codes for 206 amino-acid residues, including one of the two active-site regions of glutathione-insulin transhydrogenase, a stop codon (TAA), a long 3'-noncoding region of over 800 bases, a polyadenylation signal (AATAA), and a 29 base poly(A) tail . There exists high homology between the human and rat enzymes (94% in the overall amino-acid sequence, with 100% in the active site region and 81% in the nucleotide sequence within the coding portion of hgit-1) . As with the rat enzyme, the human enzyme shows some identity with another dithiol-disulfide-exchange protein, Escherichia coli thioredoxin . Like rat cDNA, the human hgit-1 cDNA hybridized to rat mRNA of 2500 bases on a Northern blot . The relative quantitative abundance of GIT mRNA in nine rat tissues studied using hgit-1 as a hybridization probe was found to be in the same order as previously found with the rat cDNA . Thus, the above studies indicate that glutathione-insulin transhydrogenase is a highly conserved protein and that the human hgit-1 cDNA is suitable for use as a probe for further studies on gene regulation of this enzyme.

Biochim Biophys Acta, 1988 Feb 28, 949(2), 195 - 205
Gene response upon illumination in forming mRNA encoding peroxisomal glycollate oxidase; Gerdes HH et al.; Glycollate oxidase is a constituent of leaf peroxisomes . Its biosynthesis is, like the biosynthesis of many chloroplastic proteins, controlled by light, via phytochrome . The level of mRNA coding for glycollate oxidase was determined at different stages of greening of etiolated plant cells . The appearance of glycollate oxidase mRNA in the cytoplasm was measured by hybridization with cDNA containing part of the coding sequence for glycollate oxidase . cDNA was prepared from enriched mRNA, inserted into the Pst I site of pBR 322, and cloned in Escherichia coli DH-1 . By differential colony hybridization and hybrid selection, a clone containing a 670 bp sequence complementary to mRNA encoding glycollate oxidase was selected and identified . Northern blot hybridization was used to investigate mRNA levels induced by light . It was found that continuous light affected the formation of glycollate oxidase mRNA . When a large population of microbodies was present in the cells being induced, the immediate mRNA increase was very pronounced, and was detectable as little as 20 min after the beginning of the light treatment . In contrast, a lag period in the mRNA increase was observed when the induction was performed with etiolated leaves which are characterized by the occurrence of a rather small population of microbodies . For comparison, we measured the time-course of formation of mRNA coding for a light-induced chloroplastic protein, i.e., a protein of the light-harvesting complex . The time-courses of levels of the two mRNAs indicate that the program of gene expression differs between the two particular proteins destined either for chloroplasts or for peroxisomes . The formation of glycollate oxidase mRNA could also be stimulated by a short pulse of light, a treatment of 15 s being a sufficient trigger.

Biochim Biophys Acta, 1988 Feb 28, 949(2), 206 - 12
An EBV-based mammalian cell expression vector for efficient expression of cloned coding sequences; Jalanko A et al.; The construction of a mammalian cell expression vector using human cytomegalovirus immediate early gene enhancer to initiate transcription of inserted coding sequences is described . The vector also carries Epstein-Barr virus EBNA-1 nuclear antigen gene, ori-P sequences and hygromycin B resistance gene hph from E . coli . The expression capacity of this construct was tested by inserting the chloramphenicol acetyltransferase (CAT) gene into the vector . The EBV-CAT construct was transfected into various cell lines and high levels of CAT activity were obtained in human and monkey cells . In these cells, the vector DNA also replicates as an extrachromosomal element having 1 to 20 copies per cell . In most cases, the vector copy number and the expression level of inserted gene was in positive correlation in different cell clones.

J Chromatogr, 1988 Feb 26, 424(2), 243 - 53
Synthesis of high-capacity immunoaffinity sorbents with oriented immobilized immunoglobulins or their Fab' fragments for isolation of proteins; Prisyazhnoy VS et al.; Two methods for synthesizing high-capacity immunoaffinity sorbents on Sepharose and Separon HEMA E-1000 are described . The first is the oriented immobilization of monovalent immunoglobulin Fab fragments on a maleimide derivative of Sepharose via the formation of a covalent bond between the SH group of the Fab fragment at the C-terminus of the molecule and the maleimide covalently coupled to Sepharose . The second method is based on the oxidation of the immunoglobulin carbohydrate component, located in the Fc fragment, by periodate with subsequent immobilization of the derivatives on hydrazide derivatives of Sepharose or Separon . Sorbents for the isolation of monoclonal antibodies from the culture supernatants and the elongation factor EF-G from a crude extract of Escherichia coli cells were obtained . These sorbents are characterized by a high capacity, minimal non-specific sorption and high stability.

Science, 1988 Feb 26, 239(4843), 1033 - 5
Modulation of folding pathways of exported proteins by the leader sequence; Park S et al.; Leader peptides that function to direct export of proteins through membranes have some common features but exhibit a remarkable sequence diversity . Thus there is some question whether leader peptides exert their function through conventional stereospecific protein-protein interaction . Here it is shown that the leader peptides retarded the folding of precursor maltose-binding protein and ribose-binding protein from Escherichia coli . This kinetic effect may be crucial in allowing precursors to enter the export pathway.

Cell, 1988 Feb 26, 52(4), 551 - 7
Mini-P1 plasmid replication: the autoregulation-sequestration paradox; Chattoraj DK et al.; It has been proposed that the initiator protein RepA is rate limiting for mini-P1 plasmid replication, and that the role of the plasmid copy number control locus is to sequester the initiator and thus reduce replication . This proposal appears inconsistent with the observation that RepA is autoregulated, since the protein lost by sequestration should be replenished . A resolution of this autoregulation-sequestration paradox is possible if the sequestered RepA, unavailable for replication, is still available for promoter repression . We demonstrate that RepA binds to the control locus and to the promoter region simultaneously, causing the intervening DNA to loop . DNA looping could provide the requisite mechanism by which RepA bound to the control locus might exert repression.

Nucleic Acids Res, 1988 Feb 25, 16(4), 1541 - 9
Nucleotide sequencing of the ruv region of Escherichia coli K-12 reveals a LexA regulated operon encoding two genes; Benson FE et al.; The nucleotide sequence of a 2505 bp region of the Escherichia coli chromosome containing the LexA regulated ruv gene has been determined . A sequence of 1631 bp encoding two non-overlapping open reading frames that constitute a single operon and which specify polypeptides with predicted molecular weights of 22172 daltons and 37177 daltons respectively, was identified as the most probable sequence for ruv . Each of the two open reading frames, designated ruvA and ruvB, is preceded by a reasonable Shine-Dalgarno sequence . Two 16 bp sequences (SOS boxes) that match the consensus sequence for binding LexA protein are located 5' to ruvA in a region that provides a possible single promoter for expression of both ruvA and ruvB, with the second SOS box overlapping the putative -35 region . A possible transcriptional terminator is located 137 bp downstream of ruvB . The amino acid sequence predicted for RuvB contains a region that matches a highly conserved sequence found in several DNA repair and recombination proteins that bind ATP.

Nucleic Acids Res, 1988 Feb 25, 16(4), 1333 - 48
A heat shock element in the phosphoglycerate kinase gene promoter of yeast; Piper PW et al.; The phosphoglycerate kinase (PGK) promoter is often employed in yeast expression vectors due to its very high efficiency . Its activity in unstressed cells has been shown to be due to an upstream activator site (UASPGK) at -402 to -479 . Since levels of PGK mRNA can sometimes be elevated by heat shock of yeast cultures this investigation determined how specific deletions of PGK promoter sequences effect levels of PGK mRNA both before and after heat shock . A series of PGK promoter deletions was inserted on a high copy plasmid into cells having a TRP1 gene disruption of the solitary chromosomal PGK locus . This enabled PGK transcripts of plasmid and chromosomal origin to be distinguished by virtue of their different sizes . Certain deletions lacking UASPGK displayed activities that were very low in unstressed cells, but which increased fifty to one-hundred fold after heat shock . With UASPGK present heat shock had only a relatively small or negligible effect on PGK mRNA levels . Heat shock activation was abolished when the -256 to -377 region with homology to the heat shock element consensus of eukaryotes was deleted in addition to UASPGK, but was unaffected by the deletion of regions further downstream containing TATA- and CAAT- sequence motifs . This is the first demonstration of a heat shock element, an activator site normally found upstream of eukaryotic heat shock protein genes, as a natural constituent of a high efficiency glycolytic promoter . It is proposed that PGK may be one member of a small subset of yeast genes that are highly expressed in unstressed cells yet possess a heat shock element to ensure their continued transcription after heat shock.

Nucleic Acids Res, 1988 Feb 25, 16(4), 1233 - 50
Protein binding sites on Escherichia coli 16S ribosomal RNA; RNA regions that are protected by proteins S7, S9 and S19, and by proteins S8, S15 and S17; Wiener L et al.; Selected groups of isolated 14C-labelled proteins from E . coli 30S ribosomal subunits were reconstituted with 32P-labelled 16S RNA, and the reconstituted complexes were partially digested with ribonuclease A . RNA fragments protected by the proteins were separated by gel electrophoresis and subjected to sequence analysis . Complexes containing proteins S7 and S19 protected an RNA region comprising helices 29 to 32, part of helix 41, and helices 42 and 43 of the 16S RNA secondary structure . Addition of protein S9 had no effect . When compared with previous data for proteins S7, S9, S14 and S19, these results suggest that S14 interacts with helix 33, and that S9 and S14 together interact with the loop-end of helix 41 . Complexes containing proteins S8, S15 and S17 protected helices 7 to 10 as well as the "S8-S15 binding site" (helices 20, 22 and parts of helices 21 and 23) . When protein S15 was omitted, S8 and S18 showed protection of part of helix 44 in addition to the latter regions . The results are discussed in terms of our model for the detailed arrangement of proteins and RNA in the 30S subunit.

J Biol Chem, 1988 Feb 25, 263(6), 2761 - 7
The primary structure of the mitochondrial energy-linked nicotinamide nucleotide transhydrogenase deduced from the sequence of cDNA clones; Yamaguchi M et al.; The amino acid sequence of the bovine mitochondrial nicotinamide nucleotide transhydrogenase, which catalyzes hydride ion transfer between NAD(H) and NADP(H) coupled to proton translocation across the mitochondrial inner membrane, has been deduced from the corresponding cDNA . Two clones were isolated by screening a bovine lambda gt10 cDNA library, using two synthetic oligonucleotides and a cDNA restriction fragment as probes . The inserts together covered 3,105 base pairs of coding sequence, corresponding to 1.035 amino acid residues . However, the reading frame at the 5' end was still open . N-terminal sequence analysis of the isolated enzyme indicated the presence of 8 additional residues . Thus, the mature transhydrogenase appeared to have 1,043 amino acid residues and a calculated molecular weight of 109,212 . The deduced amino acid sequence of the transhydrogenase contained the sequences of four tryptic peptides that had been isolated from the enzyme . Two of these were the peptides that had been used for construction of the oligonucleotide probes . The other two were tryptic peptides isolated after labeling the NAD-binding site of the transhydrogenase once with {3H}p-fluorosulfonylbenzoyl-5'-adenosine (FSBA), and another time with {14C}N,N'-dicyclohexylcarbodiimide . The FSBA-labeled peptide was found to be located immediately upstream of the {14C}N,N'-dicyclohexylcarbodiimide-labeled peptide, about 230 residues from the N terminus . One of the tryptic peptides used for oligonucleotide probe construction was the same as that labeled with {3H}FSBA when the NAD-binding site was protected from FSBA attack . This peptide, which might be at the NADP-binding site of the transhydrogenase, was located very near the C terminus of the enzyme . The central region of the transhydrogenase (residues 420-850) is highly hydrophobic and appears to comprise about 14 membrane-spanning segments . By comparison, the N- and the C-terminal regions of the enzyme, which contain the NAD- and the putative NADP-binding sites, respectively, are relatively hydrophilic and are probably located outside the mitochondrial inner membrane on the matrix side . There is considerable homology between the bovine enzyme and the Escherichia coli transhydrogenase (two subunits, alpha with Mr = 54,000 and beta with Mr = 48,700), whose amino acid sequence has been determined from the genes (Clarke, D.M., Loo, T.W., Gillam, S., and Bragg, P.D . (1986) Eur . J . Biochem . 158, 647-653).

J Biol Chem, 1988 Feb 25, 263(6), 2638 - 43
Uridine diphosphate galactose 4-epimerase . pH dependence of the reduction of NAD+ by a substrate analog; Arabshahi A et al.; Neutron activation analysis of UDP-galactose 4-epimerase from Escherichia coli for 53 metals shows that the enzyme does not contain any of these metals at significant levels . The substrate analog P1-5'-uridine-P2-glucose-6-yl pyrophosphate (UGP), a structural isomer of UDP-glucose with the sugar linked to UDP through the C-6 hydroxyl group, is an inactivator that irreversibly reduces epimerase.NAD+ to epimerase.NADH . The pH dependence of kobs reveals the essential involvement of an acidic group, kinetically measured pKa = 5.48 +/- 0.08, in unprotonated form and two weakly acidic or basic groups, apparent pKa values of 10.03 +/- 0.43, in protonated forms . Measurements of kobs as a function of {UGP} show that it is given by kobs = k{UGP}/(K + {UGP}) at a given pH, where K = 0.19 +/- 0.04 mM throughout the pH range 4.8-10.4 . The pH-dependent first order rate constants range from 0.28 to 1.94 s-1, with the maximum value at pH 7.6 and decreasing at acidic and basic pH values . Reaction of {glucose-1-2H}UGP proceeds with kinetic isotope effects of 5.0, 2.1, 2.0, 1.9, and 3.5 at pH values 5.0, 6.2, 7.6, 9.0, and 10.0, respectively . Therefore, hydride transfer becomes rate-limiting at pH extremes but is not limiting at neutral pH, although deuteride transfer is significantly limiting at all pH values . The isotope effects facilitated correction of the kinetic pK values to the thermodynamic values 6.1-6.2 on the acid side and 9.0-9.6 on the alkaline side . We postulate that the group with pK1 = 5.5 (6.1-6.2 corrected) functions as an enzymic general base that abstracts the glucosyl C-1 hydroxyl proton in concert with transfer of the C-1 hydrogen and two electrons to NAD+ . The pH dependence on the alkaline side may be related to the uridine nucleotide-dependent conformational transition that is an essential step in the reduction of epimerase.NAD+ to epimerase.NADH by sugars.

J Biol Chem, 1988 Feb 25, 263(6), 2848 - 52
A 3' splice site mutation in a nuclear gene encoding a mitochondrial ribosomal protein in Neurospora crassa; Kuiper MT et al.; We showed previously that the cyt-21+ gene of Neurospora crassa encodes a mitochondrial ribosomal protein homologous to Escherichia coli ribosomal protein S-16 (Kuiper, M . T . R., Akins, R . A., Holtrop, M., de Vries, H., and Lambowitz, A . M . (1988) J . Biol . Chem . 263, 2840-2847) . A mutation in this gene, cyt-21-1, results in deficiency of mitochondrial small ribosomal subunits and small rRNA (Collins, R . A., Bertrand, H., LaPolla, R . J., and Lambowitz, A . M . (1979) Mol . Gen . Genet . 177, 73-84) . In the present work, cloning and sequencing of the cyt-21-1 mutant allele show that it contains a single dG to dA transition at the 3' splice site AG of the first intron in the protein coding region . This mutation leads to inactivation of the normal 3' splice site and activation of a cryptic 3' splice site, 15 nucleotides downstream . The use of this cryptic splice site results in an in-frame deletion of 5 amino acids from the cyt-21 protein . Comparison of mutant and wild-type mitochondrial small ribosomal subunit proteins showed one protein, S-24, with an altered electrophoretic mobility, consistent with the predicted deletion . The mutant ribosomal protein is still capable of binding to mitochondrial small ribosomal subunits, but results in abnormal mitochondrial ribosome assembly.

J Biol Chem, 1988 Feb 25, 263(6), 2840 - 7
Isolation and analysis of the Neurospora crassa Cyt-21 gene . A nuclear gene encoding a mitochondrial ribosomal protein; Kuiper MT et al.; The Neurospora crassa nuclear mutant cyt-21-1 (originally 297-24; Pittenger, T.H., and West, D.J . (1979) Genetics 93, 539-555) has a defect leading to gross deficiency of mitochondrial small ribosomal subunits . Here, we have cloned the cyt-21+ gene from a N . crassa genomic library, using the sib selection procedure (Akins, R . A., and Lambowitz, A . M . (1985) Mol . Cell Biol . 5, 2272-2278) . The genomic clone contains a short split gene encoding a basic protein of 107 amino acid residues . This protein shows strong homology to Escherichia coli ribosomal protein S-16 . Comparison of mutant and wild-type mitochondrial ribosomal proteins (Kuiper, M . T . R., Holtrop, M., Vennema, H., Lambowitz, A . M., and de Vries, H . (1988) J . Biol . Chem . 263, 2848-2852) indicates that the cyt-21 gene encodes N . crassa mitochondrial ribosomal protein S-24 . The expression of the cyt-21+ gene is regulated such that the level of the putative cyt-21+ mRNA is increased about 5-fold when mitochondrial protein synthesis is inhibited . We suggest that this reflects part of a general mechanism for coordinately activating Neurospora nuclear genes that encode mitochondrial constituents in response to impaired mitochondrial function . This is the first report of the cloning and characterization of a mitochondrial ribosomal protein gene from N . crassa.

J Biol Chem, 1988 Feb 25, 263(6), 2830 - 9
RPA190, the gene coding for the largest subunit of yeast RNA polymerase A; Memet S et al.; Yeast RNA polymerases are being extensively studied at the gene level . The entire gene encoding the largest subunit of RNA polymerase A, A190, was isolated and characterized in detail . Southern hybridization and gene disruption experiments showed that the RPA190 gene is unique in the haploid yeast genome and essential for cell viability . Nuclease S1 mapping was used to identify mRNA 5' and 3' termini . RPA190 encodes a polypeptide chain of 186,270 daltons in a large uninterrupted reading frame . A dot matrix comparison of the deduced amino acid sequence of subunit A190 with Escherichia coli beta' and cognate subunits B220 and C160 from yeast RNA polymerases B and C showed a conserved pattern of homology regions (I-VI) . A potential DNA-binding site (zinc-binding motif) is conserved in the N-terminal region I . Remarkably, the A190 subunit does not harbor the heptapeptide repeated sequence present in the B220 subunit . The sequence of the A190 subunit diverges from B220 and C160 by the presence of two hydrophilic domains inserted between homology regions I and II, and V and VI . From their codon usage and third base pyrimidine bias, RNA polymerase genes RPA190, RPB220, RPC160, and RPC40 fall among yeast genes expressed at an average level . The RPA190 5'-flanking region contains features present in other polymerase genes that might function in regulation.

J Biol Chem, 1988 Feb 25, 263(6), 2719 - 23
Functionality of the dnaA protein binding site in DNA replication is orientation-dependent; Seufert W et al.; We analyzed the functionality of different dnaA protein binding sites by assaying in vitro dnaA-dependent replication of pBR322 derivatives . Single dnaA sites from oriC and from the mioC and dnaA gene promoters were active when combined with the primer generating element of pBR322 in a proper distance . Prereplisome assembly did not require sequences in addition to the 9-base pair consensus dnaA binding site . Inversion of the structurally asymmetric dnaA site relative to its orientation in wild type pBR322 resulted in a marked reduction in replication efficiency, as observed with five different dnaA sites studied . The direction of DNA replication was not affected.

J Biol Chem, 1988 Feb 25, 263(6), 2597 - 602
Stringent and growth control of rRNA synthesis in Escherichia coli are both mediated by ppGpp; Baracchini E et al.; Weak stringent or relaxed responses were induced in Escherichia coli (relA+), using mild amino acid starvation or treatment with chloramphenicol at low concentrations, respectively, such that the growth rate was barely reduced . In this manner, the intracellular concentration of the nucleotide guanosine tetraphosphate, ppGpp, could be varied in any desired range between 0 and 1000 pmol of ppGpp per OD460 unit of culture mass . At the same time, the rate of synthesis of stable RNA (rs; rRNA and tRNA) was measured, relative to the total instantaneous rate of RNA synthesis (rt) . The correlation between the cytoplasmic concentration of ppGpp and stable RNA gene activity (rs/rt) was the same as that observed previously with relA+ and relA strains growing exponentially at different rates in different media . This suggests that the distinction between growth control and stringent control of stable RNA synthesis is arbitrary, and that both kinds of control reflect the same ppGpp-dependent phenomenon . By increasing the stable RNA gene dosage, using high copy number plasmids carrying an rrn gene, we have tested the idea that ppGpp partitions the bacterial RNA polymerase into two forms with different probabilities to initiate at stable RNA and mRNA promoters . The relaxed response was not significantly altered, but the extent of the stringent response was reduced by the presence of extra rrn genes . The results agree with quantitative predictions derived from the RNA polymerase partitioning hypothesis.

J Immunol Methods, 1988 Feb 24, 107(1), 67 - 72
Detection of alpha 1-antitrypsin from recombinant Escherichia coli lysates utilizing the particle concentration fluorescence immunoassay; Del Tito BJ Jr et al.; A particle concentration fluorescence immunoassay for the quantitative determination of human alpha 1-antitrypsin in Escherichia coli is described . The principle advantages of this system are speed, automation and a high level of sensitivity compared with enzyme assays and Western blot analysis . Two monoclonal antibodies recognizing different epitopes on the protein are used for the detection and quantitation of alpha 1-antitrypsin . This method has a measured range of 30-2500 ng/ml with a mean accuracy of 5.5% and a precision of 5.1%.

Biochemistry, 1988 Feb 23, 27(4), 1205 - 12
Properties of the high-affinity single-stranded DNA binding state of the Escherichia coli recA protein; Menetski JP et al.; The properties of the high-affinity single-stranded DNA (ssDNA) binding state of Escherichia coli recA protein have been studied . We find that all of the nucleoside triphosphates that are hydrolyzed by recA protein induce a high-affinity ssDNA binding state . The effect of ATP binding to recA protein was partially separated from the ATP hydrolytic event by substituting calcium chloride for magnesium chloride in the binding buffer . Under these conditions, the rate of ATP hydrolysis is greatly inhibited . ATP increases the affinity of recA protein for ssDNA in a concentration-dependent manner in the presence of both calcium and magnesium chloride with apparent Kd values of 375 and 500 microM ATP, respectively . Under nonhydrolytic conditions, the molar ratio of ATP to ADP has an effect on the recA protein ssDNA binding affinity . Over an ATP/ADP molar ratio of 2-3, the affinity of recA protein for ssDNA shifts cooperatively from a low-to a high-affinity state.

Biochemistry, 1988 Feb 23, 27(4), 1086 - 94
A description of conformational transitions in the Pribnow box of the trp promoter of Escherichia coli; Lefevre JF et al.; Selective changes in the NMR parameters of the sequence of CGTACTAGTTAACTAGTACG, which corresponds to the trp operator of Escherichia coli, were observed as a function of temperature . The changes were localized to the sequence TTAA in the Pribnow box (underlined) . Differential changes in chemical shift were analyzed in terms of a three-state model (states I, II, and III) to give the equilibrium constants, enthalpy changes, and populations . The midpoints of the first and second transitions were 9 and 30 degrees C, with enthalpy changes of 58 and 35 kcal/mol, respectively . Measurement of the spin-lattice and cross-relaxation rate constants at different temperatures allowed some structural conclusions to be drawn about the nature of the transitions . The line width of the H2 of A11 goes through a maximum at about 30 degrees C, indicating moderately fast exchange between the states . The rate constants for exchange at the midpoints were about 200 (I----II) and 250 (II----III) s-1 . Taking these findings into account, we propose a mechanism for the interaction between RNA polymerase and the promoter . This mechanism can explain the temperature dependence observed for the initiation of transcription.

Biochemistry, 1988 Feb 23, 27(4), 1094 - 104
Dynamics of repressor-operator recognition: the Tn10-encoded tetracycline resistance control; Kleinschmidt C et al.; Binding of the Tet repressor to nonspecific and specific DNA leads to quenching of the Tet fluorescence by approximately 22% and approximately 35%, respectively . This effect is used for a direct, quantitative characterization of the binding equilibria and dynamics involved in the recognition of the operator by its repressor . From the dependence of the nonspecific binding constant on the ion concentration, it is concluded that nonspecific binding is almost completely driven by the entropy change resulting from the release of three to four Na+ ions from the double helix upon protein binding . Formation of the specific complex is driven by a higher entropy term resulting from the release of seven to eight Na+ ions and in addition by a free energy term of -33 kJ/mol from nonelectrostatic interactions, which are attributed to the specific contacts . The dynamics of the repressor-operator recognition are resolved by stopped-flow measurements at various salt concentrations and for different DNA chain lengths into two separate steps . The first step follows a second-order mechanism and results in an intermediate complex associated with formation of about three to four electrostatic contacts between protein and DNA; apparently, this complex is equivalent to the nonspecific complex . The existence of an intermediate is also indicated by experiments in mixed Na+-Mg2+ buffers, which can be described with high accuracy by competition of Mg2+ and protein . The intermediate complex is formed at a rate of 3 X 10(8) M-1 s-1 and is converted in the second reaction step to the specific complex with a rate constant of 6 X 10(4) s-1, which is almost independent of the salt concentration . Our interpretation and the parameters obtained from our model are confirmed by competition of nonspecific DNA with operator DNA for repressor binding . The observed maximal rate constant of 3 X 10(8) M-1 s-1 is very close to theoretical predictions for the association without a sliding mechanism . The very small dependence of the observed rate constants on the chain length shows that the Tet repressor is not able to slide over any substantial distance even at low salt concentrations . The question of a potential contribution from sliding under our experimental conditions is critically discussed . The absence of sliding in the case of the Tet repressor under physiological conditions is compared with the high sliding efficiency of the lac repressor and is discussed with respect to possible molecular mechanisms of sliding in relation to biological function.

J Mol Biol, 1988 Feb 20, 199(4), 559 - 73
SUF12 suppressor protein of yeast . A fusion protein related to the EF-1 family of elongation factors; Wilson PG et al.; Mutations at the suf12 locus were isolated in Saccharomyces cerevisiae as extragenic suppressors of +1 frameshift mutations in glycine (GGX) and proline (CCX) codons, as well as UGA and UAG nonsense mutations . To identify the SUF12 function in translation and to understand the relationship between suf12-mediated misreading and translational frameshifting, we have isolated an SUF12+ clone from a centromeric plasmid library by complementation . SUF12+ is an essential, single-copy gene that is identical with the omnipotent suppressor gene SUP35+ . The 2.3 x 10(3) base SUF12+ transcript contains an open reading frame sufficient to encode a 88 x 10(3) Mr protein . The pattern of codon usage and transcript abundance suggests that SUF12+ is not a highly expressed gene . The linear SUF12 amino acid sequence suggests that SUF12 has evolved as a fusion protein of unique N-terminal domains fused to domains that exhibit essentially co-linear homology to the EF-1 family of elongation factors . Beginning internally at amino acid 254, homology is more extensive between the SUF12 protein and EF-1 alpha of yeast (36% identity; 65% with conservative substitutions) than between EF-1 alpha of yeast and EF-Tu of Escherichia coli . The most extensive regions of SUF12/EF-1 alpha homology are those regions that have been conserved in the EF-1 family, including domains involved in GTP and tRNA binding . It is clear that SUF12 and EF-1 alpha are not functionally equivalent, since both are essential in vivo . The N-terminal domains of SUF12 are unique and may reflect, in part, the functional distinction between these proteins . These domains exhibit unusual amino acid composition and extensive repeated structure . The behavior of suf12-null/SUF12+ heterozygotes indicates that suf12 is co-dominantly expressed and suggests that suf12 allele-specific suppression may result from functionally distinct mutant proteins rather than variation in residual wild-type SUF12+ activity . We propose a model of suf12-mediated frameshift and nonsense suppression that is based on a primary defect in the normal process of codon recognition.

J Mol Biol, 1988 Feb 20, 199(4), 623 - 35
Interactions of Escherichia coli transcription termination factor rho with RNA . II . Electron microscopy and nuclease protection experiments; Bear DG et al.; Structural aspects of the interaction between Escherichia coli transcription termination factor rho and RNA have been investigated, using nuclease protection assays and electron microscopy . A synthetic RNA, poly(rC), has been used as a substrate for these studies, since it binds tightly to rho and acts as a strong activator of the ATPase activity of rho . Digestion of oligo(rC)-rho complexes with ribonuclease A yields oligo(rC) fragments with a maximum length of 70 to 80 nucleotide residues . Electron micrographs demonstrate that rho binds to poly(rC) as a toroid-shaped oligomer with an outside diameter of approximately 120 A . Taken together with data from the accompanying paper, which shows that the RNA binding site size per rho monomer is 13(+/- 1) nucleotide residues, we infer that rho binds RNA as a hexamer with an oligomeric site size of 72 to 84 residues . Further analysis of the electron micrographs has revealed that the polynucleotide chain is wrapped around, or condensed within, the protein oligomer . rho hexamers bind to poly(rC) with moderate co-operativity (omega = 380 +/- 60), displaying no significant preference for binding to chain ends versus internal sites on the polynucleotide chain . These findings and those of the companion paper are discussed in terms of various models for the structure of the rho-RNA complex in transcription termination.

J Mol Biol, 1988 Feb 20, 199(4), 609 - 22
Interactions of Escherichia coli transcription termination factor rho with RNA . I . Binding stoichiometries and free energies; McSwiggen JA et al.; In this paper we examine the binding of Escherichia coli transcription termination factor rho to single-stranded RNA . Random polyribonucleotide copolymers containing low ratios of the fluorescent base 1,N6-ethenoadenosine have been synthesized using polynucleotide phosphorylase . Binding of rho to these polynucleotides elicits a significant increase in fluorescence, thus allowing either the direct monitoring of the titration of these polynucleotides with rho or measurement of the competitive displacement of the protein from these probes with other nucleic acids, even in the presence of biologically significant concentrations of ATP . By these techniques, it is shown that the binding site size (n) of rho protein to polynucleotides is 13(+/- 1) nucleotide residues per rho monomer (or 78(+/- 6) nucleotide residues per rho hexamer) . Binding constants (K) and co-operativity parameters (omega) for the binding of rho to these polynucleotides have been measured as a function of nucleotide composition and of salt concentration . The results show that the affinity of rho for cytosine residues is quite strong and salt concentration independent, whilst binding to uridine residues is somewhat weaker and very salt concentration dependent . Poly(rC) and poly(dC) bind to rho competitively and with equal affinity and site size, although poly(rC) is the strongest cofactor for activating rho-dependent ATPase and poly(dC) has no ATPase cofactor activity at all . It is also shown that ATP (or ADP or ATP-gamma-S) binding does not change the binding site size of rho on RNA nor decrease its affinity for RNA binding . Circular dichroism measurements of rho binding to phage R17 RNA suggest that the affinity (K omega) of rho for RNA may be increased by ATP . The possible significance of these results for models of rho-dependent transcription termination is discussed in the companion paper.

