CopR is one of the two copy number control elements of the streptococcal plasmid pIP501 . It represses transcription of the repR mRNA encoding the essential replication initiator protein about 10- to 20-fold by binding to its operator region upstream of therepR promoter pII . CopR binds at two consecutive sites in themajor groove of the DNA that share the consensus motif 5'-CGTG.Previously, the minimal operator was narrowed down to 17 bp,and equilibrium dissociation constants for DNA binding and dimerizationwere determined to be 0.4 nM and 1.4 µM, respectively.In this work, we used a SELEX procedure to study copR operatorsequences of different lengths in combination with electrophoreticmobility shift assays of mutated copR operators as well as copynumber determinations to assess the sequence requirements forCopR binding . The results suggest that in vivo evolution wasdirected at maximal binding affinity . Three simultaneous nucleotideexchanges outside the bases directly contacted by CopR onlyslightly affected CopR binding in vitro or copy numbers in vivo.Furthermore, the optimal spacer sequence was found to comprise7 bp, to be AT rich, and to need an A/T and a T at the 3' positions,whereas broad variations in the sequences flanking the minimal17-bp operator were well tolerated.

 
Replication of the streptococcal plasmid pIP501 is regulatedby two components that act in concert: the transcriptional repressorCopR [10.6 kDa] and the antisense RNA RNAIII [136 nucleotides[nt]] [5] . Whereas RNAIII exerts its inhibitory effect by prematuretermination [attenuation] of the essential repR mRNA [6, 8],CopR has a dual function . On the one hand, it represses transcriptionfrom the essential repR promoter pII about 10- to 20-fold [7];on the other hand, it prevents convergent transcription frompII and pIII [antisense promoter], thereby indirectly increasingtranscription initiation at pIII [9] . Previously, it was foundthat CopR contacts the DNA asymmetrically at two consecutivemajor grooves that share the consensus motif 5'-CGTG [28] . Thus,the outermost G residues were found to be most important forCopR binding, whereas exchanges of nucleotides adjacent [3']to the CGTG motif only slightly altered DNA binding . The operatorsequence was narrowed down to 17 bp . Furthermore, it was foundthat CopR binds exclusively as a dimer, and the equilibriumdissociation constants for the CopR dimers and the CopR-DNAcomplex were calculated to be 0.4 nM and 1.4 µM, respectively[29] . A three-dimensional model of the N-terminal 63 amino acidsof CopR was built and was used to identify amino acids involvedin DNA binding and dimerization [30, 31, 32] . By this means,it was found that amino acids R29 and R34, located in the recognitionhelix [helix III] of the helix-turn-helix motif, make specificcontacts to the DNA at G240 [binding site I] and G254 [bindingsite II] or G242/T243 [site I] and G251 [site II], respectively.Water-mediated contacts were suggested for E35 interacting withthe outermost C residues in both binding sites . Unspecific DNAcontacts via the sugar-phosphate backbone were proposed forK10 in -helix I and S28 in the recognition helix [30] . Furthermore, it was established that the structured acidic C terminus of CopR that forms a ß-strand is necessary for stabilizationof the protein [22, 23] . A fluorescence energy study revealedthat CopR bends the operator DNA slightly [20 to 25°] uponbinding, and it was proposed that two pyrimidine-purine dinucleotidesteps in the operator sequence that are separated by one helicalturn are required for bendability [33] . With all these dataon hand, we asked whether the copR operator found in nature[on plasmid pIP501] was optimized for strong DNA binding orwhether it would be possible to find an operator that is boundmore efficiently by CopR and, if so, how such an operator wouldfunction in copy number control in vivo.

