Z Allg Mikrobiol, 1977, 17(8), 581 - 91 Different restriction of bacteriophages T3 and T7 by P1-lysogenic cells and the role of the T3-coded SAMase; Kruger DH et al.; The intracellular growth of the phages T3 and T7 is restricted in the presence of the Escherichia coli prophage P1 . Phage T3 has a higher ability to express its genome and to damage the host cell than T7 . This partial protection of T3 against P1 restriction is due to the T3-coded SAMase, an enzyme which degrades S-adenosylmethionine, the cofactor of the P1 restriction endonuclease . Since we did not observe DNA cleavage in vivo, we conclude that the in vivo action of the P1 nuclease is limited to a SAM-dependent repressor-like binding to T3 and T7 DNA, while further reactions with the DNA (modification vs cleavage) are blocked. Gene, 1977, 2(2), 61 - 74 Insertion sequence IS2 associated with int-constitutive mutants of bacteriophage lambda; Pilacinski W et al.; We have examined mutations in bacteriophage lambda called int-c, which confer elevated constitutive expression on the int gene for prophage integration . One class of mutations, which map between the b538 and bio386 endpoints, does not appear to be associated with any major chromosomal modification, whereas the second class has the IS2 insertion sequence in orientation II within the region between gene int and the b538 endpoint, All int-c mutations are within gene xis, with the possible exception of int-c548, which might be located between int and xis . The present data are most consistent with the following notion: (1) the point mutations of class one inactivate the tI terminator signal of the pI-tI leader RNA for gene int and thus render int expression independent of the antiterminating action of the cII and cIII products, and (2) the second class of int-c mutants is constitutive for Int because the IS2 insertion, when strategically located between int and tI, provides a new constitutive promoter for int transciption. Genetika, 1977, 13(6), 1108 - 18 {Reparation of UV-damaged bacteriophage ed}; Preobrazhenskaia ES et al.; A repair of UV-damaged phage DNA in the "phage-host" system in accordance with the excision reparative mechanism is demonstrated by means of centrifugation in alkaline sucrose gradient of virulent 3H-thymidine labelled phage sd . The increase of the transfectants quantity of UV-irradiated DNA on uvr+ bacteria compatibly to uvr- bacteria evidences that the bacterial host participates in phage reparation . Caffeine inhibition of UV-irradiated phage sd survival confirms the participation of cell-host in reparation of UV-damaged phage. Genetika, 1977, 13(4), 696 - 709 {IS-elements and their role in genetic recombination}; Smirnov GB et al.; The data concerning the biological functions and properties of short specific polynucleotide sequences (so called insertion sequences--IS) are reviewed . IS elements integrated in a genome can lead to strongly polar mutations in Escherichia coli, its bacteriophages and plasmids, while some IS (IS2) being integrated in inverted orientation turn on the gene activity . Several copies of the IS elements are present in the E . coli chromosome . A characteristic feature of IS is their ability to recA-independent migration along the bacterial chromosome . Possible mechanisms of IS integration are discussed . IS elements play the key role in the majority of recA-independent recombinational events: F-prime and partially Hfr-formation, plasmid recombination and dissociation, some cases of deletion formation etc . IS elements participate in recombination in the form of direct or inverted repeats . Direct repeats probably determine the processes of dissociation of the complete multicomponent R-factors and other plasmids . Inverted repeats (some of them are palindromes) are responsible for the migration of several drug-resistance determinants called transposons . Possible mechanisms of IS-dependent and probably IS-controlled recombination are discussed. Genetika, 1977, 13(3), 502 - 8 {Recombination of amber mutants of bacteriophage T4B . II . Localization of amber mutants on maps of genes 30, 34, 35, 36 and 38}; Piruzian ES et al.; Localization of 275 amber mutants of five genes of phage T4B (30, 34, 35, 36 and 38) on genetic maps allowed us to determine the recombination length of these genes . Gene 34 substantially differs from the rest studied genes by numbers of amber mutants isolated in each gene and by recombination frequency . In particular, according to the results of crossing the flank markers, the recombination length of gene 34 is 10 times greater than in gene 38; using the summary value of recombination frequencies between elementary intervals a 20-fold excess of the length of gene 34 compared with the length of gene 38 was receieved . Molecular weight of the product of gene 34 is only 6 times as great as in gene 38 . An elevated recombination frequency was also detected in gene 35 . The data obtained indicate a local recombination anomaly at the region of genes 34--35 of bacteriophage T4 genome. Genetika, 1977, 13(2), 286 - 91 {Mutation of bacteriophage T4 restoring phage supressor psul+ activity in bacterial strain Escherichia coli BN}; Buianovskaia EA et al.; The mutant of bacteriophage T4psu1+XF2 carrying a mutational aleration in the central region of proline-serine tRNA precursor is isolated . The mutational alteration results in the recovery of amber suppressor activity of phage psu1+ serine tRNA in Escherichia coli BN in which the synthesis of this tRNA is normally blocked . Since the amber suppressor activity of mutant serine tRNA becomes sensitive to a restrictive action of strR mutations, its structure seems to be different from that of parental suppressor serine tRNA. Zentralbl Bakteriol Parasitenkd Infektionskr Hyg, 1977, 132(2), 163 - 77 {The action of selected herbicides on bacteriophages and Escherichia coli (author's transl)}; Toure IM et al.; The effect of eight herbicides on the multiplication of bacteria and bacteriophages was tested with Escherichia coli, strains W1665F+ and C600, and with the RNA-phage M12 and the DNA-phage lambda in turbidimetric investigations and one-step growth experiments . E . coli is inhibited by seven of the herbicides investigated in concentrations of 10(-3)M, partly of 10(-4)M, too, and is promoted by some compounds in weaker concentrations . Naphthylacetic acid, (NES) largely independent of its concentration, causes increased density of bacteria in fluid culture . The multiplication of the M12 phage is inhibited in sometimes wide ranges of concentration by 2,4-D, MCPA, 2,4-DP, and CMPP but it is stimulated by NES and amitrole . The lambda-phage multiplication is inhibited only by CMPP, MCPA, MCPB, and phenylacetic acid interfere with the lysogenization of the bacteria and increase the lytic activity of the lambda-phages as 2,4-DP and NES do . 2,4-D strongly inhibits the plaque-forming ability of M12 phages already prior to their contact with the host cells, whereas MCPA and CMPP are inhibitory in the first phases and 2,4-DP in all phases of the phage replication . In the lambda-phage replication, too, CMPP is effective only in the first phases . Aspects of the mode of action of the herbicides in the procaryoute virus system are discussed. Nucleic Acids Res, 1977 Jan, 4(1), 1 - 15 Differential requirements for polypeptide chain initiation complex formation at the three bacteriophage R17 initiator regions; Steitz JA et al.; The initiation specificity of washed E . coli ribosomes in the presence and absence of purified initiation factors and/or S1 protein has been examined in protection experiments using 32P-labelled R17 RNA . We find that the three bacteriophage initiator regions do not exhibit equal requirements for either of these components during initiation complex formation . Specifically, both factors and S1 stimulate ribosome binding to the beginnings of the coat and replicase cistrons to a greater extent than they promote recognition of the A protein initiation site . The differential effects are therefore inversely correlated with the degree of mRNA-16S rRNA complementarity exhibited by the three initiator regions . We also observe that S1 suppresses ribosome binding to spurious sites in the R17 RNA. Biochimie, 1977, 59(2), 179 - 88 Single-stranded bacteriophage T5 stO DNA as template for in vitro fMet-tRNA binding to ribosomes and protein synthesis; Hulen C et al.; Good evidence is provided that fMet-tRNA binding and aminoacid incorporation, when single-stranded DNA is used instead of mRNA in an E . coli cell-free system, are strictly dependent on the magnesium concentration . Ten sites homologous to the initiation sites of translation can be detected on denatured T5 stO DNA when using ribosomes and initiation factors from uninfected E . coli F . In S-30 extracts, at high magnesium concentrations and in the presence of neomycin, initiation of the translation of denatured T5 stO DNA begins anywhere on the molecule, and yet high molecular weight polypeptides are synthesized . The template potentiality of the denatured T5 stO DNA decreased when using ribosomes plus initiation factors and crude extracts from T5 stO-infected bacteria . By in vitro formation of initiation complexes sites analogous to initiation sites of translation were localized on T5 stO DNA molecules using single-stranded fragments separated by sedimentation in alkaline sucrose gradient. J Bacteriol, 1977 Jan, 129(1), 282 - 90 Genetic inversion in the formation of an Hfr strain from a temperature-sensitive F' gal strain; Bergquist PL et al.; An Hfr strain (PB15) that carries a duplicated copy of the galactose operon genes flanking the integrated sex factor is unusually stable since it does not show excision of the repeated deoxyribonucleic acid segment . The right-hand galactose operon is in the normal orientation . Deletion mutations that eliminate the right-hand galactose genes, the sex factor, and some of the left-hand operon have been isolated . Mutants believed to have their left-hand galactose operon inverted were able to be induced for galactose epimerase synthesis by D-fucose but did not show escape synthesis on induction of bacteriophage lambda . Ribonucleic acid specific for the galactose operon was isolated after induction of lysogenic strains presumed to carry the galactose operon in the normal and inverted orientation . Hybridization to the isolated left and right strands of lambdapgal showed that the noninformational strand of the left-hand galactose operon of the deletion mutant of PB15 was transcribed on escape induction . These results show that inversion has occurred. Arch Immunol Ther Exp (Warsz), 1977, 25(5), 693 - 700 Nucleic acid as interferon inducer . Its antiviral and antitumor activity; Feldmane G et al.; The results of the present study have demonstrated that dsRNA obtained in the system E . coli--bacteriophage is an interferon inducer and possesses antiviral and antitumoral activities. J Virol, 1977 Jan, 21(1), 7 - 15 Evidence for a diffusible T4 bacteriophage protein governing the initiation of delayed early RNA synthesis; Linder CH et al.; Two forms of prereplicative phage RNA can be discerned in Escherichia coli early after infection with bacteriophage T4, immediate early and delayed early RNA . The transition from immediate early to delayed early RNA synthesis is inhibited by chloramphenicol . The present work presents evidence for the existence of a phage-specific protein, which effects this transition . Delayed early RNA formation was measured by a cistron-specific enzyme-forming-capacity method, in which RNA synthesized in the presence of chloramphenicol was allowed to express itself into enzyme activity after (i) the addition of rifampin to inhibit further transcription and (ii) subsequent removal of chloramphenicol . As representatives of delayed early transcription, the two phage-specific enzymes dCTPase and deoxynucleotide kinase were chosen . Primary infection with a phage mutant defective in one of these two enzymes was found to induce a diffusible factor, which in the presence of chloramphenicol could effect the formation of delayed early RNA corresponding to the missing enzyme, upon superinfection with wild-type phage . The activity of this factor, acting in trans, was abolished by the amino acid analogue ethionine . Mutation in the suA gene of the host did not relieve phage of the apparent need for protein synthesis in the transition from immediate early to delayed early phage RNA synthesis. Scand J Immunol, 1977, 6(9), 923 - 932 In vivo responses of alloreactive lymphocytes stimulated in vitro . Helper-cell activity of MLR-primed lymphocytes; Corley RB et al.; Populations of mouse lymphocytes enriched in specific alloreactive cells by priming in a mixed lymphocyte response (MLR) include cells which, when injected into congenic nude mice, enable them to make alloantibody after immunization . Helper cells for the priming H-2 alloantigens (H-2b or H-2k) were enriched relative to helper cells for the other H-2 type . Furthermore, the alloantibody responses of nude mice reconstituted with lymphocytes primed twice in vitro were virtually monospecific for the priming alloantigens . These studies suggest that lymphocytes that proliferate in MLR include lymphocytes capable of giving specific help for H-2 antigens in vivo . Nude mice reconstituted with MLR-primed