Science, 1988 Feb 19, 239(4842), 888 - 93
Three-dimensional structure of an oncogene protein: catalytic domain of human c-H-ras p21; de Vos AM et al.; The crystal structure at 2.7 A resolution of the normal human c-H-ras oncogene protein lacking a flexible carboxyl-terminal 18 residue reveals that the protein consists of a six-stranded beta sheet, four alpha helices, and nine connecting loops . Four loops are involved in interactions with bound guanosine diphosphate: one with the phosphates, another with the ribose, and two with the guanine base . Most of the transforming proteins (in vivo and in vitro) have single amino acid substitutions at one of a few key positions in three of these four loops plus one additional loop . The biological functions of the remaining five loops and other exposed regions are at present unknown . However, one loop corresponds to the binding site for a neutralizing monoclonal antibody and another to a putative "effector region"; mutations in the latter region do not alter guanine nucleotide binding or guanosine triphosphatase activity but they do reduce the transforming activity of activated proteins . The data provide a structural basis for understanding the known biochemical properties of normal as well as activated ras oncogene proteins and indicate additional regions in the molecule that may possibly participate in other cellular functions.

Biochem J, 1988 Feb 15, 250(1), 25 - 31
Purification and regulatory properties of isocitrate lyase from Escherichia coli ML308; MacKintosh C et al.; Isocitrate lyase was purified to homogeneity from Escherichia coli ML308 . Its subunit Mr and native Mr were 44,670 +/- 460 and 17,000-180,000 respectively . The kinetic mechanism of the enzyme was investigated by using product and dead-end inhibitors of the cleavage and condensation reactions . The data indicated a random-order equilibrium mechanism, with formation of a ternary enzyme-isocitrate-succinate complex . In an attempt to predict the properties of isocitrate lyase in intact cells, the effects of pH, inorganic anions and potential regulatory metabolites on the enzyme were studied . The Km of the enzyme for isocitrate was 63 microM at physiological pH and in the absence of competing anions . Chloride, phosphate and sulphate ions inhibited competitively with respect to isocitrate . Phosphoenolpyruvate inhibited non-competitively with respect to isocitrate, but the Ki value suggested that this effect was unlikely to be significant in intact cells . 3-Phosphoglycerate was a competitive inhibitor . At the concentration reported to occur in intact cells, this metabolite would have a significant effect on the activity of isocitrate lyase . The available data suggest that the Km of isocitrate lyase for isocitrate is similar to the concentration of isocitrate in E . coli cells growing on acetate, about one order of magnitude higher than the Km determined in vitro in the absence of competing anions.

Eur J Biochem, 1988 Feb 15, 172(1), 155 - 9
Excision of apurinic and/or apyrimidinic sites from DNA by nucleolytical enzymes from rat brain; Ivanov VA et al.; Apurinic and/or apyrimidinic (AP) sites were excised from PM2 phage DNA by two enzymes: an AP endodeoxyribonuclease isolated from rat neocortex chromatin and a rat brain exodeoxyribonuclease, DNase B III . The resulting gap was filled with DNA polymerase beta prepared from rat liver and finally ligated by Escherichia coli DNA ligase.

FEBS Lett, 1988 Feb 15, 228(2), 263 - 7
Electron microscopy study of Q beta replicase; Berestowskaya NH et al.; Purified preparations of Q beta replicase have been studied by electron microscopy using a negative staining technique, and a three-dimensional model of the enzyme molecule has been constructed . The molecule of this four-subunit protein appears to be a compact structure having a size of 100 +/- 10 A; it is subdivided into two unequal bipartite subparticles . The conclusion has been made that all the constituent subunits, including the ribosomal protein Sl, acquire a globular conformation when associated in the replicase complex.

FEBS Lett, 1988 Feb 15, 228(2), 254 - 8
Structural differences between oxidized and reduced thioredoxin monitored by two-dimensional 1H NMR spectroscopy; Dyson HJ et al.; Two-dimensional high resolution NMR techniques have been applied to study the structural differences between the oxidized and reduced forms of Escherichia coli thioredoxin in solution . Sequential proton resonance assignments indicate only limited conformational changes; major chemical shift differences are found for a few residues in a beta-strand immediately preceding the active site S-S bridge and the active site itself . Additional resonance shifts are observed for several residues distant in the primary sequence . The X-ray structure of oxidized thioredoxin shows that these residues form a flat hydrophobic surface, close to the active site S-S bridge, which is probably involved in interactions with other protein molecules.

Biochem Biophys Res Commun, 1988 Feb 15, 150(3), 1115 - 21
Effect of phorbol ester on contractile response of aorta from endotoxic rats; Wakabayashi I et al.; The influence of phorbol ester on the isometric contractile response of aorta from endotoxic rats was examined . In endotoxic rat aorta, the contractile responses to KCl and phorbol 12,13-dibutyrate (PDBu) were both remarkably diminished, compared to those in control rat aorta . Preincubation with PDBu augmented the aortic contractile response to KCl in both control and endotoxic rats . This augmentative effect of PDBu was significantly more pronounced in endotoxic rats than in controls . When the contractile response to 80 mM KCl reached a plateau after PDBu pretreatment, addition of 5 mM CaCl2 (final concentration) to the organ bath completely reversed the diminished contractile response of endotoxic rat aorta to the control level . These results suggest that the hyporesponsiveness of endotoxic rat aorta to KCl may be caused by decreases in both protein kinase C mediated response and calcium sensitivity of vascular smooth muscle cells.

J Biol Chem, 1988 Feb 15, 263(5), 2571 - 4
Structure determination of a monoclonal Fab fragment specific for histidine-containing protein of the phosphoenolpyruvate: sugar phosphotransferase system of Escherichia coli; Prasad L et al.; Jel 42 is a monoclonal antibody specific for histidine-containing protein, a small phosphocarrier protein required for sugar transport in Escherichia coli . Fab fragments prepared from this antibody by papain digestion consisted of three major isoelectric forms which were separated on a chromatofocusing column . Two of these forms produced large crystals in space group P21 and unit cell dimensions a = 117.48 A, b = 66.56 A, c = 67.31 A, and beta = 118.7 degrees, with two Fab fragments per asymmetric unit . Data were collected to 3.5-A resolution . The structure of Fab Jel 42 was solved by the Molecular Replacement method (least-squares refined to R = 0.282) using the known structure of Fab HED 10 (12) as the search model; the amino acid residues of the hypervariable and elbow regions of Fab HED 10 were omitted from the starting model . A Fourier map calculated at this stage revealed electron density which corresponded to the hypervariable loops forming the antigen-binding crevice and the elbow region of Fab Jel 42 . The elbow angles for the two independent Fab molecules are 159 and 167 degrees, similar to that of the Fab HED 10 search model which has an elbow angle of 162 degrees . There is no local noncrystallographic axis of symmetry relating the two molecules in the asymmetric unit.

J Biol Chem, 1988 Feb 15, 263(5), 2477 - 82
Evidence of histidine phosphorylation in isocitrate lyase from Escherichia coli; Robertson EF et al.; Escherichia coli isocitrate lyase (EC 4.1.3.1.) can be phosphorylated in vitro by an ATP-dependent reaction . The enzyme becomes phosphorylated by an endogenous kinase when partially purified sonic extracts are incubated with {gamma-32P}ATP . Treatment of isocitrate lyase with diethyl pyrocarbonate, a histidine-modifying reagent, blocked incorporation of {32P}phosphate from {gamma-32P}ATP . The isoelectric point of the enzyme was altered by treatment with phosphoramidate, a histidine phosphorylating agent, which suggests that isocitrate lyase can be phosphorylated at a histidine residue(s) . Immunoprecipitated 32P-labeled isocitrate lyase was subjected to alkaline hydrolysis, mixed with chemically synthesized phosphohistidine standards, and analyzed by anion exchange chromatography . Characterization of the phosphoamino acid was based on the demonstration that the 32P-labeled product from alkali-hydrolyzed isocitrate lyase comigrated with synthetic 1-phosphohistidine . In addition, loss of catalytic activity after treatment with potato acid phosphatase indicates that catalytically active isocitrate lyase is the phosphorylated form of the enzyme.

J Biol Chem, 1988 Feb 15, 263(5), 2163 - 9
In vitro mutagenesis of Escherichia coli citrate synthase to clarify the locations of ligand binding sites; Anderson DH et al.; In vitro mutagenesis techniques have been used to investigate two structure-function questions relating to the allosteric citrate synthase of Escherichia coli . The first question concerns the binding site of alpha-keto-glutarate, which is a structural analogue of the substrate oxaloacetate and yet has been suggested to be an allosteric inhibitor of the enzyme . Using oligonucleotide-directed mutagenesis of the cloned E . coli citrate synthase gene, we prepared missense mutants, designated CS226H----Q and CS229H----Q, in which histidine residues at positions 226 and 229, respectively, were replaced by glutamine . In the homologous pig heart citrate synthase it is known (Wiegand, G., and Remington, S . J . (1986) Annu . Rev . Biophys . Biophys . Chem . 15, 97-117) that the equivalent of His-229 helps to bind oxaloacetate, while the equivalent of His-226 is nearby . Kinetic and ligand binding measurements showed that CS226H----Q had a reduced affinity for oxaloacetate and alpha-ketoglutarate, while CS229H----Q bound oxaloacetate even less effectively, and was not inhibited by alpha-ketoglutarate at all under our conditions . This parallel loss of binding affinities for oxaloacetate and alpha-ketoglutarate, in two mutants altered in residues at the active site of E . coli citrate synthase, strongly suggests that inhibition of this enzyme by alpha-ketoglutarate is not allosteric but occurs by competitive inhibition at the active site . The second question investigated was whether the known inhibition by acetyl-CoA of binding of NADH, an allosteric inhibitor of E . coli citrate synthase, occurs heterotropically, as an indirect result of acetyl-CoA binding at the active site, or directly, by competition at the allosteric NADH binding site . Using existing restriction sites in the cloned E . coli citrate synthase gene, we prepared a deletion mutant which lacked 24 amino acids near what is predicted to the acetyl-CoA-binding portion of the active site . The mutant protein was inactive, and acetyl-CoA did not bind to the active site but still inhibited NADH binding . Thus acetyl-CoA can interact with both the allosteric and the active sites of this enzyme.

J Biol Chem, 1988 Feb 15, 263(5), 2152 - 8
Native-like intermediate on the folding pathway of Escherichia coli succinyl-CoA synthetase; Khan IA et al.; The transition between the native and denatured states of the tetrameric succinyl-CoA synthetase from Escherichia coli has been investigated by circular dichroism, fluorescence spectroscopy, cross-linking by glutaraldehyde and activity measurements . At pH 7.4 and 25 degrees C, both denaturation of succinyl-CoA synthetase by guanidine hydrochloride and refolding of the denatured enzyme have been characterized as reversible reactions . In the presence of its substrate ATP, the denatured enzyme could be successfully reconstituted into the active enzyme with a yield of 71-100% . Kinetically, reacquisition of secondary structure by the denatured enzyme was rapid and occurred within 1 min after refolding was initiated . On the other hand, its reactivation was a slow process which continued up to 25 min before 90% of the native activity could be restored . Both secondary and quaternary structures of the enzyme, reconstituted in the absence of ATP, were indistinguishable from those of the native enzyme but the renatured protein was catalytically inactive . This observation indicates the presence of catalytically inactive tetramer as an intermediate in the reconstitution process . The reconstituted protein could be reactivated by ATP even 10 min after the reacquisition of the native secondary structure by the refolding protein . However, reactivation of the protein by ATP 60 min after the regain of secondary structure was significantly less, suggesting that rapid refolding and reassociation of the monomers into a native-like tetramer and reactivation of the tetramer are sequential events; the latter involving slow and small conformational rearrangements in the refolded enzyme that are likely to be associated with phosphorylation.

J Biol Chem, 1988 Feb 15, 263(5), 2344 - 51
The recognition by RNase P of precursor tRNAs; Baer MF et al.; We have generated mutants of M1 RNA, the catalytic subunit of Escherichia coli RNaseP, and have analyzed their properties in vitro and in vivo . The mutations, A333----C333, A334----U334, and A333 A334----C333 U334 are within the sequence UGAAU which is complementary to the GT psi CR sequence found in loop IV of all E . coli tRNAs . We have examined: 1) whether the mutant M1 RNAs are active in processing wild type tRNA precursors and 2) whether they can restore the processing defect in mutant tRNA precursors with changes within the GT psi CR sequence . As substrates for in vitro studies we used wild type E . coli SuIII tRNA(Tyr) precursor, and pTyrA54, a mutant tRNA precursor with a base change that could potentially complement the U334 mutation in M1 RNA . The C333 mutation had no effect on activity of M1 RNA on wild type pTyr . The U334 mutant M1 RNA, on the other hand, had a much lower activity on wild type pTyr . However, use of pTyrA54 as substrate instead of wild type pTyr did not restore the activity of the U334 mutant M1 RNA . These results suggest that interactions via base pairing between nucleotides 331-335 of M1 RNA and the GT psi CG of pTyr are probably not essential for cleavage of these tRNA precursors by M1 RNA . For assays of in vivo function, we examined the ability of mutant M1 RNAs to complement a ts mutation in the protein component of RNaseP in FS101, a recA- derivative of E . coli strain A49 . In contrast to wild type M1 RNA, which complements the ts mutation when it is overproduced, neither the C333 nor the U334 mutant M1 RNAs was able to do so.

J Biol Chem, 1988 Feb 15, 263(5), 2146 - 51
Structure of the yeast HOM3 gene which encodes aspartokinase; Rafalski JA et al.; The yeast HOM3 gene has been cloned molecularly by complementation of a HOM3 mutant . The gene is located about 8 kilobase pairs from HIS1 and is present as a single copy in the yeast genome . Mutations in HOM3 result in a requirement for threonine and methionine (or homoserine) for growth and a lack of detectable aspartokinase activity . The nucleotide sequence of HOM3 predicts an enzyme 414 amino acids long that shows homology to the three Escherichia coli aspartokinases, indicating that it is the structural gene for yeast aspartokinase . An approximately 1800-base pair mRNA is transcribed from the HOM3 gene, initiating at several start sites, 80 and 70 base pairs downstream, respectively, from two TATA boxes . Upstream of the TATA boxes is a single TGACTC sequence . This sequence has been shown to be essential for regulation of several genes that encode amino acid biosynthetic enzymes by the general control system . However, no increase in aspartokinase mRNA is observed under general control derepressing conditions.

Biochem Biophys Res Commun, 1988 Feb 15, 150(3), 1106 - 14
Site-specific mutagenesis of the human interleukin-1 beta gene: structure-function analysis of the cysteine residues; Kamogashira T et al.; Human interleukin-1 beta (IL-1 beta) has two cysteines located at amino acid residues 8 and 71 of the mature protein consisting 153 amino acids . To clarify the role of these characteristic cysteine residues in IL-1 beta, at first, an expression plasmid for site-specific mutagenesis has been constructed by inserting the ori and intergenic region of phage f1 into the IL-1 beta expression vector . The plasmid can be used not only for isolation of the modified IL-1 beta gene but for expression of the mutant protein in Escherichia coli . Using this plasmid, each of the cysteine codons in IL-1 beta gene was changed to serine or alanine codon, or deleted . The modified IL-1 beta showed that the two cysteine residues in IL-1 beta are not essential for biological activity but not to be eliminated for the maintenance of the functional structure of IL-1 beta.

J Biol Chem, 1988 Feb 15, 263(5), 2409 - 16
The sulfate activation locus of Escherichia coli K12: cloning, genetic, and enzymatic characterization; Leyh TS et al.; The sulfate activation locus of Escherichia coli K12 has been cloned by complementation . The genes and gene products of this locus have been characterized by correlating the enzyme activity, complementation patterns, and polypeptides associated with subclones of the cloned DNA . The enzymes of the sulfate activation pathway, ATP sulfurylase (ATP:sulfate adenylyltransferase, EC 2.7.7.4) and APS kinase (ATP:adenosine-5'-phosphosulfate 3'-phosphotransferase, EC 2.7.1.25) have been overproduced approximately 100-fold . Overproduction of ATP sulfurylase requires the expression of both the cysD gene, encoding a 27-kDa polypeptide, and a previously unidentified gene, denoted cysN, which encodes a 62-kDa polypeptide . Purification of ATP sulfurylase to homogeneity reveals that the enzyme is composed of two types of subunits which are encoded by cysD and cysN . Insertion of a kanamycin resistance gene into plasmid or chromosomal cysN prevents sulfate activation and decreases expression of the downstream cysC gene . cysC appears to be the APS kinase structural gene and encodes a 21-kDa polypeptide . The genes are adjacent and are transcribed counterclockwise on the E . coli chromosome in the order cysDNC . cysN and cysC are within the same operon and cysDNC are not in an operon containing cysHIJ.

J Biol Chem, 1988 Feb 15, 263(5), 2364 - 70
All four repeating domains of the endogenous inhibitor for calcium-dependent protease independently retain inhibitory activity . Expression of the cDNA fragments in Escherichia coli; Emori Y et al.; We have already determined the primary structure of the endogenous inhibitor for calcium-dependent protease (CANP inhibitor, calpastatin) from the cDNA sequence and revealed that the CANP inhibitor contains four internally repeating units which could be responsible for its multiple reactive sites (Emori, Y., Kawasaki, H., Imajoh, S., Imahori, K., and Suzuki, K . (1987) Proc . Natl . Acad . Sci . U.S.A . 84, 3590-3594) . Restriction fragments of the cDNA corresponding to each of the four domains (encoding 104-156 amino acid residues of the total 718 residues) were subcloned into the multicloning site of pUC9 or pUC18 in a direction and frame matched to the lacZ' open reading frame of the vector . Under the lac operator-promoter system, we succeeded in producing truncated fragments of the CANP inhibitor in Escherichia coli . The CANP inhibitor fragments were partially purified, and the inhibitory activities toward calcium-dependent protease (CANP) were examined . All fragments containing well conserved regions of about 30 amino acid residues (domains I-IV) located in the middle of the four units exhibited the inhibitory activity . However, their inhibitory activities varied considerably . Further truncation experiments revealed that small fragments containing 30-70 amino acid residues of the CANP inhibitor still retained inhibitory activity . From these experimental results the following conclusions can be drawn: 1) each of the four repeating units of the CANP inhibitor (about 140 amino acid residues) is a real functional unit and can inhibit CANP activity independently; and 2) domains corresponding to well conserved sequences of about 30 amino acid residues containing a consensus Thr-Ile-Pro-Pro-X-Tyr-Arg sequence are essential for the inhibitory activity, and the bordering regions are important for its modulation.

Anal Biochem, 1988 Feb 15, 169(1), 132 - 7
Agarose gel electrophoresis of denatured RNA with silver staining; Skopp RN et al.; This paper describes agarose gel electrophoresis and silver staining of denatured RNAs . Glyoxal- or formaldehyde-denatured RNAs are electrophoresed in an agarose gel cast on a plastic support using an inert, low conductivity buffer . Following electrophoresis, the gel is stained with a sensitive silver stain . The method produces sharp, well-resolved bands and yields accurate RNA size estimates . Because of its sensitivity and simplicity, it is suitable for routine laboratory use.

FEBS Lett, 1988 Feb 15, 228(2), 245 - 8
Bioenergetics of dihydrostreptomycin transport by Escherichia coli; Goss SR et al.; Previous demonstrations of the irreversibility of dihydrostreptomycin transport across the cytoplasmic membrane of Escherichia coli were not due to decreases in the magnitude of the cytoplasmic membrane potential (delta psi) . Irreversibility was probably not due to ATP hydrolysis being coupled to transport, because the rate of energy-dependent dihydrostreptomycin uptake was unaffected by 10-fold reduction in the cellular ATP level.

Biochem Biophys Res Commun, 1988 Feb 15, 150(3), 979 - 86
tRNAPhe and tRNAPro are the near-ultraviolet molecular targets triggering the growth delay effect; Blondel MO et al.; The illumination of Escherichia coli cells with UVA light, 320 nm less than or equal to lambda less than or equal to 380 nm, triggers a transient growth and division delay . The built-in 4-thiouridine chromophore which absorbs light at 340 nm leads to the quantitative 8-13 crosslinking of a number of tRNA species corresponding to 50% of the bulk tRNA molecules . Determination of the tRNA acylation level by the various aminoacids shows that only the tRNA species acylated by Phe and Pro are strikingly affected in vivo . Both acylation levels decrease to less than 10% of their initial value during the illumination period, remain stable all along the growth lag and increase concomitantly with cell mass when growth resumes . Hence tRNA(Phe) and tRNA(Pro) are the UVA light molecular targets triggering growth delay and related effects of biological significance such as cell volume reduction, photoprotection and protection against UV mutagenesis (antiphotomutagenesis).

Cell, 1988 Feb 12, 52(3), 355 - 65
Murine genomic DNA sequences replicating autonomously in mouse L cells; Holst A et al.; Plasmids that replicate autonomously in mouse L cells were constructed by inserting random genomic DNA fragments from Ltk- cells into a plasmid containing the HSV-1 thymidine kinase gene with a truncated low-efficiency promoter . HAT resistance was used as a selective marker . The presence of free plasmids in the DNA of transformants was demonstrated by hybridization with a specific plasmid probe, by electron microscopic visualization of circular DNA, and by recovering these plasmids by E . coli transformation . Nineteen different DNA fragments were isolated . They were characterized as murine autonomously replicating sequences by Mbol restriction endonuclease sensitivity, by bromodeoxyuridine substitution, by copy number determination, and by segregation analysis . Sequence analysis of the inserts of nine plasmids revealed a conserved element of 12 bp (CTCATGAGAGGCCAA) in five out of nine autonomously replicating sequences.

Nucleic Acids Res, 1988 Feb 11, 16(3), 883 - 93
Mutational analysis of the tobacco mosaic virus 5'-leader for altered ability to enhance translation; Gallie DR et al.; Mutational analysis of the 5'-untranslated leader sequence (omega) of tobacco mosaic virus (TMV) was carried out to determine those sequences necessary for the translational enhancement associated with omega . Five deletion mutants, a single base substitution, and a 25 base replacement mutant were tested for alterations in omega's ability to enhance expression of beta-glucuronidase (GUS) mRNA in tobacco mesophyll protoplasts and Escherichia coli or chloramphenicol acetyltransferase (CAT) mRNA in Xenopus laevis oocytes . Alteration of an eight base subsequence required for the binding of a second ribosome resulted in the loss of translational enhancement in X . laevis oocytes but not in protoplasts . Substantial increases in enhancement were observed for several of the mutants in E . coli.

Nucleic Acids Res, 1988 Feb 11, 16(3), 815 - 32
RNA-protein cross-linking in Escherichia coli 50S ribosomal subunits; determination of sites on 23S RNA that are cross-linked to proteins L2, L4, L24 and L27 by treatment with 2-iminothiolane; Gulle H et al.; RNA-protein cross-links were introduced into E . coli 50S ribosomal subunits by treatment with 2-iminothiolane followed by mild ultraviolet irradiation . After partial digestion of the RNA, the cross-linked RNA-protein complexes were separated by our recently published three-step procedure . In cases where this separation was inadequate, a further purification step was introduced, involving affinity chromatography with antibodies to the ribosomal 50S proteins . Analysis of the isolated complexes enabled four new cross-link sites on the 23S RNA to be identified, as well as re-confirming several previously established sites . The new sites are as follows: Protein L2 is cross-linked within an oligonucleotide at positions 1818-1823 in the 23S RNA, protein L4 within positions 320-325, protein L24 within positions 99-107, and protein L27 within positions 2320-2323.

Nucleic Acids Res, 1988 Feb 11, 16(3), 791 - 802
5'-3' exonucleases in phosphorothioate-based oligonucleotide-directed mutagenesis; Sayers JR et al.; The application of T7 and lambda exonuclease to phosphorothioate-based oligonucleotide-directed mutagenesis was investigated . Oligonucleotide primers designed to introduce single or double base mismatches, an insertion or a deletion (each of 16 bases) were annealed to M13 phage derivatives . Double stranded closed circular DNA (RF IV) containing phosphorothioate internucleotidic linkages in the (-)strand was prepared enzymatically from these templates . A nick was introduced into the (+)strand of the hetroduplex DNA . This nicked DNA (RF II) was subjected to treatment with T7 or lambda exonuclease . Both of these enzymes were able to degrade almost all of the viral (+)strand when presented with DNA containing one or two base mismatches . Repolymerisation of the DNA after the gapping reaction, followed by transfection into E . coli cells gave mutational efficiencies of up to 95% . In the case of RF II DNA prepared with insertion or deletion primers these exonucleases could only partially degrade the viral (+)strand but were nevertheless highly efficient in such mutagenesis experiments.

Nucleic Acids Res, 1988 Feb 11, 16(3), 997 - 1010
Affinities of ribosomal protein S20 and C-terminal deletion mutants for 16S rRNA and S20 mRNA; Donly BC et al.; We have measured the binding of E . coli ribosomal protein S20 and a number of C-terminal deletion mutants to 16S rRNA and in vitro transcribed S20 mRNA . Mutant S20s of interest were synthesized in vitro from the appropriate plasmid templates by coupled transcription and translation . The affinity of S20 produced in vitro for 16S rRNA is 1.2 x 10(7) (M-1) in a gel filtration assay . Removal of as few as 6 residues from the C terminus of S20 results in a sharp loss of binding activity, suggesting the presence of critical residues in this region . Analysis of the amino acid sequence of S20 indicates that these residues may constitute part of a segment of alpha helix . Although S20 is known to autoregulate its own synthesis, we were unable to demonstrate any measurable affinity of S20 for its own mRNA.

Biochemistry, 1988 Feb 9, 27(3), 901 - 9
Expression of human DNA polymerase beta in Escherichia coli and characterization of the recombinant enzyme; Abbotts J et al.; The coding region of a human beta-polymerase cDNA, predicting a 335 amino acid protein, was subcloned in the Escherichia coli expression plasmid pRC23 . After induction of transformed cells, the crude soluble extract was found to contain a new protein immunoreactive with beta-polymerase antibody and corresponding in size to the protein deduced from the cDNA . This protein was purified in a yield of 1-2 mg/50 g of cells . The recombinant protein had about the same DNA polymerase specific activity as beta-polymerase purified from mammalian tissues, and template-primer specificity and immunological properties of the recombinant polymerase were similar to those of natural beta-polymerases . The purified enzyme was free of nuclease activity . We studied detailed catalytic properties of the recombinant beta-polymerase using defined template-primer systems . The results indicate that this beta-polymerase is essentially identical with natural beta-polymerases . The recombinant enzyme is distributive in mode of synthesis and is capable of detecting changes in the integrity of the single-stranded template, such as methylated bases and double-stranded region . The enzyme recognizes a template region four to seven bases downstream of the primer 3' end and utilizes alternative primers if this downstream template region is double stranded . The enzyme is unable to synthesize past methylated bases N3-methyl-dT or O6-methyl-dG.

Biochemistry, 1988 Feb 9, 27(3), 983 - 91
Subunits of human alpha 2-macroglobulin produced by specific reduction of interchain disulfide bonds with thioredoxin; Larsson LJ et al.; Disulfide bonds in alpha 2-macroglobulin (alpha 2M) were reduced with the thioredoxin system from Escherichia coli . Under the conditions selected, 3.5-4.1 disulfide bonds were cleaved in each alpha 2M molecule, as determined by the consumption of NADPH during the reaction and by the incorporation of iodo{3H}acetate into the reaction product . This extent of disulfide bond reduction, approximately corresponding to that expected from specific cleavage of all four interchain disulfide bonds of the protein, coincided with the nearly complete dissociation of the intact alpha 2M molecule to a species migrating as an alpha 2M subunit in gel electrophoresis, under both denaturing and nondenaturing conditions . The dissociation was accompanied by only small changes of the spectroscopic properties of the subunits, which thus retain a near-native conformation . Reaction of isolated subunits with methylamine or trypsin led to the appearance of approximately 0.55 mol of thiol group/mol of subunits, indicating that the thio ester bonds are largely intact . Moreover, the rate of cleavage of these bonds by methylamine was similar to that in the whole alpha 2M molecule . Although the bait region was specifically cleaved by nonstoichiometric amounts of trypsin, the isolated subunits had minimal proteinase binding ability . Reaction of subunits with methylamine or trypsin produced changes of farultraviolet circular dichroism and near-ultraviolet absorption similar to those induced in the whole alpha 2M molecule, although in contrast with whole alpha 2M no fluorescence change was observed . The methylamine- or trypsin-treated subunits reassociated to a tetrameric species, migrating as the "fast" form of whole alpha 2M in gradient gel electrophoresis.(ABSTRACT TRUNCATED AT 250 WORDS)

FEBS Lett, 1988 Feb 8, 228(1), 7 - 11
An initiator protein for plasmid R6K DNA replication . Mutations affecting the copy-number control; Inuzuka M et al.; Two kinds of mutations affecting the copy-number control of plasmid R6K were isolated and identified in an initiator pi protein by DNA sequencing . Firstly, a temperature-sensitive replication mutation, ts22, with decreased copy number results in a substitution of threonine to isoleucine at position 138 of the 305-amino-acid pi protein . Secondly, a high-copy-number (cop21) mutant was isolated from this ts mutant and was identified by an alteration of alanine to serine at position 162 . This cop21 mutation suppressed the Ts character and was recessive to the wild-type allele in the copy control.

FEBS Lett, 1988 Feb 8, 228(1), 22 - 6
Cloning, sequencing and expression of a full-length rabbit fast skeletal troponin-C cDNA; Chen Q et al.; A full-length cDNA coding for troponin-C isolated from an adult rabbit fast skeletal muscle library has been sequenced and expressed in an E . coli host . The amino acid sequence derived from the coding region agrees with the published protein sequence except that the first two residues are reversed . The expressed protein was found to be identical to purified rabbit skeletal troponin-C based on electrophoretic mobilities in polyacrylamide gels containing either SDS or urea, and on immunoblotting . These results establish that our troponin-C cDNA clone is suitable for site-directed mutagenesis studies on the structure and function of troponin-C.

FEBS Lett, 1988 Feb 8, 228(1), 33 - 6
Enzymatic sequence-specific spin labeling of a DNA fragment containing the recognition sequence of EcoRI endonuclease; Bobst AM et al.; Deoxyuridine analogs spin labeled in position 5 have been enzymatically incorporated sequence specifically into an oligodeoxyribonucleotide to form a spin-labeled 26-mer . The 26-mer contains the EcoRI-binding site and two labels which are located symmetrically close to the binding site . The labels are separated from one another far beyond the Heisenberg spin-exchange distance . The local base motion as determined by ESR spectroscopy is of the order of 4 ns in the oligonucleotide duplex . This is the same value as reported earlier for local T motions in polynucleotide duplexes, thereby providing direct experimental evidence that the ESR line shape of spin levels covalently attached to nucleic acids depends primarily on the local dynamics of the nucleic acid building blocks.

FEBS Lett, 1988 Feb 8, 228(1), 144 - 8
The influence of a double-stranded hindrance on DNA synthesis performed by DNA polymerase alpha, T4 DNA polymerase, DNA polymerase I (Klenow fragment) and AMV reverse transcriptase; Scamrov AV et al.; The influence of a double-stranded region on DNA synthesis performed by a series of DNA polymerases on a single-stranded template was studied . Two types of double-stranded hindrances were employed: a stable hairpin formed by the template alone and a region formed by the template and an extraneous oligonucleotide complementary to the template . While T4 and calf thymus alpha DNA polymerases are strongly arrested at the beginning of either of the two double-stranded hindrances, the Klenow fragment of E . coli DNA polymerase I and avian myeloblastosis virus reverse transcriptase can pass through the double-stranded regions . The DNA chain-elongation rate seems to be undisturbed in the case of reverse transcriptase but greatly reduced for DNA polymerase I.