In 1990, the SELEX procedure was developed independently bytwo laboratories [13, 36] . This procedure uses randomized sequences[DNA or RNA] to select for different criteria, like bindingof certain proteins or small metabolites or the ability to performenzymatic reactions, followed by PCR amplification and furtherrounds of selection . SELEX not only yielded impressive resultsthat supported the RNA world hypothesis, e.g., selection of RNA molecules that were able to carry out templated RNA polymerization [21] or amino acylation of tRNAs [24] or selection of high-affinityRNA ligands to parasite target molecules [18], but was alsoemployed successfully to study a broad variety of protein-DNAinteractions . Examples of the uses of SELEX include the in vitroselection of binding sites for the Escherichia coli trp repressor[12], methionine repressor MetJ [19], integration host factor [IHF] [17], a response regulator of Bradyrhizobium japonicum[14], and bacteriophage Ff gene 5 protein, a single-strand bindingprotein [37] . Consensus sequences for a UP element for bacterialpromoters [15] or for embryonic heat shock factor 2 [25] were defined . Furthermore, sequence requirements for efficient termination of conjugation in the oriT gene of E . coli plasmid R1162 were determined [2], and the promoter discrimination between ^s and ⁷⁰ RNA polymerases of E . coli was investigated [16] . SELEX revealedan unusual DNA binding mode for TRF1, a key player of telomerelength regulation [3] . In the case of proteins that do not seemto recognize strongly defined consensus sequences, like topoisomeraseII, in vitro evolution identified preferred DNA cleavage sites[10] . Additionally, SELEX was used for applicative purposeslike the selection of DNA aptamers against human immunodeficiencyvirus type 1 RNase H that display in vitro antiviral activity[1] . All these examples demonstrate the power of in vitro selectionfor the analysis of DNA-protein interactions.

To answer the questions mentioned above, we applied the SELEX procedure with copR operator sequences of different lengthsin combination with electrophoretic mobility shift assays [EMSAs]with mutated operator fragments, copy number determinations,and in vitro transcription . Our results demonstrate that invivo evolution of the copR operator sequence was directed atmaximal binding affinity . Furthermore, we defined sequence andlength requirements for the spacer and regions adjacent to thetwo binding sites.

 
DNA preparation, manipulation, and copy number determination. Plasmid DNA was isolated from Bacillus subtilis as reported previously [5] . DNA manipulations such as restriction enzyme cleavage and ligation were carried out under the conditions specified by the manufacturer or according to standard protocols[26] . A PCR kit from Roche was used for PCR amplifications.DNA sequencing was performed according to the dideoxy chaintermination method [27] with a Sequenase kit from Amersham Bioscience.Copy numbers of pIP501 derivatives in B . subtilis were determinedas described previously [5], except that gel photographs were scanned and band intensities were quantified with the PCBAS2.0 program.

Construction of E . coli-B . subtilis shuttle vectors containing mutations in the copR operator. Plasmid pPRC333 containing the wild-type copR operator regionwas constructed as follows . First, a PstI site was created atposition 582 [4] to facilitate the subsequent construction ofmutations in the leader region; a BamHI/PstI fragment spanningnt 160 to 582 was obtained by PCR on pPR1 as a template by usingthe primer combinations shown below and inserted into the pUC19BamHI/PstI vector, resulting in plasmid pUC333 . The BamHI/PstIfragment of plasmid pUC333 and the PstI/EcoRI fragment of plasmidpUCR3 [20] were jointly cloned into the pPR4 BamHI/EcoRI vector[5], yielding plasmid pPRP333 . Subsequently, the copR gene was inserted as a 549-bp EcoRI fragment derived from plasmid pCOP1B2[7] into the unique EcoRI site of plasmid pPRP333, and the plasmid containing copR in the same direction as the repR gene was designatedpPRC333 . All PCR-generated fragments were confirmed by sequencing.

Mutated operator sequences were constructed by the same procedure using the following primers in combination with primer SB214[5'-TAG AAG CTA CGA TCA AAG TTG AA]: pPRC333-SB333 [5'-AATTGGATCCGATTTCGTGTGAATAATGCA], pPRC334-SB334 [5'-AATTGGATCCGATTTCGTGCGAATAATGCACGAAATCATT], pPRC221-SB221 [5'-AATTGGATCCAAAAGCAATGATTTCGTGTCCCCCCCGCACGAAATCATTGCTTAT], pPRC222-SB222[5'-AATTGGATCCAAAAGCAATGATTTCGTGTGAAAAAAAGCACGAAATCATTGCTTAT], pPRC227-SB227 [5'-AATTGGATCCGATTTCGTGTGAAAAATGCACGAAATCATTGCTTAT], pPRC228-SB228 [5'-AATTGGATCCGATTTCGTGTGAATTAATGCACGAAATCATTGCTT], pPRC292-SB292 [5'-AATTGGATCCGATTTCGTGTGGGGGGGCACGAAATCATTGCTTAT], pPRC294-SB294 [5'-AATTGGATCCGATTTCGTGTGAATAATACACGAAATCATTGCTTA], and pPRC416-SB416 [5'-AATTGGATCCGATTTTGTGCATGTATTGGACGAAATCATTGCTTATTTT].