lymphocytes made less antibody to bacteriophage T4 and phix than mice reconstituted with unprimed cells, and fewer mice responded . Priming of cells a second time in MLR further depleted the population of phage helper cells . Similar results were sometimes, but not always, obtained when testing reconstituted nude mice for their ability to make anti-sheep erythrocyte (SRBC) responses . These results suggest that lymphocytes primed against H-2b or H-2k alloantigens do not have specificity for antigens of T4 or phix . These alloreactive cells may also lack specificity for SRBC . However, the results do not allow a definitive conclusion to be drawn. Rev Ig Bacteriol Virusol Parazitol Epidemiol Pneumoftiziol Bacteriol Virusol Parazitol Epidemiol, 1977 Jan-Mar, 22(1), 9 - 16 {Bacteriocin-bacteriophage interrelations}; Israil AM; The present paper refers to levels of morphological, serological and genetic similarity in bacteriocinogenic-lysogenic interrelationships, the similarity of the means of inducing bacteriocinogenic and lysogenic properties and the similarity of adsorption on specific cellular receptors . Nevertheless, bacteriocins and bacteriophages are still considered as agents of a different nature . Bacteriocins, with their varied chemical structure, are inert, whereas phages are complex chemical units with a nucleic acid nucleus and the capacity of self replication. J Bacteriol, 1977 Jan, 129(1), 265 - 75 Biosynthesis of the outer membrane receptor for vitamin B12, E colicins, and bacteriophage BF23 by Escherichia coli: kinetics of phenotypic expression after the introduction of bfe+ and bfe alleles; Bassford PJ Jr et al.; The bfe locus codes for the cell surface receptor for vitamin B12, the E colicins, and bacteriophage BF23 in the Escherichia coli outer membrane . When the bfe+ allele, which is closely linked to the argH locus, was introduced into an argH bfe recipient by conjugation, arg+ recombinant cells rapidly and simultaneously acquired sensitivity to colicin E3 and phage BF23 . In the reciprocal experiment introducing bfe into an argH bfe+ recipient, it was found that colicin E3-resistant, arg+ cells began to appear shortly after the arg+ recombinant population began to divide . This was far earlier than would have been predicted on the basis of 220 receptors per haploid cell . Moreover, there was a lag between the appearance of colicin resistance and the appearance of resistance to killing by phage BF23, and hence a period of time during which some arg+ recombinant cells were sensitive to the phage but resistant to the colicin . Colicin E3 added to cells during this period of time protected against phage killing, indicating that the colicin-resistant cells still had receptors capable of binding colicin on their surface . The modification of the phenotypic expression of colicin and phage resistance by inhibitors of deoxyribonucleic acid, ribonucleic acid, and protein synthesis was also investigated . The results obtained indicate that the receptor protein coded for by the bfe locus can exist on the cell surface in several different functional states. J Gen Microbiol, 1977 Jan, 98(1), 223 - 9 An alginate lysate from Azotobacter vinelandii phage; Davidson IW et al.; The alginate depolymerase associated with bacteriophage infection of Azotobacter vinelandii has been used in the analysis of sodium alginate . The enzyme degraded the polysaccharide to a series of oligouronides each containing a terminal 4-deoxy-alpha-L-erythro-hex-4-enopyranuronosyl residue . Analysis of these oligouronides, together with kinetic information, indicated that the enzyme was specific for mannuronic acid-containing regions of the polyuronide . The specificity of the enzyme made it possible to determine the primary structure of the macro-molecule . The phage-induced enzyme was shown to be distinct from the alginate lyase elaborated by the host organisms by its pH optimum, molecular weight, Michaelis constant and stability. Mol Gen Genet, 1976 Dec 22, 149(3), 357 - 8 Revertants of double opal-mutants of bacteriophage T4; Pozdniakov VN et al.; Revertants of double opal-mutants of bacteriophage T4 have been obtained . The properties of these revertants suggest that reversion of double opal-mutants is effected by the activity of some gent-suppressor appeared in the phage genome . Restriction of these revertants by streptomycin-resistant bacterial strains shows that the suppression of the opal-mutants is realized at translation. Mol Gen Genet, 1976 Dec 22, 149(3), 335 - 45 Effect of ultraviolet irradiation of bacteriophage f1 DNA on its conversion to replicative form by extracts of Escherichia coli; Masamune Y; When DNA of phage chiX174 or phage f1 is used as a template after exposure to ultraviolet radiation, the conversion of single-stranded DNA to replicative form by cell-free extracts of Escherichia coli is inhibited . The extend of synthesis is proportional to the distance of a pyrimidine dimer from a specific origin of replication as calculated from the random location of dimers at various UV doses . The results therefore indicate that the initiation of DNA synthesis on these phage DNAs occurs normally at a specific site, and that chain elongation is blocked when replication reaches a photo product in the template . Reinitiation of DNA synthesis distal to the lesion does not occur. Biochim Biophys Acta, 1976 Dec 22, 453(2), 311 - 8 Changes in membrane proteins of Escherichia coli K12 mediated by bacteriophage IKe-specific plasmids; Iyer R et al.; At least 3 minor proteins have been detected by sodium dodecyl sulfate polyacrylamide gel electrophoresis in the unseparated (31 000 daltons) and inner membranes (53 000 and 86 000 daltons) of a non-piliated strain of E . coli K12 bearing the phage IKe-specific resistance plasmid RM98 (Tra+); these proteins are lacking in its Tra- derivative and in the plasmidless host . In contrast, in another K12 host carrying each of different IKe-specific colicinogenic factors, an extra 30 000 dalton protein is observed in the outer membranes; a number of minor proteins seen in the inner membranes appear to be different from those observed in the RM98+ strain . The evidence suggests that the 30 000-31 000 dalton protein is transfer function specific. Biochemistry, 1976 Dec 14, 15(25), 5419 - 30 Structure of gene 5 protein-oligodeoxynucleotide complexes as determined by 1H, 19F, and 31P nuclear magnetic resonance; Coleman JE et al.; 1H nuclear magnetic resonance (NMR) spectra at 270 MHz of gene 5 protein from bacteriophage fd and its complexes with tetra- and octadeoxynucleotides show that approximately 12 of the 37 aromatic protons of the protein undergo upfield shifts upon nucleotide binding . In the complex with d(pT)8, the upfield shifts of the aromatic protons average approximately 0.3 ppm, while in the d(pA)8 complex the same resonances (assigned to tyrosyl protons) shift upfield approximately 0.8 ppm . These are interpreted as ring current shifts induced by stacking of the phenyl rings of three of the five tyrosyl residues with the bases of the nucleotides . 19FNMR of m-fluorotyrosyl gene 5 protein shows five separate resonances: two downfield from m-fluorotyrosine corresponding to "buried" tyrosyls and three near m-fluorotyrosine corresponding to "surface" tyrosyls . The latter (assigned to Tyr-26, -41, and -56, shown by chemical modification to be exposed to solvent) move upfield on nucleotide binding . The downfield 19F resonances are unaffected . Thus the aromatic protons shifted upfield on nucleotide binding appear to be those of Tyr-26, -41, and -56 . In contrast to tetra-, octanucleotide binding to gene 5 protein induces large changes in the 1H resonances of the -CH3 groups of the Val, Leu, and Ile side chains . These may reflect conformational changes induced by protein-protein interactions between two monomers bound to the octanucleotide . 1H resonances of the epsilon-CH2 groups of the lysyl residues in the protein and the complexes with nucleotides are narrow with long T2 values, suggesting considerable rotational motion . Thus epilson-NH3+-phosphate interactions, if they occur, are on the surface of the complex and allow the epsilon-CH2 groups to retain considerable rotational freedom . 31P NMR of the bound nucleotides shows large decreases in T1 for the 3'-5' diesters, but little chemical shift suggesting no unusual distortion of the nucleotide backbone on binding to gene 5 protein . A three-dimensional model of a gene 5 protein-octanucleotide complex has been built based on predictions of the secondary structure from the amino acid sequence (87 AA) and tertiary folding dictated by known chemical and NMR features of the complex. Proc Natl Acad Sci U S A, 1976 Dec, 73(12), 4613 - 7 Single burst study of rec- and red-mediated recombination in bacteriophage lambda; Sarthy PV et al.; Single bursts from three-point crosses of bacteriophage lambda were analyzed for recombination of markers several thousand nucleotide pairs apart . Single recombination, mediated by the rec system of Escherichia coli, is usually reciprocal . Double recombinants are also significantly correlated in single bursts, although the correlation is weaker than for reciprocal singles . Reciprocity is not found in crosses mediated by the lambda red system . With respect to certain other paraments of recombination, the two systems appear to be alike . Double recombinants usually result from one event, not from two independent single recombinations, and their average clone size is about half that of single recombinants . The results are discussed in terms of current molecular models of recombination. Eur J Biochem, 1976 Dec, 71(1), 211 - 27 A complex control circuit . Regulation of immunity in temperate bacteriophages; Thomas R et al.; Temperate bacteriophages can display in a stable way two essentially different behaviours . In the immune state, a gene (cI) produces a repressor which prevents expression of all the other viral genes; in the non-immune state the typically viral functions are expressed . The choice between the two pathways and the establishment of one of them have much in common with cell determination and differentiation . This choice depends on a complex control system, in fact one of the most intricate nets of regulation known in some detail . Our paper provides a formal description and partial analysis of this regulatory net . It is shown that even for relatively simple known models, this kind of analysis uncovers predictions which had previously remained hidden . Some of these predictions were checked experimentally . The experimental part chiefly deals with the efficiency of lysogenization by thermoinducible lambda phage carrying mutations in one or more of the regulatory genes, N, cro and cII . Although N- mutations are widely known for preventing efficient integration, and both N- and cII mutations for preventing efficient establishment of immunity, it is shown that, as predicted by a simple model, both N- and cII- phage efficiently lysogenize at low temperature if they are in addition cro- . In contrast with lambda N- cro+, lambda N- cro- is not propagated as a plasmid at low temperature, precisely because it establishes immunity too efficiently . Genetic control circuits are described in terms of sets of logic equations, which relate the state of expression of genes or of chemical reactions (functions) to input (genetic and environmental) variables and to the presence of gene and reaction products (internal, or memorization varibles) . From the set of equations, one derives a matrix which shows the stable stationary states (if any) of the system, and from which one can derive the pathways (temporal sequences of states) consistent with the model . This kind of analysis is complementary to the more widely used analysis based on differential equations; it allows one to analyze in less detail more complex systems . The language might be used as well, mutatis mutandis, in fields very different from genetics . The last part of the discussion deals with the role of positive feedback loops in our specific problem (establishment and maintenance of immunity in temperate bacteriophages) and in developmental genetics in general . As a generalization of an old idea, it is suggested that cell determination (for a given character) depends on a set of genes whose interaction constitutes a positive feedback loop . Such a system has two stable stationary states: which one is chosen will usually depend on additional controls grafted on the loop. J Gen Virol, 1976 Dec, 33(3), 509 - 12 Synthesis of bacteriophage phi6 double-stranded ribonucleic acid; Coplin DL et al.; Uracil was incorporated into all three bacteriophage phi6 dsRNA segments throughout the infection cycle; the rates of incorporation into each of the three segments were approx . constant for the first 15 to 20 min and then increased rapidly until 50 min after infection . The medium and small dsRNA segments were produced in greater amounts than the large dsRNA segment at all times in the infection cycle . Inhibition of host RNA and protein synthesis with rifampin and chloramphenicol revealed that virus dsRNA synthesis immediately after infection was independent of either host function. Genetics, 1976 Dec, 84(4), 663 - 74 Studies on the mechanism of transduction by bacteriophage phi gamma . I . Genetic characterization of the transducing segment; Gratia JP; The bacteriophage phi gamma, though related to the lambdoid phage phi80, has unusual features in its specialized transduction and is being investigated to determine the mechanism of the transduction process . Genetic analysis of the transducing element gives evidence for a relatively long and uniform linear segment, up to about 1% of the E . coli chromosome, extending in either direction from the prophage attachment site, e.g., on the right side: att80-tonB-trpABCDE-cysB-pryF . The att end includes a variable amount of phage genome, probably very short in most particles . In a small fraction of the transducing particles the phage segment may be more extensive and, conversely, the bacterial segment is shorter, ending around cysB . The transducing segment from modificationless bacteria carries a site susceptible to the K-restriction system which affects the efficiency of transduction. Eur J Biochem, 1976 Dec, 71(1), 19 - 24 DNA blockade by rifampicin-inactivated Escherichia coli RNA polymerase, and its amelioration by a specific mutation; Hayward; 1 . Partially diploid strains of Escherichia coli containing both rifampicin-sensitive and rifampicin-resistant RNA polymerase are, in general, sensitive to the drug: of the two copies of the rpoB gene present in such strains, that which codes for sensitive enzyme is dominant . 