J Chromatogr, 1988 Feb 5, 436(2), 299 - 307
Lanthanide ions as luminescent chromophores for the liquid chromatographic detection of polynucleotides and nucleic acids; Wenzel TJ et al.; Europium(III) and terbium(III) can be used as luminescent chromophores for the liquid chromatographic detection of certain nucleotides and nucleic acids . The method is dependent upon an energy transfer from the nucleic acid to the lanthanide ion . Of the base moieties, only xanthine, guanine, and thiouridine have appropriate excited state energy levels for efficient energy transfer . The lanthanide ion can be added in a pre- or post-column mode . The applicability of the method was demonstrated for the detection of homologous polynucleotides such as poly X and poly G . The method was also used to detect transfer RNA from Escherichia coli.

J Biol Chem, 1988 Feb 5, 263(4), 1978 - 90
Antifolate-resistant Chinese hamster cells . Molecular basis for the biochemical and structural heterogeneity among dihydrofolate reductases produced by drug-sensitive and drug-resistant cell lines; Melera PW et al.; Nucleotide sequence analysis of a cDNA clone shown to direct the synthesis in Escherichia coli of a pI 6.5 form of dihydrofolate reductase (DHFR) with an apparent molecular weight of 21,000 has clarified the allelic nature of the DHFR genes present in the Chinese hamster lung cell line DC-3F . By comparison with other cDNAs encoding different forms of DHFR produced by these cells or by antifolate-resistant sublines derived from them (Melera, P.W., Davide, J.P., Hession, C.A., and Scotto, K.W (1984) Mol . Cell . Biol . 4, 38-48) and with the use of transcription vectors to generate homogeneous populations of specific DHFR mRNAs for subsequent translation in vitro, we demonstrate that, with respect to the proteins they encode, these alleles differ only at amino acid position 95; a conversion of Asp----Asn at this position is solely responsible for the electrophoretic mobility and pI differences between the Mr 21,000 pI 6.5 and Mr 20,000 pI 6.7 forms of the enzyme . We also show that the conversion of Leu to Phe at position 22 of the Mr 21,000 pI 6.5 enzyme results in a mutant form whose catalytic activity is equal to or greater than normal, but whose IC50 for methotrexate is 85 microM . Additionally, the in vitro translation experiments show that the minor pI forms of DHFR known to exist in Chinese hamster lung cells are generated by a translational or post-translational modification step . Preliminary evidence suggests that this modification may result from an acetylation of the N terminus of the protein.

J Biol Chem, 1988 Feb 5, 263(4), 1693 - 7
An epimerase-reductase in L-fucose synthesis; Chang S et al.; The first committed enzyme in GDP-L-fucose formation from GDP-D-mannose is GDP-D-mannose 4,6-dehydratase, which forms GDP-4-keto-6-deoxy-D-mannose . The uncertain enzymatic steps beyond this point were examined in this study . Assays were developed for the epimerase and reductase activities which the putative pathway would predict . A protein was isolated exhibiting homogeneity by several criteria . This single protein, which forms GDP-L-fucose from GDP-4-keto-6-deoxy-D-mannose and NADH, appears to possess both epimerase and reductase capabilities and may be termed GDP-4-keto-6-deoxy-D-mannose-3,5-epimerase-4-reductase . Analysis on a molecular sieve column using fast protein liquid chromatography established a molecular weight of 63,100 for the native enzyme, whereas sodium dodecyl sulfate-polyacrylamide gel electrophoresis established a subunit molecular weight of 31,500.

Science, 1988 Feb 5, 239(4840), 631 - 5
Replacements of Pro86 in phage T4 lysozyme extend an alpha-helix but do not alter protein stability; Alber T et al.; To investigate the relation between protein stability and the predicted stabilities of individual secondary structural elements, residue Pro86 in an alpha-helix in phage T4 lysozyme was replaced by ten different amino acids . The x-ray crystal structures of seven of the mutant lysozymes were determined at high resolution . In each case, replacement of the proline resulted in the formation of an extended alpha-helix . This involves a large conformational change in residues 81 to 83 and smaller shifts that extend 20 angstroms across the protein surface . Unexpectedly, all ten amino acid substitutions marginally reduce protein thermostability . This insensitivity of stability to the amino acid at position 86 is not simply explained by statistical and thermodynamic criteria for helical propensity . The observed conformational changes illustrate a general mechanism by which proteins can tolerate mutations.

J Biol Chem, 1988 Feb 5, 263(4), 1798 - 802
Identification of the reactive cysteines of Escherichia coli 5-enolpyruvylshikimate-3-phosphate synthase and their nonessentiality for enzymatic catalysis; Padgette SR et al.; Reaction of 5-enolpyruvylshikimate-3-phosphate synthase of Escherichia coli with the thiol reagent 5,5'-dithiobis-(2-nitrobenzoic acid) (DTNB) leads to a modification of only 2 of the 6 cysteines of the enzyme, with a significant loss of its enzymatic activity . Under denaturing conditions, however, all 6 cysteines of 5-enolpyruvylshikimate-3-phosphate synthase react with DTNB, indicating the absence of disulfide bridges in the native protein . In the presence of shikimate 3-phosphate and glyphosate, only 1 of the 2 cysteines reacts with the reagent, with no loss of activity, suggesting that only 1 of these cysteines is at or near the active site of the enzyme . Cyanolysis of the DTNB-inactivated enzyme with KCN leads to elimination of 5-thio-2-nitrobenzoate, with formation of the thiocyano-enzyme . The thiocyano-enzyme is fully active; it exhibits a small increase in its I50 for glyphosate (6-fold) and apparent Km for phosphoenolpyruvate (4-fold) compared to the unmodified enzyme . Its apparent Km for shikimate 3-phosphate is, however, unaltered . These results clearly establish the nonessentiality of the active site-reactive cysteine of E . coli 5-enolpyruvylshikimate-3-phosphate synthase for either catalysis or substrate binding . Perturbations in the kinetic constants for phosphoenolpyruvate and glyphosate suggest that the cysteine thiol is proximal to the binding site for these ligands . By N-{14C}ethylmaleimide labeling, tryptic mapping, and N-terminal sequencing, the 2 reactive cysteines have been identified as Cys408 and Cys288 . The cysteine residue protected by glyphosate and shikimate 3-phosphate from its reaction with DTNB was found to be Cys408.

J Biol Chem, 1988 Feb 5, 263(4), 1761 - 7
Signals sufficient for rho-dependent transcription termination at trp t' span a region centered 60 base pairs upstream of the earliest 3' end point; Galloway JL et al.; We have characterized the functional attributes of a 211-base pair region containing the Escherichia coli tryptophan operon rho-dependent terminator trp t', utilizing a series of constructs that alter the orientation, location, or extent of the trp t' sequences with respect to the trp promoter . In each instance, the extent of the rho-dependent response was monitored in vivo by read-through expression into a distal galactokinase gene and was compared with the results of transcription assays in vitro . As expected, transcription termination in vivo is dependent on the proper orientation of the terminator, and a tandem repeat of the terminator increases termination proportionally . Placing the terminator fragment only 14 nucleotides from the promoter does not affect termination significantly, supporting the belief that sequences outside of the 211-base pair fragment itself are dispensable . One construct, which lacks 116 base pairs, including the region encoding the normal RNA end points, still reduces galK activity in vivo and terminates transcription in vitro . Our results indicate that the rho response depends primarily on sequences in this 95-base pair segment, causing RNA polymerase to terminate transcription in a region 15-45 nucleotides further downstream.

J Biol Chem, 1988 Feb 5, 263(4), 1848 - 54
The use of limited proteolysis to probe interdomain and active site regions of beta-galactosidase (Escherichia coli); Edwards LA et al.; Limited proteolysis by pancreatic elastase (EC 3.4.21.36) and chymotrypsin (EC 3.4.21.1) was used to study the domain structure and active site of beta-galactosidase (EC 3.2.1.23) (Escherichia coli) . Treatment with elastase resulted in a rapid cleavage between residues Ala-732 and Ala-733 . No inactivation accompanied this cleavage suggesting that this bond is in a hinge region of the protein . Some slow cleavages beyond the initial one were observed to occur and were accompanied by inactivation . Treatment of beta-galactosidase with chymotrypsin resulted in cleavages first between Trp-585 and Ser-586 and then between Phe-601 and Cys-602 . The first of these cleavages resulted in total inactivation of beta-galactosidase . The presence of monovalent ions or isopropyl-beta-D-thiogalactopyranoside protected against the cleavages but when Mg2+ or Mn2+ was present in the reaction mixture, the bond between Trp-585 and Ser-586 was more susceptible to the action of chymotrypsin . These data demonstrate that the conformation of beta-galactosidase around Trp-585 and Ser-586 is dramatically affected by the binding of ions and isopropyl-beta-D-thiogalactopyranoside . The mutant M15 beta-galactosidase, which is missing residues 11 through 41 and is an inactive dimer rather than an active tetramer, was found to be much more labile to proteases than native beta-galactosidase, but the same initial cleavages were found to occur . In addition, trypsin cleaved the M15 protein between Arg-431 and Trp-432 while native beta-galactosidase was stable to trypsin.

J Biol Chem, 1988 Feb 5, 263(4), 1607 - 10
Deletion of the N-terminal region of Xenopus transcription factor IIIA inhibits specific binding to the 5 S RNA gene; Fiser-Littell RM et al.; Xenopus transcription factor IIIA (TFIIIA) is expressed in Escherichia coli by utilizing one plasmid with a T7 RNA polymerase gene and another plasmid with TFIIIA cDNA cloned downstream of a T7 promoter . Wild-type TFIIIA and a TFIIIA deletion mutant, isolated from E . coli cell extracts, are identified by antiserum against native TFIIIA purified from Xenopus immature oocytes . DNase I protection experiments indicate that wild-type TFIIIA, synthesized from a full-length TFIIIA cDNA, binds specifically to the coding and noncoding strands of the 5 S RNA gene . The TFIIIA deletion mutant, expressed from TFIIIA cDNA lacking the coding sequence for the N-terminal 29 amino acids, fails to bind specifically to the 5 S RNA gene as judged by its inability to protect to any degree the coding or noncoding strands of the gene from DNase I digestion . Both wild-type TFIIIA and the N-terminal deletion mutant promote DNA renaturation.

Biochem Cell Biol, 1988 Feb, 66(2), 100 - 6
Germin . Molecular cloning of cDNA that selects germin mRNA from bulk wheat mRNA; Rahman S et al.; (1) Bulk mRNA from germinated wheat embryos was denatured with methylmercury and subjected to electrophoresis in agarose gel to obtain a fraction of mRNA that was modestly enriched with respect to its complement of translatable germin mRNA . This fraction of mRNA was used as a source of primary templates for preparing a cDNA library . (2) Escherichia coli JM101 was transfected with recombinant pUC8 plasmids containing cDNA inserts . Colonies of transformed bacteria (ca . 4 x 10(3)) were differentially screened by hybridizing them with cDNA probes that were prepared from RNA populations containing different proportions of translatable germin mRNA . (3) A 160 base pair (bp) cDNA, which hybridized more strongly to the probe made from the RNA population containing the greater proportion of translatable germin mRNA in colony hybridizations, also hybridized more strongly to the RNA population containing the greater proportion of translatable germin mRNA when it was used as a probe for Northern analysis . (4) As judged by peptide mapping of a protein made by cell-free translation, the 160-bp cDNA selected virtually pure germin mRNA from the bulk mRNA of germinated wheat embryos when it was used in "hybrid release" experiments . The same 160-bp cDNA was used to select a "full length" germin cDNA from a library prepared by the Gubler-Hoffman method.

Bioorg Khim, 1988 Feb, 14(2), 276 - 8
{Rapid automated synthesis of polydeoxynucleotides}; Kumarev VP et al.; A rapid automatic method of synthesis of deoxypolynucleotides from 5'-O-dimethoxytritylnucleoside-3'-H-phosphonates is described . An improved construction of synthesizer "Gene-2" adapted for this method has been developed . The modified scheme of synthesis included detritylation with trifluoroacetic acids in dichloromethane, washing with acetonitrile instead of pyridine--acetonitrile mixture and one-step oxidation with iodine solution in acetic acid and pyridine instead of two-step oxidation in the presence of amines . By means of this method, more then 160 polynucleotides containing 8 to 83 monomers were prepared for various biochemical goals including synthesis of promotor 9(260 bp) of the mouse metallothionein-I gene and of promotor and leader sequence (120 bp) of gene of the E . coli alkaline phosphatase.

Circ Shock, 1988 Feb, 24(2), 123 - 31
Left ventricular performance in canine endotoxin shock; Papadakis EJ et al.; Left ventricular performance was studied in 6 control and 7 experimental open-chest, heart-paced dogs before and after a single 1 mg/kg dose of E . coli endotoxin under pentobarbital anesthesia . Positive maximal dp/dt, time to peak ventricular pressure (PVP time), cardiac output, stroke work, tension-time index (TTI), coronary flow, and cardiac oxygen consumption were derived from left ventricular pressure, aortic flow, left atrial pressure, coronary sinus flow and A-V oxygen difference . During a control period and for 2 h post-endotoxin, while mean arterial pressure (afterload) and heart rate were held constant, +dp/dt max, PVP time, cardiac output, and cardiac work were related to left ventricular end diastolic pressure to obtain ventricular function curves . Positive maximal dp/dt was found depressed early (60 min) during the 2 h period of endotoxicosis studied (P less than .05) . PVP time values increased after endotoxin administration but not significantly . Coronary sinus flow was found to be significantly elevated at 2 h post-endotoxin . The findings indicate the presence of early (60 min) and sustained depression of ventricular performance at elevated coronary blood flows during endotoxicosis.

Circ Shock, 1988 Feb, 24(2), 111 - 21
Glucose kinetics in rats infused with endotoxin-induced monokines or tumor necrosis factor; Bagby GJ et al.; This study was conducted to determine if macrophage elaborated monokines in general, and human recombinant tumor necrosis factor (hrTNF alpha) in particular alter glucose metabolism in a manner analogous to that observed in endotoxin-treated animals . Endotoxin-tolerant rats were infused for 3 hr with saline, E . coli endotoxin (100 micrograms/l weight) or monokines contained in conditioned media from endotoxin-stimulated RAW 264.7 cells (1 microgram/ml) . Compared to saline- and endotoxin-infused rats, animals receiving the monokine mixture had no change in mean arterial blood pressure or heart rate but exhibited overt signs of morbidity including stupor and diarrhea . Monokine-infused rats remained euglycemic but had elevated lactate concentrations and a 15-30% increase in glucose rate of appearance (Ra) . Nontolerant rats received a 3 hr infusion of saline, hrTNF alpha (15 micrograms/100 g), or heat-treated hrTNF alpha . HrTNF alpha infusion increased glucose Ra about 25% compared to the two control groups but did so without producing signs of morbidity seen in the monokine infused animals . Serum TNF levels were 6-fold higher in rats infused with the monokine mixture compared to animals infused with hrTNF alpha, and this reflected the different levels of TNF contained in the monokine mixture and hrTNF alpha infusates . Plasma insulin, glucagon, and catecholamine concentrations were increased in rats infused with either the monokine mixture or hrTNF alpha, but the increases were more pronounced in rats receiving the monokine mixture . The results demonstrate that monokines and hrTNF alpha increase glucose production in vivo, and that the effect may be mediated by endocrine changes known to influence glucose homeostasis.

Biochem Cell Biol, 1988 Feb, 66(2), 157 - 60
Quantitative assays for uracil-DNA glycosylase of high sensitivity; Morgan AR et al.; We have developed a sensitive fluorometric assay using bisulfite deaminated (C----U), covalently-closed circular PM2 DNA as the substrate . We describe a reliable way to prepare this substrate without nicking the PM2 DNA . Methods, which depend on toluenization of the cells, are described for reproducibly and quantitatively assaying uracil-DNA glycosylase . The sensitivity is such that only 200 EL4 mouse thymoma cells or 30,000 Escherichia coli cells are needed for each point in a kinetic assay.

Mol Cell Biol, 1988 Feb, 8(2), 578 - 87
The human c-fps/fes gene product expressed ectopically in rat fibroblasts is nontransforming and has restrained protein-tyrosine kinase activity; Greer PA et al.; A 13-kilobase EcoRI genomic restriction fragment containing the human c-fps/fes proto-oncogene locus was expressed transiently in Cos-1 monkey cells and stably in Rat-2 fibroblasts . In both cases, human c-fps/fes directed synthesis of a 92-kilodalton protein-tyrosine kinase (p92c-fes) indistinguishable from a tyrosine kinase previously identified with anti-fps antiserum which is specifically expressed in human myeloid cells . Transfected Rat-2 cells containing approximately 50-fold more human p92c-fes than is found in human leukemic cells remained morphologically normal and failed to grow in soft agar . Synthesis of p92c-fes in this phenotypically normal line exceeded that of the P130gag-fps oncoprotein in a v-fps-transformed Rat-2 line . Despite this elevated expression, human p92c-fes induced no substantial increase in cellular phosphotyrosine and was not itself phosphorylated on tyrosine . In contrast, p92c-fes immunoprecipitated from these Rat-2 cells or expressed as an enzymatically active fragment in Escherichia coli from a c-fps/fes cDNA catalyzed tyrosine phosphorylation with an activity similar to that of v-fps/fes polypeptides . Thus, p92c-fes is not transforming when ectopically overexpressed in Rat-2 fibroblasts . This lack of transforming activity correlates with a restriction imposed on the kinase activity of the normal c-fps/fes product in vivo which is apparently lifted for v-fps/fes oncoproteins, suggesting that regulatory interactions within the host cell modify fps/fes protein function and normally restrain its oncogenic potential.

J Neurosci, 1988 Feb, 8(2), 508 - 17
Cloning of cDNA for DARPP-32, a dopamine- and cyclic AMP-regulated neuronal phosphoprotein; Kurihara T et al.; A cDNA clone for the mRNA of bovine DARPP-32 (dopamine- and adenosine 3',5'-monophosphate-regulated phosphoprotein, Mr = 32,000) was isolated from a modified Okayama-Berg plasmid library . Transformed Escherichia coli colonies were screened by in situ colony hybridization with 2 different oligonucleotide probes corresponding to a region unusually rich in glutamate within the protein . Three positive clones were isolated and shown to encode DARPP-32 by an in situ immunoblot assay of their fusion protein products with beta-galactosidase . The results of the sequence analysis of the longest cDNA clone, pTKD7 (1771 nucleotides), revealed a 606-nucleotide-long coding region, in exact agreement with the bovine DARPP-32 amino acid sequence (Williams et al., 1986) . Southern blot analysis of total bovine genomic DNA showed that there is a single gene coding for DARPP-32 . Northern blot analysis of caudate nucleus RNA using antisense RNA derived from the clone pTKD7 demonstrated the existence of 2 abundant mRNA species, corresponding to 1.8 and 1.65 kilobase in length . The high concentration of DARPP-32 mRNAs in the caudate nucleus is in agreement with the known distribution of this protein.

Biochem Genet, 1988 Feb, 26(1-2), 165 - 75
Expression of human salivary protein genes; Mamula PW et al.; Human proline-rich proteins (PRPs) are polymorphic, homologous in sequence, and linked in a cluster called the human salivary protein complex (SPC) . Recently this complex was localized to human chromosome band 12p13.2 (Mamula et al., Cytogenet . Cell Genet . 39:279, 1985) . We have isolated a PRP cDNA, EO27, from a human parotid gland library, identified it by DNA sequencing, and used it to study the molecular and cellular biology of PRP production . Cell-free translation and mRNA characterization with EO27 indicate that the numerous PRPs seen in saliva are produced from relatively few, large precursors, probably by posttranslational cleavage . This supports an hypothesis originally proposed by Friedman and Karn in 1977 (Am . J . Hum . Genet . 29:44 A; Biochem . Genet . 15:549) and later supported by biochemical studies (Karn et al., Biochem Genet . 17:1061, 1979) and molecular studies (Mamula et al., Fed . Proc . 43:1522, 1984; Maeda et al., J . Biol . Chem . 260:1123, 1985) . EO27 was also used in this study to localize PRP mRNA production to the acinar cells of the parotid gland by in situ hybridization.

Mol Gen Mikrobiol Virusol, 1988 Feb, (2), 41 - 4
{ptsS: a new regulatory element of the fructose operon in Escherichia coli}; Bol'shakova TN et al.; Expression of catabolite sensitive operons is repressed in E . coli mutants devoid of HPr--a component of glucose transport system . The ptsH mutants do not utilize the substrates for phosphoenolpyruvate dependent phosphotransferase system (PTS) except for fructose . Besides that, the mutants are deficient in utilization of many substrates entering the bacteria via the other transport systems . The ptsS mutation mapped in the region of the fructose regulon on the 46th min of the chromosomal map restores the growth of ptsH mutants on all substrates . The accumulation and PEP-dependent phosphorylation of proteins substrates of PTS is also restored . The synthesis of the fructose specific phosphotransferase system becomes constitutive under the effect of ptsS mutation . The mutation is supposed to impair the regulatory region of the fructose regulon.

J Appl Physiol, 1988 Feb, 64(2), 697 - 704
Effect of intravenous catalase on the pulmonary vascular response to endotoxemia in goats; Maunder RJ et al.; Neutrophils have been implicated in the pathogenesis of acute lung injury associated with clinical and experimental sepsis . Data from in vitro systems and experimental animals have suggested that neutrophil-derived oxidants, particularly H2O2, may be primarily responsible for endothelial damage, vasoconstriction, and lung edema . With the use of endotoxin infusion as an in vivo model of sepsis we tested the hypothesis that pretreatment with catalase, a peroxide scavenger, would ameliorate the resultant changes in pulmonary vasoconstriction and lung fluid balance . Paired experiments were performed in 16 goats with chronic lung lymph fistulas . One group of animals (n = 7) received endotoxin first alone and then again, several days later, after pretreatment with Ficoll-linked catalase . As a control, identical experiments were performed in a separate group (n = 6) with Ficoll-linked albumin substituted for Ficoll-catalase . A third group (n = 3) was given endotoxin alone and then again during a continuous infusion of catalase . Plasma and lymph levels of catalase were comparable to or exceeded those previously shown to be completely protective in isolated perfused lung preparations and in vitro systems . Endotoxin caused neutropenia, pulmonary arterial hypertension, decreased cardiac output, and increases in lymph flow to approximately three times base line, with a return of all variables toward control values by 6 h . Catalase pretreatment produced no significant differences in any of these variables . These experiments do not support a role for H2O2 as a mediator of acute lung injury due to endotoxemia.

J Appl Physiol, 1988 Feb, 64(2), 592 - 8
Endotoxemia produces an increase in arterial but not venous lipid peroxides in sheep; Demling RH et al.; Our purpose was to determine the effect of an endotoxin-induced lung injury on circulating lipid peroxides . We measured both malondialdehyde (MDA) and conjugated dienes (as optical density at 233 nm) in aortic and venous plasma and lung lymph in 10 unanesthetized sheep given 1 microgram/kg of Escherichia coli endotoxin . Total lipids and prostanoids 6-ketoprostaglandin F1 alpha and thromboxane B2 were also measured . Six control sheep were also studied . Animals were monitored for a 12-h period and then killed, and lung tissue MDA was determined . A two-phase endotoxin response was noted with an initial pulmonary hypertension followed by a steady-state increase in protein-rich lung lymph flow (QL) between a 3- and 6-h period . Aortic plasma MDA was significantly increased from a base line of 4.8 +/- 1.4 to 8.9 +/- 1.6 and 7.5 +/- 1.3 nmol/ml at 1 and 4 h post-endotoxin . Aortic plasma conjugated dienes increased in all 10 sheep post-endotoxin . Venous levels of both MDA and conjugated dienes were not significantly increased . Lung QL increased two- to three-fold . Lung lymph MDA increased significantly at 1 h post-endotoxin . Lymph conjugated dienes decreased . Plasma and lymph lipid peroxide levels returned to base line by 12 h in most animals . However, tissue MDA remained significantly increased in all sheep from base line of 45 +/- 9 to 85 +/- 14 nmol/g tissue . We conclude that both MDA and conjugated dienes are transiently released into aortic plasma during endotoxin-induced oxidant lung injury.(ABSTRACT TRUNCATED AT 250 WORDS)

Circ Shock, 1988 Feb, 24(2), 133 - 41
Changes in renal sympathetic nerve activity during experimental septic and endotoxin shock in conscious rats; Palsson J et al.; Changes in postganglionic renal sympathetic nerve activity, arterial pressure, and heart rate were measured in conscious rats during intravenous infusion of live E . coli bacteria (10(9)/h) or bolus injection of E . coli endotoxin (20 mg/kg) . Bacteria infusion was associated with a marked and parallel increase in heart rate and sympathetic activity with only minor changes in mean arterial pressure . The early response to bolus injection of endotoxin was a short-lasting decrease in mean arterial pressure combined with a marked increase in sympathetic activity and heart rate, probably due to baroreceptor unloading . However, when mean arterial pressure returned to pre-endotoxin levels, sympathetic activity and heart rate remained markedly elevated, indicating a partly nonreflexogenic increase in central sympathetic outflow . This study using direct nerve recordings of sympathetic activity in conscious animals confirms earlier clinical observations of an increased activity of the sympathetic nervous system in septic shock.

EMBO J, 1988 Feb, 7(2), 465 - 72
The glutathione transferase activity and tissue distribution of a cloned Mr28K protective antigen of Schistosoma mansoni; Taylor JB et al.; A protective Mr28K antigen of Schistosoma mansoni, expressed from its cDNA, has been purified in a single step and shown to possess glutathione (GSH) transferase activity as predicted from sequence homologies with two mammalian GSH transferase multigene families . It is notable for its high 1-chloro-2,4-dinitrobenzene GSH transferase and linoleic acid hydroperoxide GSH peroxidase activities . The major GSH transferase of S . mansoni has been purified and its subunit is identical to this Mr28K antigen by criteria of Mr, immunochemistry, substrate specificity and peptide sequence analysis . In the parasite, the antigen is present in the tegument, protonephridial cells and subtegumental parenchymal cells . No significant immunological cross-reactivity between the S.mansoni and mammalian (human and rat) GSH transferases was observed.

Anal Biochem, 1988 Feb 1, 168(2), 455 - 61
An assay for the detection of superoxide dismutase in individual Escherichia coli colonies; Schiavone JR et al.; A method for detecting superoxide dismutase activity in individual colonies of Escherichia coli was developed . The assay involves the lysis of individual cells in colonies on filter papers by a series of lysozyme, chloroform, and freeze-thaw treatments . Filters are placed on agar plates to allow diffusion of cellular enzymes into a solid matrix . A nitroblue tetrazolium overlay is applied to detect superoxide dismutase activity . Colonies possessing activity produce achromatic zones against a dark Formazan background . The assay can detect the presence of superoxide dismutase and the relative amount of enzyme as well . This assay provides a method for screening a population of cells for mutants deficient in or overproducing superoxide dismutase.

Anal Biochem, 1988 Feb 1, 168(2), 239 - 46
A simplified lysis method allowing the use of biotinylated probes in colony hybridization; Haas MJ et al.; A method is described for the lysis of bacterial cells grown on nitrocellulose filters which allows the use of nonradioactive (biotin labeled) probes in colony hybridization . Used in conjunction with a colorimetric assay involving streptavidin and alkaline phosphatase this lysis method allows the detection of clones containing a target nucleic acid sequence . Sites of positive hybridization produce dark blue-purple signals, while nonreacting clones give very light blue signals . The occurrence of false-positive and background signals is minimal . With pBR322 as the target sequence it was possible to detect approximately 20 clones in the presence of 10(5) plasmid-free cells . It was also possible to detect low-frequency plasmid-free cells in a population of clones containing the target sequence.

Protein Seq Data Anal, 1988 Feb, 1(3), 187 - 93
Sequence comparisons in the aminoacyl-tRNA synthetases with emphasis on regions of likely homology with sequences in the Rossmann fold in the methionyl and tyrosyl enzymes; Walker EJ et al.; Amino acid sequences of aminoacyl-tRNA synthetases specific for 12 different amino acids have now been published . Differences in origin at the species and organelle level result in 20 distinct sequences being available for comparison . Some of these were compared in small groups as they were determined and, although some homologies were detected, it was generally concluded that there was surprisingly little sequence homology in this functionally related group of enzymes . We have made comparisons of all of the available sequences by using a combination of computer and manual alignment methods and knowledge of the sequences in the Rossmann fold region of methionyl-tRNA synthetase from E . coli and tyrosyl-tRNA synthetase from B . stearothermophilus, enzymes whose three-dimensional structures have been described . It emerges that all of the aminoacyl-tRNA synthetase sequences thus examined show considerable homology with each other over at least parts of this region, some over virtually all of it . We conclude that a great deal more similarity than had previously been suspected exists in these proteins . In particular, the alignments we have made strongly imply the existence of a mononucleotide binding site of the Rossmann fold configuration in all of the synthetases compared.

Eur Respir J, 1988 Feb, 1(2), 145 - 52
Prevention and reversal of endotoxin-induced pulmonary hypertension by a leukotriene antagonist; Ahmed T et al.; We investigated the role of leukotrienes in endotoxin-induced changes in pulmonary circulation . In six conscious sheep, haemodynamic measurements were obtained for the calculation of pulmonary vascular resistance (PVR), along with measurements of arterial oxygen tension (PaO2), leucocyte count (WBC), thromboxane B2 (TxB2), 6-Keto-PgF1 alpha and PgF2 alpha, before and at predetermined intervals after a 10-min infusion of E . coli endotoxin (0.3 microgram/kg), with and without treatment with the leukotriene receptor antagonist, FPL-57231 . Endotoxin caused a biphasic response (i.e., phase I = 0-1 h, phase II = 1.5-4 h), with a mean +/- SE increase in PVR to 415 +/- 112% of baseline during phase I and a lesser increase of 175% (range = 153-199%) of baseline during phase II . Mean +/- SE PaO2 decreased from 86 +/- 4 to 67 +/- 6 mmHg and WBC count decreased from 8.6 +/- 0.6 to 2.8 +/- 0.7 thousand/mm3 during phase I, whereas TxB2 increased from 145 +/- 28 to 3164 +/- 1082 pg/ml, 6-Keto-PgF1 alpha from 129 +/- 14 to 438 +/- 114 pg/ml and PgF2 alpha from 122 +/- 7 to 242 +/- 43 pg/ml . One hour infusion of FPL-57231 (1 mg/kg/min) administered prior to and throughout phase I attenuated the phase I increases in PVR without preventing the increases in TxB2; however, it partly attenuated 6-Keto-PgF1 alpha and enhanced generation of PgF2 alpha during phase I . Discontinuation of FPL-57231 was followed by an exaggerated response of PVR during phase II to an average of 209% of baseline (range = 186-235%).(ABSTRACT TRUNCATED AT 250 WORDS)

Am Ind Hyg Assoc J, 1988 Feb, 49(2), 81 - 8
3-Hydroxymyristic acid as a measure of endotoxin in cotton lint and dust; Morris NM et al.; A series of samples consisting of purified cellulose, purified cellulose spiked with endotoxin, and cotton lint and dust samples from the Human Panel Acute Exposure Studies at Clemson, South Carolina, were extracted with pyrogen-free water and with phenol-water . Phenacyl esters of the dried, hydrolyzed extract were prepared and chromatographed on a high performance liquid chromatograph . A peak assigned to the phenacyl ester of 3-hydroxymyristic acid appears in the chromatograms of extracts of celluloses that have been spiked with endotoxins and not in those of unspiked celluloses . This peak also appears in the extracts of cotton lint from samples that cause the greatest decrement in lung function in the Clemson human exposure studies . The area of this peak increases with increasing amounts of endotoxin and may serve as a measure of endotoxin concentration in cotton lint and dust, at least when fairly high levels of endotoxin (0.50 micrograms or greater) are present . The effect of extraction method on the determined amount of endotoxin is discussed.