Construction of lacZ fusion vectors and determination of ß-galactosidase activity. Plasmids pUC333 [wild type], pUC334 [symmetric operator], andpUC221 [spacer with 7C] were used for the isolation of EcoRI/HindIIIblunt fragments comprising promoter pII with the upstream copRoperator region, promoter pIII, attenuator, and 130 bp downstream[Table 1] . These fragments were inserted into the EcoRI/BamHIblunt vector pAC6 [34] to generate transcriptional fusions withthe promoterless lacZ gene . The resulting vectors, pAC333, pAC334,and pAC221, were linearized with ScaI, and the correspondinglacZ fusions were integrated into the amyE locus of the B . subtilis chromosome of strain DB104 by double crossover . To provide CopRin trans, the corresponding integrant strains were transformedwith plasmid pCOP9 [5], and Cm^r Pm^r transformants were selected.These strains were used for the determination of ß-galactosidaseactivity as described previously [7].

 
Construction of vector pBTYC11 for overexpression and purification of native CopR. A promoterless copR gene generated by PCR with primers SB203[5'-GGT GGT TGC TCT TCC AAC ATG GAA CT GCA TTT AGA GAA] andC-951-30 [5'-GAA TTC CTG CAG TCA CAC GAA ATC ATT GCT] on plasmid pCOP7C as a template and subsequently digested with SapI and PstI was inserted into vector pTYB11 [New England Biolabs] digested with the same pair of enzymes . E . coli strain TG1 was used for transformation of the ligation mixture, and Amp^r transformants were screened for the presence of recombinant pTYB11 . The resulting vector was designated pTYBC11, and the inserted copR gene was confirmed by sequencing . In pTYBC11, the N-terminal codons of CopR are fused to the intein tag and hence the C-terminal codonsof the chitin binding domain . Expression strain ER2566 [IMPACT-CN protein purification system; New England Biolabs] was transformed with pTYBC11 and used for the overexpression of native CopR.

Preparation of labeled wild-type and mutant CopR targets. Oligodeoxyribonucleotides listed in Table 6 were 5' end labeledwith [-³²P]ATP [26] and purified from 8% denaturing polyacrylamide gels . Double-stranded CopR targets were generated in a Klenow reaction with oligodeoxyribonucleotide SB176 [5'-CCC CTT AAAAAA ATA AGC] and, in the case of SB414, SB417, and SB418, oligodeoxyribonucleotide SB415 [5'-TCGCTGAACATTCGATCTA] as primers.

 
Overexpression and purification of His₆ CopR and native CopR. Plasmid pQEC1 was used for overexpression and purification ofHis₆ CopR as described previously [28, 29] . For the preparationof native CopR, strain ER2566 [pTYBC11] was used . After inductionwith IPTG [isopropyl-ß-D-thiogalactopyranoside] atan optical density at 560 nm of 1.0, the strain was grown at 12°C overnight until an optical density at 560 nm of 1.8to 1.9 was reached, to prevent the accumulation of insolubleprotein . Afterwards, cells were pelleted and sonicated . Thesupernatant was centrifuged at 4°C for 10 min at 13,000rpm in a Beckman J2-21M centrifuge, bound with chitin for 40min at 4°C with constant stirring, and subsequently filledinto a column . After two washing steps, self-cleavage of thefusion proteins by the intein domain was induced by the additionof 50 mM dithiothreitol in a buffer containing 500 mM NaCl and20 mM Tris-HCl [pH 9.0] and incubation at room temperature for16 h . Afterwards, the native CopR protein was eluted with 500mM NaCl and 20 mM Tris-HCl [pH 8.0], and the first two 250-µlfractions containing native CopR were stored with glycerol [finalconcentration, 50%] at –20°C.