2 . RNA polymerase purified from a normal sensitive strain of E . coli, and inactivated by rifampicin, can "blockade" bacteriophage T7 DNA in vitro, inhibiting its transcription by drug-resistant enzyme molecules . 3 . A mutation, rcs-40, reverses the normal dominance relationship in vivo, without detectably affecting the concentrations of resistant and sensitive RNA polymerase in the diploid cell . I show that rcs-40 is closely linked to the rpoB gene which codes for the rifampicin-sensitive enzyme . 4 . Rifampicin-sensitive RNA polymerase purified from E . coli rcs-40, although indistinguishable from the normal enzyme by many criteria, is significantly less efficient in the production of drug-dependent DNA blockade. Proc Natl Acad Sci U S A, 1976 Dec, 73(12), 4405 - 9 Induction of sigma factor synthesis in Escherichia coli by the N gene product of bacteriophage lambda; Nakamura Y et al.; Thermoinduction of cells of E . coli carrying prophage lambdacI857 within the bfe gene brings about not only "escape synthesis" of core subunits of the DNA-dependent RNA polymerase (RNA nucleotidyltransferase, nucleosidetriphosphate:RNA nucleotidyltransferase, EC 2-7-7-6), but also a striking stimulation of sigma factor synthesis . The latter phenomenon, termed sigma induction, is generally observed after lambda phage infection or prophage induction . A series of experiments with various bacterial and phage strains led us to conclude that the N gene product of lambda is directly involved to the sigma induction . These and other results obtained with mutants defective in transcription termination factor rho suggest the involvement of a rho-sensitive site in the control of sigma gene expression in E . coli. Proc Natl Acad Sci U S A, 1976 Dec, 73(12), 4636 - 40 Antiviral effect on MS-2 coliphage obtained with a synthetic antigen; Langbeheim H et al.; The coat protein of bacteriophage MS-2 was cleaved with cyanogen bromide to yield three fragments, possessing the sequence 1-88 (P1), 89-108 (P2), and 109-129 (P3), respectively . The mixture of peptides P2 and P3, which could not be separated, was found capable of inhibiting the neutralization of the phage by antiserum to the whole MS-2 . The peptides corresponding to P2 and P3 were therefore synthesized . The synthetic P3 had no capacity to interfere with neutralization of MS-2, not did its macromolecular conjugate with multichain poly(DL-alanine) elicit neutralizing antibodies . On the other hand, the synthetic P2 was very efficient in inhibiting the inactivation of the phage by the antiserum against phage . Furthermore, a synthetic antigen prepared by attachment of P2 to multichain poly(alanine) incuded antiserum in rabbits that was capable of neutralizing MS-2 activity almost as efficiently as the antiserum prepared against the intact coat protein . This inactivation is specific, because it can, in turn, be totally inhibited by P2 peptide. Philos Trans R Soc Lond B Biol Sci, 1976 Nov 30, 276(943), 63 - 80 Structure and assembly of lipid-containing viruses, with special reference to bacteriophage PM2 as one type of model system; Franklin RM et al.; The simpler lipid-containing viruses (influenza, Semliki Forest, PM2) may have a phospholipid bilayer sandwiched between an outer shell of protein and an internal nucleocapsid possessing helical or icosahedral symmetry . Extensive physical and chemical studies have enabled us to form a more detailed picture of the structure of bacteriophage PM2 and controlled stepwise degradation of the virion has helped us to localize the four viral proteins . The surface protein (II) of PM2 is basic and interacts with the acidic phosphatidylglycerol of the bilayer to stabilize the membrane . The nucleocapsid protein (III) has proteolipid characteristics and may interact with the phospholipids in a hydrophobic fashion . The spikes are formed from protein I and the fourth protein (IV) is closely associated with the DNA . It is possible to reassemble the virus by reversing the degradation steps . Assembly has been especially useful in revealing the processes whereby the proteins and lipids interact to form the bilayer . Furthermore, results of in vivo studies of phospholipid synthesis and both in vivo and in vitro studies of viral protein synthesis have enabled us to form a reasonably complete picture of the biosynthesis of PM2. Philos Trans R Soc Lond B Biol Sci, 1976 Nov 30, 276(943), 51 - 61 Capsid transformation during packaging of bacteriophage lambdaDNA; Hohn T et al.; Assembly pathways of complex viruses might not be simple additions of one protein after another with rigid tertiary structure . It might in fact involve shifts in subunit structure, movement of subunits relative to each other to form new arrangements, transient action of proteins and protein segments, involvement of structure forming 'microenvironments' of the host . Thus morphogenesis of the bacteriophage lambda head starts with the formation of a core-containing DNA-free petit lambda particle . In a first transition, and dependent on a host function, the core is released, minor protein components of the capsid are processed and the particle's structure is altered, as shown by a change of its hydrodynamic properties . The resulting 'prehead' undergoes a second transition triggered by a complex of DNA and recognition protein (A-protein) . This transition is more drastic than the first one . The particle doubles its volume without increasing in protein mass, the shell becomes thinner, and the surface structure is changed . Concomitantly with this process, the DNA becomes packaged and the particle becomes able to bind the small 'D-protein' in amounts equimolar to the capsid protein, which it could not do before . The D-protein addition probably causes another shift of the capsid structure . DNA packaging is completed, and the DNA is cut from concatemeric precursors to unit length molecules . Binding sites are created for the tail connector molecules which in turn allow the independently assembled tail to attach . Research on these processes proceeds along several lines: comparison of physical and chemical properties of particles accumulating in mutants; pulse-chase experiments on assembly precursors; morphogenesis in vitro; and model transitions of aberrant lambda polyheads. Philos Trans R Soc Lond B Biol Sci, 1976 Nov 30, 276(943), 37 - 49 Structure and assembly of the capsid of bacteriophage P22; King J et al.; Identification of the genes and proteins involved in phage P22 formation has permitted a detailed analysis of particle assembly, revealing some unexpected aspects . The polymerization of the major coat protein (gene 5 product) into an organized capsid is directed by a scaffolding protein (gene 8 product) which is absent from mature phage . The resulting capsid structure (prohead) is the precursor for DNA encapsidation . All of the scaffolding protein exits from the prohead in association with DNA packaging . These molecules then recycle, directing further rounds of prohead assembly . The structure of the prohead has been studied by electron microscopy of thin sections of phage infected cells, and by low angle X-ray scattering of concentrated particles . The results show that the prohead is a double shell structure, or a ball within a shell . The inner ball or shell is composed of the scaffolding protein while the outer shell is composed of coat protein . The conversion from prohead to mature capsid is associated with an expansion of the coat protein shell . It is possible that the scaffolding protein molecules exit through the capsid lattice . When DNA encapsidation within infected cells is blocked by mutation, scaffolding protein is trapped in proheads and cannot recycle . Under these conditions, the rate of synthesis of gp8 increases, so that normal proheads continue to form . These results suggest that free scaffolding protein negatively regulates its own further synthesis, providing a coupling between protein synthesis and protein assembly. Philos Trans R Soc Lond B Biol Sci, 1976 Nov 30, 276(943), 3 - 13 DNA viruses: cooperativity and regulation through conformational changes as features of phage assembly; Kellenberger E; The assembly of bacteriophages provides experimental model systems for the study of regulation at the level of gene products . We discuss the hypothesis of regulation through sequentially induced conformational changes by which precursor-assemblies become ready at a specific stage of maturation to interact with an additional gene product or nucleic acids . Phage mutants provide excellent experimental model systems for studying, for example, the role and fate of the core in the prehead assembly . The conservative maturation of the prehead to the final, stable head consists of several steps whose complexity reflect that of the virus . It includes packaging of DNA . The surface lattice of maturing preheads apparently undergoes several steps characterized by different conformational states as suggested by in vitro studies on a morphological variant of the prehead, the polyhead of phage T4 (Steven, Couture, Aebi & Showe 1976; Laemmli, Amos & Klug 1976) . Addition of a partly purified, enriched proteolytic fraction--which is gene 21-dependent--to empty purified polyheads leads to different conformational states . These seem to go in a direction approaching the structure of the surface of finished capsids as studied by Aebi et al . on gene 24 related (Bijlenga, Aebi & Kellenberger 1976) and other genetically defined giant-variants of T4 phage (Doermann, Eiserling & Boehner 1973) . We show some experiments which suggest that high cooperativity is responsible for the stabilization of capsids . The activation energy necessary for dissociation of capsids is very high, 247 kJ for T4 capsids, and 10% smaller for T2 . Once the energy barrier has been overcome, the capsids are first structurally modified before they undergo partial and finally complete dissociation. Philos Trans R Soc Lond B Biol Sci, 1976 Nov 30, 276(943), 29 - 35 Structure and assembly of phage phi29; Vinuela E et al.; Bacteriophage phi29 is a small, morphologically complex, virus with a DNA of molecular mass 12 X 10(6) . The most likely structure of the head of phi29 consists of two fivefold symmetric end-caps based on T = 1 icosahedral symmetry, separated by an equatorial row of 5 hexamers . The eighteen genes identified in phi29 genome have been mapped and, in some cases, the gene products have been identified . Five linked genes, four coding for structural proteins (G, A, E, H) and one coding for a non-structural protein (J), are essential to determine the normal shape of the capsid . Protein pJ may be a scaffolding protein . An account of the effects of mutations in phi29 genes is given. Philos Trans R Soc Lond B Biol Sci, 1976 Nov 30, 276(943), 15 - 28 Studies on the maturation of the head of bacteriophage T4; Wagner J et al.; The presentation focuses on the structural rearrangements of the subunits and the processing of the various protein constituents which accompany the maturation events of the head of bacteriophage T4 . The major features of the maturation steps of the head are the following: (a) the viral DNA is pulled into an empty head in a series of events; (b) cleavage of two core proteins, P22 (mol . mass = 31000), to small fragments and the internal protein IPIII (mol . mass = 23000) to IPIII (mol . mass = 21000) appears to be intimately linked to the DNA packaging event, whereas the cleavage of the major head protein of the viral coat, P23 (mol . mass = 55000), to P23 (mol . mass = 45000) precedes the DNA packaging event . Recently, we have obtained information about the mechanism by which the viral DNA is pulled into a preformed empty head . Our evidence suggests that the DNA becomes attached to the inside of the empty head and is subsequently collapsed in the interior by the so-called internal peptides . These are highly acidic and derived from a large precursor protein by cleavage. Philos Trans R Soc Lond B Biol Sci, 1976 