Mol Gen Genet, 1988 Feb, 211(2), 332 - 4
A mutant in a major heat shock protein of Escherichia coli continues to show inducible thermotolerance; Ramsay N; Escherichia coli cells carrying the dnaK756 mutation, were inactivated at 52 degrees C faster than control cells . This suggests that the intact dnaK gene product plays a role in protecting the cell from lethal damage at 52 degrees C . The effect of the dnaK mutation on induced thermotolerance was examined . Prior heat shock at 42 degrees C greatly lowered the subsequent inactivation rate in both mutant and control cells . This result suggests that, although produced in large amounts in response to thermal stress, mutation in the DnaK protein has little or no effect on induced thermotolerance.

J Hepatol, 1988 Feb, 6(1), 36 - 49
Isolation and culture of Kupffer cells from human liver . Ultrastructure, endocytosis and prostaglandin synthesis; Brouwer A et al.; Kupffer cells and other sinusoidal cells were isolated after perfusion and incubation with pronase and collagenase of pieces of liver tissue obtained from organ donors . The resulting cell preparations contained endothelial cells, Kupffer cells and fat-storing cells as well as considerable numbers of leucocytes . Attempts to purify the different sinusoidal cell types by density centrifugation and centrifugal elutriation were successful only for Kupffer cells . Kupffer cells, in contrast to endothelial cells and fat-storing cells, could be kept in maintenance culture for at least 5 days . Cultured Kupffer cells were active in the endocytosis of foreign substances, such as colloidal carbon, latex beads, horseradish peroxidase and bacterial endotoxin . The cultured Kupffer cells synthesized and secreted considerable amounts of prostaglandins PGE2, PGF2 alpha, 6-keto-PGF1 alpha and thromboxane B2 . The production of prostaglandins was influenced by the presence of Escherichia coli endotoxin.

J Clin Microbiol, 1988 Feb, 26(2), 385 - 7
DNA probes for K-antigen (capsule) typing of Escherichia coli; Roberts M et al.; DNA restriction fragments derived from the polysaccharide biosynthesis regions of cloned Escherichia coli K1, K5, and K12 capsular antigen genes hybridized only with DNA of strains determined by conventional methods to be of the same K serotype . A probe derived from the common transport region hybridized to all encapsulated E . coli strains.

Arch Surg, 1988 Feb, 123(2), 188 - 92
Terminal complement complexes and anaphylatoxins in septic and ischemic patients; Heideman M et al.; Terminal complement complex (TCC) and anaphylatoxin formation in 18 patients with sepsis and 20 patients with acute limb ischemia were studied before the start of treatment and seven days later . The septic or ischemic patients had elevated levels of plasma TCC before start of therapy . In successfully treated patients these concentrations were within the normal range one week later . Similarly, the plasma anaphylatoxin level was increased before therapy and returned to the normal range within seven days . Escherichia coli incubated in vitro in fresh human serum at body temperature started formation of TCC in a dose-related manner . As complement will induce cellular lysis via TCC and edema via anaphylatoxins, anemia and impaired respiration in these patients may be influenced by increased concentrations of terminal complement complexes and of C3a and C5a.

Arch Surg, 1988 Feb, 123(2), 157 - 61
The comparative clearance rates of the pleural and peritoneal cavities; Mavroudis C et al.; We compared the rates of bacterial clearance from the pleural and peritoneal cavities of rats after contamination with 1 x 10(6) live Escherichia coli . Pleural clearance was enhanced beginning at 30 minutes after injection and extended to at least six hours . At 24 hours, the clearance was similar for both the pleural and peritoneal groups . Blood and organ bacterial cultures were similar between these two groups . White blood cell populations were similar at rest, but there was a greater increase in the leukocyte population in the pleural cavity six hours after E coli stimulation . We postulate that the increased clearance of E coli from the pleural cavity may be due to differences in lymphatic absorption, recruitment of leukocytes, or fibrin trapping of bacteria.

Am Rev Respir Dis, 1988 Feb, 137(2), 420 - 8
Effect of catalase on endotoxin-induced acute lung injury in unanesthetized sheep; Milligan SA et al.; Administration of endotoxin intravenously to unanesthetized sheep causes an acute lung injury characterized by increased microvascular barrier permeability and subsequent pulmonary edema . Endotoxin-induced sheep lung injury can be attenuated by leukocyte depletion, and may be mediated by toxic metabolites of oxygen . We studied effects of administering catalase, which catalyzes conversion of hydrogen peroxide to oxygen and water, to sheep subsequently infused with endotoxin to test the hypothesis that hydrogen peroxide plays a role in the pathogenesis of lung injury . We found that infusions of endotoxin (1 microgram/kg) into untreated sheep caused the expected biphasic response, a transient, early, marked pulmonary arterial hypertension followed by a prolonged increase in protein-rich lung lymph flow characteristic of increased microvascular permeability filtration in the lungs . Intraperitoneal injections of catalase (50 mg/kg) prior to infusing endotoxin in these same sheep resulted in substantial catalase activity in plasma and in lung lymph, and attenuated the expected changes in pulmonary arterial pressure, lung lymph flow, and arterial leukocyte counts and oxygen tension after endotoxin infusions . Furthermore, mechanical elevation of hydrostatic pressure in the lungs of a catalase-treated sheep infused with endotoxin resulted in increased lung lymph flow with a decreased protein concentration, indicating that the microvascular barrier to fluid and protein was functionally intact . Administration of catalase that was inactivated by reaction with hydrogen peroxide in the presence of aminotriazole or administration of the catalase vehicle, thymol, had no effects on the sheep responses to endotoxin . We conclude that hydrogen peroxide plays a role in the pathogenesis of endotoxin-induced acute lung injury in sheep.

Virology, 1988 Feb, 162(2), 471 - 7
Transcription stimulates recombination . II . Generalized transduction of Escherichia coli by phages T1 and T4; Dul JL et al.; Phage Mu was inserted in the trpE gene of one donor Escherichia coli strain and in the lac promoter of another . Strains with Mu prophage mutations which permitted transcription of genes whose transcription had been polarly blocked by the Mu insertion were isolated and called "bypass" strains . The transducing phages T1am, and T1am,ST, and, in one instance, T4GT7 were grown on both the bypass and the original strains . After growth on the bypass strains transducing phages were able to transduce Trp+ and Lac+, respectively, to a variety of Trp- and Lac- strains more efficiently than after growth on nonbypass strains . These results support the idea that crossovers required for generalized transduction occur more efficiently if the specific region is transcribed by both interacting parental molecules.

South Med J, 1988 Feb, 81(2), 164 - 6
Assessment of monocyte function in breast disease; Spillert CR et al.; Monocyte dysfunction has been reported in patients with cancer . The generation of a procoagulant tissue factor is a marker of the monocyte's activation . Since the only blood cell capable of generating tissue factor is the monocyte, the incubation of citrated blood with either saline (control) or endotoxin (monocyte activator) followed by determination of the recalcification time should yield a measure of monocyte activation . The recalcification times of the saline-incubated samples were similar for healthy women and those with cystic hyperplasia, but were significantly shortened in patients with breast cancer . The recalcification times of the endotoxin-activated samples were significantly shorter in patients with breast cancer than in those with cystic hyperplasia, which in turn was significantly shorter than in healthy women.

Proc Natl Acad Sci U S A, 1988 Feb, 85(4), 990 - 4
Construction and characterization of glutaredoxin-negative mutants of Escherichia coli; Russel M et al.; Deoxyribonucleotides, the precursors of DNA, are formed de novo by ribonucleotide reductase, and in vitro thioredoxin or glutathione plus glutaredoxin have been isolated as hydrogen donors . The in vivo hydrogen donor for ribonucleotide reductase is not known . To study this, the Escherichia coli glutaredoxin gene (255 base pairs) was inactivated by inserting a 2-kilobase kanamycin-resistance fragment into the coding sequence of the cloned gene . The inactivated gene was inserted into the E . coli chromosome and mapped to about 18.5 min . A gene replacement technique was used to obtain a strain, A407, that lacked glutaredoxin by radioimmunoassay and by enzymatic assay with ribonucleotide reductase . Glutaredoxin was found not to be essential for viability of E . coli . Thioredoxin is also not essential for viability, as had been shown earlier, but a double mutant lacking glutaredoxin and thioredoxin could not be obtained by P1 transduction on a defined medium, indicating that either thioredoxin or glutaredoxin is essential . In rich medium, very slowly growing, unstable transductants were obtained that at high frequency gave rise to better growing cells . One such isolate, A410, was shown to still lack glutaredoxin and thioredoxin.

Proc Natl Acad Sci U S A, 1988 Feb, 85(4), 975 - 9
Gel retardation at low pH resolves trp repressor-DNA complexes for quantitative study; Carey J; The affinity and stoichiometry of DNA binding by Escherichia coli trp repressor were studied by electrophoresis in nondenaturing gels . The ability of trp repressor to retard the electrophoretic mobility of an operator DNA fragment depends on the pH of the gel system . Above the pI of the protein, little retardation of DNA is observed, although complex formation can be detected by other assays . As the pH of the gel is lowered, retardation is enhanced . The apparent dissociation constant for the interaction between trp repressor and trpEDCBA operator fragments is 0.5 nM under the conditions used here . Nonspecific binding occurs with only about 200-fold weaker affinity . The stoichiometries of specific and nonspecific complexes were determined directly by using trp repressor labeled in vivo . High-affinity operator binding requires a single dimer of trp repressor . DNase I-protection analysis ("footprinting") was used to confirm the dissociation constants and to locate the binding site.

Proc Natl Acad Sci U S A, 1988 Feb, 85(3), 787 - 91
Structure and expression of spinach leaf cDNA encoding ribulosebisphosphate carboxylase/oxygenase activase; Werneke JM et al.; Ribulosebisphosphate carboxylase/oxygenase activase is a recently discovered enzyme that catalyzes the activation of ribulose-1,5-bisphosphate carboxylase/oxygenase {"rubisco"; ribulose-bisphosphate carboxylase; 3-phospho-D-glycerate carboxy-lyase (dimerizing), EC 4.1.1.39} in vivo . Clones of rubisco activase cDNA were isolated immunologically from spinach (Spinacea oleracea L.) and Arabidopsis thaliana libraries . Sequence analysis of the spinach and Arabidopsis cDNAs identified consensus nucleotide binding sites, consistent with an ATP requirement for rubisco activase activity . A derived amino acid sequence common to chloroplast transit peptides was also identified . After synthesis of rubisco activase in vitro, the transit peptide was cleaved and the protein was transported into isolated chloroplasts . Analysis of spinach and Arabidopsis nuclear DNA by hybridization indicated a single rubisco activase gene in each species . Leaves of spinach and Arabidopsis wild type contained a single 1.9-kilobase rubisco activase mRNA . In an Arabidopsis mutant lacking rubisco activase protein, mRNA species of 1.7 and 2.1 kilobases were observed under conditions of high-stringency hybridization with a wild-type cDNA probe . This observation indicates that the lesion in the mutant arises from an error in mRNA processing.

Proc Natl Acad Sci U S A, 1988 Feb, 85(3), 694 - 8
Molecular cloning, sequence analysis, and expression in Escherichia coli of the cDNA for guanidinoacetate methyltransferase from rat liver; Ogawa H et al.; Five cDNA clones encoding rat liver guanidinoacetate methyltransferase (S-adenosyl-L-methionine: guanidinoacetate N-methyltransferase, EC 2.1.1.2) were isolated from a lambda gt11 cDNA library by use of a polyclonal antibody to the purified enzyme . Sequence analysis of the longest cDNA indicated that it consisted of 711 base pairs (bp) of coding region, 51 bp of 5' noncoding region, and 162 bp of 3' noncoding region excluding the poly(A) tail . The amino acid sequence deduced from the cDNA contained the sequences of NH2-terminal and three tryptic peptides . The predicted amino acid composition and molecular weight were in excellent agreement with those obtained with the purified enzyme . Introduction of the cDNA into plasmid pUC118 having the lac promoter resulted in a production in Escherichia coli of a Mr 26,000 polypeptide in the presence of isopropyl beta-D-thiogalactopyranoside . This protein represented as much as 5% of the bacterial soluble protein and showed the guanidinoacetate methyltransferase activity . Sequence analysis and tryptic peptide mapping indicated that the enzyme obtained by the recombinant DNA procedures was structurally identical to the liver enzyme, except for the absence of the NH2-terminal blocking group . Also, the enzyme showed kinetic properties indistinguishable from those of the liver enzyme.

Metabolism, 1988 Feb, 37(2), 164 - 70
Perturbation of glycerolipid content and biosynthesis in hepatocytes of rats continuously infused with Escherichia coli endotoxin; Rodriguez de Turco EB et al.; The effect of chronic, nonlethal endotoxemia on the endogenous content and de novo biosynthesis of glycerolipids was investigated in rat hepatocytes . Continuous E . coli endotoxin (ET) infusion for 30 hours through a subcutaneously implanted mini-pump greatly altered the composition of membrane phospholipids . Sphingomyelin (SPH) and phosphatidylserine (PS) content increased by 56% and 29%, respectively, while the content of phosphatidylcholine (PC) decreased slightly (6%) as compared with saline-infused rats . These effects contrasted with those observed in pair-fed rats (whose food intake was matched to that voluntarily consumed by ET-infused animals) . Food restriction induced a great depletion of phospholipid content, mainly phosphatidylethanolamine (PE), PC, phosphatidylinositol (PI), and PS, with no changes at the level of SPH as compared with control (fed ad libitum) rats . Triacylglycerol (TG) content was greatly decreased (66%) in ET-infused rats and the magnitude of the change and the fatty acid composition followed a pattern similar to that observed in pair-fed rats . The kinetics of {2-3H}-glycerol incorporation reflected efficient utilization of the precursor for de novo biosynthesis of glycerolipids . Labeling of the intermediate metabolite phosphatidic acid (PA) peaked at an earlier time (1 min) in ET-infused, and in pair-fed rats, as compared with saline-infused and control rats (3 min) respectively, and was followed by a later peak in diacylglycerol (DG) labeling . The metabolic flux thereafter in endotoxemia reflected a redirection toward the synthesis of TG and PI, while in pair-fed animals the label went mainly to PC, concomitantly with a great reduction in the uptake of label into PI.(ABSTRACT TRUNCATED AT 250 WORDS)

J Med Chem, 1988 Feb, 31(2), 366 - 70
Quantitative structure-activity relationships for the inhibition of Escherichia coli dihydrofolate reductase by 5-(substituted benzyl)-2,4-diaminopyrimidines; Li RL et al.; Quantitative structure-activity relationships for the inhibition of Escherichia coli (MB 1428) dihydrofolate reductase (DHFR) by 61 5-(substituted benzyl)-2,4-diaminopyrimidines are reported and analyzed . The 61 compounds include 17 congeners whose activities have not been previously reported, five of which have a 5'-substituent larger than a methoxy group . The correlation equations indicated that the molar refractivity (MR) values of the 5'-substituent, just as with the 3'- and 4'-substituents, contributed maximally at the value of 0.79 with no increment of binding for compounds with MR larger than 0.79 (which corresponds to a 5'-methoxy substitution) . This experimental result is in agreement with the crystal structure of the Escherichia coli DHFR-trimethoprim complex, which shows a reasonably large trimethoprim-binding site . The inhibition of E . coli (MB 1428) DHFR by nine of the 17 new benzylpyrimidines is at lower concentrations than for trimethoprim . However, all 17 are much less potent than trimethoprim in inhibition of growth of E . coli (1515).

J Lab Clin Med, 1988 Feb, 111(2), 173 - 83
Transvascular flux and tissue accrual of Evans blue: effects of endotoxin and histamine; Green TP et al.; We investigated the relationship between the pharmacokinetics of exogenous molecules and transcapillary flux by studying the intravascular and tissue content and the histologic distribution of Evans blue in guinea pigs . Pharmacokinetic analysis demonstrated that 87% of the decline in intravascular Evans blue during the first 3 hours after administration was a result of transvascular flux to tissue compartments . Rapidly and slowly equilibrating compartments were identified . Greater than 90% of the clearances in lung and heart were rapid compartment clearances . Histologically, the distribution of Evans blue in these tissues was predominantly extracellular and similar to the distribution of fluorescein-labeled dextran . By contrast, the accumulation in kidney and liver was kinetically similar to characteristics of the slowly equilibrating compartment . This corresponded histologically to the predominant intracellular uptake of Evans blue in these tissues . Generalized increases in capillary permeability were produced by endotoxin or histamine infusion . Both treatments were associated with a more rapid initial decline in intravascular content of Evans blue than was found in control animals . Although the histologic distribution of Evans blue in tissues was not altered, endotoxin was associated with a more rapid appearance of Evans blue in the lung and heart than was seen in controls . We conclude that the initial decline in intravascular content of Evans blue corresponds to the intercompartmental clearance and to transcapillary macromolecular flux . The initial decline in serum concentrations may therefore be useful in studying disorders of generalized capillary permeability . Furthermore, the initial accrual of Evans blue in the lung and heart may be used as a marker of transcapillary macromolecular flux in those tissues.

J Bacteriol, 1988 Feb, 170(2), 991 - 4
Cloning and expression of the Escherichia coli K-12 sad gene; Marek LE et al.; The Escherichia coli K-12 sad gene, which encodes an NAD-dependent succinic semialdehyde dehydrogenase, was cloned into a high-copy-number vector . Minicells carrying a sad+ plasmid produced a 55,000-dalton peptide, the probable sad gene product.

J Bacteriol, 1988 Feb, 170(2), 662 - 8
Termination of DNA replication in Escherichia coli requires a trans-acting factor; Hill TM et al.; The terminus region of the Escherichia coli chromosome contains two sites that inhibit the progression of DNA replication forks . These termination sites, designated T1 and T2, are separated by 7.5 min (350 kilobases {kb}) on the genetic map and are located at the extremities of the terminus region . They demonstrate polarity (they stop replication forks traveling in one direction but not the other) and inhibit replication forks that have passed through and are about to leave the terminus . We have used deletion mutations in the terminus region to map the locations of T1 and T2 more accurately and to initiate studies on the mechanism of replication fork inhibition . We have narrowed the boundaries of T1 and T2 to 20 and 4 kb, respectively . T1 maps between kb 80 and 100 on the physical map of the terminus region (J . P . Bouche, J . Mol . Biol . 154:1-20, 1982), and T2 maps between kb 438 and 442 . In addition, we report here that deletion of the region containing the T2 termination site inactivated T1 . Supplying the T2 region on a plasmid restored T1 function, demonstrating that inhibition of replication at T1 requires a trans-acting factor which maps in the vicinity of termination site T2 . We have called this newly identified terminus function the termination utilization substance (tus).

J Bacteriol, 1988 Feb, 170(2), 1021 - 5
Cloning of the Escherichia coli K-12 hemB gene; Li JM et al.; An Escherichia coli heme-requiring, heme-permeable mutant had no detectable 5-aminolevulinate dehydratase or porphobilinogen deaminase activities . The gene which complemented this mutation was cloned to a high-copy-number plasmid, and porphobilinogen deaminase activity was restored to normal levels, but the synthesis of 5-aminolevulinate dehydratase increased 20- to 30-fold . A maxicell procedure confirmed that the gene cloned was hemB.

J Bacteriol, 1988 Feb, 170(2), 1012 - 4
Identification of the uvrA6 mutation of Escherichia coli; Brandsma JA et al.; The uvrA6 mutation has been cloned on a multicopy plasmid by using a chloramphenicol resistance marker introduced next to the uvrA gene in the Escherichia coli chromosome . The mutation was shown to reside in the N-terminal part of the uvrA gene . Sequencing part of this region of the mutant gene revealed a frameshift mutation at positions 207 to 209, which leads to a stop codon at position 262 . A marker rescue experiment showed that this frameshift is the only mutation responsible for the UV-sensitive phenotype of the UvrA6 mutant . The method presented is suitable for the cloning of every chromosomal uvrA mutation and can be useful for the study of the functional domains of the UvrA protein.

Infect Immun, 1988 Feb, 56(2), 387 - 94
Oral immunization of rabbits with enterotoxigenic Escherichia coli protects against intraintestinal challenge; Sack RB et al.; The development of a successful oral vaccine against enterotoxigenic Escherichia coli depends upon the identification of appropriate protective antigens which can be delivered effectively to intestinal mucosa . We have determined in a modified RITARD model the relative protection against intraintestinal challenge afforded by oral immunization with live enterotoxigenic E . coli carrying different candidate antigens . Studies were done with both wild-type strains and genetically manipulated strains of enterotoxigenic E . coli (parent strain E1392/75 2A) which carried plasmids containing intact heat-labile toxin (LT) gene sequences or various mutations of the LT genes . Immunizations were done by orogastric tube inoculation on days 0, 7, and 14; challenges were done on day 33 . Protection against diarrhea with a homologous challenge was found to be 84 to 100% (P less than 0.01) . Protection against diarrhea with challenges in which specific antigens could be tested included the following: (i) O and H antigens (O6:H16), 87 to 100% protection with different E . coli strains with identical O and H antigens (P less than 0.01) but no protection against a heterologous challenge; (ii) LT or the B subunit of LT only, approximately 50% protection (P less than 0.02) . These findings suggest that O antigens are highly protective in this model but afford only serotype-specific protection and that the B subunit (with or without the A subunit) affords less protection but confers cross-protection against heterologous strains producing LT . This model should be useful in further defining appropriate protective antigens for candidate enterotoxigenic E . coli vaccine strains.

Exp Parasitol, 1988 Feb, 65(1), 61 - 8
Stage-dependent processing and localization of a Plasmodium falciparum protein of 130,000 molecular weight; Perkins M; A Plasmodium falciparum protein of 130,000 molecular weight (m.w.) has been identified, cloned in Escherichia coli, and completely sequenced (Kochan et al . 1986) . The protein appeared to bind to soluble glycophorin, a host erythrocyte surface protein . In the present study, extracts of parasites from different intraerythrocytic stages were immunoblotted with antibodies, raised against a 30,000 m.w . fusion protein corresponding to the 3' end of the 130,000 m.w . protein . It was demonstrated that the protein is synthesized at the trophozoite stage, accumulates at the schizont stage, and is processed at the merozoite stage to a triplet of three polypeptides . The processed proteins are present in the culture supernatant at the time of merozoite burst from the red cell . Immunofluorescent staining of the parasite at different intracellular stages indicates that the protein is localized on the parasite at the trophozoite stage . At late trophozoite stage, it appears to be transported to the erythrocyte cytoplasm, where it is present in small vesicles or inclusions . In mature schizonts the protein accumulates around the plasma membrane of the erythrocyte . At the segmenter stage, just prior to merozoite release, it appears also to surround the intracellular merozoite, as well as the erythrocyte plasma membrane . The soluble 130,000 m.w . protein binds to erythrocytes but binds significantly greater to erythrocyte membranes, suggesting it binds to an internal domain of glycophorin rather than the domain exposed on the surface . The 130,000 m.w . protein is present in 11 different geographic isolates of P . falciparum from diverse geographic origins . Its molecular weight is similar in all isolates.

J Virol, 1988 Feb, 62(2), 417 - 26
Genomic clones of bovine parvovirus: construction and effect of deletions and terminal sequence inversions on infectivity; Shull BC et al.; Genomic clones of the autonomous parvovirus bovine parvovirus (BPV) were constructed by blunt-end ligation of reannealed virion plus and minus DNA strands into the plasmid pUC8 . These clones were stable during propagation in Escherichia coli JM107 . All clones tested were found to be infectious by the criteria of plaque titer and progressive cytopathic effect after transfection into bovine fetal lung cells . Sequencing of the recombinant plasmids demonstrated that all of the BPV inserts had left-end (3')-terminal deletions of up to 34 bases . DNA isolated from progeny virions arising from transfected infectious clones was found to be indistinguishable from wild-type DNA by restriction enzyme analysis . Defective genomes could also be detected in the progeny DNA even though the infection was initiated with homogenous, cloned DNA . Full-length genomic clones with 3' flip and 3' flop conformations were constructed and were found to have equal infectivity . Analysis of low-molecular-weight DNA isolated from lysates of cells transfected with these clones demonstrated that rescue and replication of BPV DNA could be detected 3 to 8 days after transfection . Expression of capsid proteins from transfected genomes was demonstrated by hemagglutination, indirect immunofluorescence, and immunoprecipitation of {35S}methionine-labeled cell lysates . Use of appropriate antiserum for immunoprecipitation showed the synthesis of BPV capsid and noncapsid proteins after transfection . Independently, a series of genomic clones with increasingly larger 3'-terminal deletions was prepared from separately subcloned 3'-terminal fragments . Transfection of these clones into bovine fetal lung cells revealed that deletions of up to 34 bases at the 3' end lowered but did not abolish infectivity, while deletions of greater than 52 bases were lethal . End-label analysis showed that the 34-base deletion was repaired to wild-type length in the progeny virus.

Proc Natl Acad Sci U S A, 1988 Feb, 85(4), 985 - 9
Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor; Antalis TM et al.; Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced . Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells . One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs) . This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation . A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region . The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically . By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543 . The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily . mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%) . Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence . The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators.

Biochimie, 1988 Feb, 70(2), 287 - 90
Molecular cloning and overexpression of the glucosamine synthetase gene from Escherichia coli; Dutka-Malen S et al.; A recombinant plasmid carrying a 4.6 kg restriction endonuclease NcoI-ClaI fragment of genomic DNA from Escherichia coli K12 was constructed . This plasmid complements the glmS mutation . Subcloning into pUC18 gave plasmid pGM10 encoding the structural gene of glucosamine synthetase, as judged by overexpression of enzyme activity and the isolation in high yield of the pure protein.

Biochimie, 1988 Feb, 70(2), 273 - 81
Antagonistic effects of mutant elongation factor Tu and ribosomal protein S12 on control of translational accuracy, suppression and cellular growth; Tapio S et al.; Kirromycin-resistant mutant forms of elongation factor Tu, which are coded by tufA (Ar) or tufB (Bo) and are associated with an increased rate of translational error formation, have been analysed . In vivo, Ar was found to increase misreading as well as suppression of non-sense codons irrespective of Bo in a strain with wild type ribosomes . It is therefore not necessary to evoke both tufA (Ar) and tufB (Bo) mutations together in order to increase translational error as suggested earlier {1} . When combined with a hyperaccurate ribosomal rpsL (S12) mutation, Ar counteracts the restrictive effects on translational error formation caused by the altered protein S12, thus restoring the levels of missense error in vitro and non-sense error and suppression in vivo to near wild type values . As judged from in vitro experiments this results principally from a lowered selectivity of the Ar ternary complex at the initial discrimination step on the ribosome during translation . In vivo, this compensatory effect on the rpsL mutation on non-sense error formation and suppression is seen irrespective of the nature of tRNA or codon context . Furthermore, the tufA mutation enhances the cellular growth rate of the rpsL mutant, whereas it decreases growth of strains with normal ribosomes . Inactivation of one of the two genes coding for EF-Tu (tufB), while leaving the other gene (tufA) intact, can by itself, increase non-sense error formation and suppression.

Biochem Int, 1988 Feb, 16(2), 209 - 17
Allosteric activation by purine nucleosides and nucleotides of the inactive by phosphatase ornithine decarboxylase of Tetrahymena pyriformis; Lougovoi CP et al.; Ornithine decarboxylase (ODC) of Tetrahymena pyriformis is inactivated by E . coli or calf intestinal alkaline phosphatase . Inactivated ODC by E . coli alkaline phosphatase, form b, can be allosterically reactivated to form a by purine-nucleosides or -nucleotides at 10(-4) M concentration . Inactivated ODC by calf intestinal alkaline phosphatase bound to agarose can be converted to form a by purine-analogues with 10(-7) M concentration only if inorganic phosphate is included in the incubation mixture . Pyridoxal phosphate, phosphoamino acids or other phospho-compounds are incapable to promote the conversion of b form to a form of ODC . These data suggest that purine-analogues may be the in vivo physiological regulators of ODC of T . pyriformis.

Mol Cell Biol, 1988 Feb, 8(2), 615 - 23
DNA-binding properties of the Drosophila melanogaster zeste gene product; Mansukhani A et al.; The ability of the zeste moiety of beta-galactosidase-zeste fusion proteins synthesized in Escherichia coli to bind specific DNA sequences was examined . Such fusion proteins recognize a region of the white locus upstream of the start of transcription; this region has previously been shown to be required for genetic interaction between the zeste and white loci . Another strong binding site was localized to a region between 50 and 205 nucleotides before the start of the Ubx transcriptional unit; expression of the bithorax complex is also known to be influenced by the zeste locus . Weaker binding sites were also seen in the vicinity of the bxd and Sgs-4 genes, but it is currently unclear whether these binding sites play a role in transvection effects . The DNA-binding activity of the zeste protein is restricted to a domain of approximately 90 amino acids near the N terminus . This domain does not appear to contain homeobox or zinc finger motifs found in other DNA-binding proteins . The DNA-binding domain is not disrupted by any currently characterized zeste mutations.

Int J Radiat Biol Relat Stud Phys Chem Med, 1988 Feb, 53(2), 217 - 35
Base sequence damage in DNA from X-irradiated monkey CV-1 cells; Feingold JM et al.; Two kinds of 3'-ends were detected in DNA scission fragments of highly repetitive primate component alpha DNA which were isolated from irradiated monkey CV-1 cells . The fragments' 3'-ends were characterized by 5'-32P-end labelling the DNA, followed by examination in high-resolution polyacrylamide gels under denaturing conditions . Hydrolysis of the labelled fragments' termini with exonuclease III of E . coli or by the 3'-phosphatase activity of T4 polynucleotide kinase generated a third, slowest migrating species in each mobility size class . Reference to mobility size class standards makes it highly probable that the fragment ends generated by X-rays in cells are 3'-phosphoryl and 3'-phosphoglycolate, and that they are converted to slower migrating fragments with 3'-OH ends, similar to results obtained with DNA irradiated in water (Henner et al . 1982, 1983 a, b) . Densitometer measurements of gel autoradiograms showed that X-ray induction of DNA fragments with 3'-phosphoryl and 3'-phosphoglycolate ends was dose-dependent over a range 100-900 Gy . In CV-1 cells the frequency of single-strand breaks in alpha DNA was 8.6 x 10(-7) breaks/nt/Gy . The two kinds of ends disappeared in post-radiation incubation with a half-time of 1.6 h . These results provide a new means to study X-ray damage and repair of specific sequences in animal cells.