CopR-DNA binding reaction and band shift assay. Binding reactions were performed in a final volume of 20 µlcontaining 0.5x Tris-borate-EDTA [TBE] buffer [pH 8.0], 0.9nM of end-labeled DNA fragment, and 3 to 150 nM His₆ CopR . Herringsperm DNA [0.1 µg/µl] was added as a nonspecificcompetitor . After incubation at 30°C for 30 min, the reactionmixtures were separated on 8% native polyacrylamide gel runsat room temperature for 1.5 h [16 V/cm] in 0.5x TBE buffer.Visualization and quantification of the bands were performedon a Fuji PhosphorImager . In some cases, 75 mM NaCl was includedin the reaction mixture, the gel, and the electrophoresis buffer.

In vitro selection [SELEX] procedure. To generate double-stranded templates for SELEX I, SELEX II,and SELEX IV, between 8 and 333 pmol of the following 61-bp oligodeoxyribonucleotides containing random sequences flankedby fixed regions were used as templates in a primer extensionreaction employing an 18-bp primer, SB179 [5' GAT GCA TGG ATCCAT GAT], complementary to the 3' end of randomized DNA pools:SB206 [I] [5'-ACAGGAAACAGCTATGACCATGATTACGCCGATGGAATTCAAGCTTAATGATTTCGTGT[N₇]GCACGAAATCATGGATCCATGCATCACTGGCCGTCGTTTTACAACGTC-GTGACTG], SB265 [II] [5'-ACAGGAAACAGCTATGACCATGATTACGCCGATGGAATTCAAGCTTAATGATTT[N₁₇]AAATCATGGATCCATGCATCACTGGCCGTCGTTTTACAACGTCGTGACTG], SB369 [III] [5'-TACGGTAACTGGACTGCATAACGATGCATTTGACTCATTCAAGCTTCATCCATA[N₃₀]TAGTCGTGGATCCTTGACATGACAGGTATGTAGTCATAAGCACTTAGCAA], and SB330 [IV] [5'-ACAGGAAACAGCTATGACCATGATTACGCCGATGGAATTCAAGCTTAAT[N₅]CGTGTGAATAATGCACG[N₅]ATGGATCCATGCATCACTGGCCGTCGTTTTACAACGTC-GTGACTG].

For construction of the double-stranded randomized DNA poolfor SELEX III, instead of SB179, primer SB370 [5'-ATG TCA AGGATC CAC GAC] was used . Subsequently, the DNA pools were amplifiedby PCR with primers SB223 [5'-CAG TCA CGA CGT TGT AAA ACG ACGGCC AGT GAT GCA TGG ATC CAT GAT] and SB224 [5'-ACA GGA AAC AGCTAT GAC CAT GAT TAC GCC GAT GGA ATT CAA GCT TAA TG] in the casesof SELEX I, II, and IV and primers SB371 [5'-TAC GGT AAC TGGACT GCA TAA CGA TGC ATT TGA CTC ATT CAA GCT TCAT C] and SB372[5'-TTG CTA AGT GCT TAT GAC TAC ATA CCT GTC ATG TCA AGG ATCCAC GAC] in the case of SELEX III . Primers carry an overhangto obtain longer PCR products [121 bp for SELEX I, II, and IVand 134 bp for SELEX III] . After phenol-chloroform extractions and ethanol precipitation, the PCR products were 5' end labeled with 10 µCi of [-³²P]ATP . The radioactively labeled DNAfragments were purified from 8% native polyacrylamide gels,visualized by phosphorimaging, excised, eluted two times inelution buffer containing 1 mM EDTA [pH 8.0], 500 mM NaAc, 10mM MgAc, and 0.1% sodium dodecyl sulfate for 1 h at 50°C, and precipitated with ethanol afterwards.