Nov 30, 276(943), 143 - 50 Packaging of genomes in bacteriophages: a comparison of ssRNA bacteriophages and dsDNA bacteriophages; Hohn T; In complex DNA bacteriophages like lambda, T4, T7, P22, P2, the DNA is packaged into a preformed precursor particle which sometimes has a smaller size and often a shape different from that of the phage head . This packaging mechanism is different from the one suggested for the RNA phages, according to which RNA nucleates the shell formation . The different mechanisms could be understood by comparing the genomes to be packaged: single stranded fII RNA has a very compact structure with high helix content . It might easily form quasispherical structures in solution (as seen in the electron microscope by Thach & Thach (1973)) around which the capsid could assemble . Double stranded phage DNA, on the other hand, is a rigid molecule which occupies a large volume in solution and has to be concentrated 15-fold during packaging into the preformed capsid, and the change in the capsid structure observed hereby might provide the necessary DNA condensation energy. J Biol Chem, 1976 Nov 25, 251(22), 7240 - 50 DNA "melting" proteins . IV . Fluorescence measurements of binding parameters for bacteriophage T4 gene 32-protein to mono-, oligo-, and polynucleotides; Kelly RC et al.; The quenching of the intrinsic tryptophan fluorescence of T4-coded gene 32-protein on binding to nucleotide ligands, which was described in the preceding paper, is here exploited to measure thermodynamic parameters of the single-stranded nucleic acid-gene 32-protein interaction . It is shown that binding of small ligands follows a single site binding isotherm, with association constants increasing from approximately 20 M-1 for phosphate, to approximately 10(3) M for ribose or deoxyribose 5'-phosphate, to approximately 10(4) M-1 for mononucleotides, and to approximately 10(5) M-1 for dinucleoside monophosphates (all in 0.1 M Na+) . The measured binding constants appear to be about the same for homologous ribose- and deoxyribose-containing ligands and to be independent of oligonucleotide base sequence and composition . Furthermore, beyond the dinucleotide level and up to octanucleotides, the increase in binding constant with increasing chain length is only about that expected from the statistical factor resulting from the increased number of ways a longer oligonucleotide can form a protein complex . This suggests that the basic binding unit involved in gene 32-protein associations with single-stranded nucleic acids can be approximated by a dinucleoside monophosphate . Oligonucleotides long enough to accomodate two or more protein monomers are characterized by much larger association constants, indicating that binding is cooperative in protein concentration . A cooperativity parameter (omegac) of approximately 10(3) is estimated from these data, in good agreement with that deduced from the application of ligand-perturbed helix in equilibrium coil transition calculations . Values of association constants (Kcomegac) of approximately 10(8) M-1 (in 0.1 M Na+) and site size (nc) of approximately 5 (+/-1) nucleotide residues/protein monomer are determined by the fluorescence titration technique for the cooperative binding of gene 32-protein to both poly(dA) and poly(rA); these values are also in agreement with those measured by Jensen et al . (Jensen, D.E . Kelly, R.C., and von Hippel, P.H . (1976) J . Biol . Chem . 251, 7215-7228) . Possible in vivo consequences and correlations of these findings with proposed roles for gene 32-protein in replication and recombination are discussed. J Biol Chem, 1976 Nov 25, 251(22), 7263 - 70 Translational, autogenous regulation of gene 32 expression during bacteriophage T4 infection; Russel M et al.; Functional half-life measurements of the bacteriophage T4 gene 32 messenger RNA indicate that this mRNA is extremely stable . Regulation of gene 32 expression at the transcriptional level cannot account for the rapidity with which P32 synthesis can be repressed . Furthermore, derepression of P32 synthesis occurs in the presence of rifampicin, a drug which inhibits transcriptional initiation . In addition, T4-infected cultures in which P32 expression is repressed possess almost as much gene 32 mRNA as derepressed cultures . We conclude that expression of the T4 gene 32 protein is regulated at the level of translation. J Biol Chem, 1976 Nov 25, 251(22), 7251 - 62 Regulation of gene 32 expression during bacteriophage T4 infection of Escherichia coli; Gold L et al.; The gene 32 protein of the bacteriophage T4 plays an important role in genetic recombination, DNA repair, and DNA replication; the protein functions in these processes by virtue of a strong binding capacity for single-stranded DNA . During infections of Escherichia coli by bacteriophage carrying amber of temperature-sensitive mutations in gene 32, the altered gene 32 protein (that is, the amber fragment of the missense polypeptide) is synthesized at greatly elevated rates . During infections by phages that are mutant in other genes (and wild type in gene 32), gene 32 expression is coupled to the quantity of single-stranded DNA produced during the infection . The data are consistent with a model in which the gene 32 protein binds preferentially to all available single-stranded DNA . When all available single-stranded DNA is complexed with gene 32 protein, free gene 32 protein represses its own synthesis . The high level expression of altered gene 32 proteins (amber fragments or missense polypeptides) is a direct consequence of the proposed autoregulation. J Biol Chem, 1976 Nov 25, 251(22), 7229 - 39 DNA "melting" proteins . III . Fluorescence "mapping" of the nucleic acid binding site of bacteriophage T4 gene 32-protein; Kelly RC et al.; The intrinsic tryptophan fluorescence of bacteriophage T4-coded gene 32-protein is found to be partially quenched on binding a variety of mono-, oligo-, and polynucleotides . This phenomenon is exploited to partially "map" the nucleic acid binding site of the protein . The intrinsic fluorescence spectrum of the protein peaks at about 347 nm, compared to 359 nm for the fully solvated model fluorophore, N-acetyl-L-tryptophanamide . Nucleotide binding, or collisional quenching by iodide ion, reduces the intensity of the fluorescence, with little or no peak shift . Small ligands, ranging in size from ribose- and deoxyribose-phosphate to tetranucleotides, quench the fluorescence by 2 to 6%; larger ligands quench from 20 to 35% of the intrinsic protein fluorescence . Iodide quenching experiments subjected to Stern-Vollmer analysis suggest that the binding of short nucleotide-containing ligands brings about a conformational change in the protein, fully exposing a tryptophan side chain to the solvent environment . The fluorescence of this tryptophan is fully quenched by the binding of d(Ap)2, but is largely unaffected by the binding of d(ApA) or d(pA)2, indicating both that this (tryptophan) "reporter" residue is located in the nucleic acid binding site and that binding is polar, i.e . polynucleotide chains of only one orientation are complexed . Long oligonucleotides fully quench the fluorescence of this binding site tryptophan . At high salt concentration (2 M NaCl), gene 32-protein forms self-limited dimers (Carroll, R.B., Neet, K.E., and Goldthwait, D.A . (1972) Proc . Natl, Acad . Sci . U.S.A . 69, 2741-2744; (1975) J . Mol . Biol . 91, 275-291) . These dimers, in either high salt or in low salt after cross-linking, fail to bind nucleotides, suggesting that dimer formation partially occludes the nucleic acid binding site and thus that these dimers are probably not involved as intermediates in cooperative protein binding to the DNA . On the other hand, dimerization apparently results in a conformational change which fully exposes the "reporter" tryptophan to iodide quenching . These results are used to formulate a model of some of the nucleic acid-protein and protein-protein interactions involved in the cooperative binding of gene 32-protein to single-stranded DNA. J Biol Chem, 1976 Nov 25, 251(22), 7215 - 28 DNA "melting" proteins . II . Effects of bacteriophage T4 gene 32-protein binding on the conformation and stability of nucleic acid structures; Jensen DE et al.; Bacteriophage T4-coded gene 32-protein is an essential component of the T4 replication and recombination systems . Alberts and co-workers (Alberts, B.M., Amodio, F.J., Jenkins, M., Gutmann, E.D., and Ferris, F.L . (1968) Cold Spring Harbor Symp . Quant . Biol . 33, 289-305) have shown that the major physiological activity of the protein involves preferential and cooperative binding to single-stranded DNA . In this paper, the physiochemical parameters characterizing this "melting" protein system are quantitatively determined . Boundary sedimentation velocity experiments are used to measure the interaction of gene 32-protein with native DNA . The binding is shown to be non-cooperative and involves an overlapping site size (nh) of approximately 10 nucleotide residues (or approximately 5 nucleotide pairs) . In analogy with the ribonuclease results (Jensen, D.E., and von Hippel, P.H . (1976) J . Biol . Chem . 251, 7198-7214), the logarithm of the association constant (Kh) is found to be linerarly related to log {Na+} . The binding of gene 32-protein to denatured (single-stranded) DNA involves appreciable distortion of the polynucleotide backbone from the unliganded conformation; binding totally unstacks the bases of both ribose- and deoxyribose-containing polynucleotides at 10 degrees, and results in a hyperchromic change exceeding that which can be induced by heating . This hyperchromism induced in poly(dA) on binding gene 32-protein under low salt (tight binding) conditions is used to determine a value of nc (the single-stranded DNA site size) of approximately 6.7 nucldotide residues per protein . In addition, gene 32-protein binding to single-stranded polynucleotide induces an unusual circular dichroic spectrum characterized principally by a marked decrease in the magnitude of the positive CD band centered at approximately 265 nm . This spectral change is attributed to significant uncoupling of the transition moments of the vicinal bases of the single-stranded polynucleotide on gene 32-protein binding, in accord with the ultraviolet hyperchromism observed . Binding of gene 32-protein to double helical DNA has virtually no effect on the spectral properties of this conformation... Mol Gen Genet, 1976 Nov 24, 149(1), 63 - 71 Recombination of bacteriophage T7 in vivo; Powling A et al.; Most recombination following infection with T7 was found to coincide with the time of most repid DNA synthesis, at about 20 min after infection at 30 degrees in minimal medium . Recombining DNA was investigated electron microscopically . Multiply branched DNA structures were observed after infection with T7 wild type, gene 3-, gene 6- and genes 3-, 6- phage, but not after infection with T7 gene 5- phage . Evidence is presented indicating that these structures are T7 DNA molecules in the process of recombining . The detailed structures of these recombinational intermediates suggest mechanisms by which T7 DNA initiates recombination. Mol Gen Genet, 1976 Nov 24, 149(1), 121 - 3 Analysis of a temperature sensitive mutation in gene cII of bacteriophage lambda; Oppenheim AB et al.; The mutation cIIts612 was found to map outside the immunity region of phage lambdaimm21 hybrid . As expected of a cII mutation, lambdacIIts612 is unable to stimulate either cI repressor or Int synthesis during the establishment of lysogeny . These results indicate that part of the cII gene of lambda is homologous to that of lambdaimm21 phage. Nature, 1976 Nov 18, 264(5583), 231 - 4 X-ray diffraction studies of circular superhelical DNA at 300-10,000-A resolution; Brady GW et al.; X-ray diffraction studies on circular superhelical DNA from bacteriophage PM2 at a very low scattering angle show that it is possible to measure the superhelical scattering function of the molecule . The results suggest that in addition to the primary supercoil, a higher order of supercoiling of the DNA is present, an effect which can be interpreted with a simple analogue. Mol Gen Genet, 1976 Nov 17, 148(3), 243 - 50 Overproduction of phage lambda repressor under control of the lac promotor of Escherichia coli; Gronenborn B; The gene coding for bacteriophage Lambda repressor (cI gene) has been fused to the lac operon of Escherichia coli . In some of the fusions Lambda repressor synthesis can be controlled by the lac operator and promoter . Upon induction of the lac operon the amount of Lambda repressor is increased by a factor of 7 over that found in a single lysogen . In combination with the polarity suppressor suA the induction factor rises to 20 . Transducing phages of one fusion were constructed . After thermal induction of this phage the final level of Lambda repressor was enhanced by a factor of 150. Eur J Biochem, 1976 Nov 15, 70(2), 577 - 87 Mapping of promoter sites on the genome of bacteriophage M13; Edens L et al.; With the aid of transcription studies on restriction fragments of bacteriophage M13 DNA it has been demonstrated that at least eight promoter sites are located on the M13 genome . Five of these promoters initiate the synthesis of RNA chains which contain at their 5'-terminal end