Am J Kidney Dis, 1988 Feb, 11(2), 159 - 62
Interleukin 2 toxin: a step toward selective immunomodulation; Murphy JR et al.; We have used protein engineering and recombinant DNA methodologies to genetically replace the eukaryotic cell receptor binding domain of diphtheria toxin with interleukin 2 (IL-2) . The toxin-related T cell growth factor fusion gene has been cloned in Escherichia coli K12 . Recombinant strains of E coli produce a 68,086 K hybrid toxin, IL-2 toxin that retains immunologic properties intrinsic to both its diphtheria toxin and IL-2 components . IL-2 toxin has been found to selectively inhibit protein synthesis in both human and murine T cell lines that bear high affinity IL-2 receptors, whereas the hybrid toxin is not active against cells that do not bear this receptor . The cytotoxic action of IL-2 toxin is specifically blocked by free IL-2 and monoclonal antibodies that bind to the p55 (Tac antigen) subunit of the high affinity IL-2 receptor . In addition, IL-2 toxin, like diphtheria toxin itself, must pass through an acidic compartment in order to deliver its adenosine diphosphate ribosyl transferase activity to the cytosol of target T cells . In a murine delayed type hypersensitivity (DTH) model system, we have shown that IL-2 toxin treatment induces a marked immunosuppression.

Proc Natl Acad Sci U S A, 1988 Feb, 85(4), 1043 - 6
Illegitimate recombination induced by benzo{a}pyrene diol epoxide in Escherichia coli; Kokontis JM et al.; Duplex DNA oligomer constructs (32 base pairs) were prepared that contained a single benzo{a}pyrene (BP) adduct at a specific deoxyadenosine or deoxyguanosine site in either one or both strands . These constructs were inserted into M13 replicative form viral DNA, and the DNA from progeny virus generated by transfection of Escherichia coli was examined by sequence analysis at the site of oligomer insertion . With nonalkylated constructs, and with constructs containing only one BP adduct, no sequence alterations were found in progeny viral DNAs . With constructs containing two BP adducts, one in each strand and closely spaced, some progeny DNAs showed the original oligomer sequence, whereas others exhibited large deletions and illegitimate (nonhomologous) recombination, both of which removed the damaged construct . Increasing the distance between BP adducts in the construct reduced the frequency of recombinant events . These sequence alterations occurred in both recA+ and recA- host cells . We speculate that the closely spaced adducts in opposite construct strands cause a rare distortion in DNA structure, which activates the recombinant machinery, and that mutagenic and carcinogenic agents other than polycyclic aromatic hydrocarbons may cause similar DNA distortions, which induce illegitimate recombination.

J Bacteriol, 1988 Feb, 170(2), 872 - 6
beta-Alanine auxotrophy associated with dfp, a locus affecting DNA synthesis in Escherichia coli; Spitzer ED et al.; Strains containing the conditional-lethal dfp-707 mutation, which have a defect in DNA synthesis at 42 degrees C, were found to require either pantothenate or its precursor, beta-alanine, for growth at 30 degrees C . The auxotrophy and conditional lethality were corevertible . Through localized mutagenesis of the dfp-pyrE region of Escherichia coli, another mutation, dfp-1, was obtained . It conferred the auxotrophy but not the conditional lethality of dfp-707 . Complementation analysis, performed with a set of plasmid-borne deletion and insertion mutations, revealed a correspondence between the complementation of each mutant phenotype and the production of the dfp gene product, previously identified as a 45-kilodalton flavoprotein . The dfp mutants had a normal level of aspartate-1-decarboxylase, which is the only enzyme known to produce beta-alanine in E . coli and which is specified by the distant panD gene . A prototrophic pseudorevertant of a dfp-1 strain was found to have retained the dfp mutation, to be genetically unstable, and to have an elevated level of aspartate-1-decarboxylase, suggesting that it had acquired a duplication of panD . It is not known what steps in pantothenate or DNA metabolism are affected by the mutant dfp product or how its flavin moiety may be involved.

Can J Microbiol, 1988 Feb, 34(2), 148 - 56
Suppression by the ColV,I-K94 plasmid of inhibitor sensitivities in ompA mutants of Escherichia coli; Reakes CF et al.; A series of ompA mutants derived from Escherichia coli K12 strains showed increased sensitivity (compared with the ompA+ parents) to aminoglycoside antibiotics and to other cationic agents including polymyxin B . One tested mutant also showed increased sensitivity to nafcillin and fusidic acid, but not to the hydrophilic ampicillin . All these inhibitor sensitivities in the ompA mutants were suppressed by ColV, I-K94 and by certain other ColV plasmids, but not by any of the other tested large plasmids . Suppression correlated with the production of the VmpA protein, but transfer and colicin components were not needed for suppression . Further comparison of the ompA and vmpA genes and their products was made and it indicated that there is little if any homology between the genes, that the synthesis of their products is regulated by quite different mechanisms, and that regions of these gene products exposed at the cell surface show different susceptibility to protease attack after denaturation.

J Trauma, 1988 Feb, 28(2), 131 - 9
Beta endorphin, a vasoconstrictor during septic shock; Doty S et al.; A relationship between increased peripheral resistance (TPRI) and decreased cardiac index (CI) and mortality from sepsis has been suggested . The relationship between endogenous opiates and this response was evaluated . Methods: Chronically instrumented sheep were given E . coli endotoxin (LPS, 1.5 mcg/kg x 30 minutes) . In one study, survivors (n = 9) and nonsurvivors (n = 11) of LPS were compared along with survivors (n = 8) of half the dose of LPS . In a second study, two groups of animals received naloxone: one (n = 11) had a bolus of 2 mg/kg followed by a 2 mg/kg/hr continuous infusion started 30 minutes before LPS while the other had the bolus and infusion started 1 hour after LPS was begun . Results: Both vasoconstrictive and vasodilative phases were seen . Vasoconstriction was associated with elevated beta endorphin levels, a pattern sustained until death in the nonsurvivors . Both pre- and posttreatment with naloxone lessened the maximum increase in total peripheral resistance index compared with untreated sheep . Discussion: The vasoconstrictive aspects of the response to LPS correlated with elevated beta endorphin levels and with mortality . This vascular response is attenuated with naloxone blockade.

FASEB J, 1988 Feb, 2(2), 141 - 5
Induction of helper and suppressor T cells by nonoverlapping determinants on the large protein antigen, beta-galactosidase; Krzych U et al.; The fine specificity of the T cell repertoire directed against T helper (Th)-inducing and T suppressor (Ts)-inducing determinants was examined with cyanogen bromide and tryptic peptides of Escherichia coli beta-galactosidase (GZ), a large tetrameric protein (monomer molecular weight = 116 kDa) . Immunization with cyanogen bromide fragment 2 {CB-2, amino acids (a.a.) 3-92} induced both specific Th and Ts cells . Study of the induction of these functionally opposite T cell subpopulations with tryptic peptides of CB-2 indicated that Th and Ts were activated by separate, nonoverlapping determinants . Th-inducing activity resided in a nonapeptide, T6 (a.a . 44-52), whereas T4 (a.a . 27-37) induced Ts cells . The presence of distinct helper and suppressor determinants suggests that the specificity repertoire in these T cell subpopulations may differ, perhaps owing to the expression of antigen-recognizing receptors that are coded by unique gene families . Alternatively, antigen presentation structures may be physicochemically quite different, and bind to distinct parts of the peptide antigen.

Am Rev Respir Dis, 1988 Feb, 137(2), 345 - 52
Increased intrapulmonary retention of radiolabeled neutrophils in early oxygen toxicity; Rinaldo JE et al.; Sequential lung injuries, such as oxygen toxicity followed by septicemia, are common during the adult respiratory distress syndrome (ARDS) . As these forms of vascular injury may be mediated in part by polymorphonuclear leukocytes (PMN), aberrant interactions between PMN and previously injured pulmonary endothelium are of both theoretical interest and clinical importance . The present study was undertaken to test the hypothesis that early oxygen toxicity at a dose that injuries pulmonary endothelium relatively selectively alters intrapulmonary neutrophil kinetics . Unanesthetized rats breathing 1.0 atmospheres oxygen for 36 h showed ultrastructural endothelial damage but no edema, injury, or neutrophilic inflammation by histologic criteria . However, in these oxygen-toxic animals, whereas initial accumulation of radiolabeled PMN in lungs was normal, washout of PMN was abnormal at 120 min after infusion, at which point the pulmonary retention of radiolabeled PMN in the lungs of oxygen-treated animals was significantly higher than in control animals (139% of control, p less than 0.0096) . Features of our methodology, including avoidance of osmotic stress and use of paired control animals, appear to have greatly enhanced the sensitivity of radiolabeled neutrophils for detecting a subtle abnormality of neutrophil-endothelial interactions . Our studies in the oxygen toxicity model provide the first demonstration in vivo of abnormal intrapulmonary neutrophil kinetics in early oxygen toxicity prior to the onset of histologic evidence of lung injury or inflammation.

Virology, 1988 Feb, 162(2), 466 - 70
Transcription stimulates recombination . I . Specialized transduction of Escherichia coli by lambda trp phages; Dul JL et al.; Specialized transduction of Trp+ by lambda trp phages, whose trp genes were totally under the control of the PL promoter of lambda, was studied . In all cases the efficiency of transduction (EOT) was significantly reduced in homoimmune recipients . In Su- recipients the EOT by phages whose trp gene expression was N-dependent was reduced 2- to 3-fold by the lambda mutant Pam but 30- to 100-fold by an Nam mutant . With phages whose trp gene expression was N-independent, either Pam or Nam caused 2- to 3-fold reduction in the EOT . It was concluded that transcription of the trp genes of the specialized transducing phages had a direct, stimulatory effect on their recombination leading to transduction.

J Bacteriol, 1988 Feb, 170(2), 954 - 60
Mini-P1 plasmid partitioning: excess ParB protein destabilizes plasmids containing the centromere parS; Funnell BE; The partition system of the unit-copy plasmid P1 consists of two proteins, the parA and parB gene products, and a cis-acting site, parS . Production of high levels of the P1 ParB protein, from an external promoter on a high-copy-number vector, inhibits the propagation of lambda-mini-P1 prophages and destabilizes other P1-derived plasmids . The interference by ParB protein depends on the parS site, or centromere, of the P1 partition region; plasmids lacking parS are unaffected . The defect is more severe than the defect due to mutations that simply eliminate par function . In the presence of excess ParB protein, plasmids carrying parS are more unstable than would be predicted from a random distribution at cell division . The destabilization is a segregation defect, as the copy number of parS-bearing plasmids is not decreased under these conditions . Thus, it appears that ParB protein binds to parS; if too much protein is present, it sequesters such plasmids so they cannot be properly, or even randomly, partitioned . This suggests that under normal conditions, ParB protein recognizes and binds to parS and may be the protein responsible for pairing plasmids during the process of partitioning at cell division.

J Bacteriol, 1988 Feb, 170(2), 540 - 6
Escherichia coli genes whose products are involved in selenium metabolism; Leinfelder W et al.; Mutants of Escherichia coli were isolated which were affected in the formation of both formate dehydrogenase N (phenazine methosulfate reducing) (FDHN) and formate dehydrogenase H (benzylviologen reducing) (FDHH) . They were analyzed, together with previously characterized pleiotropic fdh mutants (fdhA, fdhB, and fdhC), for their ability to incorporate selenium into the selenopolypeptide subunits of FDHN and FDHH . Eight of the isolated strains, along with the fdhA and fdhC mutants, maintained the ability to selenylate tRNA, but were unable to insert selenocysteine into the two selenopolypeptides . The fdhB mutant tested had lost the ability to incorporate selenium into both protein and tRNA . fdhF, which is the gene coding for the 80-kilodalton selenopolypeptide of FDHH, was expressed from the T7 promoter-polymerase system in the pleiotropic fdh mutants . A truncated polypeptide of 15 kilodaltons was formed; but no full-length (80-kilodalton) gene product was detected, indicating that translation terminates at the UGA codon directing the insertion of selenocysteine . A mutant fdhF gene in which the UGA was changed to UCA expressed the 80-kilodalton gene product exclusively . This strongly supports the notion that the pleiotropic fdh mutants analyzed possess a lesion in the gene(s) encoding the biosynthesis or the incorporation of selenocysteine . The gene complementing the defect in one of the isolated mutants was cloned from a cosmid library . Subclones were tested for complementation of other pleiotropic fdh mutants . The results revealed that the mutations in the eight isolates fell into two complementation groups, one of them containing the fdhA mutation . fdhB, fdhC, and two of the new fdh isolates do not belong to these complementation groups . A new nomenclature (sel) is proposed for pleiotropic fdh mutations affecting selenium metabolism . Four genes have been identified so far: selA and selB (at the fdhA locus), selC (previously fdhC), and selD (previously fdhB).

Mol Cell Biochem, 1988 Feb, 79(2), 181 - 9
Purification and properties of the Drosophila zen protein; Chen HZ et al.; The zen protein is encoded by the zerknullt gene required for normal early development in Drosophila . Like many regulatory proteins of this type, zen contains a 60 amino acid homeobox sequence . We have purified the zen protein and studied its solution behavior and its interaction with DNA . The zen protein exists as a monomer in solution with a molecular weight of about 40,000 . It binds specifically to a site about 900 bases upstream from the zen gene . Within this binding site DNase protection experiments indicate that binding is confined to two regions approximately 11 and 14 bases in length that are separated by about 30 base pairs . The protein concentration dependence of the binding curve suggests that protein binding is non cooperative.

Br J Haematol, 1988 Feb, 68(2), 195 - 201
Use of minisatellite DNA probes for recognition and characterization of relapse after allogeneic bone marrow transplantation; Min GL et al.; Restriction fragment length polymorphisms can be used to distinguish blood and marrow cells from close relatives . We used two probes that recognize a series of dispersed and highly polymorphic tandem-repetitive minisatellite regions in the human genome that can be detected via a shared 10-15 base pair core sequence similar to the generalized recombination sequence (chi) of E . coli . We have studied the resulting individual-specific DNA fingerprints in 15 patients before and after allogeneic bone marrow transplantation performed for chronic myeloid leukaemia and in two patients transplanted for acute leukaemia . Early engraftment could be demonstrated at 3 weeks post-transplant based on the recognition of cells of donor origin . One patient who failed to engraft had only recipient type marrow cells 3 months post-transplant . Nine patients who relapsed after transplantation had only cells of recipient origin . In one patient who relapsed after transplantation with T-cell depleted donor marrow, fractionation studies showed that his T-cells at relapse were of recipient origin . We conclude that these minisatellite probes are valuable for characterizing the origin of different cell populations after marrow transplantation and could be useful for characterizing relapse when donor and recipient are of the same sex.

J Bioenerg Biomembr, 1988 Feb, 20(1), 19 - 39
Expression of the unc genes in Escherichia coli; McCarthy JE; The unc (or atp) operon of Escherichia coli comprises eight genes encoding the known subunits of the proton-translocating ATP synthase (H+-ATPase) plus a ninth gene (uncI) of unknown function . The subunit stoichiometry of the H+-ATPase (alpha 3 beta 3 gamma 1 delta 1 epsilon 1 a1b2c10-15) requires that the respective unc genes be expressed at different rates . This review discusses the experimental methods applied to determining how differential synthesis is achieved, and evaluates the results obtained . It has been found that the primary level of control is translational initiation . The translational efficiencies of the unc genes are determined by primary and secondary mRNA structures within their respective translational initiation regions . The respective rates of translation are matched to the subunit requirements of H+-ATPase assembly . Finally, points of uncertainty remain and experimental strategies which will be important in future work are discussed.

Arch Surg, 1988 Feb, 123(2), 162 - 70
Inhibition of cyclo-oxygenase attenuates the metabolic response to endotoxin in humans; Revhaug A et al.; Acute infection initiates fever, acute-phase changes, and catabolic responses in the host, resulting in weight loss, hypermetabolism, and accelerated proteolysis . To test the hypothesis that cyclo-oxygenase inhibition might attenuate these responses, we administered Escherichia coli endotoxin intravenously to seven normal volunteers and to seven additional subjects pretreated with a cyclo-oxygenase inhibitor (ibuprofen) . Control studies were also performed following administration of saline and ibuprofen alone . Vital signs, metabolic rate, and concentrations of pituitary and stress hormones, as well as those of other substrates, were serially measured . Endotoxin administration produced a response similar to an acute illness, with flulike symptoms, fever, tachycardia, increased metabolic rate, and stimulation of stress hormone release . These changes were markedly attenuated by cyclo-oxygenase inhibition . The leukocytosis, hypoferremia, and elevation of the C-reactive protein level induced by endotoxin were unaffected by cyclo-oxygenase inhibition . These data indicate that activation of the cyclooxygenase pathway is necessary to produce many of the metabolic changes observed during critical illness.

J Bacteriol, 1988 Feb, 170(2), 921 - 6
Purification and characterization of protease Re, a cytoplasmic endoprotease in Escherichia coli; Park JH et al.; Protease Re, a new cytoplasmic endoprotease in Escherichia coli, was purified to homogeneity by conventional procedures, using {3H}casein as the substrate . The enzyme consists of a single polypeptide of 82,000 molecular weight . It is maximally active between pH 7 and 8.5 and is independent of ATP . It has a pI of 6.8 and a Km of 10.8 microM for casein . Since diisopropyl fluorophosphate and phenylmethylsulfonyl fluoride inhibited this enzyme, it appears to be a serine protease . Protease Re was sensitive to inhibition by L-1-tosylamido-2-phenylethylchloromethylketone but not to that by 1-chloro-3-tosylamido-7-aminoheptanone, thiol-blocking reagents, chelating agents, or various peptide aldehydes . Re also degraded {125I}globin, {125I}glucagon, and 125I-labeled denatured bovine serum albumin to acid-soluble products (generally oligopeptides of greater than 1,500 daltons), but it showed no activity against serum albumin, growth hormone, insulin, or a variety of fluorometric peptide substrates . It also hydrolyzed oxidatively inactivated glutamine synthetase (generated by ascorbate, oxygen, and iron) four- to fivefold more rapidly than the native protein . Protease Re appears to be identical to the proteolytic enzyme isolated by Roseman and Levine (J . Biol . Chem . 262:2101-2110, 1987) by its ability to degrade selectively oxidatively damaged glutamine synthetase in vivo . Its role in intracellular protein breakdown is uncertain.

Infect Immun, 1988 Feb, 56(2), 513 - 7
A block of urovirulence genes encoding multiple fimbriae and hemolysin in Escherichia coli O4:K12:H-; High NJ et al.; Cosmid gene libraries were constructed from a uropathogenic isolate of Escherichia coli O4:K12:H- that secretes alpha-hemolysin and produces the F14, F12-rel, F1C, and F13 fimbrial antigens . A series of overlapping clones was generated, and individual cosmid clones were found to express various combinations of fimbriae and hemolysin, suggesting that the genes for these potential virulence factors are closely linked . By using Southern hybridization analysis and restriction endonuclease mapping, it was demonstrated that the cosmid clones carried a nested set of overlapping, cloned, genomic DNA fragments . A comparison of the phenotypic properties of individual cosmid clones and subclones allowed the order of the gene clusters encoding these factors to be deduced . The cloning also revealed the presence of a fifth fimbria that had P-adhesin specificity.

Gastroenterology, 1988 Feb, 94(2), 367 - 73
Age-related differences in receptors for Escherichia coli heat-stable enterotoxin in the small and large intestine of children; Cohen MB et al.; Escherichia coli that produce heat-stable enterotoxin are a worldwide cause of diarrheal disease, especially in children . We examined small and large intestinal specimens from children of various ages for the presence of E . coli heat-stable entero-toxin receptors and determined whether the number of receptors or the binding affinity of these receptors was related to the age of the child . We observed specific binding of 125I-heat-stable enterotoxin to all small intestinal and colonic specimens . However, a greater number of receptors per microgram of membrane protein were present in infants and the number of receptors rapidly decreased with increasing age . We also observed that increased heat-stable enterotoxin stimulation of guanylate cyclase was correlated with increased receptor density . We suggest that a greater number of gastrointestinal receptors for heat-stable enterotoxin, capable of activating more guanylate cyclase, may contribute to the increased severity of diarrhea noted in young children exposed to enterotoxigenic E . coli.

Drug Des Deliv, 1988 Feb, 2(3), 191 - 206
Structure/function studies on recombinant human gamma interferon; Fish EN et al.; Structure/function relationships for human gamma interferon (IFN-gamma) were investigated using recombinant DNA-derived homologues produced in E . coli . The various biological effects examined were antiviral, growth inhibitory and 2-5A synthetase activities, as well as receptor binding characteristics . Specific structural changes led to IFN-gamma homologues with defined alterations in biological activities . Amino acid residue changes at the hydrophobic core of the molecule resulted in two homologues exhibiting loss of affinity for the IFN-gamma receptor and dramatically reduced biological activities . These diminished activities probably relate to the inability of the homologues to form appropriately folded structures . Residue changes at two sites associated with beta-turns on the surface of IFN-gamma likewise resulted in homologues with reduced biological activities . In these cases, the reduced biological activities were not associated with reduced receptor binding . Addition of cysteine-tyrosine-cysteine to the amino-terminus of IFN-gamma, known to perturb the protein conformation, slightly reduced the affinity of the so-derived homologue for the IFN-gamma receptor on T98G cells, and there was concommitant reduction in biological activities . Experiments with a monoclonal antibody that binds to the carboxy-terminus of IFN-gamma indicated that this region of the molecule may not influence antiviral or antiproliferative activities . Overall our data imply that several sites along the IFN-gamma polypeptide contribute to biological activity, and that receptor binding and effector sites are distinct.

Microb Pathog, 1988 Feb, 4(2), 103 - 13
A new heat-labile cytolethal distending toxin (CLDT) produced by Escherichia coli isolates from clinical material; Johnson WM et al.; A new heat-labile Escherichia coli toxin cytolethal to Vero, HeLa, HEp-2 and CHO cells and negative in Y-1 cells has been demonstrated in culture filtrates of 43 E . coli strains associated with diarrheal disease . This new toxin was termed a cytolethal distending toxin (CLDT) to reflect the progressive cell distention and cytotoxicity evidenced in all sensitive tissue cells . CLDT was distinct from the classic heat-labile (LT) and heat-stable enterotoxins, Verotoxins and hemolysins and was produced by some strains of the following E . coli serogroups (02, 07, 08, 018, 022, 039, 044, 055, 083, 086, 091, 0113, 0119, 0128 and 0167) . Moderate cyclic AMP accumulation (75-fold) was observed in CHO cells exposed to E . coli CLDT for 24 h . In contrast to E . coli LT, cyclic AMP levels were optimal at 24 h and were observed to decrease over the following 72 h period in CHO cells exposed to E . coli CLDT . In addition to heat-lability at 70 degrees C for 15 min, E . coli CLDT demonstrated a molecular weight over 30,000, was nondialyzable and trypsin-sensitive . E . coli CLDT was negative in adult rabbit ligated ileal loop and suckling mouse assays and provoked only an erythematous response in rabbit skin . All CLDT-positive E . coli strains identified to date were non-hemolytic and non-invasive . Verotoxin and heat-labile enterotoxin were found in combination with CLDT in a few E . coli strains.

J Gen Microbiol, 1988 Feb, 134 ( Pt 2), 403 - 12
A transposon insertion in the Escherichia coli uvrC gene; UvrC protein is absolutely required for the incision step in excision repair; Walters RG et al.; The formation of single-stranded breaks in DNA following UV irradiation is assessed in uvrC34 mutants . By altering the SOS DNA-repair system, either by additional mutations or by using drugs affecting transcription or translation, it is shown that such single-stranded breaks require one or more DNA-damage-inducible functions . A UV-sensitive strain is characterized as carrying a Tn10 insertion into the uvrC gene . The absence of post-irradiation incision in this strain demonstrates that uvrC function is absolutely required in vivo for the incision stage of excision repair, and suggests that other uvrC mutants are 'leaky'.

Mol Gen Mikrobiol Virusol, 1988 Feb, (2), 12 - 6
{Introduction of new DNA sequences into previously selected regions of a plasmid genome by means of the formation of heteroduplexes}; Saparbaev MK et al.; A new method for obtaining the recombinant DNA based on heteroduplex-initiated site-directed insertion of alien nucleotide sequences is proposed . To generate a single-stranded region, plasmid DNA was nicked with restriction endonuclease in the presence of ethidium bromide with subsequent exonuclease III controlled digestion . The inserted DNA sequences flanked by nucleotide sequences complementary to single-stranded region were annealed with plasmid DNA and E . coli cells were transformed by the resulting heteroduplex molecules . The presented data show the possibility to insert as many as 200 nucleotides . The yield of recombinant DNA varied from 16 to 0.7% as the number of nucleotides inserted correspondingly varied from 15 to 200 . The site of insertion does not depend crucially on the localization of the restriction site used.

EMBO J, 1988 Feb, 7(2), 567 - 72
Differential regulation of the Tn10-encoded tetracycline resistance genes tetA and tetR by the tandem tet operators O1 and O2; Meier I et al.; The Tn10-encoded tet transcriptional control sequence consists of bidirectional, overlapping promoters which are superimposed by a tandem operator arrangement . Three mutations have been constructed by oligonucleotide-directed mutagenesis which reduce binding of Tet repressor to either one or both of the tandem tet operators 1000-fold as determined by DNAseI footprinting in vitro . The affinity of Tet repressor for mutant tet operators is not affected by the presence of an already occupied neighbouring wild-type operator, indicating little or no cooperativity . The regulation of the divergently oriented tet promoters PA and PR by the tet operators O1 and O2 and Tet repressor provided in trans is determined using transcriptional fusions of the promoters to lacZ and galK indicator genes located with different polarity on the same plasmid . The results demonstrate that expression of the resistance gene tetA is regulated by Tet repressor bound to either O1 or O2 . Expression of the repressor gene tetR is only marginally reduced when Tet repressor is bound to O2 . This result is discussed with respect to the double promoter structure found for PR . Occupation of O1 with Tet repressor turns off transcription from PR completely . The implications of these findings on the establishment of tetracycline resistance upon induction are discussed.

EMBO J, 1988 Feb, 7(2), 547 - 56
DNA supercoiling changes the spacing requirement of two lac operators for DNA loop formation with lac repressor; Kramer H et al.; We have used a gel retardation assay to investigate the influence of DNA supercoiling on loop formation between lac repressor and two lac operators . A series of 15 DNA minicircles of identical size (452 bp) was constructed carrying two lac operators at distances ranging from 153 to 168 bp . Low positive or negative supercoiling (sigma = +/- 0.023) changed the spacing between the two lac operators required for the formation of the most stable loops . This reveals the presence of altered double helical repeats (ranging from 10.3 to 10.7 bp) in supercoiled DNA minicircles . At elevated negative supercoiling (sigma = -0.046) extremely stable loops were formed at all operator distances tested, with a slight spacing periodicity remaining . After relaxation of minicircle-repressor complexes with topoisomerase I one superhelical turn was found to be constrained in those minicircles which carry operators at distances corresponding to a non-integral number of helical turns . This indicates that DNA loop formation can define local DNA domains with altered topological properties of the DNA helix.

Genes Dev, 1988 Feb, 2(2), 137 - 49
Tn7 transposition: two transposition pathways directed by five Tn7-encoded genes; Waddell CS et al.; The bacterial transposon Tn7 is capable of high-frequency transposition to a specific site in the Escherichia coli chromosome, attTn7, and of low-frequency transposition to sites other than attTn7 . Using an in vitro insertional mutagenesis procedure, we have identified and characterized five tns (Tn seven) genes that are essential for Tn7 transposition . Three of these genes, tnsA, tnsB, and tnsC, are required, but are not sufficient, for all Tn7 transposition events . In addition, tnsD is specifically required for transposition to attTn7, whereas tnsE is specifically required for transposition to other sites . Thus, Tn7 is an elaborate transposon that encodes two distinct but overlapping transposition pathways.

Mol Cell Biol, 1988 Feb, 8(2), 974 - 7
Introduction of new genetic material into human myeloid leukemic blast stem cells by retroviral infection; Smith LJ et al.; An amphotropic retroviral vector containing the bacterial neomycin phosphotransferase gene (neo) was used to infect blast cells from patients with acute myeloblastic leukemia . The infected cells acquired a G418-resistant phenotype that was stable as measured in a clonogenic assay and in long-term suspension culture . Thus, gene transfer into stem cells was accomplished by this procedure . This approach for manipulating gene expression in blast stem cells provides a means to assess the roles of a variety of genes in self-renewal, differentiation, and leukemogenesis.

Mol Cell Biol, 1988 Feb, 8(2), 843 - 53
DNA sequence, structure, and tyrosine kinase activity of the Drosophila melanogaster Abelson proto-oncogene homolog; Henkemeyer MJ et al.; We report our molecular characterization of the Drosophila melanogaster Abelson gene (abl), a gene in which recessive loss-of-function mutations result in lethality at the pupal stage of development . This essential gene consists of 10 exons extending over 26 kilobase pairs of genomic DNA . The DNA sequence encodes a protein of 1,520 amino acids with strong sequence similarity to the human c-abl proto-oncogene beginning in the type lb 5' exon and extending through the region essential for tyrosine kinase activity . When the tyrosine kinase homologous region was expressed in Escherichia coli, phosphorylation of proteins on tyrosine residues was observed with an antiphosphotyrosine antibody . These results show that the abl gene is highly conserved through evolution and encodes a functional tyrosine protein kinase required for Drosophila development.

Mol Gen Genet, 1988 Feb, 211(2), 326 - 31
An Escherichia coli gene in search of a function; Baliko G et al.; The rrnB gene of Escherichia coli is preceded by an open reading frame, which is cotranscribed with rrnB both in vivo and in vitro . It has earlier been shown that a 289 amino acid protein corresponding to this gene is actually synthesized in E . coli . In this paper we show that: (1.) The transcription of this gene diminishes the stringent response of the P1 promoter of the linked rrnB gene, but this is a cis effect and is not mediated by the protein product of the gene . (2.) The functional integrity of this gene seems to be essential, because efforts to replace it by a plasmid-coded copy mutagenized by Tn5 completely failed . (3.) The protein product of this gene was strongly overproduced by a recombinant plasmid, exploiting the principle of "translational coupling" . This overproduction did not change the phenotype of the host cell significantly . The protein was purified to apparent electrophoretic homogeneity.

Mol Gen Genet, 1988 Feb, 211(2), 320 - 5
Transposon Tn21 encodes a RecA-independent site-specific integration system; Martinez E et al.; The IncW plasmid R388 and the DNA region of Tn21 containing the Smr and the Sur genes are capable of RecA-independent recombination . This recombination occurs at a relatively high frequency (up to 10(-4) recombinants per recipient molecule) and results in integration of the two plasmids . No detectable repeats are formed in the process . The crossover points have been confined to a 0.4-kb homologous segment in both plasmids which contains a 59-bp DNA sequence presumably involved in the acquisition of new genes by Tn21 and its relatives (Cameron et al . 1986) . It is likely that the recombination occurs precisely at this point . At least one trans-acting function (an integrase) is required for the site-specific recombination . It has been localized to a 1456-bp BstEII-BamHI fragment of Tn21 and can efficiently complement the integration of plasmids containing the integration site.