Binding reactions were performed in a final volume of 20 µl containing the labeled DNA fragment and 84 nM His₆ CopR in 0.5x TBE buffer . In all cases, incubation without His₆ CopR was used for comparison . As a reference for the excision of the shifted CopR target, which was not visible in the first round of selection with SELEX II and III, primers with wild-type operator sequencebut that were the same length as the SELEX primer were usedin each SELEX experiment and treated in the same way [Klenowreaction, PCR amplification, labeling, and EMSA] . After round3 of each SELEX procedure, a 0.6 µM wild-type DNA fragment[KS1] [28], which has no binding sites for amplification primers,was added as a competitor in each binding reaction to promoteselection towards a high-affinity and high-specificity pool.After 30 min at 30°C, bound and unbound DNA species wereseparated on 8% native polyacrylamide gels at 230 V . Band shiftswere detected by phosphorimaging . The bound species were excisedand eluted in elution buffer [see above] followed by phenol-chloroformextractions to remove the CopR protein and ethanol precipitation.

The recovered bound ligand sequences were dissolved in waterand subsequently PCR amplified by using primers SB225 [5'-CAGTCA CGA CGT TGT AAA] and SB226 [5'-ACA GGA AAC AGC TAT GAC]for SELEX I, SELEX II, and SELEX IV products and primers SB372[5'-TAC GGT AAC TGG ACT GCA] and SB374 [5'-TTG CTA AGT GCT TATGAC] for SELEX III products . Twenty cycles of PCR amplificationwere performed for 30 s each at 95, 52, and 72°C . PCR productswere phenol-chloroform extracted and precipitated with ethanolfollowed by 5' labeling as described above . These steps wererepeated 10 times . After the 10th round of SELEX, amplificationproducts were digested with BamHI and HindIII and inserted intothe pUC19 BamHI/HindIII vector . After transformation of E . colistrain TG1, the DNA of individual white transformants was sequenced.

In vitro transcription with B . subtilis RNA polymerase. Linear templates for in vitro transcription were generated byPCR from the corresponding pUC derivatives pUC333, pUC334, pUC294, pUC292, pUC221, and pUC228 with primer SB214 and the universal sequencing primer and gel purified . In vitro transcription assays were performed in a final volume of 20 µl containing 60mM Tris HCl [pH 7.8], 12 mM MgCl₂, 1 mM dithiothreitol, and1 ng of different linear DNA templates as well as 200 µM[each] ATP, GTP, and CTP; 20 µM UTP; 5 µCi of [-³²P]UTP; and 240 ng of native CopR . After incubation at 30°C for15 min, 0.5 µl of B . subtilis RNA polymerase [0.24 µg]was added, and the incubation continued at 30°C for 30 min.Transcription was stopped by phenol-chloroform extraction andethanol precipitation, and the products were dissolved in waterand 50% formamide loading dye, heat denatured for 5 min at 95°C,and separated on a 6% denaturing polyacrylamide gel . Dried gelswere analyzed and quantitated in a Fuji PhosphorImager.

 
Use of SELEX to study the spacer region reveals two consensus positions at the 3' end. To answer the question of whether there are any sequence preferencesin the spacer region between the two CopR binding sites, ina first SELEX approach [SELEX I], an operator sequence that was randomized at the 7-bp spacer region but that contained wild-type binding sites I and II was used . The SELEX experimentwas started with 8 pmol of the randomized sequence, which correspondsto 2.9 x 10⁹ copies of every possible sequence, and this poolwas amplified by PCR prior to labeling as described in Materialsand Methods . As expected, a shifted band was already visiblein round 1 [Fig . 1] . After round 10, the selected DNA fragmentswere amplified by PCR, digested with BamHI and HindIII, andinserted into the pUC19 vector . Twenty-eight clones were sequenced,and the results are shown in Table 2 . In all but one case, spacerswere found with an A or T at position 6, and in all but twocases, a T in position 7 flanked by otherwise random sequencesin positions 1 to 5 was found . However, all spacers were ATrich, with only three of them having more than two G or C residues.