pppG (G promoters), while the other three promoters initiate RNA chains which start exclusively with pppA (A promoters) . The positions of these promoter sites on the physical map are: 0.82 (G0.82), 0.88 (G0.88), 0.94 (G0.94), 0.01 (G0.01), 0.08 (G0.08), 0.36 (A0.36), 0.51 (A0.51) and 0.56 (A0.56) . The G promoters were found to be clustered within a distance of one-third of the genome length from the central termination site for transcription (map position 0.77) . The A promoters, however, were found at greater distances from this termination signal . Based upon the incorporation of {gamma-32P}ATP or {gamma-32P}GTP, the capacity of these promoters to initiate the synthesis of RNA chains varies . The strongest G promoters are G0.82, G0.94 and G0.08 and the strongest A promoter is A0.36 . As judged from their position on the genetic map, it is postulated that two promoters, namely G0.94 and G0.01, are located within gene II . The other promoters are most probably located immediately in front of the gene VIII/VII boundary (G0.82), and immediately in front of gene V (G0.88), gene II (G0.08), gene IV (A0.36), gene I (A0.51) and gene VI (A0.56) . No evidence has been obtained so far for the existence of a promoter immediately in front of gene III. Eur J Biochem, 1976 Nov 15, 70(2), 523 - 9 Replication of M-13 DNA in plamolysed Escherichia coli cells . Formation of fully synthetic duplex DNA; Kessler-Liebscher BE et al.; The replication of the double-stranded replicative-form DNA of bacteriophage M-13 was studied in a cellular system in vitro prepared by plasmolysis of M-13-am5-infected Escherichia coli cells . Newly synthesized DNA was density-labelled with bromodeoxyuridine triphosphate and analysed by equilibrium centrifugation in neutral CSCL . After a 60-min incubation at 30 degrees C 15-20% of the radioactive label in corporated from (32P)DGTP was found in fully synthetic duplex DNA, corresponding to 7-9 replicative form molecules/cell . The plasmolysed cell system is therefore capable of re-initiating new rounds of replicative form replication in vitro . The kinetics of labelling indicate that molecules are selected for replication at random from an intracellular pool of approximately 150 replicative form molecules . Rifampicin and nalidixic acid, which interfere with the semiconservative replication of replicative form DNA, completely prevent the formation of fully synthetic duplex DNA. Proc Natl Acad Sci U S A, 1976 Nov, 73(11), 4205 - 9 Protein cleavage during virus assembly: a novel specificity of assembly dependent cleavage in bacteriophage T4; Isobe T et al.; Cleavage of precursor proteins occurs during assembly of numerous viruses . Seven bacteriophage T4 head-related proteins areknown to be cleaved during morphogenesis . Sequences surrounding the cleavage sites in T4 head precursors P23 and IPIII are reported here . We previously determined the sequences of precursor and processed forms of IPII and IPI . Cleavage occurs at a glutamyl-alanyl bond in each protein . By comparison of sequences around five cleaved and four uncleaved Glu-Ala bonds in head precursors, it appears that cleavage is limited to the Thr or Ala, and X2 to hydrophilic residues . The results suggest the viral-induced assembly protease recognizes and cleaves an extended primary structure in the structurally dissimilar precursors. Proc Natl Acad Sci U S A, 1976 Nov, 73(11), 4174 - 8 Construction of plasmids carrying the cI gene of bacteriophage lambda; Backman K et al.; By techniques of recombination in vitro, we have constructed a plasmid bearing the repressor gene (cI) of bacteriophage lambda fused to the promoter of the lac operon . Strains carrying this plasmid overproduce lambda repressor . This functional cI gene was reconstituted by joining DNA fragments bearing different parts of that gene . Flush end fusion techniques, involving no sequence overlap, were necessary for the construction; in certain cases, the abutting of the DNA molecules bearing ends generated by different restriction endonucleases creates a sequence at the junction which is recognized by one of the restriction endonucleases. Proc Natl Acad Sci U S A, 1976 Nov, 73(11), 4159 - 63 Heat mutagenesis in bacteriophage T4: the transversion pathway; Bingham PM et al.; Heat induces transversions (as well as transitions) at G-C base pairs in bacteriophage T4 . The target base for transversions is guanine,which is converted to a product which is sometimes replicated and transcribed as a pyrimidine.A model for this process is proposed in which the deoxyguanosine glycosidic bond migrates from N9 to N2: the resulting deoxyneoguanosine may pair with normal guanine to produce G-C leads to C-G transversions. Proc Natl Acad Sci U S A, 1976 Nov, 73(11), 4125 - 9 Superstructure of linear duplex DNA; Vollenweider HJ et al.; The superstructure of a covalently closed circular DNA (of bacteriophage PM 2) was compared by electron microscopy with that of a linear duplex DNA (of bacteriophage T7) when ionic strength and benzyldimethylalkylammonium chloride concentration were varied . In parallel studies the sedimentation behavior of these DNAs was studied by analytical ultracentrifugation, but for technical reasons these had to be without benzyldimethylalkylammonium chloride . By combining the information from the two methods one has to conclude that with increasing ionic strength the linear duplex T7 DNA spontaneously forms a structure similar to that of the superhelical structure of closed circular PM 2 DNA . The superstructure is destroyed under premelting conditions and in the presence of an excess of ethidium bromide. Vopr Virusol, 1976 Nov-Dec, (6), 731 - 4 {Study of the structure of bacteriophage DD7 by the small angle of dispersion x-ray method}; Boiarintseva AK et al.; The method of roentgen small angle dispersion was used for the study of the structure of bacteriophage DD7 . According to the results, phage DD7 is a homogeneous icosahedral particle (with the edge of 410-415 A) with a round cylindrical tail (1700-1750 A in length, 110-120 A in diameter) . The lineal sizes of the head exceed those determined by electron microscope approximately by 25% . The thickness of the protein coat of the phage is 25-30 A, that is, 2 times less than that of phages Cd and PB-2 . This confirms the assumption that the lipid-containing portion of the phage coat is eliminated by centrifugation in cesium chloride density gradient. Ann Microbiol (Paris), 1976 Nov-Dec, 127B(4), 447 - 51 {Transduction of drug resistance factors and colicinogenic properties by bacteriophage phi-gamma (author's transl)}; Delhalle E et al.; Bacteriophage phi-gamma is capable of transducing long segments from hybrids R,Col,Trp plasmids carrying its prophage attachment site, even in absence of definite integration therein . Transductants inherite segments adjacent to the attachment site which may comprise determinants of drug resistance and of colicinogeny . Presence of a related plasmid in the recipient may have a helping effect probably in allowing recombination of the transduced genes with a replicon. Nucleic Acids Res, 1976 Nov, 3(11), 2959 - 70 Detection and identification of minor nucleotides in intact deoxyribonucleic acids by mass spectrometry; Wiebers JL; A mass spectral method is described for the detection and identification of unusual nucleotide residues present in DNAs . Analysis by this method of intact, underivatized DNA from salmon sperm, calf thymus, mouse L-cells, wheat germ, M . lysodeikticus, E . Coli, and the bacteriophages 0X-174, fd, and lamda, yields diagnostic ions for the four common components of DNA as well as characteristic ions for 5-methyldeoxycytidine residues . The spectrum from T2 DNA contains ions indicative of 5-hydroxymethyldeoxycytidine and 5-methyldoxycytidine components but no ions corresponding to deoxycytidine residues . The DNAs of phages fd and 0X-174 also display ion products indicative of N6-methyldeoxyadenosine residues . Additional series of ions in the spectra of all four bacteriophage DNAs suggest the presence of 5-substituted deoxyuridine residues . The detection method exhibits considerable sensitivity in that amounts of DNA as low as 0.01 A260nm units can be used in the analysis, and thus, the procedure should prove of some value in the detection and location of modified components in specific regions of the various genomes by analysis of the appropriate endonuclease restriction fragments. Genetics, 1976 Nov, 84(3), 423 - 36 Marker effects on reversion of T4rII mutants; Ronen A et al.; The frequencies of 2-aminopurine- and 5-bromouracil-induced A:T leads to G:C transitions were compared at nonsense sites throughout the rII region of bacteriophage T4 . These frequencies are influenced both by adjacent base pairs within the nonsense codons and by extracodonic factors . Following 2AP treatment, they are high in amber (UAG) and lower in opal (UGA) codons than in allelic ochre (UAA) codons . In general, 5BU-induced transitions are more frequent in both amber and opal codons than in the allelic ochre codons . 2AP- and 5BU-induced transition frequencies in the first and third positions of opal codons are correlated with those in the corresponding positions of the allelic ochre codons . Similarly, the frequencies of 2AP-induced transition in the first and second positions of amber codons and their ochre alleles are correlated . However, there is little correlation between the frequencies of 5BU-induced transitions in the first and second positions of allelic amber and ochre codons. J Bacteriol, 1976 Nov, 128(2), 644 - 50 Restriction of a bacteriophage of Streptomyces albus G involving endonuclease SalI; Chater KF et al.; The bacteriophage Pa16, isolated from soil on Streptomyces albus G, was restricted when transferred from an alternative host back to S . albus G . Extracted unmodified Pa16 deoxyribonucleic acid was cleaved at a single site by a cell-free extract of S . albus G . Fractions cleaving Pal6 deoxyribonucleic acid contained the endonuclease SalI first described by J . Arrand, P . Myers, and R . J . Roberts (unpublished data) . A mutant of S . albus G was isolated which was defective in both restriction and modification of Pal6 . This mutant lacked SalI activity . It is concluded that SalI is the agent of restriction of Pal6 by S . albus G. Can J Microbiol, 1976 Nov, 22(11), 1647 - 53 The isolation of an infectious A protein--RNA complex from coliphage R17; Reynolds S et al.; The coprecipitate of A protein and RNA which results from acetic acid treatment of bacteriophage R17 has been shown to form two bands after equilibrium density gradient centrifugation in Cs2SO4 . The band of higher density, whose position coincides with that of phage RNA prepared by phenolisation possesses neither A protein nor infectivity while the band of lower density which contains both RNA and A protein is infectious for intact E . coli cells . The nature of the bonding between the A protein and the RNA was also investigated. Gut, 1976 Nov, 17(11), 844 - 8 Immune response to phi X 174 in man . 5 . Primary and secondary antibody production in primary biliary cirrhosis; Thomas HC et al.; In primary biliary cirrhosis, the primary immune response to the bacteriophage phi X 174 is normal but the secondary response is significantly reduced . The reduction is primarily of IgG antibody, while IgM is proportionately less affected . These changes may be the result of a reduction in helper T lymphocyte function and may contribute to the increase in the ratio of serum concentration of IgM to IgG. J Gen Virol, 1976 Nov, 33(2), 309 - 19 Polypeptides specified by bacteriophage T1; Martin DT et al.; The proteins synthesized during the replication of phage TI in u.v.