Mol Gen Genet, 1988 Feb, 211(2), 282 - 9
Second-element turn-on of gene expression in an IS1 insertion mutant; Schwartz E et al.; To learn more about the ways in which genes silenced by insertion mutations can be reactivated, we have undertaken a systematic investigation of Gal+ revertants of the polar mutant galOP-306::IS1 in Escherichia coli K12 . The selective conditions used excluded reversion to wild type by precise excision of IS1 . In this system (which resided on a multi-copy plasmid) reversion to the Gal+ phenotype occurred with a frequency of about 10(-7) per cell and per generation . Analysis of the revertants revealed that - with the single exception of the previously published chromosomal mutant sis1 - alterations in the structure of IS1 lead to reactivation of gal operon expression . These events fall into four classes: (I) insertion of IS2 at position 327 in IS1, insertion of IS2 at position 687 in IS1, (III) insertion of a hitherto undetected mobile element, IS150, at position 387, (IV) a 16-bp deletion encompassing IS1 coordinates 553-568 . Of some 200 independent reversion events studied, all but one were of types I-III i.e . they involved the intervention of a second mobile element.

Mol Gen Genet, 1988 Feb, 211(2), 244 - 51
Cointegrate formation by IS50 requires multiple donor molecules; Lichens-Park A et al.; The insertion sequence, IS50R, promotes cointegrate formation between a lambda::IS50R phage and the chromosome of Escherichia coli strain C . We show that formation of cointegrates mediated by IS50R between the non-replicating phage genome and the bacterial chromosome requires multiple donor molecules and depends on homologous recombination functions . We conclude that the two copies of IS50 present in the cointegrate originate in two different molecules . Thus, the existence of the cointegrate structure cannot be used as evidence for replication of IS50 sequences during IS50 transposition.

Mol Gen Genet, 1988 Feb, 211(2), 231 - 43
The complete nucleotide sequence of the colicinogenic plasmid ColA . High extent of homology with ColE1; Morlon J et al.; The complete nucleotide sequence of the colicinogenic plasmid ColA has been determined . The plasmid DNA consists of 6720 bp (molecular weight 4.48 X 10(6} . Fifteen putative biological functions have been identified using the functional map previously determined . These include 11 genes and 3 DNA sites . Nine genes encode proteins of which 3 have been fully characterized . The replication region of ColA coding for RNAI and RNAII is highly homologous to that of ColE1 and Clo DF13 . The same holds true for the site-specific recombination region containing palindromic symmetry and involved in stable maintenance of the plasmids . A high percentage of homology has been detected for putative mobility proteins encoded by ColA and ColE1 . The exclusion proteins are also highly homologous.

Mol Gen Genet, 1988 Feb, 211(2), 223 - 30
Identification of functional regions of the colicinogenic plasmid ColA; Morlon J et al.; ColA is a colicinogenic plasmid of 6.72 kb . It is compatible with ColE1 but not with ColK . Transposon insertion mutagenesis as well as complementation studies have been carried out to investigate the location of the various functional regions of this plasmid . Four independent ColA::Tn1 and one ColA::Tn3 plasmids were isolated and the locations of insertions were determined . From these plasmids, six different deletion mutants were constructed . In addition, various restriction fragments of ColA have been cloned into pUC8 to carry out complementation studies . We have thus confirmed the location of the DNA regions involved in colicin production, colicin release and immunity function . The DNA region involved in conjugal mobility promoted by R64 drd11 has been identified and we have demonstrated that the ColE1 mobility proteins can act in trans on the bom (basis of mobility) site of ColA . The location of this site, as well as the region involved in stable maintenance of ColA, have also been determined . These results are discussed with regard to the homology in nucleotide sequence between ColA and ColE1.

Biull Eksp Biol Med, 1988 Feb, 105(2), 191 - 4
{Molecular genetic study of the changes in the incompatibility and regulation of the transfer of the F-like pAP18-1 plasmid induced by nitrosoguanidine and the Tn5 and Tn9 transposons}; Shchipkov VP et al.; Relation between induced mutations of plasmid pAP18-1 (Tc, Col) and alterations in it's restriction map was studied . Nitrosoguanidine induced mutations of transfer regulation system and incompatibility of this plasmid related with alteration in the situation of recognition sites for restrictases EcoR1 and Sal1 in map positions 42.2-4.3 and 12.9-17.9 MD . Insertions of transposons Tn5 and Tn9 into the plasmid DNA resulted in a decrease of incompatibility level.

J Clin Microbiol, 1988 Feb, 26(2), 244 - 9
Novel densitometric method for endonuclease analysis of Escherichia coli DNA samples containing multiple plasmids; Takahashi S et al.; We developed a novel method whereby the digestion pattern of each plasmid was distinguished in a sample of endonuclease-digested plasmid DNAs which contained multiple plasmids extracted from a bacterial strain . This method consisted of two procedures . (i) The concentration ratio of each undigested plasmid DNA and of each digested DNA fragment was calculated on the basis of densitometric scanning of an electrophoretogram, and the concentration ratio was then compared with the theoretical concentration ratio to determine from which plasmid each fragment was generated . (ii) The second procedure involved rapid visual identification with a scanning graph . We thus analyzed five strains of Escherichia coli that harbored several cryptic plasmids . The two procedures made it possible to analyze the restriction digestion pattern of each plasmid without the need to isolate the individual plasmids, except in the case of certain fragments . Even when the digested patterns of these exceptional fragments could not be distinguished completely, however, our method had the advantage that peak patterns of plasmids could be compared visually among different bacterial strains.

Arch Biochem Biophys, 1988 Feb 1, 260(2), 577 - 84
Purification and characterization of glpQ-encoded glycerophosphodiester phosphodiesterase from Escherichia coli K-12; Larson TJ et al.; Periplasmic glycerophosphodiester phosphodiesterase (EC 3.1.4.2) of Escherichia coli was purified seven-fold to near homogeneity from the cold osmotic shock fraction of a strain harboring a multicopy plasmid carrying the glpQ gene . The enzyme had a minimum subunit molecular weight of 40,000 as assessed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis . The native size of the enzyme was 70,000 as assessed by gel filtration chromatography and 75,000 as assessed by nondenaturing gradient polyacrylamide gel electrophoresis, indicating that the native state of the enzyme is dimeric . The enzyme hydrolyzed the deacylation products of all glycerophospholipids tested including glycerophosphocholine, glycerophosphoethanolamine, glycerophosphoglycerol, glycerophosphoinositol, and glycerophosphoserine . The enzyme did not release glycerol or sn-glycerol 3-phosphate from phosphatidyl-DL-glycerol or lysophosphatidyl-DL-glycerol present in Triton X-100 micelles . The enzyme functioned optimally at pH 7.8 . The enzyme was totally inactivated by dilution into 1 mM ethylenediaminetetraacetate or ethylene glycol bis(beta-aminoethyl ether)-N,N-tetraacetic acid . Activity was restored by the addition of Ca2+ or Cd2+, and was partially restored by the addition of Mn2+ or Cu2+ . Co2+, Mg2+, Zn2+, and Fe2+ did not restore activity . The presence of calcium ions decreased the Km of the enzyme for the substrate, glycerophosphoglycerol, and increased the Vmax.

Proc Natl Acad Sci U S A, 1988 Feb, 85(4), 1023 - 7
Anaerobic induction of Escherichia coli formate dehydrogenase (hydrogenase-linked) is enhanced by gyrase inactivation; Axley MJ et al.; Escherichia coli synthesizes a hydrogenase-linked formate dehydrogenase (FDHH) under anaerobic conditions in the absence of nitrate . In striking contrast to many other anaerobic-specific genes, which require DNA to be negatively supercoiled for expression, we have found that inhibition of DNA gyrase activity enhances expression from the gene (fdhF) encoding the selenopolypeptide of FDHH . Fusions of the 5' flanking region of fdhF and the structural gene of lacZ were used to determine fdhF expression under varying conditions . Chemical inhibitors and a temperature-sensitive mutant allowed in vivo inhibition of gyrase activity . In each case, concomitant with gyrase inhibition there was a substantial increase in the induction of fusion protein synthesis . This enhancement of expression is observed for the intact fdhF gene residing on the chromosome as well as the fusion gene in a multicopy plasmid . Inhibition of gyrase activity will partially overcome the inhibition of fdhF expression due to nitrate but does not allow fusion protein synthesis in the presence of oxygen.

Proc Natl Acad Sci U S A, 1988 Feb, 85(3), 865 - 9
Gene transfer system for the phytopathogenic fungus Ustilago maydis; Wang J et al.; A selectable marker for transformation was constructed by transcriptional fusion of a Ustilago maydis heat shock gene promoter with the hygromycin B phosphotransferase gene of Escherichia coli . U . maydis was transformed to hygromycin B resistance by polyethylene glycol-induced fusion of spheroplasts following exposure to plasmid DNA that carried the marker gene . Transformation frequencies of 50 and 1000 transformants per microgram of DNA per 2 x 10(7) spheroplasts were obtained for circular and linear vector DNA, respectively . In the majority of transformants, the vector was integrated at a single chromosomal site, in either single copy or tandem duplication, as determined by Southern hybridization analysis of electrophoretically separated chromosomes and of restriction-endonuclease-cleaved DNA . The predominant form (82%) of vector integration was by nonhomologous recombination; the remainder carried the plasmid at the homologous heat shock gene locus . No evidence for gene conversion or gene replacement was obtained in 28 transformants . Hygromycin B phosphotransferase activity and resistance to hygromycin B were roughly correlated with the copy number of the integrated vector at the homologous location . Transforming DNA was stably maintained during mitosis and meiosis . This transformation procedure and associated vector should permit the cloning of genes by direct complementation in U . maydis.

J Bacteriol, 1988 Feb, 170(2), 852 - 8
Coordination of chromosome replication initiation in Escherichia coli: effects of different dnaA alleles; Skarstad K et al.; The synchrony of initiation of chromosomal replication in single cells was determined in ten different dnaA(Ts) mutants . After inhibiting the initiation of replication but allowing initiated rounds of replication to terminate, we measured the number of fully replicated chromosomes per individual cell by flow cytometry . Synchronous initiation at the several independent origins (oriC) in single rapidly growing cells would give 2'' (n = 0,1,2,3,...) chromosomes per cell, whereas asynchronous initiation was indicated by the presence of a different number of chromosomes . Mutations mapping in the central part of the dnaA gene (dnaA5, dnaA46, dnaA601, dnaA602, and dnaA604) lead to a high degree of asynchrony (class I mutants), whereas mutations mapping in either of the distal parts of the gene (dnaA508, dnaA167, dnaA203, and dnaA204) yielded a low degree of asynchrony at the permissive temperature (class 2 mutants) . The dnaA205 mutant exhibited an intermediate degree of asynchrony . Mutants dnaA203 and dnaA204 (promoter distal) differed from the other class 2 mutants (dnaA167, dnaA508; promoter proximal) in that asynchrony increased no more than twofold between 25 and 37 degrees C compared with the more-than-fourfold increase in the latter . The high degree of asynchrony in class 1 mutants was independent of temperature and was not due to insufficient functional DnaA protein, because overproduction of DnaA46 protein did not decrease the asynchrony . The data demonstrate that the DnaA protein has functions in addition to acting positively in the initiation process and negatively as its own repressor, namely in coordinating initiations at all oriC sites within a single cell.

J Bacteriol, 1988 Feb, 170(2), 775 - 80
Disruption of the Escherichia coli cls gene responsible for cardiolipin synthesis; Nishijima S et al.; The cls gene of Escherichia coli is responsible for the synthesis of a major membrane phospholipid, cardiolipin, and has been proposed to encode cardiolipin synthase . This gene cloned on a pBR322 derivative was disrupted by either insertion of or replacement with a kanamycin-resistant gene followed by exchange with the homologous chromosomal region . The proper genomic disruptions were confirmed by Southern blot hybridization and a transductional linkage analysis . Both types of disruptants had essentially the same properties; cardiolipin synthase activity was not detectable, but the strains grew well, although their growth rates and final culture densities were lower than those of the corresponding wild-type strains and strains with the classical cls-1 mutation . A disruptant harboring a plasmid that carried the intact cls gene grew normally . The results indicate that the cls gene and probably the cardiolipin synthase are dispensable for E . coli but may confer growth or survival advantages . Low but definite levels of cardiolipin were synthesized by all the disruptants . Cardiolipin content of the cls mutants depended on the dosage of the pss gene, and attempts to transfer a null allele of the cls gene into a pss-1 mutant were unsuccessful . We point out the possibilities of minor cardiolipin formation by phosphatidylserine synthase and of the essential nature of cardiolipin for the survival of E . coli cells.

J Bacteriol, 1988 Feb, 170(2), 757 - 68
Structure of the Caulobacter crescentus trpFBA operon; Ross CM et al.; The DNA sequences of the Caulobacter crescentus trpF, trpB, and trpA genes were determined, along with 500 base pairs (bp) of 5'-flanking sequence and 320 bp of 3'-flanking sequence . An open reading frame, designated usg, occurs upstream of trpF and encodes a polypeptide of 89 amino acids which seems to be expressed in a coupled transcription-translation system . Interestingly, the usg polypeptide is not homologous to any known tryptophan biosynthetic enzyme . S1 nuclease mapping of in vivo transcripts indicated that usg, trpF, trpB, and trpA are arranged into a single operon, with the transcription initiation site located 30 bp upstream from the start of usg . Sequences centered at -30 and -6 bp upstream from the transcription initiation site are somewhat homologous to the Escherichia coli promoter consensus sequence and are homologous to sequences found upstream of genes from several organisms which are evolutionarily related to C . crescentus . Furthermore, the trpFBA operon promoter sequence lacks homology to promoter sequences identified for certain developmentally regulated C . crescentus genes . The structures of the C . crescentus usg, trpF, trpB, and trpA genes were further analyzed in terms of codon usage, G+C content, and genetic signals and were related to genetic signals previously identified in C . crescentus and other bacteria . Taken together, these results are relevant to the analysis of gene expression in C . crescentus and the study of trp gene structure and regulation.

J Bacteriol, 1988 Feb, 170(2), 528 - 33
Isolation and characterization of OmpC porin mutants with altered pore properties; Misra R et al.; The LamB protein is normally required for the uptake of maltodextrins . Starting with a LamB- OmpF- strain, we have isolated mutants that will grow on maltodextrins . The mutation conferring the Dex+ phenotype in the majority of these mutants has been mapped to the ompC locus . These mutants, unlike LamB- OmpF- strains, grew on maltotriose and maltotetraose, but not on maltopentaose, and showed a significantly higher rate of {14C}maltose uptake than the parent strain did . In addition, these mutants showed increased sensitivity to certain beta-lactam antibiotics and sodium dodecyl sulfate, but did not exhibit an increase in sensitivity to other antibiotics and detergents . The nucleotide sequence of these mutants has been determined . In all cases, residue 74 (arginine) of the mature OmpC protein was affected . The results suggest that this region of the OmpC protein is involved in the pore domain and that the alterations lead to an increased pore size.

J Bacteriol, 1988 Feb, 170(2), 522 - 7
Cloning, characterization, and effects of overexpression of the Escherichia coli rnd gene encoding RNase D; Zhang JR et al.; RNase D is a 3'-exoribonuclease whose in vitro specificity has suggested that it is involved in the processing of tRNA precursors . Its in vivo role has remained unclear, however, because mutant cells devoid of the enzyme display no defect in growth or tRNA processing . To learn more about the structure and function of RNase D, we cloned the Escherichia coli rnd gene, which is thought to code for this enzyme . The rnd gene was isolated from a cosmid library based on elevated RNase D activity and was subcloned as a 1.4-kilobase-pair fragment in pUC18 . Maxicell analysis of the cloned fragment revealed that a single protein of approximately 40 kilodaltons, which is the size of RNase D, was synthesized . The rnd gene is present as a single copy on the E . coli chromosome and is totally absent in a deletion mutant . Cells that harbored the cloned rnd gene displayed RNase D activity that was elevated as much as 20-fold over that of the wild type . As growth of the culture progressed, however, RNase D specific activity declined dramatically, together with a similar decrease in plasmid copy number . In contrast, no decrease in copy number was observed with an inactive rnd gene . Placement of the rnd gene downstream from the lac promoter led to inducible RNase D overexpression and concomitantly slowed cell growth . These findings support the idea that rnd is the structural gene for RNase D and indicate that elevated RNase D activity is deleterious to E . coli.

J Bacteriol, 1988 Feb, 170(2), 1015 - 7
Confirmation of the Fur operator site by insertion of a synthetic oligonucleotide into an operon fusion plasmid; Calderwood SB et al.; We constructed a synthetic oligonucleotide corresponding to the previously proposed consensus binding site for the Fur protein, a central iron-regulatory protein of Escherichia coli . When this oligonucleotide was introduced at the start of transcription of an operon fusion between the ompF promoter and the lacZ structural gene, beta-galactosidase activity became iron regulated . This consensus sequence is sufficient to function as an operator site for the binding of Fur protein in vivo.

Exp Parasitol, 1988 Feb, 65(1), 69 - 83
Plasmodium falciparum: molecular analysis of a putative protective antigen, the thermostable 96-kDa protein; Bonnefoy S et al.; A group of three Plasmodium falciparum antigens of distinct pI, migrating with an apparent MW of 96 kDa has been previously identified as a target of protective immunity both in humans and in monkeys (Jouin et al . 1987, Dubois et al . 1987) . These antigens are produced during the late stages of asexual intraerythrocytic development . One of these 96-kDa proteins, the 96 tR, has a pI of 5.25, is thermostable, and is released in the culture supernatant (Jouin et al . 1987) . We report here the cloning and expression in Escherichia coli of the gene coding for this antigen . Antibodies raised to the recombinant 96 tR immunoprecipitated exclusively the 96 tR, indicating that the other two antigens of 96 kDa are the product(s) of distinct gene(s) . Northern and Southern blots as well as DNA sequencing of the gene showed that the 96 tR antigen is identical to proteins identified in other laboratories as the glycophorin binding protein GBP 130 (Perkins 1984, Ravetch et al . 1985) and Ag 78 (Bianco et al . 1987) . The 96-kDa antigen is produced at the trophozoite stage and more actively in the schizonts . It is released in the culture supernatant at the time of schizont rupture, together with two minor products, forming a characteristic triplet . This triplet was also detected in immunoblots of merozoites . An approximate quantification on immunoblots indicated that the largest proportion of the protein is found in the culture supernatant, a minor fraction being loosely associated with merozoites . By immunofluorescence and immunoelectron microscopy, intense signals were observed in the erythrocyte cytoplasm . The 50-amino acid repeats were found in all strains examined, the protein showing some size polymorphism . The antigen was detected in the serum of infected monkeys as well as in that of infected humans.

J Virol, 1988 Feb, 62(2), 367 - 75
High levels of genetic recombination among cotransfected plasmid DNAs in poxvirus-infected mammalian cells; Evans DH et al.; The frequency of recombination between transfected plasmid DNAs was measured by using cultured cells infected with a variety of poxviruses . Plasmid derivatives of pBR322 containing XhoI linker insertion mutations in the tetracycline gene were used to assess recombination frequencies in rabbit cells infected with the leporipoxviruses Shope fibroma virus and myxoma virus and the orthopoxvirus vaccinia virus . Recombination frequencies were calculated by Southern blotting, which detects novel plasmid restriction fragments generated by genetic recombination, and by a plasmid rescue procedure in which the reconstruction of an intact tetracycline gene in the transfected rabbit cell was monitored by transformation back into Escherichia coli . The highest recombination frequencies were measured in cells infected with Shope fibroma virus and myxoma virus, and a minimum recombination frequency of at least one recombination event per 7 kilobases was calculated within 24 h posttransfection under these conditions . The deduced recombination frequency in vaccinia virus-infected cells was at least fivefold lower and was not detectable in mock-infected cells, suggesting that the induced recombination activity detected by these methods was under viral control . The results of kinetic studies, analysis with methylation-sensitive restriction enzymes, and the use of phosphonoacetic acid, a specific inhibitor of poxvirus DNA polymerase, indicated that recombination between transfecting DNAs occurred concomitantly with DNA replication but that the two processes could be partially uncoupled . We conclude that the dramatic expansion of recombination activities in the cytoplasm of poxvirus-infected cells is virus specific and offers a good model system with which to analyze the mechanism of recombination in a eucaryotic environment.

J Biomol Struct Dyn, 1988 Feb, 5(4), 951 - 63
The 3' terminal colicin fragment of Escherichia coli 16S ribosomal RNA . Conformational details revealed by enzymic and chemical probing; Heus HA et al.; The conformation of the colicin fragment of E . coli 16S rRNA was probed with various nucleases and with the adenosine-specific reagent diethylpyrocarbonate (DEP) . The results confirm the presence of a stable central hairpin in the colicin fragment and a weaker additional secondary structure involving the regions 5' and 3' to this hairpin . By monitoring DEP accessibility at various stages of heat-denaturation sequential unfolding of individual base pairs was followed . In agreement with previous results it could be shown that dimethylation of the two adjacent adenosines in the hairpin loop (a feature in virtually all ribosomes) leads to a destabilization of the hairpin helix . Accessibilities of G residues, involved in the weaker additional secondary structure is anomalous . One G residue is sensitive to the single strand specific RNase T1 and insensitive to DEP, while the situation is reversed for the adjoining G residue . The strong reaction of the latter G-residue with DEP is unusual and indicates a very special conformation.

Mol Biochem Parasitol, 1988 Feb, 28(1), 21 - 30
Cloning and expression of Taenia ovis antigens in Escherichia coli; Howell MJ et al.; Double stranded DNA complementary to poly(A)+ mRNA from the tapeworm Taenia ovis was cut with Sau 3A to an average length of about 300 bp and inserted into the Bam HI site of the expression plasmids pEX1, pEX2 and pEX3 . These plasmids express a hybrid protein derived from a fusion of the cro gene with the lac Z gene (truncated at its 5' end by 53 bp) of phage lambda . Cloning sites lie downstream from the gene fusion . Escherichia coli infected with another plasmid (pCI857) bearing the temperature sensitive repressor of phage lambda was transformed with the pEX plasmids into which T . ovis DNA had been inserted; recombinants were selected by growth at 30 degrees C in the presence of ampicillin at 100 micrograms ml-1 . Replicas were made and hybrid protein expression induced in recombinants by transferring them to 42 degrees C . Several recombinants expressing antigenic determinants of T . ovis were detected with T . ovis infected sheep serum that had been absorbed to remove antibodies to E . coli . Of five selected for further study, three expressed hybrid proteins of between 165 and 170 kDa of which the T . ovis component contributed between 48 and 55 kDa; in the other two, the tapeworm contribution was between 0.5 and 1.5 kDa . These antigenic determinants may be of some interest with respect to vaccine development since they are expressed during the normal course of T . ovis infection in sheep, and they are also present in the oncosphere - the infective larva of the parasite which stimulates immunity in sheep . The native antigens in adult worms and oncospheres that correspond to the antigenic determinants produced by the recombinant clones comprise a number of species ranging from 92.5 to 180 kDa . Tests with affinity purified antibodies indicate that the expressed products of the clones represent different epitopes on the same subset of polypeptides in both adult worms and oncospheres.

J Interferon Res, 1988 Feb, 8(1), 95 - 103
Interferon production in leukocytes of spotted sousliks--effect of hibernation on the interferon response in vitro; Kandefer-Szerszen M; A comparative study of interferon (IFN) production (types alpha and gamma) was carried out using leukocytes from blood, spleen, and peritoneal cavity of sousliks (ground squirrels) active in summer, hibernating in winter, awakened from hibernation in winter, and hibernating in summer . Newcastle disease virus, Radom velogenic strain (NDV-R), and lipopolysaccharide from Escherichia coli (LPS) were used as inducers for IFN-alpha and phytohemagglutinin M (PHA) and concanavalin A (ConA) for IFN-gamma production . There were significant differences between the titers of IFN-alpha and IFN-gamma produced by leukocytes from sousliks hibernating in winter and in summer in comparison with titers of IFNs produced by cells of sousliks active in summer . Cells of hibernating spotted sousliks exhibited diminished IFN production . The IFN production in blood and peritoneal leukocytes of sousliks awakened from winter hibernation was also lower than that observed in cultures of leukocytes of sousliks active in summer, and higher when spleen leukocytes of sousliks awakened from hibernation were examined.

EMBO J, 1988 Feb, 7(2), 557 - 66
Control of ColE1 replication: low affinity specific binding of Rop (Rom) to RNAI and RNAII; Helmer-Citterich M et al.; We have studied the interactions between the three molecules Rop, RNAI and RNAII that are involved in the regulatory mechanism controlling the replication of ColE1 plasmids . We show that it is possible to purify the two RNA molecules by passing an RNA mixture through an affinity column containing Rop immobilized to a solid support . The dissociation constants of the Rop-RNAI and Rop-RNAII complexes are of the order of 10(-4) M, several orders of magnitude higher than dissociation constants of stable protein-nucleic acid complexes (10(-10) M in the lambda repressor system) . Although complete RNAI molecules have higher affinity, stem-and-loop I alone can also bind Rop, suggesting that this structure plays an important role in the interaction . Rop protects the stems of RNAI and RNAII from digestion by RNases while the sensitivity of the loops to digestion by RNase T1 is not affected by high concentrations of Rop . We propose a model for Rop-RNAI/RNAII interaction in which the dimeric protein acts as an adaptor between stem structures to position the two RNAs in the correct position for loop interaction.

Proc Natl Acad Sci U S A, 1988 Feb, 85(4), 1218 - 22
Expression of soluble, enzymatically active, human immunodeficiency virus reverse transcriptase in Escherichia coli and analysis of mutants; Hizi A et al.; We have constructed a plasmid that, when introduced into Escherichia coli, induces the synthesis of large quantities of a protein with an apparent molecular mass of 66 kDa that differs from human immunodeficiency virus (HIV) RNA-dependent DNA polymerase (deoxynucleoside-triphosphate:DNA deoxynucleotidyltransferase or reverse transcriptase, EC 2.7.7.49) only in that it has two additional amino-terminal amino acids . This protein is soluble in E . coli extracts, is active in reverse transcriptase assays, and shows inhibition profiles with dideoxy-TTP and dideoxy-GTP that are indistinguishable from the viral enzyme . The deletion of 23 amino-terminal or carboxyl-terminal amino acids or the insertion of 5 amino acids at position 143 substantially decreases the polymerizing activity of the HIV reverse transcriptase made in E . coli . The properties of a 51-kDa reverse transcriptase-related protein made in E . coli suggests that the p51 found in the virion probably does not have substantial polymerizing activity . The full-length HIV reverse transcriptase and the various mutant proteins produced in E . coli should be quite useful for structural and biochemical analyses as well as for the production of antibodies.

Proc Natl Acad Sci U S A, 1988 Feb, 85(3), 689 - 93
Use of a foreign epitope as a "tag" for the localization of minor proteins within a cell: the case of the immunity protein to colicin A; Geli V et al.; The immunity protein to colicin A (Cai), which is constitutively expressed at a very low level in Escherichia coli strains, has been studied in recombinant plasmid constructs allowing expression of various immunity fusion proteins under the control of inducible promoters . The 13-amino acid NH2-terminal region of Cai was substituted by polypeptides from beta-galactosidase or from colicin A . Upon induction of the chimeric proteins, the rate of expression of the immunity protein could be correlated to the level of resistance to colicin A . The immunity protein has been "tagged" with an epitope from the colicin A protein for which a monoclonal antibody is available . Using this technique, we have directly demonstrated that the immunity protein is located in the cytoplasmic membrane . The results indicate that the NH2-terminal region of Cai is directed toward the cytoplasm and is probably not required for Cai insertion into the membrane or for its function.

J Bacteriol, 1988 Feb, 170(2), 568 - 77
Cloning and characterization of the methyl coenzyme M reductase genes from Methanobacterium thermoautotrophicum; Bokranz M et al.; The genes coding for methyl coenzyme M reductase were cloned from a genomic library of Methanobacterium thermoautotrophicum Marburg into Escherichia coli by using plasmid expression vectors . When introduced into E . coli, the reductase genes were expressed, yielding polypeptides identical in size to the three known subunits of the isolated enzyme, alpha, beta, and gamma . The polypeptides also reacted with the antibodies raised against the respective enzyme subunits . In M . thermoautotrophicum, the subunits are encoded by a gene cluster whose transcript boundaries were mapped . Sequence analysis revealed two more open reading frames of unknown function located between two of the methyl coenzyme M reductase genes.

Biochem Biophys Res Commun, 1988 Jan 29, 150(2), 866 - 9
An oxygen enhancement ratio in an Escherichia coli strain lacking both the iron and manganese superoxide dismutases; Morse ML et al.; A mutant of Escherichia coli lacking both the iron and manganese superoxide dismutases, shows an oxygen effect and therefore the oxygen effect is not dependent directly upon the superoxide radical.

Biochem Biophys Res Commun, 1988 Jan 29, 150(2), 731 - 8
Probing of DNA polymorphic structure in the cell with osmium tetroxide; Palecek E et al.; It is shown that osmium tetroxide, 2,2'-bipyridine can be applied as a probe of DNA structure in a bacterial cell . Using this probe we demonstrate (a) presence of structural distortions at the junctions between the right-handed B and left-handed Z DNA in a recombinant plasmid pRW751 and (b) unusual structure of the d(A-T)16 insert in pAT32 plasmid in E . coli cells and in in vitro.

Biochem Biophys Res Commun, 1988 Jan 29, 150(2), 517 - 25
Differential enzymatic accessibilities of the 5' and 3' splice sites of beta-globin pre-messenger RNA in splicing competent HeLa cell nuclear extract; Siegall CB et al.; Inhibition of oligonucleotide-directed cleavage of pre-mRNA using exogenously added E . coli RNase H has been utilized as a probe for mRNA-protein interaction . We now show that such an RNase H-like activity is present in splicing competent Hela cell nuclear extract . Using this extract and in vitro transcribed beta-globin pre-mRNA, we have demonstrated that synthetic oligonucleotides, complementary to the splice site sequences, direct preferential cleavage of the 5' splice site . Thus, these experiments using complementary oligonucleotide-directed, endogenous RNase H-like cleavage of pre-mRNA, suggest a useful probe for studying the mRNA-protein complex in vitro.