 
The results of SELEX I show that an optimal spacer region should comprise 7 bp, be AT rich, and contain preferably an A or aT in position 6 and a T in position 7 . This is in agreementwith a previous fluorescence resonance energy transfer studywhich revealed a slight [20 to 25°] bend of the copR operatorregion upon binding of the CopR protein [33] . We argued that two pyrimidine-purine steps one helical turn apart might berequired for flexibility and hence bendability . SELEX I seemsto confirm this argument; one of these pyrimidine-purine stepsis at the boundary between the spacer and binding site II andrequires the T in position 7 of the spacer which indeed wasalso found with SELEX II [see below] and found to be a T orC in 9 of 14 sequenced clones by SELEX III [see below] . Theother pyrimidine-purine step is provided by T241 and G242 inbinding site I, which was not found to be altered in any SELEX-derivedsequence.

Use of SELEX to study a randomized 17-mer sequence selects both the asymmetric wild-type operator sequence and an operator sequence with perfect symmetry. To find out whether binding sites that are bound more efficientlyby CopR than by the wild-type operator exist, a randomized sequenceof 17 bp, the minimal wild-type operator length, was used inthe SELEX II experiment . This SELEX II experiment was startedwith 20 pmol of the randomized sequence, corresponding to 700 copies of every possible sequence, which was PCR amplified and labeled prior to selection [see above] . Selection was performedfor the first three rounds without a competitor, and after ashifted band emerged in round 3 [Fig . 1], the nonlabeled wild-type operator was added as a competitor and seven additional rounds of selection were performed . After 10 rounds, selected fragmentswere cloned into the pUC19 vector as described above, and 24independent clones were sequenced . The results [Table 3] show that all selected sequences contained wild-type binding sitesI and II . Furthermore, the 3' nucleotide of binding site I,which is a T in the wild-type site, was in 17 of 24 sequencesreplaced by a C, making both binding sites perfectly symmetric.Such a perfectly symmetric operator sequence with T243C [Fig.2], termed KS9, had been analyzed previously [28] and was foundto be bound at least as efficiently as the wild-type sequence.Our three-dimensional model of the N-terminal 63 amino acidsof CopR [30] predicts that this nucleotide position in bindingsite I is contacted by R34 of the recognition helix [Fig . 2]and that the contact would be stronger with a C instead of aT.

 
Interestingly, the spacer regions of all 24 clones were AT rich[in 22 of 24 cases, 2 G's or C's were found] and contained aT in position 7 and, in 18 cases, an A in position 6 . The latterdata are in agreement with the results described above.

Use of SELEX to study a 30-mer sequence selects the symmetric and the asymmetric wild-type operator sequence and a novel sequence with three nucleotide exchanges. Since in vitro selection of a 17-bp randomized sequence neitherallows extended spacer lengths to be found nor is able to obtainany information on the variability of the flanking sequences,a randomized 30-mer sequence was used in a third SELEX [SELEXIII] experiment . This experiment was started with 333 pmol [8 µg] of randomized oligodeoxyribonucleotide SB369, whichwas PCR amplified and labeled prior to selection . Here, in round4, a bound fraction appeared, and the next rounds were againperformed in the presence of a competitor sequence . After 10rounds, 14 independent clones were sequenced as described above.Table 4 presents the results . Interestingly, whereas the asymmetricwild-type binding sites in two cases [numbers 1 and 4] and thesymmetric binding sites in one case [number 13] were found tobe similar to those in SELEX II, the other 11 clones containedbinding sites with one [number 5], two [numbers 2 and 3], three[numbers 6, 7, 8, 10, 11, 12, and 14], or even four [number9] nucleotide exchanges . One of these exchanges was the C inposition 243 found in the symmetric wild-type operator by SELEXII . However, the other exchanges were within the consensus bindingmotif 5'-CGTG [Fig . 2] . In binding site I, the C in wild-typeposition 239 was replaced by a T, and in binding site II, theC in wild-type position 252 was altered to a G [Fig . 3] . Additionally,in one case [number 9], the G in position 255 was replaced byan A . These results were surprising, since previous mutationsin binding sites I and II seemed to suggest that the four positionsof the consensus motif [5'-CGTG] cannot be altered without significantloss of binding affinity [28; unpublished data].