-irradiated Escherichia coli strain B have been examined by polyacrylamide gel electrophoresis of polypeptides pulse-labelled with 14C-amino acids . Up to 50 discrete bands were identified of which about 30 were sufficiently distinct to be classified in terms of time of synthesis . Three polypeptides were synthesized only during the first 6 to 8 min post infection (Class I, Early); 16 or 17 were synthesized predominantly during the later stages of replication starting from 6 to 8 min after infection (Class III, Late); three classes of proteins were made continuously, two at constant rate (Class II, Continuous), five at decreasing rate (Class IV, Early-continuous) and five at increasing rate (Class V, Late-continuous) . Of the 14 polypeptides identified as structural components of the virion, three (P7, PI0 and PI) account for about 85% of the particle weight with P7 comprising 50% of the particle . P7 and PI0 appear to result from the cleavage of larger polypeptides . Preliminary studies with amber mutants suggest that normal levels of TI DNA synthesis are not required for the manufacture of late proteins and that a phage-controlled function may control the switch-off of proteins made early and the switch-on of proteins made late. Cell, 1976 Nov, 9(3), 449 - 63 A functional requirement for modification of the wobble nucleotide in tha anticodon of a T4 suppressor tRNA; Colby DS et al.; Temperature-sensitive mutants of E . coli have been isolated which restrict the growth of strains of bacteriophage T4 which are dependent upon the function of a T4-coded amber or ochre suppressor transfer RNA . One such mutant restricts the growth of certain ochre but not amber suppressor-requiring phage . Analysis of the T4 tRNAs synthesized in this host revealed that many nucleotide modifications are significantly reduced . The modifications most strongly affected are located in the anticodon regions of the tRNA'S . The T4 ochre suppressor tRNAs normally contain a modified U residue in the wobble position of the anticodon; it has been possible to correlate tha absence of this specific modification in the mutant host with the restriction of suppressor activity . Furthermore, the extent of this restriction varies dramatically with the site of the nonsense codon, indicating that the modification requirement is strongly influenced by the local context of the mRNA . An analysis of spontaneous revertants of the E . coli ts mutant indicates that temperature sensitivity, restriction of phage suppressor function, and undermodification of tRNA are the consequences of a single genetic lesion . The isolation of a class of partial revertants to temperature insensitivity which have simultaneously become sensitive to streptomycin suggests that the translational requirement for the anticodon modification can be partially overcome by a change in the structure of the ribosome. J Virol, 1976 Nov, 20(2), 400 - 12 Bacterial rep- mutations that block development of small DNA bacteriophages late in infection; Tessman ES et al.; Several related mutants of Escherichia coli C have been isolated that block the growth of the small icosahedral DNA phages phiX174 and S13 late in infection . Phage G6 is also blocked, at a stage not yet known . Growth of the filamentous phage M13, though not blocked, is affected in these strains . These host mutations co-transduce with ilv at high frequency, as do rep- mutations . However, the new mutants, designated groL-, differ from previously studied rep- mutants in that they permit synthesis of progeny replicative-form DNA . The groL- mutants are blocked in synthesis of stable single-stranded DNA of phiX174 and related phages . They are gro+ for P2 . Evidence that groL- mutations and rep- mutations are in the same gene is presented . Spontaneous mutants (ogr) of phiX174, S13, and the G phages can grow on groL- strains . The ogr mutations are located in the phage's major capsid gene, F, as determined by complementation tests . There are numerous sites for mutation to ogr . Some mutations in genes A and F interfere with the ogr property when combined with an ogr mutation on the same genome . The ogr mutations are cis acting in a groL- cell; i.e., an ogr mutant gives very poor rescue of a non-ogr mutant . The wild-type form of each G phage appears to be naturally in the ogr mutant state for one or more groL- strains . It is suggested that a complex between F and rep proteins is involved in phage maturation . The A protein appears to interact with this complex. J Virol, 1976 Nov, 20(2), 441 - 5 Evidence that mismatched bases in heteroduplex T4 bacteriophage are recognized in vivo; Berger H et al.; T4 heteroduplex heterozygotes are lost selectively after prolonged incubation of phage-infected Escherichia coli cells under nonreplicating conditions . The loss of heterozygosity occurs for four out of six rII sites tested and is not dependent upon T4 v gene function . The results are interpreted to indicate the existence of a base-specific system for the recognition of mismatched bases in intracellular DNA. Biochem J, 1976 Nov, 159(2), 317 - 22 Isolation and characterization of two sequence-specific endonucleases from Anabaena variabilis; Murray K et al.; Two endonucleases, AvaI and AvaII, were isolated from Anabaena variabilis on the basis of their ability to make a limited number of breaks at specific points in bacteriophage lambda DNA . Neither enzyme has cofactor requirements beyond Mg2+ . Endonuclease AvaI makes eight breaks in the phage lambda chromosome at which the 5'-terminal sequence is pPy-C-G-N . AvaII endonuclease cuts phage lambda DNA more extensively, yielding fragments with the 5'-terminal sequence G-T-C-N or G-A-C-N . Neither enzyme generates cohesive ends. J Biol Chem, 1976 Oct 25, 251(20), 6379 - 87 Protein synthesis in rabbit reticulocytes . Characteristics of mRNA (AUG codon)-dependent binding of Met-tRNAfMet to 40 S and 80 S ribosomes; Chatterjee B et al.; The characteristics of Met-tRNAfMet binding to ribosomes (40 S and 80 S) were studied using a two-stage assay method (Gupta, N.K., Chatterjee, B . and Majumdar, A . (1975) Biochem . Biophys . Res . Commun . 65, 797) and the complexes formed were analyzed either by Millipore filtration or by sucrose density gradient centrifugation . The results are summarized as follows: (a) with both assay methods, Met-tRNAfMet binding to 40 S ribosomes was entirely dependent upon addition of a partially purified mixture of initiation factors and AUG codon; (b) this binding occurred over a wide Mg2+ concentration range; significant binding was observed even at 20 mM Mg2+; (c) upon addition of 60 S ribosomes, a significant part of Met-tRNAfMet bound to 40 S ribosomes was transferred to 80 S complex . This transfer reaction had a sharp Mg2+ optimum around 2 mM . Met-tRNAfMet-80 S-AUG complex thus formed was active in Met-puromycin synthesis; (d) Met-tRNAfMet deacylase present in crude 0.5 M KCl ribosomal wash is a potent inhibitor of the binding reaction as it deacylates Met-tRNAfMet in the Met-tRNAfMet-40 S-AUG complex; (e) glutaraldehyde (0.5%) degrades Met-tRNAfMet-40 S-AUG complex but increases the background binding of Met-tRNAfMet to 40 S ribosomes in the absence of AUG codon; (f) polynucleotides containing uracil and adenosine are strong inhibitors of Met-tRNAfMet binding to 40 S ribosomes . The order of inhibitory activities of the polynucleotides tested was as follows: poly(rU)-poly(rA) (2:1) greater than poly(rU)-poly(rA) (1:1) greater than poly(rU) greater than poly(rA) . Other RNAs tested such as poly(rC), poly(rI)-poly(rC) and phi6 bacteriophage RNA (double-stranded) were without significant effects on the Met-tRNAfMet-binding reaction. Biochim Biophys Acta, 1976 Oct 18, 447(3), 274 - 84 Mechanism of hydroxylamine mutagenesis . Crystal structure and conformation of 1,5-dimethyl-N4-hydroxycytosine; Shugar D et al.; The crystal structure of the title compound, which is a formal analogue of 5-methyl-N4-hydroxycytosine nucleosides, has been determined by X-ray diffraction . The space group is P2(1)/c with a = 7.368 (2), b = 12.096 (3), c = 9.192 (4) A, beta = 113.94 (3) degrees . Three-dimensional intensity data were collected with a four-circle diffractometer, and the structure was refined by block-diagonal least-squares to R = 0.053 . The compound is in the imino form, and the exocyclic N4-OH is located essentially in the plane of the pyrimidine ring, and syn to the ring (N(3) . There is an intramolecular hydrogen bond involving the N(3)-H as donor and O(4) as acceptor, viz . N(3)-H(31)----O(4)-H . With this conformation, which probably prevails also in solution, the compound would be unable to participate in normal Watson-Crick base pairing . It is shown that a similar situation may prevail for N4-hydroxycytosine nucleosides . The implications with regard to the molecular mechanism of hydroxylamine mutagenesis, with particular reference to the T-even bacteriophages, are discussed . Analogous considerations are applied to an examination of the possible behaviour of hydroxylamine-modified adenine nucleosides. Mol Gen Genet, 1976 Oct 18, 148(1), 93 - 8 A transducing bacteriophage lambda carrying the structural gene for elongation factor Ts; Friesen JD et al.; A specialized transducing bacteriophage lambdadpolCdap D-9 has been isolated that carries the structural gene for EF-Ts1 (tsf) . The presence of EF-Ts among the proteins synthesized under the direction of this phage in UVL-inactivated cells has been detected by two-dimensional gel electrophoresis and has been verified by antibody precipitation . In an induced lysogen of this phage the relative rate of synthesis of EF-Ts is increased 4-fold . Evidence is presented which suggest that the structural genes for ribosomal protein S2 (rpsB) and RNA polymerase sigma factor (sit) also lies on lambdadpolCdap D-9. Mol Gen Genet, 1976 Oct 18, 148(1), 79 - 82 Isolation and characterization of phi80dgal transducing phages that carry gal operator-promoter insertion mutations; Besemer J et al.; phi80dgal transducing bacteriophages have been isolated by the F-fusion technique of Press et al . (1971) and gal-operator-promoter insertion mutations have been introduced by homogenate formation . Five different phi80dgal isolates have been studied in more detail . One of the phi80 phages transduces the gal operon and gene aroG as well as at least part of the trp-operon; the gal operon of another phi80dgal transducing phage is inverted with respect to the phi80dgal sequences . Heteroduplex DNA mapping indicates that one of the phi80dgal isolates in addition to the gal operon and a portion of the adjacent chromosomal region carries an IS2-element which is derived from the F'gal episome . The isolated phi80dgal phages may be utilized for preparing pure gal mRNA and insertion-RNA as well as pure gal operon DNA. Mol Gen Genet, 1976 Oct 18, 148(1), 31 - 42 Isolation of lambda prophage mutants defective in structural genes: their use for the study of bacteriophage morphogenesis; Katsura I; Mutants of coliphage lambda defective in structural genes were isolated and characterized . The isolation method consisted in lysogenizing bacteria with mutagenized phage and testing for inability to form plaques after heat induction . The mutants were propagated as prophages in the lysogens . Mutants in the region of the tail-genes U, V, G and H were enriched for by a selection method based on recombination and complementation with known mutants, and they were mapped by deletion mapping with newly isolated lambdadg's . The lysates of all the mutants were examined by electron microscopy . Some of the mutants showed phenotypes different from those of known amber mutants in the same genes . They are interpreted as producing partially active, altered gene products and might be useful for the studies of morphogenesis and of the mechanism of infection. Mol Gen Genet, 1976 Oct 18, 148(2), 175 - 82 Specificity of polarity suppression in E . coli: correction of defects in gene N, but not in gene Q, of phage lambda; Dambly C et al.; The bacterial mutation psuA1, known as (suA) a polarity suppressor, partially relieves all N defects in bacteriophage lambda growth . No evidence is found that psuA1 relieves Q defects in lambda growth . Specific mechanisms of action by the N and Q gene products are discussed . The psuA1 mutation was also found to suppress IS1 type but not IS2 type insertion mutations in lambda. Mol Gen Genet, 1976 Oct 18, 148(2), 171 - 3 Efficient suppression of the requirement for N function of bacteriophage lambda by a Rho-defective E.coli suA mutant; Belfort M et al.; The E . coli suA mutant (T82), which is a suppressor of polarity by virtue of its impaired transcription termination factor (rho) activity, is shown to be an efficient suppressor of lambdaN- mutants . The relief of the N requirement by this host is reflected in a substantial restoration of growth and N-dependent beta-galactosidase expression as well as in a partial relief of polarity of N-defective phages. Mol Gen Genet, 1976 Oct 18, 148(2), 139 - 42 Host factor requirements and some properties of phiXtB . An evolutionary aspect of phiX-type phages; Taketo A; Replication of phiXtB, a capsid mutant of bacteriophage phiX174, depends on the host functions directed by the E.coli genes dnaE, dnaF, dnaG, dnaZ, lig and rep . The cellular products of dnaA, dnaB, dnaC(D), dnaI, dnaP, polA, polB and xth genes are, however, dispensable for the viral growth . In these host factor requirements, phiXtB resembles phages phiK and St-1 rather than phiX174 . Host ranges of phiXtB, St-1 and phiK overlap considerably, and growth temperature of the three phages is somewhat higher than that of phiX174 . Furthermore, phiXtB is, like phiK, inactivated by antiserum against St-1 . phiXtB may thus fill an evolutionary gap between the phiX174 group and the St-1 group. Mol Gen Genet, 1976 Oct 18, 148(2), 131 - 8 The molecular mechanism of virus induction . I . A procedure for the biochemical assay of prophage induction; Smith CL et al.; The basic conditions for use of a new biochemical assay of bacteriophage induction are described . This method is based on the read-through transcription of the tryptophan operon integrated into an "early" transcribed region of the bacteriophage phi80 or gamma genome . Inactivation of repressor molecules was assayed by measuring, in the presence of tryptophan, anthranilate synthetase activity in an Escherichia coli (trpE-) phi80 or gamma lysogen infected with phi80ptrp or gammaptrp, respectively, and treated with mitomycin C or UV irradiation . This method provides a sensitive and easy means to analyze the induction process. Biochim Biophys Acta, 1976 Oct 18, 447(3), 319 - 27 Addition by ATP: RNA adenylyltransferase from Escherichia coli of 3'-linked oligo(A) to bacteriophage Qbeta RNA and its effect on RNA replication; Devos R et al.; An oligo(A) or poly(A) segment was added in a stepwise fashion to the 3'-end of bacteriophage Qbeta-RNA with the aid of ATP : RNA adenylyltransferase from Escherichia