Biochemistry, 1988 Jan 26, 27(2), 546 - 53
Mechanisms of error discrimination by Escherichia coli DNA polymerase I; el-Deiry WS et al.; The mechanism of base selection by DNA polymerase I of Escherichia coli has been investigated by kinetic analysis . The apparent KM for the insertion of the complementary nucleotide dATP into the hook polymer poly(dT)-oligo(dA) was found to be 6-fold lower than that for the noncomplementary nucleotide dGTP, whereas the Vmax for insertion of dATP was 1600-fold higher than that for dGTP . The ratio of Kcat/KM values for complementary and mismatched nucleotides of 10(4) demonstrates the extremely high specificity of base selection by DNA polymerase I and is in agreement with results obtained with a different template-primer, poly(dC)-oligo(dG) {El-Deiry, W . S., Downey, K . M., & So, A . G . (1984) Proc . Natl . Acad . Sci . U.S.A . 81, 7378} . Studies on the effects of phosphate ion on the polymerase and 3'- to 5'-exonuclease activities of DNA polymerase I showed that, whereas the polymerase activity was somewhat stimulated by phosphate, the exonuclease activity was markedly inhibited, being 50% inhibited at 25 mM phosphate and greater than 90% inhibited at 80 mM phosphate . Selective inhibition of the exonuclease activity by phosphate also resulted in inhibition of template-dependent conversion of a noncomplementary dNTP to dNMP and, consequently, markedly affected the kinetic constants for insertion of noncomplementary nucleotides . The mutagenic metal ion Mn2+ was found to affect error discrimination by both the polymerase and 3'- and 5'-exonuclease activities of DNA polymerase I.(ABSTRACT TRUNCATED AT 250 WORDS)

Biochemistry, 1988 Jan 26, 27(2), 752 - 9
Heparin cofactor II: cDNA sequence, chromosome localization, restriction fragment length polymorphism, and expression in Escherichia coli; Blinder MA et al.; Heparin cofactor II (HCII) is an inhibitor of thrombin in plasma that is activated by dermatan sulfate or heparin . An apparently full-length cDNA for HCII was isolated from a human liver lambda gt11 cDNA library . The cDNA consisted of 2215 base pairs (bp), including an open-reading frame of 1525 bp, a stop codon, a 3'-noncoding region of 654 bp, and a poly(A) tail . The deduced amino acid sequence contained a signal peptide of 19 amino acid residues and a mature protein of 480 amino acids . The sequence of HCII demonstrated homology with antithrombin III and other members of the alpha 1-antitrypsin superfamily . Blot hybridization of an HCII probe to DNA isolated from sorted human chromosomes indicated that the HCII gene is located on chromosome 22 . Twenty human leukocyte DNA samples were digested with EcoRI, PstI, HindIII, KpnI, or BamHI, and Southern blots of the digests were probed with HCII cDNA fragments . A restriction fragment length polymorphism was identified with BamHI . A slightly truncated form of the cDNA, coding for Met-Ala instead of the N-terminal 18 amino acids of mature HCII, was cloned into the vector pKK233-2 and expressed in Escherichia coli . The resultant protein of apparent molecular weight 54,000 was identified on an immunoblot with 125I-labeled anti-HCII antibodies . The recombinant HCII formed a complex with 125I-thrombin in a reaction that required the presence of heparin or dermatan sulfate.

Biochemistry, 1988 Jan 26, 27(2), 603 - 9
Structure-function relationships of the Escherichia coli ATP synthase probed by trypsin digestion; Gavilanes-Ruiz M et al.; Trypsin cleavage has been used to probe structure-function relationships of the Escherichia coli ATP synthase (ECF1F0) . Trypsin cleaved all five subunits, alpha, beta, gamma, delta, and epsilon, in isolated ECF1 . Cleavage of the alpha subunit involved the removal of the N-terminal 15 residues, the beta subunit was cleaved near the C-terminus, the gamma subunit was cleaved near Ser202, and the delta and epsilon subunits appeared to be cleaved at several sites to yield small peptide fragments . Trypsin cleavage of ECF1 enhanced the ATPase activity between 6- and 8-fold in different preparations, in a time course that followed the cleavage of the epsilon subunit . This removal of the epsilon subunit increased multisite ATPase activity but not unisite ATPase activity, showing that the inhibitory role of the epsilon subunit is due to an effect on cooperativity . The detergent lauryldimethylamine oxide was found to increase multisite catalysis and also increase unisite catalysis more than 2-fold . Prolonged trypsin cleavage left a highly active ATPase containing only the alpha and beta subunits along with two fragments of the gamma subunit . All of the subunits of ECF1 were cleaved by trypsin in preparations of ECF1F0 at the same sites as in isolated ECF1 . Two subunits, the beta and epsilon subunits, were cleaved at the same rate in ECF1F0 as in ECF1 alone . The alpha, gamma, and delta subunits were cleaved significantly more slowly in ECF1F0.(ABSTRACT TRUNCATED AT 250 WORDS)

Biochemistry, 1988 Jan 26, 27(2), 553 - 60
Beta subunit of rat liver mitochondrial ATP synthase: cDNA cloning, amino acid sequence, expression in Escherichia coli, and structural relationship to adenylate kinase; Garboczi DN et al.; The amino acid sequence of all but a few N-terminal residues of the beta subunit of rat liver ATP synthase has been determined from cDNA clones . Rat liver F1-beta is shown to contain 17 amino acid differences from that reported for F1-beta of bovine heart, 2 differences of which involve differences in charge . This may account in part for the observation that bovine heart F1 binds nucleotides with much greater affinity than the rat liver enzyme . Rat liver F1-beta also contains homologous regions with another nucleotide binding protein, adenylate kinase, for which high-resolution structural studies are available . Adjacent to one of these homologous regions is an eight amino acid stretch which bears striking homology to the phosphorylation region of the (Na+,K+)-ATPase . The combination of these two homology regions may constitute at least part of a nucleotide binding domain in F1-beta . Significantly, both rat liver and bovine heart beta contain these regions of homology, whereas the 17 amino acid differences between the two enzymes lie outside this region . The possibility of a second nucleotide binding domain which differs between the two enzymes is discussed . A cDNA clone containing all the regions of homology as well as 11 of the 17 amino acid differences between the bovine heart and rat liver beta subunits has been ligated into the bacterial expression vector pKK223-3 . After transformation of a protease-deficient strain of Escherichia coli, this cDNA clone is expressed as a 36-kilodalton protein.(ABSTRACT TRUNCATED AT 250 WORDS)

Biochemistry, 1988 Jan 26, 27(2), 570 - 5
Structure of M1 RNA as determined by psoralen cross-linking; Lipson SE et al.; The RNA moiety of ribonuclease P from Escherichia coli (M1 RNA) has been photoreacted with 4'-(hydroxymethyl)-4,5',8-trimethylpsoralen (HMT) and long-wave UV light (320-380 nm) in a buffer containing 60 mM Mg2+, where the RNA moiety acts as a true catalyst of tRNA processing . Limited specific digestion and two-dimensional gel electrophoresis yield fragments cross-linked by HMT . By photoreversal of the isolated cross-linked fragments and enzymatic sequencing of the fragments, the positions of the cross-links have been elucidated . This method allows us to locate the cross-link to +/- 15 nucleotides . Further assignments of the exact locations of the cross-links have been made on the basis of the known photoreactivity of the psoralen with different bases . Nine unique cross-links have been isolated in the M1 RNA including four long-range interactions . The short-range interactions are discussed here in detail.

Nucleic Acids Res, 1988 Jan 25, 16(2), 703 - 17
High level expression and purification of HhaI methyltransferase; Wu JC et al.; A cloning system for the DNA-(cytosine-5)-methyltransferase MHhaI and high level expression of the enzyme are described . A parent plasmid was constructed from fragments of the MHhaI gene and synthetic oligonucleotides . The construct permits introduction of various restriction sites for cloning at precise positions near the initiation codon, and beyond the termination codon . The entire MHhaI coding sequence was introduced as a 1042 b.p . NdeI-XbaI fragment into the vector pAR3040 which contains the T7 RNA polymerase promoter . The resultant plasmid pTNX3 (MHhaI-pAR3040) was introduced into McrB- E . coli strains HB101 and GM2929, and expression of MHhaI was induced by infection with the lambda phage CE6 carrying the T7 RNA polymerase gene . In induced cells, catalytically active MHhaI was produced at a level that corresponds to about 8% of the total soluble protein; an insoluble form of the protein was also formed, but could be readily removed . The expressed soluble enzyme from HB101/pTNX3 was purified to apparent homogeneity in about 50% yield by a two-step chromatographic procedure involving DEAE-cellulose and Heparin-Sepharose; a one liter culture gave about 2.5 mg of pure enzyme . The molecular weight and kinetic properties of the expressed protein are identical to those reported for the authentic MHhaI, and its amino terminal sequence agrees with that predicted from the DNA sequence.

Nucleic Acids Res, 1988 Jan 25, 16(2), 425 - 38
Characterization and heterospecific expression of cDNA clones of genes in the maize GSH S-transferase multigene family; Grove G et al.; We have isolated from a constructed lambda gt11 expression library two classes of cDNA clones encoding the entire sequence of the maize GSH S-transferases GST I and GST III . Expression of a full-length GST I cDNA in E . coli resulted in the synthesis of enzymatically active maize GST I that is immunologically indistinguishable from the native GST I . Another GST I cDNA with a truncated N-terminal sequence is also active in heterospecific expression . Our GST III cDNA sequence differs from the version reported by Moore et al . {Moore, R . E., Davies, M . S., O'Connell, K . M., Harding, E . I., Wiegand, R . C., and Tiemeier, D . C . (1986) Nucleic Acids Res . 14:7227-7235} in eight reading frame shifts which result in partial amino acid sequence conservation with the rat GSH S-transferase sequences . The GST I and GST III sequences share approximately 45% amino acid sequence homology . Both the GST I and the GST III mRNAs contain different repeating motifs in front of the initiation codon ATG . Multiple poly(A) addition sites have been identified for these two classes of maize GSH S-transferase messages . Genomic Southern blotting results suggest that both GST I and GST III are present in single or low copies in the maize (GT112 RfRf) genome.

Nucleic Acids Res, 1988 Jan 25, 16(2), 413 - 24
Mechanism of autonomous control of the Escherichia coli F plasmid: purification and characterization of the repE gene product; Masson L et al.; E protein, the 29 Kd repE gene product, is essential for the replication of the Escherichia coli F plasmid . The repE gene has been cloned and expressed in an inducible ATG-fusion vector, and the protein product has been purified to homogeneity . The purified E protein is present as a dimer in solution and binds specifically to both the 19-bp direct repeats (incB) found within the mini-F origin of replication ori2 and the repE operator DNA . Examination of the amino acid sequence of E protein revealed a consensus sequence for DNA binding.

J Biol Chem, 1988 Jan 25, 263(3), 1518 - 23
3' processing of tRNA precursors in ribonuclease-deficient Escherichia coli . Development and characterization of an in vitro processing system and evidence for a phosphate requirement; Cudny H et al.; In order to determine the mechanism and enzyme(s) responsible for 3' processing of tRNA precursors, we have developed an in vitro processing system that uses as substrates two SP6 RNA polymerase-generated transcripts of the gene for tRNA(Tyrsu3)+ that contain 49 extra 5'-nucleotides and either 5 or 25 extra 3'-nucleotides . A high speed supernatant fraction from an Escherichia coli strain deficient in five ribonucleases was found to accurately process both tRNA precursors in this system to the size of mature tRNA(Tyr) . Final 3' end processing of each precursor occurs in an exonucleolytic manner to generate the correct 3' terminus; however, a prior endonucleolytic cleavage also is observed in processing of the longer precursor . The system requires Mg2+ and works optimally at about 50 mM KCl and pH 8-9 . Dialysis of the supernatant fraction leads to loss of processing activity but can be restored to normal by the addition of inorganic phosphate or arsenate . Furthermore, nucleoside diphosphates are a product of the processing reaction . These data indicate that 3' processing in RNase-deficient extracts involves a phosphorolytic reaction . On the other hand, phosphate is not required for processing in RNase+ extracts, although it does aid in processing of the longer precursor . The usefulness of this in vitro system for studies of tRNA processing and the identity of the phosphate-requiring enzyme are discussed.

J Biol Chem, 1988 Jan 25, 263(3), 1307 - 13
Recombinant human parathyroid hormone synthesized in Escherichia coli . Purification and characterization; Rabbani SA et al.; Recombinant human parathyroid hormone (hPTH) was expressed in Escherichia coli harboring a plasmid containing a synthetic human parathyroid hormone gene under the control of the E . coli lac promoter . Three major forms of the hormone were isolated by acid extraction and purified to homogeneity by high performance liquid chromatography . By amino acid analysis and NH2-terminal sequencing, these were identified as hPTH-(1-84), formyl-methionyl-hPTH-(1-84), and hPTH-(8-84) . The recombinant hPTH-(1-84) was immunologically indistinguishable from a World Health Organization standard of extracted native hPTH-(1-84) . Recombinant hPTH-(1-84) was also bioactive in renal and skeletal adenylate cyclase assays . In the skeletal bioassay performed in UMR 108 osteosarcoma cells its activity was identical to that of an hPTH-(1-84) standard . In this bioassay, formyl-methionyl-hPTH-(1-84) had 10% of the activity of hPTH-(1-84) and hPTH-(8-84) was inactive . The results demonstrate the importance of isolating hPTH-(1-84) from other recombinant forms and metabolites to achieve full hormonal bioactivity and indicate that purified recombinant hPTH-(1-84) can thereby be obtained which should be a useful source of hormone for both basic and clinical studies.

Biochim Biophys Acta, 1988 Jan 25, 949(1), 97 - 109
Studies on ras proteins . Catalytic properties of normal and activated ras proteins purified in the absence of protein denaturants; Satoh T et al.; Normal (Gly12) and activated (Val12) Ha-ras proteins were produced in Escherichia coli, and purified to an apparent homogeneity without using any protein denaturants . The purified proteins contained an equimolar amount of GDP . They were stable in the presence of 5 mM Mg2+ and 25% (v/v) glycerol when incubated at 60 degrees C for 5 min . The binding of GDP to the protein was greatly stabilized by Mg2+ . In the presence of 10 mM Mg2+, the bound GDP hardly exchanged with external guanine nucleotides, even at 30 degrees C . The exchange reaction was markedly enhanced in the presence of 10 mM EDTA or 120 mM ammonium sulfate . The rate-limiting step of the exchange reaction was the dissociation of the bound GDP from the ras protein, and this step was facilitated 40- to 100-fold by the addition of EDTA or ammonium sulfate . The dissociation rate of the normal (Gly12) ras protein was 2- to 3-fold faster than that of the activated (Val12) protein . The dissociation constants (Kd) for GDP of the normal and activated ras proteins were 1.2 X 10(-8) and 3.1 X 10(-9) M, respectively . The overall turnover rate of GTPase activity of the normal ras protein (10.8 mmol.mol-1.min-1) was about 10-fold higher than that of the activated protein (1.1 mmol.mol-1.min-1) in the absence of Mg2+ (less than 10(-8) M).

Biochim Biophys Acta, 1988 Jan 25, 949(1), 16 - 26
Circular intermediates with missing nucleotides in the conversion of supercoiled or nicked circular to linear duplex DNA catalyzed by two species of BAL 31 nuclease; Przykorska AK et al.; The extracellular nucleases from Alteromonas espejiana BAL 31 can catalyze the endonucleolytic and/or exonucleolytic hydrolysis of duplex DNA in response to a variety of alterations, either covalent or noncovalent, in DNA structure . The nuclease can exist as at least two kinetically and molecularly distinct protein species . The two species that have been studied, called the 'fast' (F) and 'slow' (S) nucleases, both readily convert negatively supercoiled DNAs to linear duplex molecules and accomplish this conversion through the formation of a circular duplex intermediate containing usually a single interruption in one strand . It is further shown that most of these intermediates contain gaps arising from the removal in a processive manner of one or more nucleotide residues after the introduction of the initial strand break (nick) . Considering only the intermediates with gaps, the average number of missing residues is 6.3 +/- 0.5 and 2.8 +/- 0.3, respectively, for DNA acted upon by the F and S enzymes independently of the extent of conversion of supercoiled DNA . The nicks and gaps are bounded by 3'-hydroxyl and 5'-phosphoryl termini . When singly nicked circular DNA is used as the substrate, conversion to the linear duplex form occurs predominantly through a gapped circular intermediate with the same average numbers, within experimental error, of missing nucleotides for the respective nuclease species as found when supercoiled DNA is the substrate . The conversion to linear duplex DNA is much slower when nicked circular DNA is the substrate compared to that found when supercoiled DNA is the starting material.

J Biol Chem, 1988 Jan 25, 263(3), 1320 - 4
Site-directed mutagenesis of a residue located in the regulatory site of Escherichia coli aspartate transcarbamoylase . Involvement of lysine 94 in effector binding and the allosteric mechanism; Zhang Y et al.; Lysine 94 in the regulatory chain of aspartate transcarbamoylase has been changed to a glutamine residue by site-directed mutagenesis . The resulting enzyme is almost insensitive to the activator ATP and shows a substantially reduced response to the feedback inhibitor CTP . Competition experiments indicate that ATP is still able to bind at low concentrations to the regulatory site of the mutant enzyme, even though no stimulation could be detected . When the nucleosides adenosine or cytidine were used, the saturation curves of the mutant and the wild-type enzyme became indistinguishable . Together these results indicate that lysine 94 is strongly involved in the binding of ATP and CTP by interacting specifically with the triphosphate moiety of these nucleotide effectors . Furthermore, unlike the wild-type enzyme, the inhibitory and stimulatory effects in the mutant enzyme are insensitive to changes in aspartate concentrations, implying that the lysine 94 side chain is also involved in the allosteric mechanism of the enzyme.

FEBS Lett, 1988 Jan 25, 227(2), 131 - 5
Purification and characterization of a lipocortin-like 33 kDa protein from guinea pig neutrophils; Sato EF et al.; A lipocortin-like, phospholipase A2 inhibitory 33 kDa protein was purified from guinea pig neutrophils . From amino acid composition and sequence data, this protein was found to have a high degree of homology to human lipocortin I . This protein inhibited porcine pancreatic phospholipase A2 activity in the presence of {3H}oleic acid-labeled Escherichia coli membranes as substrate . Maximal inhibition amounted to 65% whereas 50% inhibition occurred at 83.5 nM . This protein showed F-actin-binding ability in a Ca2+-dependent manner.

J Biol Chem, 1988 Jan 25, 263(3), 1524 - 9
Purification and properties of the phosphorylated form of guanylate cyclase; Ramarao CS et al.; Guanylate cyclase is dephosphorylated in response to the interaction of egg peptides with a spermatozoan surface receptor (Suzuki, N., Shimomura, H., Radany, E . W., Ramarao, C . S., Ward, G . E., Bentley, J . K., and Garbers, D . L . (1984) J . Biol . Chem . 259, 14874-14879) . Here, the phosphorylated form of guanylate cyclase was purified to apparent homogeneity from detergent-solubilized spermatozoan membranes by the use of GTP-agarose, DEAE-Sephacel, and concanavalin A-Sepharose chromatography . To prevent dephosphorylation of the enzyme during purification, glycerol (35%) was required in all buffers . Following purification, a single protein-staining band of Mr 160,000 was obtained on sodium dodecyl sulfate-polyacrylamide gels . The final specific activity of the purified enzyme was 83 mumol of cyclic GMP formed/min/mg of protein at 30 degrees C, an activity 5-fold higher than that observed with the purified, dephosphorylated form of guanylate cyclase . A preparation containing protein phosphatase from spermatozoa, or highly purified alkaline phosphatase (from Escherichia coli), catalyzed the dephosphorylation of the enzyme; this resulted in a subsequent decrease in guanylate cyclase activity and a shift in the Mr from 160,000 to 150,000 . The phosphate content of the high Mr form of the enzyme was 14.6 mol/mol protein whereas the phosphate content of the low Mr form was 1.6 mol/mol protein . All phosphate was localized on serine residues . The Mr 160,000 form of guanylate cyclase demonstrated positive cooperative kinetics with respect to MnGTP while the Mr 150,000 form displayed linear, Michaelis-Menten type kinetics . The phosphorylation state of the membrane form of guanylate cyclase, therefore, appears to dictate not only the absolute activity of the enzyme but also the degree of cooperative interaction between catalytic or GTP-binding sites.

FEBS Lett, 1988 Jan 25, 227(2), 103 - 6
The 5'-CA DNA-sequence preference of daunomycin; Skorobogaty A et al.; The DNA-sequence specificity of daunomycin was investigated by DNase I footprinting and an E . coli RNA polymerase transcription-inhibition assay . The 5'-CA sequence was identified as being the highest affinity binding site, although other modest affinity (5'-GC, CG, CT, TC, AC) and poor affinity sites (5'-AA, AT, TA) were also observed . The preference of daunomycin for 5'-CA nucleotide sequence suggests that its biological activity may arise from association with the 5'-CA-containing sequences thought to be associated with genetic regulatory elements in eukaryotes.

J Biol Chem, 1988 Jan 25, 263(3), 1584 - 92
A membrane-bound diacylglycerol kinase that selectively phosphorylates arachidonoyl-diacylglycerol . Distinction from cytosolic diacylglycerol kinase and comparison with the membrane-bound enzyme from Escherichia coli; MacDonald ML et al.; The membrane-bound diacylglycerol kinase from Swiss 3T3 cells (M-DG kinase) was characterized with a mixed micellar assay system, and compared with the cytosolic diacylglycerol kinase from 3T3 cells and with the membrane-bound diacylglycerol kinase from Escherichia coli . M-DG kinase selectively phosphorylated arachidonoyl-diacylglycerols, at a rate 2- to 8-fold higher than that for other naturally occurring long-chain diacylglycerols . In contrast, the cytosolic 3T3 enzyme exhibited little or no selectivity among long-chain diacylglycerols but had higher activity with more soluble substrates such as 1,2-didecanoylglycerol . Comparison of the properties of M-DG kinase with those of the bacterial membrane-bound enzyme revealed that selectivity for arachidonoyl-diacylglycerol was unique to the mammalian enzyme . All three kinases were activated by phosphatidylserine, but activation did not alter the arachidonoyl selectivity of M-DG kinase . Phosphatidylserine activated M-DG kinase by increasing Vm and decreasing the apparent Km for diacylglycerol . High concentrations of diacylglycerol reduced the Ka for phosphatidylserine, but did not abolish the phosphatidylserine requirement for maximum activity . Examination of the thermal lability of M-DG kinase revealed that this enzyme was rapidly and selectively inactivated by preincubation with its preferred substrate . This novel effect may have obscured previous attempts to discern substrate selectivity . Taken together, the results provide evidence that M-DG kinase is an arachidonoyl-diacylglycerol kinase that may participate in the formation of arachidonoyl-enriched species of phosphatidylinositol.

J Biol Chem, 1988 Jan 25, 263(3), 1494 - 9
The purification and properties of deoxyguanosine triphosphate triphosphohydrolase from Escherichia coli; Seto D et al.; Deoxyguanosine triphosphate (dGTP) triphosphohydrolase (EC 3.1.5.1) has been purified approximately 16,000-fold to apparent homogeneity from extracts of Escherichia coli . The enzyme has a native molecular weight of 230,000 and a sedimentation coefficient of 9.3 S . Its subunit molecular weight derived from electrophoresis in denaturing polyacrylamide gels is 58,900, and it has a unique N-terminal sequence for the first 25 amino acids, which indicate that the native enzyme is composed of 4 homologous subunits . It is insensitive to sulfhydryl reagents and EDTA and can be heated to 60 degrees C for 60 min without loss of activity . The enzyme requires Mg2+ for activity, is highly specific for dGTP among the canonical deoxynucleoside triphosphates, and has a unique activity among nucleoside triphosphatases in that the products of the reaction are deoxyguanosine and inorganic tripolyphosphate . Preliminary evidence suggest that this enzyme is responsible for the optA mutant phenotype first described by Saito and Richardson (Saito, H., and Richardson, C.C . (1981) J . Virol . 37, 343-351).

J Biol Chem, 1988 Jan 25, 263(3), 1182 - 7
Porin channels in intact cells of Escherichia coli are not affected by Donnan potentials across the outer membrane; Sen K et al.; Donnan potential (interior negative) across the outer membrane of Escherichia coli was measured by the distribution of {14C}choline in a mutant with a deletion through the genes for the active transport of choline . Calculation showed that the presence of membrane-derived oligosaccharides in the periplasm could quantitatively explain the magnitude of the Donnan potential and the periplasmic volume . By measuring the permeability of porin channels in intact cells suspended in solutions of widely different ionic strengths, it was shown that changing Donnan potential from 5 mV to approximately 100 mV had no effect on the permeability of either OmpF or OmpC porin channel toward a zwitterionic compound, cephaloridine . Thus, the "voltage-dependent gating" of porin channel, previously reported from another laboratory, is likely to be an artifact of in vitro reconstitution . The influx of negatively charged compounds, however, was affected by the Donnan potential as expected from the electrolyte diffusion theory.

J Mol Biol, 1988 Jan 20, 199(2), 277 - 93
Interaction of Escherichia coli RNA polymerase with DNA in an elongation complex arrested at a specific psoralen crosslink site; Shi YB et al.; We have probed the interaction of Escherichia coli RNA polymerase with DNA in an elongation complex arrested by a site-specifically placed psoralen crosslink using DNase I footprinting techniques . The psoralen derivative 4'-hydroxymethyl-4,5',8-trimethylpsoralen was first placed at a specific site in the middle of a chemically synthesized double-stranded DNA fragment containing an E . coli RNA polymerase promoter at one end . The psoralen molecule was photochemically attached to two adjacent thymidine residues on opposite strands as a diadduct . Using this crosslinked DNA as the template for transcription, we found that the E . coli RNA polymerase was blocked at the psoralen diadduct, yielding a transcript 29 nucleotides long . The arrested elongation complex inhibited DNase I digestion of both the coding strand and the non-coding strand from about 22 nucleotides upstream to 15 nucleotides downstream from the diadduct . These results, which suggest that the unwindase and the catalytic sites of the polymerase are very close to each other, have been incorporated into a model of the transcription elongation complex.

Mol Biochem Parasitol, 1988 Jan 15, 27(2-3), 249 - 56
Expression of an enzymatically active parasite molecule in Escherichia coli: Schistosoma japonicum glutathione S-transferase; Smith DB et al.; The NH2-terminal amino acid sequence of the Mr 26 000 glutathione S-transferase (EC 2.5.1.18) of Schistosoma japonicum (Sj26) has been deduced by RNA and protein sequence analysis . Using this information, a bacterial plasmid has been constructed that directs the synthesis of the entire Sj26 molecule in Escherichia coli . Recombinant Sj26 exhibits glutathione S-transferase activity and can be readily purified from bacteria in a one-step procedure under non-denaturing conditions . The availability of recombinant Sj26 in essentially unlimited quantities will aid its assessment as a candidate vaccine molecule in schistosomiasis and could eventually lead to the rational design of a drug targetted on schistosome glutathione S-transferases.

Biochem J, 1988 Jan 15, 249(2), 613 - 6
Nucleotide sequence for the hemD gene of Escherichia coli encoding uroporphyrinogen III synthase and initial evidence for a hem operon; Jordan PM et al.; 1 . The hemD gene, encoding uroporphyrinogen III synthase, has been located adjacent to the hemC gene at 85 min on the Escherichia coli chromosome . 2 . The entire nucleotide sequence (741 base pairs) of the hemD gene is reported . 3 . E . coli strains harbouring plasmics containing the hemD gene produce greatly elevated levels of uroporphyrinogen III synthase . 4 . Purified uroporphyrinogen III synthase, isolated from the hemD-containing strain ST1046, has an Mr of 29,000, in close agreement with that predicted from the nucleotide sequence . 5 . The existence of a hem operon is suggested.

Biochem J, 1988 Jan 15, 249(2), 319 - 26
Sequencing and overexpression of the Escherichia coli aroE gene encoding shikimate dehydrogenase; Anton IA et al.; The Escherichia coli aroE gene encoding shikimate dehydrogenase was sequenced . The deduced amino acid sequence was confirmed by N-terminal amino acid sequencing and amino acid analysis of the overproduced protein . The complete polypeptide chain has 272 amino acid residues and has a calculated Mr of 29,380 . E . coli shikimate dehydrogenase is homologous to the shikimate dehydrogenase domain of the fungal arom multifunctional enzymes and to the catabolic quinate dehydrogenase of Neurospora crassa.

Eur J Biochem, 1988 Jan 15, 171(1-2), 301 - 5
Association of glyceraldehyde-3-phosphate dehydrogenase with mono- and polyribosomes of rabbit reticulocytes; Ryazanov AG et al.; It has been shown recently that glyceraldehyde-3-phosphate dehydrogenase (GAPD) is one of the three major RNA-binding proteins of rabbit reticulocytes {Ryazanov, A . G . (1985) FEBS Lett . 192, 131-134} . It was suggested that, due to its RNA-binding capacity, GAPD can form loose dynamic complexes with polyribosomes . This communication reports that a considerable amount of GAPD activity can be found in the mono- and polyribosome fraction after sucrose gradient centrifugation of rabbit reticulocyte lysate . An increase of ionic strength, as well as the addition of exogenous RNA to the extract, result in the removal of GAPD from the complex with mono- and polyribosomes . It appears that GAPD forms the complex with polyribosomes due to the interaction with some exposed RNA regions of these structures . Although the interaction of GAPD with ribosomes is weak, it can be detected under physiological ionic conditions by the difference boundary sedimentation velocity technique . Association of GAPD with mono- and polyribosomes can be prevented by a low concentration (10 microM) of NADH, but not NAD+ . A nitrocellulose filter binding assay also shows that NADH has a stronger inhibitory effect on the enzyme-RNA complex formation, as compared with NAD+ . We propose that the RNA-mediated association of GAPD with mono- and polyribosomes can provide compartmentation of the energy-supplying system on these structures within the cell . This can maintain a high local concentration of ATP and GTP near the sites of protein synthesis.

J Biol Chem, 1988 Jan 15, 263(2), 868 - 77
Valyl-tRNA synthetase gene of Escherichia coli K12 . Primary structure and homology within a family of aminoacyl-TRNA synthetases; Heck JD et al.; The DNA nucleotide sequence of the valS gene encoding valyl-tRNA synthetase of Escherichia coli has been determined . The deduced primary structure of valyl-tRNA synthetase was compared to the primary sequences of the known aminoacyl-tRNA synthetases of yeast and bacteria . Significant homology was detected between valyl-tRNA synthetase of E . coli and other known branched-chain aminoacyl-tRNA synthetases . In pairwise comparisons the highest level of homology was detected between the homologous valyl-tRNA synthetases of yeast and E . coli, with an observed 41% direct identity overall . Comparisons between the valyl- and isoleucyl-tRNA synthetases of E . coli yielded the highest level of homology detected between heterologous enzymes (19.2% direct identity overall) . An alignment is presented between the three branched-chain aminoacyl-tRNA synthetases (valyl- and isoleucyl-tRNA synthetases of E . coli and yeast mitochondrial leucyl-tRNA synthetase) illustrating the close relatedness of these enzymes . These results give credence to the supposition that the branched-chain aminoacyl-tRNA synthetases along with methionyl-tRNA synthetase form a family of genes within the aminoacyl-tRNA synthetases that evolved from a common ancestral progenitor gene.