coli . Nearly all RNA molecules, present in the reaction mixture, could be polyadenylated . For tail lengths not exceeding 200 nucleotide residues, the physical properties of Qbeta-RNA-poly(A) were found to be only slightly different from those of the original RNA . The polyadenylated RNA was purifed by affinity chromatography . The properties of Qbeta-RNA with oligo(A) tails of different average lengths were investigated in the in vitro replication reaction . Almost complete abolishment of template activity, even by short oligo(A) stretches, was found . Furthermore, polyadenylated Qbeta-RNA inhibited the normal replication reaction of Qbeta-RNA by removal of host factor HFI, in the same way as does free poly(A). Biochemistry, 1976 Oct 5, 15(20), 4403 - 9 Temperature-sensitive DNA polymerase induced by a bacteriophage T5 mutant: relationship between polymerase and exonuclease activities; Fujimura RK et al.; DNA polymerase induced by bacteriophage T5ts53, a mutant with temperature-sensitive polymerase, was purified to about 95% purity as judged by dodecyl sulfate gel electrophoresis . The 3' leads to 5' exonuclease associated with the polymerase had higher activity than that associated with the parent wild-type enzyme . It was more stable to heat than the polymerase, and it degraded primer-template even in the presence of 4 dNTP's at higher temperature . However, the evidence presented shows that the inhibition of DNA synthesis by higher temperature was primarily due to defects in polymerase function rather than to overactive exonuclease . The presence of primer-template DNA stabilized the polymerase to heat . Purified ts53 polymerase was also shown to discriminate against incorportion of BrdUMP, especially at higher temperature . This is an agreement with observations made in vivo with ts53-infected bacteria. Nucleic Acids Res, 1976 Oct, 3(10), 2485 - 90 Construction of a hybrid col E1 plasmid carrying the gene for bacteriophage lambda repressor; Tikhomirova LP et al.; A biologically active hybrid DNA molecule was constructed from plasmid Col E1 and the Eco R1 fragment of lambda DNA containing the gene for lambda repressor . The presence of this gene in the hybrid molecule was demonstrated genetically . The hybrid plasmid contains two closely located targets for restriction endonuclease Hind 111 in the integrated fragment . Thus, the plasmid may be used as a vector not only for Eco R1 fragments but also for Hind 111 fragments. Proc Natl Acad Sci U S A, 1976 Oct, 73(10), 3524 - 8 Restriction assay for integrative recombination of bacteriophage lambda DNA in vitro: requirement for closed circular DNA substrate; Mizuuchi K et al.; A novel assay has been developed for in vitro genetic recombination of DNA . Substrate and product DNAs are cleaved with a restriction endonuclease and the resulting fragments are separated by electrophoresis in agarose gels . The substrate DNA has been chosen so that the recombination to be studied deletes a segment of DNA . The remaining DNA gives rise to a unique restriciton fragment, as does the DNA segment that has been removed . The method provides a convenient and physical, rather than genetic, assessment of the conversion of parental to recombinant DNA . This method has been applied to an in vitro system that carries out integrative recombination of bacteriophage lambda . We find that, different molecular forms of DNA tested, closed circular DNA is the only efficient substrate . Linear DNA and three kinds of circular DNA containing interruptions are at best very poor substrates . The implications of this surprising result are discussed . In addition, we show that the in vitro recombination system completes the breaking and rejoining steps of recombination . No stable DNA intermediates involving chiasmata or broken end structures are found. Proc Natl Acad Sci U S A, 1976 Oct, 73(10), 3519 - 23 Mapping of in vivo messenger RNAs for bacteriophage phiX-174; Hayashi M et al.; In vivo messenger RNA for bacteriophage phiX174 was fractionated in agarose gels into a number of discrete species ranging in size from 0.23 X 10(6) to 2.3 X 10(6) daltons . These RNA species were eluted from the gels and hybridized to specific fragments derived from phiX-174 replicative form DNA by cleavage with restriction enzymes . A map of the orientation of in vivo messenger RNAs with respect to the bacteriophage genetic map was constructed . This map indicated that initiation of messenger RNA occurred before gene B, gene C or D, and probably before gene A and that termination occurred after genes E, F, G, and H . Termination of transcription at any particular site appeared not to be entirely effective such that a number of overlapping transcripts with the same 5'-terminus was observed . Messenger RNA for gene A seemed to be relatively unstable. Nucleic Acids Res, 1976 Oct, 3(10), 2411 - 26 The isolation and characterization of bacteriophage T7 messenger RNA fragments containing an RNase III cleavage site; Kramer RA et al.; We have isolated overlapping RNA fragments which contain the region surrounding the ribonuclease III cleavage site between bacteriophage T7 genes 0.3 and 0.7 . Although all of these fragments contain the site of cleavage, only certain fragments are correctly recognized and cleaved by RNase III . Analysis of the cleavage products of the fragments indicates that the enzyme produces a single endonucleolytic break at this site in the T7 early RNA precursor molecule . In addition, the 3'-terminal adenylic acid residues observed previously on the in vivo T7 early RNA species were not found in these fragments and, therefore, must represent a post-transcriptional, post-processing modification of the RNA. J Virol, 1976 Oct, 20(1), 63 - 9 Mapping of two isoleucine tRNA isoacceptor genes in bacteriophage T5 DNA; Hunt C et al.; T5 bacteriophage codes for the synthesis of more than 14 different tRNA species, which map in four separate clusters in the C segment of the T5 chromosome . In this study, two tRNAile isoacceptor species have been identified by reverse-phase chromatography and shown to be transcribed from two different tRNA loci along the T5 chromosome . The map positions of the tRNA isoacceptors were aided by the use of several T5 deletion mutants in which the position and size of the deleted DNA segments had been previously determined by heteroduplex mapping . Hybridization analysis suggests the presence of some sequence homology between the two tRNAile species. J Bacteriol, 1976 Oct, 128(1), 283 - 9 Isolation of specialized transducing bacteriophages carrying deletions of the regulatory region of the Escherichia coli K-12 tryptophan operon; Jones BB et al.; A lysogen of a wild-type strain of Escherichia coli K-12 carrying a heat-inducible lambda-phi80 hybrid prophage was induced to yield transducing phages carrying all of the structural genes of the tryptophan operon . The presence or absence of elements of the trp regulatory region was determined by examining the effects of lambda genes N and cI on trp gene expression . The phages were further characterized by transduction studies and by examining anthranilate synthetase (EC 4.1.3.27) (TRYPE+D) synthesis in the presence of the lambda cI product . A number of phages deleted for the trp promoter were found . Recombination studies between trpOc bacteria and the transducing phages have yielded information that can be used to order the trp end points of some phages and to provide an estimate of the size of the trp promoter region. Nucleic Acids Res, 1976 Oct, 3(10), 2665 - 75 Studies on the biological role of DNA methylation . II . Role of phiX174 DNA methylation in the process of viral progeny DNA synthesis; Friedman J et al.; In vivo inhibition of bacteriophage phiX174 DNA methylation by nicotinamide resulted in the accumulation of replicative intermediates with multiple-genome length single-stranded "tails" . These abnormal replicative intermediates could not be chased into viral single-stranded circular DNA . The effect of nicotinamide on phage maturation and accumulation of abnormal replicative intermediates could be reversed by washing out the inhibitor . The results suggest that the single methyl group present in the viral DNA serves as a recognition site for a specific endonuclease, probably the gene A protein product, that is responsible for the excision of the single-stranded one-genome long viral DNA, before final maturation of the virus occurs. J Virol, 1976 Oct, 20(1), 70 - 7 Exonuclease associated with bacteriophage T5-Induced DNA polymerase; Das SK et al.; T-5-induced DNA polymerase has been shown to possess a 3' leads to 5'-exonucleolytic activity . The exonuclease acts on both native and denatured DNA, but the apparent rate of degradation of denatured DNA is about five times faster than that for native DNA . The enzyme appears to act only on 3'-OH ends and produces mainly 5'-dNMP's . Like polymerase activity, exonuclease activity shows a pH optimum around 8.6 . Mg2+, dithiothreitol, and N-ethylmaleimide had identical effects on both the activities . Nicked DNA was almost totally protected from exonuclease action under synthetic conditions, i.e., in the presence of 4dNTP's . Denatured DNA was partly degraded in the early phase of incubation with 4dNTP's, presumably due to unhybridized tails at the 3'-OH primer ends . However, the exonuclease activity was operative in both cases under synthetic conditions, as evidenced by template-dependent conversion of {3H}dTTP to {3H}dTMP. J Immunol, 1976 Oct, 117(4), 1387 - 91 Comparison of the inactivation of IgM and IgG complement fixation sites by acid and base; Stollar BD et al.; Rabbit IgM antibodies to denatured mammalian or T6 bacteriophage DNA or poly(A)-poly(U) irreversibly lost complement-(C) fixation reactivity on exposure to low pH and reneutralization, with a halving of the complement-fixation titer occurring after treatment at about pH 3 . The titers of IgG antibodies to denatured phage DNA, to poly(A)-poly(U), or to hemocyanin were halved only after exposure to pH 2 . Inactivation by acid was enhanced by low protein concentrations, incubation at higher temperatures, and by slow reneutralization; under all these conditions it was more extensive with IgM than with IgG . Inactivation of IgM C-fixation activity at pH 2.5 and room temperature was a first order reaction, with a half-time of about 20 min . Both classes retained antigen-binding activity after exposure to pH 2 . In the alkaline range, full C-fixation reactivity was retained by both classes after reneutralization from pH 11.5, some loss occurred at pH 12, and total irreversible inactivation occurred by pH 12.5 . In the latter case, antigen-binding activity was also lost . The C-fixation inactivation curves in the alkaline range were similar for IgG and IgM antibodies. J Biol Chem, 1976 Sep 10, 251(17), 5225 - 32 Control of mutation frequency by bacteriophage T4 DNA polymerase . II . Accuracy of nucleotide selection by the L88 mutator, CB120 antimutator, and wild type phage T4 DNA polymerases; Gillin FD et al.; The accuracy of nucleotide selection by wild type, L88 mutator, and CB120 antimutator T4 DNA polymerases has been compared by measuring both stable incorporation of complementary and noncomplementary nucleotides into polymer and the DNA-dependent conversion of deoxynucleoside triphosphate to monophosphate . The increased accuracy of the CB120 antimutator enzyme is shown by a ratio of utilization of incorrect to correct nucleotides with poly(dA)-poly(dT) as template which is only 10 to 30% of that of the wild type enzyme . In contrast, the ratio of incorrect to correct nucleotide utilized by the L88 mutator enzyme with this template was higher than that of the wild type enzyme, in agreement with the report of Hershfield (Hershfield, M.S . (1973) J . Biol, Chem . 248, 1417-1423) . The antimutator, mutator, and wild type enzymes each have a much higher apparent Km for the noncomplementary nucleotides than for complementary nucleotides with this template . The L88 mutator polymerase has a higher "Km" for poly(dA)-poly(dT) than the wild type enzyme in reactions with both complementary and noncomplementary nucleotides . The antimutator polymerase has an elevated "Km" for polymer only for reactions with noncomplementary nucleotides . The wild type and L88 mutator enzymes also utilized both noncomplementary nucleotides much more frequently than the CB120 antimutator enzymes with poly {d(A-T)} as the template-primer . The T4 gene 32DNA unwinding protein appears to facilitate the correct reading of this template since it decreases the ratio of incorrect nucleotides utilized by both the wild type and L88 mutator polymerases. J Biol Chem, 1976 Sep 10, 251(17), 5219 - 24 Control of mutation frequency by bacteriophage T4 DNA polymerase . I . The CB120 antimutator DNA polymerase is defective in strand displacement; Gillin FD et al.; The ts CB1200 (antimutator) mutation in bacteriophage T4 DNA polymerase increases the accuracy of DNA replication since it results in a decrease in the frequency of mutations in other phage genes . The CB120 polymerases differs from the wild type enzyme in the slow rate at which it copies templates where primer extension requries displacement of polynucleotides base-paired to the template strand, even in the presence of the T4 DNA unwinding protein (gene 32-protein) . The ratio of nucleotides turned over (DNA-dependent conversion of deoxynucleoside triphosphate to deoxynucleoside monophosphate) to nucleotides stably incorporated into product is 10 to 100 times higher with the mutant than wild type enzyme, depending on the DNA used as the template . This high turnover rate may increase the efficiency of removal of noncomplementary nucleotides by the antimutator enzyme and is in agreement with the findings of Muzyczka et al, (Muzyczka, N., Poland, R . L., and Bessman, M . J . (1972) J . Biol, Cehm . 247, 7116-7122) with the L141 and L42 antimutator T4 DNA polymerases . Since the 3'- to 5'-exonuclease activity of the CB120 mutant polymerase is not higher than that of the wild type enzyme, it is suggested that the high turnover rate may result from increased opportunity to remove newly incorporated nucleotides due to the slow rate at which the mutant enzyme moves to the next template nucleotide . In the accompanying paper we show that the CB120 antimutator polymerase also initially selects incorrect nucleotides for incorporation less frequently than the wild type enzyme . Thus this antimutator polymerase appears to have both greater accuracy in nucleotide selection and an enhanced ability to remove incorrect nucleotides. J Biol Chem, 1976 Sep 10, 251(17), 5124 - 40 Escherichia coli tyrosine transfer ribonucleic acid genes . Nucleotide sequences of their promoters and of the regions adjoining C-C-A ends; Contreras R et al.; The template-dependent primer elongation method for determining DNA sequences of specific regions (e.g . Loewen, P., Sekiaya, T., and Khorana, H . G . (1974) J . Biol . Chem . 249, 217-226) has been applied to the determination of the sequences of the promoters and of the regions beyond the C-C-A ends of the tyrosine tRNA genes in Escherichia coli . The following results have been obtained . (a) The promoter of the tRNA1Tyr (su+) gene in the bacteriophage phi80psu+III (the singlet strain) and phi80psu+-III (the doublet strain) and, significantly, the promoter of the tRNA2Tyr gene in the bacteriophage lambdah80dglyTsu+36 all have the following identical sequence in the first 59 nucleotides: (see article) Transcription begins at the underlined terminal nucleotide and proceeds to the right . (b) tRNA1Tyr (su+) as present in the singlet strain phi80psu+III and the tRNA1Tyr (su-), the second gene in the doublet strain phi80psu+-III, have the following identical sequence beyond the C-C-A sequences: (5') TCACTTCAAAAGTCCTGAACT (3') (c) tRNA1Tyr (su+), the first gene in the doublet strain phi80psu+-III, has the sequence (5') TAATTCACCACAGGG (CA) (3'), and tRNA2Tyr in lambdah80dglyTsu+36 has the sequence (5') ATTTCGGCCACGCGA (TGCGG) (3') beyond the C-C-A nucleotides. Proc Natl Acad Sci U S A, 1976 Sep, 73(9), 3098 - 102 A gene of bacteriophage T4 whose product prevents true late transcription on cytosine-containing T4 DNA; Snyder L et al.; T-even coliphages have 5-hydroxymethylcytosine in their DNA instead of cytosine . In some T4 mutants, the replicated DNA contains cytosine, but then no late gene products are made . We show that the inability to make late gene products with cytosine-containing T4 DNA is due to a T4 gene products . This gene product, while probably nonessential under normal conditions, interacts with an essential part of the transcription apparatus . Mutations in this gene allow viable T4 particles to be made whose DNA has been substituted almost 100% with cytosine. Biochem J, 1976 Sep 1, 157(3), 721 - 40 The binding of echinomycin to deoxyribonucleic acid; Wakelin SP et al.; Echinomycin is a peptide antibiotic which binds strongly to double-helical DNA up to a limit of approximately one molecule per five base-pairs . There is no detectable interaction with rRNA and only extremely feeble non-specific interaction with poly(rA)-poly(rU) . Heat denaturation of DNA greatly decreases the binding, and similarly limited interaction is observed with naturally occurring single-stranded DNA . Association constants for binding to nine double-helical DNA species from different sources are presented; they vary by a factor of approximately 10, but are not simply related to the gross base composition . The interaction with DNA is ionic-strength-dependent, the binding constant falling by a factor of 4 when the ionic strength is raised from 0.01 to 0.10mol/litre . From the effect of temperature on the association constant for calf thymus DNA, the enthalpy of interaction is calculated to be about -13kJ/mol (-3kcal/mol) . Binding of echinomycin persists in CsCl gradients and the buoyant density of nicked bacteriophage PM2 DNA is decreased by 25 mg/ml . Echinomycin interacts strongly with certain synthetic poly-deoxynucleotides, the binding constant decreasing in the order poly(dG)-poly(dC) greater than poly(dG-dC) greater than poly(dA-dT) . For the latter two polymers the number of base-pairs occluded per bound antibiotic molecule is calculated to be three, whereas for poly(dG)-poly(dC) it is estimated to be four to five . Poly(dA)-poly(dT) and poly(dI)-poly(dC) interact only very weakly with the antibiotic . Poly(dI-dC) interacts to a slightly greater extent, but the binding curve is quite unlike that seen with the three strongly binding synthetic polynucleotides . Echinomycin affects the supercoiling of closed circular duplex bacteriophage PM2 DNA in the characteristic fashion of intercalating drugs . At low ionic strength the unwinding angle is almost twice that of ethidium . Likewise the extension of the helix, determined from changes in the viscosity of rod-like sonicated DNA fragments, is nearly double that expected for a simple (monofunctional) intercalation process . On this basis the interaction process is characterized as bifunctional intercalation . At higher ionic strength the unwinding angle relative to that of ethidium and the helix extension per bound echinomycin molecule fall, indicating a smooth progression towards more nearly monofunctional intercalation . Two simpler compounds which act as analogues of the quinoxaline chromophores of echinomycin, quinoxaline-2-carboxamide and the trypanocidal drug Bayer 7602, interact with DNA very much more weakly than does echinomycin, showing that the peptide portion of the antibiotic plays an essential role in determining the strength and specificity of the interaction. J Virol, 1976 Sep, 19(3), 792 - 800 Characterization of an RNA-a protein complex isolated from the RNA bacteriophage M12; Leipold B et al.; The properties of an RNA-A protein complex isolated from the RNA bacteriophage M12 are described . The molar ratio of RNA to A protein in the complex is estimated to be 1:1 . In sucrose gradients, the complex sediments like free RNA molecules . In contrast to RNA alone, which can only infect spheroplasts, the RNA-A protein complex infects intact Escherichia coli cells and produces infectious progeny particles like the original phage . Evidence is presented that the infection of the host cells by the complex takes place via F pili . All of the infectivity disappears if the ionic bonds of RNA to A protein in the complex are dissociated in 0.5 M sodium chloride buffer at 37 degrees C . Furthermore, the kinetics of complex dissociation and loss of infectivity are the same, implying that the binding of A protein to the RNA is a prerequisite for infectivity on intact host cells. Eur J Biochem, 1976 Sep, 68(1), 139 - 52 Structure and synthesis of a lipid-containing bacteriophage . Purification, chemical composition, and partial sequences of the structural proteins; Hinnen R et al.; The four structural proteins of the lipid-containing bacteriophage PM2 have been purified by dissociation of the virus in the presence of acetic acid followed by a combination of gel filtration and ion-exchange chromatography in the presence of sodium dodecylsulfate and guanidine hydrochloride . Amino acid analyses of each of the proteins were performed and correlated with the properties and functions of the proteins . Protein I has the highest polarity and is the only water-soluble protein . Protein II has a rather high polarity and hydrophobicity index and probably interacts electrostatically and hydrophobically with the bilayer . Proteins III and IV have low polarities and possess the solubility properties of proteolipids . At least protein III and perhaps also protein IV may interact with the bilayer . No fatty acids are covalently linked to these proteins . Tryptic fingerprints showed that proteins I and II contain a high proportion of hydrophobic peptides, but especially protein I also contains a large number of hydrophilic peptides . Proteins III and IV have relatively few hydrophobic peptides despite their relatively high hydrophobicity . Protein IV has two distinct regions, as shown by partial sequence studies . Basic amino acids at the N-terminus would serve for interaction with the viral DNA, the following hydrophobic sequence might interact with protein III or with the bilayer. J Virol, 1976 Sep, 19(3), 915 - 24 Bacteriophage G4 DNA synthesis in temperature-sensitive dna mutants of Escherichia coli; Derstine PL et al.; The synthesis of bacteriophage G4 DNA was examined in temperature-sensitive dna mutants under permissive and nonpermissive conditions . The infecting single-stranded G4 DNA was converted to the parental replicative form (RF) at the nonpermissive temperature in infected cells containing a temperature sensitive mutation in the dnaA, dnaB, dnaC, dnaE, or dnaG gene . The presence of 30 mug of chloramphenicol or 200 mug of rifampin per ml had no effect on parental RF synthesis in these mutants . Replication of G4 double-stranded RF DNA occurred at a normal rate in dnaAts cells at the nonpermissive temperature, but the rate was greatly reduced in cells containing a temperature-sensitive mutation in the dnaB, dnaC, dnaE, or dnaG gene . RF DNA replicated at normal rates in revertants of these dna temperature-sensitive host cells . The simplest interpretation of these observations is that none of the dna gene products tested is essential for the synthesis of the complementary DNA strand on the infecting single-stranded G4 DNA, whereas the dnaB, dnaC, dnaE, (DNA polymerase III), and dnaG gene products are all essential for replication of the double-stranded G4 RF DNA . The alternate possibility that one or more of the gene products are actually essential for G4 parental RF synthesis, even though this synthesis is not defective in the mutant hosts, is also discussed. J Virol, 1976 Sep, 19(3), 1012 - 27 Properties of condensed bacteriophage T4 DNA isolated from Escherichia coli infected with bacteriophage T4; Hamilton S et al.; Methods developed for isolating bacterial nucleoids were applied to bacteria infected with phage T4 . The replicating pool of T4 DNA was isolated as a particle composed of condensed T4 DNA and certain RNA and protein components of the cell . The particles have a narrow sedimentation profile (weight-average s=2,500S) and have, on average, a T4 DNA content similar to that of the infected cell . Their dimensions observed via electron and fluorescence microscopy are similar to the dimensions of the intracellular DNA pool . The DNA packaging density is less than that of the isolated bacterial nucleoid but appears to be roughly similar to its state in vivo . Host-cell proteins and T4-specific proteins bound to the DNA were characterized by electrophoresis on polyacrylamide gels . The major host proteins are the RNA polymerase subunits and two envelope proteins (molecular weights, 36,000 and 31,000) . Other major proteins of the host cell were absent or barely detectable . Single-strand breaks can be introduced into the DNA with gamma radiation or DNase without affecting its sedimentation rate . This and other studies of the effects of intercalated ethidium molecules have suggested that the average superhelical density of the condensed DNA is small . However, these studies also indicated that there may be a few domains in the DNA that become positively supercoiled in the presence of high concentrations of ethidium bromide . In contrast to the Escherichia coli nucleoid, the T4 DNA structure remains condensed after the RNA and protein components have been removed (although there may be slight relaxation in the state of condensation under these conditions). Eur J Biochem, 1976 Sep, 68(1), 55 - 70 Restriction-enzyme-cleavage maps of bacteriophage M13 . Existence of an intergenic region on the M13 genome; Van Den Hondel CA et al.; Replicative form DNA of bacteriophage M13 was cleaved into specific fragments by an endonuclease isolated from Hemophilus aegyptius (endoR.HaeII) and an endonuclease from Arthrobacter luteus (endoR.AluI) . The fragments were ordered as to construct a circular map of the phage M13 genome by: (a) using each fragment as a primer for the synthesis in vitro of its respective neighbour and (b) digesting the isolated fragments with the Hemophilus aegyptius enzyme endoR.HaeII or the Hemophilus aphirophilus enzyme endoR.HapII and subsequent analysis of the overlapping sets of fragments . The resulting physical map was correlated with the M13 genetic map by marker rescue experiments with amber mutant phage DNAs and purified wild-type fragments . From the results of these analyses it has been concluded that gene II and gene V are contiguous on the genetic map . Evidence is provided that there i