J Biol Chem, 1988 Jan 15, 263(2), 857 - 67
Valyl-tRNA synthetase gene of Escherichia coli K12 . Molecular genetic characterization; Heck JD et al.; We report the subcloning and characterization of the molecular elements necessary for the expression of the Escherichia coli valS gene which encodes the enzyme valyl-tRNA synthetase (EC 6.1.1.9) . The valS gene was subcloned from the Clarke-Carbon plasmid pLC26-22 by genetic complementation of the valS temperature-sensitive mutant strain, AB4141 . The protein-coding region of the valS structural gene was determined by in vitro DNA directed coupled transcription-translation assays . Assays of cellular extracts of cells transformed with a plasmid containing a full length copy of the valS gene enhanced in vivo valyl-tRNA synthetase-specific activity 12-fold . The DNA sequences of the 5'- and 3'-terminal regions of the valS structural gene are presented . The transcription initiation sites of the valS gene were determined, in vivo and in vitro, by S1 nuclease protection studies, primer-extension analysis and both alpha-32P labeled and gamma-32P-end-labeled in vitro transcription assays . In vivo, valS transcription initiates from tandem overlapping promoters separated by seven nucleotides . In vitro, only the upstream promoter is active . The presence of several regions of hyphenated dyad symmetry overlapping the tandem promoter region are noted . The valS translational start codon (AUG) is located 93 base pairs downstream from the major transcription initiation site . The valS transcriptional unit encodes only the valyl-tRNA synthetase gene since the 3' terminus of the amino acid-coding region of this gene is followed closely (26 base pairs) by an efficient rho-independent transcription termination site.

J Biol Chem, 1988 Jan 15, 263(2), 1013 - 6
Overproduction and rapid purification of the biotin operon repressor from Escherichia coli; Buoncristiani MR et al.; The Escherichia coli biotin operon repressor protein (BirA) has been overexpressed at the level of 0.5-1% of the total cellular protein from the plasmid pMBR10 . Four lines of evidence demonstrated that authentic BirA protein was produced . First, birA plasmids complemented birA mutants for both the repressor and biotin holoenzyme synthetase activities of BirA . Second, biotin holoenzyme synthase activity was increased in strains containing the overproducing plasmids . Third, deletion of sequences flanking the birA gene did not alter production of the 35-kDa BirA protein, but insertion of oligonucleotide linkers within the birA coding region abolished it . Fourth, the 35-kDa protein copurified with the biotin binding activity normally associated with BirA . The birA protein has been purified to homogeneity in a three-step process involving chromatography on phosphocellulose and hydroxyapatite columns.

J Biol Chem, 1988 Jan 15, 263(2), 1008 - 12
Interaction of OmpR, a positive regulator, with the osmoregulated ompC and ompF genes of Escherichia coli . Studies with wild-type and mutant OmpR proteins; Mizuno T et al.; The OmpR protein is a positive regulator involved in osmoregulatory expression of the ompC and ompF genes that specify the major outer membrane proteins OmpC and OmpF, respectively . We purified the OmpR protein not only from wild-type cells but also from two ompR mutants (ompR2 and ompR3) exhibiting quite different phenotypes as to osmoregulation of the ompC and ompF genes . The OmpR2 protein has an amino acid conversion in the C-terminal portion of the OmpR polypeptide, whereas the OmpR3 protein has one in the N-terminal portion . Comparative studies on these purified OmpR proteins were carried out in terms of their interaction with the ompC and ompF promoters . The nucleotide sequences involved in OmpR-binding were determined in individual promoter regions by deoxyribonuclease I footprinting . The OmpR3 protein as well as the wild-type OmpR protein appeared to bind, to similar extents, to both the ompC and ompF promoters . In contrast, the OmpR2 protein bound preferentially to the ompF promoter and failed to protect the ompC promoter against DNAse I digestion . These results support the view that the C-terminal portion of the OmpR protein is responsible for the binding of the OmpR protein to the ompC and ompF promoter DNAs . Based on these results, the structure and function of the OmpR protein are discussed in relation to the mechanism of osmoregulation.

Eur J Biochem, 1988 Jan 15, 171(1-2), 137 - 41
Expression in Escherichia coli and characterization of human growth-hormone-releasing factor; Villa S et al.; A chemically synthesized DNA sequence, coding for the 44 amino acid residues of human growth-hormone-releasing factor (GRF) preceded by a tryptophan codon, was cloned in frame with Escherichia coli trpE gene within a pBR322-derived plasmid . GRF was expressed in E . coli as a fused polypeptide chain (TrpE-GRF) and then the GRF amino acid sequence was released from the fused protein by specific chemical cleavage at the tryptophan residue using o-iodosobenzoic acid . The thioether group of the methionine residue of GRF was converted in the sulfonium salt derivative, in order to prevent irreversible oxidation of methionine to the sulfone derivative by the o-iodosobenzoic acid reagent . GRF was purified by HPLC and characterized in terms of amino acid composition after acid hydrolysis, protein sequencing and gel electrophoretic behaviour . These data clearly established that the biosynthetic GRF was identical to the natural one, except for the lack of amidation at the carboxyl-terminal amino acid . Far-ultraviolet circular dichroism measurements established that both biosynthetic and natural GRF are devoid of secondary structure in aqueous solution at neutral pH, whereas both peptide samples achieve a high percentage of helical structure in the presence of trifluoroethanol.

Biochem Biophys Res Commun, 1988 Jan 15, 150(1), 156 - 62
Thioredoxin fragment 31-36 is reduced by dihydrolipoamide and reduces oxidized protein; Spector A et al.; The thioredoxin peptide Trp-Cys-Gly-Pro-Cys-Lys, which contains the redox active dithiol, was found to be reduced by lipoamide in a coupled reaction with lipoamide dehydrogenase and NADH . The reduced peptide in turn was shown to reduce insulin, oxidized lens protein and glyceraldehyde-3-phosphate dehydrogenase . While the peptide is not as effective a catalyst for utilizing pyridine nucleotides to reduce protein disulfides as thioredoxin, it offers a system which may be developed to provide more efficient disulfide reduction . This is particularly relevant since no thioredoxin peptides have been found to be active with thioredoxin reductase.

J Biol Chem, 1988 Jan 15, 263(2), 735 - 9
5-Enolpyruvyl shikimate 3-phosphate synthase from Escherichia coli . Identification of Lys-22 as a potential active site residue; Huynh QK et al.; 5-Enolpyruvyl shikimate 3-phosphate synthase catalyzes the reversible condensation of phosphoenolpyruvate and shikimate 3-phosphate to yield 5-enolpyruvyl shikimate 3-phosphate and inorganic phosphate . The enzyme is a target for the nonselective herbicide glyphosate (N-phosphonomethylglycine) . In order to determine the role of lysine residues in the mechanism of action of this enzyme as well as in its inhibition by glyphosate, chemical modification studies with pyridoxal 5'-phosphate were undertaken . Incubation of the enzyme with the reagent in the absence of light resulted in a time-dependent loss of enzyme activity . The inactivation followed pseudo first-order and saturation kinetics with Kinact of 45 microM and a maximum rate constant of 1.1 min-1 . The inactivation rate increased with increase in pH, with a titratable pK of 7.6 . Activity of the inactive enzyme was restored by addition of amino thiol compounds . Reaction of enzyme with pyridoxal 5'-phosphate was prevented in the presence of substrates or substrate plus glyphosate, an inhibitor of the enzyme . Upon 90% inactivation, approximately 1 mol of pyridoxal 5'-phosphate was incorporated per mol of enzyme . The azomethine linkage between pyridoxal 5'-phosphate and the enzyme was reduced by NaB3H4 . Tryptic digestion followed by reverse phase chromatographic separation resulted in the isolation of a peptide which contained the pyridoxal 5'-phosphate moiety as well as 3H label . By amino acid sequencing of this peptide, the modified residue was identified as Lys-22 . The amino acid sequence around Lys-22 is conserved in bacterial, fungal, as well as plant enzymes suggesting that this region may constitute a part of the enzyme's active site.

Cell, 1988 Jan 15, 52(1), 9 - 17
Synapsis of attachment sites during lambda integrative recombination involves capture of a naked DNA by a protein-DNA complex; Richet E et al.; During lambda integration, Int recombinase must specifically bind to and cut attachment sites on both the viral and host chromosomes . We show here by foot-printing and by a novel cleavage assay that the bacterial attachment site, attB, cannot stably bind Int in competition with other DNAs . Instead, during recombination reactions, attB obtains its Int by collision with the intasome, a nucleoprotein assembly that forms on the viral attachment site, attP . Our cleavage assay also shows that the capture of attB by the attP intasome does not depend on DNA homology between the two sites; synapsis is governed solely by protein-protein and protein-DNA interactions.

Biochem Biophys Res Commun, 1988 Jan 15, 150(1), 33 - 8
Molecular cloning of Escherichia coli K-12 ggt and rapid isolation of gamma-glutamyltranspeptidase; Suzuki H et al.; Based on the results of mapping of ggt, eight strains were selected from a gene library of E . coli . One of the strains harboring pLC9-12 was found to show 14 times higher gamma-glutamyltranspeptidase activity per cell than the wild type strain . The ggt was subcloned to the BamHI site of pUC18 and the recombinant plasmid pSH101 was obtained . Ggt- phenotype of gamma-glutamyltranspeptidase-deficient mutants was complemented by pSH101 . The specific activity of the enzyme in cells harboring pSH101 was 37-fold higher than that in the wild type cells . gamma-Glutamyltranspeptidase was isolated from the periplasmic fraction of the cells by simple two steps and crystallized.

Eur J Biochem, 1988 Jan 15, 171(1-2), 335 - 42
Lipid-dependent membrane enzymes . Purification to homogeneity and further characterization of diacylglycerol kinase from Escherichia coli; Russ E et al.; 1 . Diacylglycerol kinase apoprotein was purified from membranes of Escherichia coli K12 by a six-step procedure that included HPLC . The proposed assignment of the enzyme to the dgkA gene {Lightner et al . (1983) J . Biol . Chem . 258, 10856-10861} could be supported by molecular mass determination (approximately 14 kDa), N-terminal sequencing (Met-Ala-Asn), cyanogen bromide fragmentation and amino acid analysis . As predicted, proline was absent . 2 . The membrane-associated as well as the butan-1-ol-dissolved enzyme survived heating to 100 degrees C . 3 . Alkylglycoside detergents were found to constitute an additional class of lipid activators . 4 . The enzyme apoprotein in a non-activating substrate/detergent solution was capable of autocatalytic self-activation which was attributed to a novel feedback activation mechanism involving phosphatidic acid (diacylglycerol 3-phosphate).

J Biol Chem, 1988 Jan 15, 263(2), 850 - 6
Homology of yeast mitochondrial leucyl-tRNA synthetase and isoleucyl- and methionyl-tRNA synthetases of Escherichia coli; Tzagoloff A et al.; Respiratory deficient mutants of Saccharomyces cerevisiae previously assigned to complementation group G59 are pleiotropically deficient in respiratory chain components and in mitochondrial ATPase . This phenotype has been shown to be a consequence of mutations in a nuclear gene coding for mitochondrial leucyl-tRNA synthetase . The structural gene (MSL1) coding for the mitochondrial enzyme has been cloned by transformation of two different G59 mutants with genomic libraries of wild type yeast nuclear DNA . The cloned gene has been sequenced and shown to code for a protein of 894 residues with a molecular weight of 101,936 . The amino-terminal sequence (30-40 residues) has a large percentage of basic and hydroxylated residues suggestive of a mitochondrial import signal . The cloned MSL1 gene was used to construct a strain in which 1 kb of the coding sequence was deleted and substituted with the yeast LEU2 gene . Mitochondrial extracts obtained from the mutant carrying the disrupted MSL1::LEU2 allele did not catalyze acylation of mitochondrial leucyl-tRNA even though other tRNAs were normally charged . These results confirmed the correct identification of MSL1 as the structural gene for mitochondrial leucyl-tRNA synthetase . Mutations in MSL1 affect the ability of yeast to grow on nonfermentable substrates but are not lethal indicating that the cytoplasmic leucyl-tRNA synthetase is encoded by a different gene . The primary sequence of yeast mitochondrial leucyl-tRNA synthetase has been compared to other bacterial and eukaryotic synthetases . Significant homology has been found between the yeast enzyme and the methionyl- and isoleucyl-tRNA synthetases of Escherichia coli . The most striking primary sequence homology occurs in the amino-terminal regions of the three proteins encompassing some 150 residues . Several smaller domains in the more internal regions of the polypeptide chains, however, also exhibit homology . These observations have been interpreted to indicate that the three synthetases may represent a related subset of enzymes originating from a common ancestral gene.

J Biol Chem, 1988 Jan 15, 263(2), 633 - 7
Affinity labeling of the allosteric activator site(s) of spinach leaf ADP-glucose pyrophosphorylase; Morell M et al.; Pyridoxal-P has been shown to be an activator of the spinach leaf ADP-glucose pyrophosphorylase . It has a higher apparent affinity than the physiological activator 3-phosphoglycerate but only activates the enzyme activity 6-fold whereas 3-phosphoglycerate gives a 25-fold activation . Reductive phosphopyridoxylation of the spinach leaf enzyme results in enzyme having less dependence on the presence of activator for activity . Labeled pyridoxal-P is incorporated into both the 54- and 51-kilodalton subunits of the spinach leaf enzyme . The incorporation is inhibited by the presence of either 3-phosphoglycerate or the allosteric inhibitor, inorganic phosphate, thus suggesting that pyridoxal phosphate is covalently bound to the allosteric activator site . The pyridoxal phosphate is bound to an epsilon-amino group of a lysine residue . The phosphopyridoxylated enzyme is more resistant to phosphate inhibition than the unmodified form . The modified 51-kDa subunit has been digested with trypsin, and the peptide containing the labeled pyridoxal phosphate has been purified via high performance liquid chromatography and sequenced . Comparison of this sequence with the deduced amino acid sequence of a rice endosperm cDNA clone indicates that the putative allosteric site of the 51-kDa subunit is close to the carboxyl-terminal . This is in contrast to what had been demonstrated for the position of the activator site of the Escherichia coli ADP-glucose pyrophosphorylase which was shown to be close to the amino-terminal of the subunit.

J Immunol, 1988 Jan 15, 140(2), 597 - 601
Antigenic proteins of Mycobacterium leprae . Complete sequence of the gene for the 18-kDa protein; Booth RJ et al.; Recombinant clones expressing antigenic determinants of the 18-kDa protein antigen from Mycobacterium leprae recognized by the L5 monoclonal antibody were isolated from a lambda gt11 expression library and their nucleotide sequences determined . All clones expressed the M . leprae-specific determinant as part of a large fusion protein with Escherichia coli beta-galactosidase . The deduced amino acid sequence of the coding region indicated that all the lambda gt11 recombinant clones contained an incomplete M . leprae gene sequence representing the carboxy-terminal two-thirds (111 amino acids) of the 18-kDa gene and coding for a peptide of m.w . 12,432 . Subsequent isolation and sequencing of a 3.2kb BamHI-PstI DNA fragment from a genomic M . leprae cosmid library permitted the deduction of the complete 148 amino acid sequence with a predicted m.w . of 16,607 . A second open reading frame 560 bases downstream from the 18-kDa coding sequence was found to code for a putative protein of 137 amino acids (m.w . = 15,196) . Neither this nor the 18-kDa amino acid sequence displayed any significant homologies with any proteins in the GENBANK, EMBL, or NBRF data bases . Crude lysates from recombinant lambda gt11 clones expressing part of the 18-kDa protein have been reported to stimulate the proliferation of some M . leprae-specific helper T cell clones . Thus, it is significant that the complete 18-kDa sequence contains five short peptides predicted to be possible helper T cell antigenic epitopes based on their propensity to form amphipathic helices . Although three of these occur within the 111 amino acid carboxy-terminal peptide expressed by lambda gt11 clones, the most highly amphipathic peptide is found in the amino-terminal region not present in the lambda gt11 recombinants.

J Biol Chem, 1988 Jan 15, 263(2), 1063 - 71
Mammalian heterogeneous nuclear ribonucleoprotein complex protein A1 . Large-scale overproduction in Escherichia coli and cooperative binding to single-stranded nucleic acids; Cobianchi F et al.; Characterization of mammalian heterogeneous nuclear ribonucleoprotein complex protein A1 is reported after large-scale overproduction of the protein in Escherichia coli and purification to homogeneity . A1 is a single-stranded nucleic acid binding protein of 320 amino acids and 34,214 Da . The protein has two domains . The NH2-terminal domain is globular, whereas the COOH-terminal domain of about 120 amino acids has low probability of alpha-helix structure and is glycinerich . Nucleic acid binding properties of recombinant A1 were compared with those of recombinant and natural proteins corresponding to the NH2-terminal domain . A1 bound to single-stranded DNA-cellulose with higher affinity than the NH2-terminal domain peptides . Protein-induced fluorescence enhancement was used to measure equilibrium binding properties of the proteins . A1 binding to poly (ethenoadenylate) was cooperative with the intrinsic association constant of 1.5 X 10(5) M-1 at 0.4 M NaCl and a cooperativity parameter of 30 . The NH2-terminal domain peptides bound noncooperatively and with a much lower association constant . With these peptides and with intact A1, binding was fully reversed by increasing {NaCl}; yet . A1 binding was much less salt-sensitive than binding by the NH2-terminal domain peptides . A synthetic polypeptide analog of the COOH-terminal domain was prepared and was found to bind tightly to poly-(ethenoadenylate) . The results are consistent with the idea that the COOH-terminal domain contributes to A1 binding through both cooperative protein-protein interaction and direct interaction with the nucleic acid.

Nature, 1988 Jan 14, 331(6152), 171 - 3
Cloning of the mycobacterial epitope recognized by T lymphocytes in adjuvant arthritis; van Eden W et al.; Adjuvant arthritis (AA) is a chronic disease inducible in rats by immunization with an antigen of Mycobacterium tuberculosis . After the isolation of arthritogenic T-cell lines and clones, it became possible to demonstrate that the critical M . tuberculosis antigen contained an epitope cross-reactive with a self-antigen in joint cartilage . Like AA rats, patients suffering from rheumatoid arthritis demonstrated specific T-lymphocyte reactivity to the M . tuberculosis fraction containing the cross-reactive epitope . To characterize the critical M . tuberculosis epitope we used AA T-cell clones to screen mycobacterial antigens expressed in Escherichia coli and genetically engineered truncated proteins and synthetic peptides . The AA T-cell clones recognized an epitope formed by the amino acids at positions 180-188 in the sequence of a Mycobacterium bovis BCG antigen . Administration of this antigen to rats induced resistance to subsequent attempts to produce AA.

Biochemistry, 1988 Jan 12, 27(1), 487 - 95
Partial assignment of resonances in the 19F nuclear magnetic resonance spectra of 5-fluorouracil-substituted transfer RNAs; Hardin CC et al.; Features of the 19F nuclear magnetic resonance (NMR) spectra of three purified 5-fluorouracil-(FUra-) substituted Escherichia coli tRNAs, tRNA(1Val), tRNA(mMet), and tRNA(fMet), are compared . Each of the tRNA species can be resolved into two isoaccepting forms, A and B, whose 19F NMR spectra differ in the shift of one peak from the 4.5 to 4.8 parts per million (ppm) range (FUra = O) in the spectrum of isoacceptor B upfield to ca . -15 ppm in that of isoacceptor A . Because the sequences of the two isoacceptors of each tRNA differ only at one position in the D loop, that normally occupied by a dihydrouridine residue, we assign the 4.5 ppm peak in the spectrum of fluorine-labeled tRNA(1Val) to FUra17 and the resonance at 4.6 ppm in the spectrum of fluorouracil-substituted tRNA(mMet) to FUra20 . A reciprocal 19F{19F} nuclear Overhauser effect is observed between the downfield peaks A and B in the 19F NMR spectrum of 19F-labeled tRNA(1Val) . Assuming that fluorine-labeled tRNA(1Val) has a structure similar to that of yeast tRNA(Phe), only FUra54 and -55 are close enough (4-5 A) to give an appreciable 19F homonuclear Overhauser effect . Peaks A and B have therefore been assigned to FUra54 and -55 . As the temperature is raised from 30 to 45 degrees C, the intensity of peak B (6.6 ppm) in the spectrum of 19F-labeled tRNA(1Val) gradually shifts upfield to 6.4 ppm (Tm = 36 degrees C), indicating a temperature-dependent slow exchange of the corresponding 5-fluorouracil residue between two magnetically distinct environments.(ABSTRACT TRUNCATED AT 250 WORDS)

Biochemistry, 1988 Jan 12, 27(1), 456 - 71
Equilibrium binding of Escherichia coli single-strand binding protein to single-stranded nucleic acids in the (SSB)65 binding mode . Cation and anion effects and polynucleotide specificity; Overman LB et al.; The Escherichia coli single-strand binding (SSB) protein binds single-stranded (ss) nucleic acids in at least four distinct binding modes depending on the salt conditions {Lohman, T . M., & Overman, L . B . (1985) J . Biol . Chem . 260, 3594; Bujalowski, W., & Lohman, T . M . (1986) Biochemistry 25, 7799} . Equilibrium binding constants for the interaction of the E . coli SSB protein with poly(A), poly(U), poly(dA), and poly(dT) have been measured over a range of monovalent salt concentrations and types under conditions which favor only the high site size, (SSB)65 binding mode, which covers 65 nucleotides per SSB tetramer . The binding isotherms are analyzed by using a statistical thermodynamic model ("tetramer/octamer" model) that assumes cooperative binding of SSB is limited to the formation of octamers {Bujalowski, W., & Lohman, T . M . (1987) J . Mol . Biol . 195, 897} rather than the indefinite clustering of tetramers . The dependence of the intrinsic association equilibrium constant, Kobsd, and cooperativity parameter, omegoT/O, on salt concentration has been determined by titrations which monitor the fluorescence quenching of the SSB protein upon complex formation . In the (SSB)65 binding mode, SSB binds with only moderate cooperativity to ss nucleic acids {Lohman, T . M., Overman, L . B., & Datta, S . (1986) J . Mol . Biol . 187, 603} . The cooperativity parameter derived from the tetramer/octamer model, which represents the equilibrium constant for formation of a nucleic acid bound SSB octamer from two nucleic acid bound tetramers, has a value of omegaT/O = 410 +/- 120 and is independent of salt concentration and type for poly(dA), poly(U), and poly(A) (25 degrees C, pH 8.1) . However, Kobsd decreases steeply with increasing salt concentration, such that alpha log Kobsd/alpha log {NaCl} = -7.4 +/- 0.5 for poly(U), -6.1 +/- 0.6 for poly(dA), and -6.2 +/- 0.3 for poly(A) (25.0 degrees C, pH 8.1) . The SSB-poly(dT) affinity is too high to measure in buffers containing even 5 M NaCl; however, in 1.8-2.5 M NaBr, we measure alpha log Kobsd/alpha log {NaBr} = -5.7 +/- 0.7, with a lower value of omega T/O = 130 +/- 70 . The polynucleotide specificity of the (SSB)65 binding mode (0.20 M NaCl, 25.0 degrees C, pH 8.1) is Kobsd(dT) greater than Kobsd(dC) much greater than Kobsd(ss M13 DNA) greater than Kobsd(I) greater than Kobsd(U) = 8Kobsd(dA) = 87Kobsd(A) much greater than Kobsd(C).(ABSTRACT TRUNCATED AT 400 WORDS)

Biochemistry, 1988 Jan 12, 27(1), 289 - 96
Site-directed mutagenesis and 1H NMR spectroscopy of an interdomain segment in the pyruvate dehydrogenase multienzyme complex of Escherichia coli; Texter FL et al.; Deletion of two of the three homologous lipoyl domains that form the N-terminal half of each dihydrolipoamide acetyltransferase (E2p) polypeptide chain of the Escherichia coli pyruvate dehydrogenase complex can be achieved by in vitro deletion in the structural gene aceF . A site-directed mutagenesis of this shortened aceF gene was carried out to replace the glutamine residue at position 291 (wild-type numbering) with a histidine residue . Residue 291 is near the middle of a long segment (about 30 amino acid residues) of polypeptide chain, rich in alanine, proline, and charged amino acids, that links the remaining lipoyl domain to the dihydrolipoamide dehydrogenase (E3) binding domain in the E2p chain . A fully active enzyme complex was still assembled, and despite the enormous size of the particle (Mr approximately 4 x 10(6)), sharp resonances attributable to the single new histidine residue per E2p chain could be detected in the 400-MHz 1H NMR spectrum of the complex . The sharpness of these resonances, their chemical shifts (7.94 and 7.05 ppm), and the apparent pKa (6.4) of the side chain were all consistent with this histidine residue being exposed to solvent in a conformationally flexible region of the E2p polypeptide chain . These experiments provide direct proof for the conformational flexibility of this region of polypeptide chain, which is thought to play an important part in the movement of the lipoyl domain required for active site coupling in the enzyme complex.(ABSTRACT TRUNCATED AT 250 WORDS)

Biochemistry, 1988 Jan 12, 27(1), 276 - 83
A possible model for the concerted allosteric transition in Escherichia coli aspartate transcarbamylase as deduced from site-directed mutagenesis studies; Ladjimi MM et al.; Aspartate transcarbamylase is stabilized in a low-affinity-low-activity state exhibiting no cooperativity by selective perturbation of the Glu-50-Arg-167 and Glu-50-Arg-234 interdomain salt bridges . Similarly, a high-affinity-high-activity state of the enzyme, retaining a significant amount of cooperativity, is obtained by perturbation of the interaction between Tyr-240 and Asp-271 . In this work, we show that the rupture of the link between Tyr-240 and Asp-271 in the enzyme already lacking the interdomain salt bridges regenerates the homotropic cooperative interactions between the catalytic sites and substantially increases the activity and affinity of the enzyme for aspartate . These results suggest a possible relationship between these two sets of interactions for the establishment of the cooperative behavior of the enzyme . Another mutation, Glu-239 to Gln, introduced to perturb the Glu-239-Lys-164 and Glu-239-Tyr-165 interactions between the two catalytic subunits, is sufficient to "lock" the enzyme in the R state . These observations emphasize the importance of the interactions at the interface between the catalytic trimers in maintaining the T state of the enzyme and shed light on the role played by this pathway in the communication of homotropic cooperativity between the different sites . A model including all these findings, as well as the interactions stabilizing the T state or the R state in the presence of the natural substrates, is proposed.(ABSTRACT TRUNCATED AT 250 WORDS)

Biochemistry, 1988 Jan 12, 27(1), 268 - 76
Relationship between domain closure and binding, catalysis, and regulation in Escherichia coli aspartate transcarbamylase; Ladjimi MM et al.; Previous evidence, from both crystallographic and biochemical studies, has indicated that profound tertiary and quaternary changes in the structure of Escherichia coli aspartate transcarbamylase occur upon the binding of the bisubstrate analogue N-(phosphonoacetyl)-L-aspartate (PALA) . In particular, within a single catalytic polypeptide chain, the aspartate binding domain relocates closer to the carbamyl phosphate binding domain, thereby resulting in a major reorganization of the interface between the two domains . Among the new interactions, salt bridges between Glu-50 and both Arg-167 and Arg-234 are formed . In the present study, site-directed mutagenesis is used to replace Glu-50 by glutamine in the catalytic chain . The Michaelis constant for aspartate of the mutant catalytic subunit is about 10-fold higher and the turnover number 10-fold lower than their respective counterparts in the wild-type catalytic subunit, whereas the dissociation constant for carbamyl phosphate is almost unchanged . For the holoenzyme, this substitution results in an 8-fold decrease in the specific activity, a 20-fold increase in the aspartate concentration that gives half of the maximal velocity, and a loss of cooperativity for both substrates . However, the mutant enzyme is not "frozen" in a low-affinity-low-activity conformation since PALA stimulates the activity severalfold and induces an increase in the sulfhydryl reactivity analogous to that of the wild-type enzyme . Together these results indicate that the stabilization of the aspartate binding domain near the carbamyl phosphate binding domain, through specific interdomain bridging interactions, is necessary for the high-affinity-high-activity configuration of the active site.(ABSTRACT TRUNCATED AT 250 WORDS)

Biochemistry, 1988 Jan 12, 27(1), 226 - 33
DNA binding domain of Escherichia coli DNA polymerase I: identification of arginine-841 as an essential residue; Mohan PM et al.; To identify the DNA binding site(s) in Escherichia coli DNA polymerase I (pol I) (Klenow fragment), we have used an active-site-directed reagent, phenylglyoxal (PG), which specifically reacts with arginine residues . Preincubation of DNA pol I with PG resulted in the loss of polymerase, 3'-5'-exonuclease, and DNA binding functions . Furthermore, the presence of DNA but not deoxynucleoside triphosphates protected the enzyme from inactivation . Labeling studies with {7-14C}PG indicated that two arginine residues were modified per mole of enzyme . In order to locate the site of PG modification, we digested the PG-treated enzyme with trypsin and V-8 protease . The resulting peptides from each digest were then resolved on reverse-phase hydrophobic columns . An appearance of a new peptide peak was observed in both tryptic and V-8 protease digests . Since inclusion of template-primer during PG modification of enzyme blocks the appearance of these peaks, these peptides were concluded to represent the template-primer binding domain of pol I . Indeed, the extent of inactivation of enzyme by PG treatment correlated very well with the quantitative increase in the new tryptic peptide peak . Amino acid composition analysis of both tryptic peptide and V-8 peptide revealed that the two peptides were derived from the same general region; tryptic peptide spanned between residues 837 and 857 while V-8 peptide spanned between residues 841 and 870 in the primary sequence of pol I . Sequence analysis of tryptic peptide further identified arginine-841 as the site of PG modification, which implicates this residue in the DNA binding function of pol I.

What Is Biotechnology?, What Is Prokaryote?, What Is Environmental Microbiology?, What Is Functional Genomics?, What Is Amino Acid?, i, Microbiology, n, Microbe, r, Microbes, c, Bacteria, o, Bacterium, n, Thermophiles, r, Haemophilus, r, Multidrug resistant, e, Escherichia coli, n, Clostridia, s, Yeasts, e, Saccharomyces yeast, o, Bacillus subtilis, r, Bacteria, r, Alcaligenes, a, Escherichia coli, r, Clostridia, c, Enterobacters, i, Anaerobic bacteria, c, Enterobacters, n, Antibiotics, s, Cryptococci, e, Erythromycin, n, B. anthracis, n, Candida tropicalis, e, Multidrug resistant

Scientific Publications - Work Done by Microbiology Reader Bioscreen C
Agricultural Microbiology Anaerobic Microbiology Antimicrobial Susceptibility Artificial Atmosphere Bioassay of Antibiotics Biofilm Microbiology Bioreactor Technology Biotechnology Cell Biology Clinical Microbiology Environmental Microbiology Experiments with Yeast	Fermentation Food Microbiology Functional Genomics Gene Technology Growth Media Development Growth Rate and Lag Time Industrial Microbiology Medical/Pharmaceutical Field Microbiological Assay Microbiological Research Microbiology of Cosmetics go to a specific theme...	Military Microbiology Molecular Microbiology Mutagenicity and Genotoxicity Oral Microbiology Patents Postantibiotic Studies Soil Microbiology Spore Microbiology Veterinary Microbiology Waste/Wastewater Treatment Water Microbiology Wine Microbiology

� 2005 Transgalactic Ltd (manufacturer of Bioscreen C software) | Privacy Statement | P.O. Box 1393, 00101 Helsinki, Finland, phone: +358 9 85172920, fax: +358 9 8749481, e-mail: microbiology@bionewsonline.com

Last modified: May 25, 2005