 
Although several other operators in addition to the symmetricand the asymmetric wild-type operator with two, three, or evenfour nucleotide exchanges were found, these exchanges did notaffect nucleotides for which direct covalent contacts with aminoacids in the recognition helix of the CopR proteins were proposed[Fig. 2].

With regard to the selected spacer sequences, the results ofSELEX I and II for an AT-rich spacer and the necessity of Tin position 6 were confirmed, whereas in position 7, a C wasfound in five cases . Interestingly, no alterations of the spacerlength were selected; i.e., neither an 8-bp nor a 6-bp spaceremerged . The flanking sequences could not be analyzed in sufficientdetail, since the binding sites were found in the 5' portionin some cases and in the 3' portion of the randomized 30-mersequence in other cases.

The 5' and 3' flanking sequences of binding sites I and II can vary widely. In order to obtain information on the sequences flanking bindingsites I and II, a fourth SELEX [SELEX IV] experiment was performedusing a 17-bp wild-type operator with a randomized 5-bp spacerregion on either side . This SELEX was started with 200 pmol of randomized sequence, corresponding to 115 x 10⁶ copies ofevery sequence variant which were PCR amplified and labeledprior to selection . As expected, a shifted band was visiblefrom SELEX round 1, and after 10 rounds of selection [rounds4 to 10 with a wild-type competitor], fragments were clonedand 14 clones were analyzed by sequencing . Table 5 shows clearlythat no specific sequences are preferred either 5' or 3' ofbinding sites I and II, respectively . Even the AT content doesnot seem to play a role in these regions.

 
Binding curves of mutated copR operators confirmed the SELEX results. Four independent SELEX experiments yielded a set of data concerningbinding sites, the spacer region, and surrounding regions ofthe copR operator . However, no information was obtained aboutthe ability of an 8-bp spacer to bind CopR or about the importanceof the pyrimidine-purine dinucleotide steps within the operatorregions for efficient binding . In this context, binding efficienciesfor spacers comprising exclusively A or T residues or, on theother hand, only G or C residues were of interest, even when such spacers were not selected in vitro . Furthermore, the exchange of single nucleotides such as those found in the mutated operator selected with the SELEX III experiment within the consensus regions and their effects on binding of CopR should be investigated. A comparison of binding curves of operators found with SELEXII and SELEX III should enable us to estimate whether CopR complexeswith the selected operator sequences indeed had the same oreven lower equilibrium dissociation rate constants as thosewith the wild-type operator, i.e., if an operator sequence wasselected that is bound more tightly by the repressor.

For this purpose, gel shift assays were performed with the mutated operator sequences listed in Table 6 . The corresponding bindingcurves are shown in Fig . 4, and the calculated K_d values forthe CopR operator complexes are shown in Table 7.

 
With regard to the spacer region, three important results were obtained . First, an 8-bp spacer sequence did not prevent CopR binding; however, only unstable complexes were formed [Fig. 4A] . On the other hand, a 6-bp spacer did not allow CopR binding[data not shown] . Second, the alteration of a pyrimidine-purinestep within the spacer did not affect binding . Third, spacerscomposed of only A's or T's were bound equally well and comparableto those of the wild-type . In contrast, spacers comprising onlyC's or G's were bound with significantly lower efficiency [10-to 15-fold lower] . These results are in correlation with theSELEX I experiment, where AT-rich spacers were selected, and in correlation with SELEX III, where only 7-bp spacers were found.

A comparison of binding constants of asymmetric and symmetric operators as selected with SELEX II demonstrated that the K_d value of the latter one [former KS9] [28] was twofold lowerthan that of the asymmetric wild-type operator; i.e., this operatorwas bound slightly more efficiently than the wild-type operator.This is most probably the reason why the symmetric operator was selected with SELEX II in the majority of the cases . The mutated operator selected with SELEX III [SB414] yielded a K_d value that was threefold higher than that of the asymmetric wild-type operator . A mutated operator containing only one ofthe two mutations within the 5'-CGTG motif [SB417] bound CopRalmost as efficiently as the wild-type with a K_d of 0.6 nM.

Exchanges of other single nucleotides in binding site I or II impaired or prevented CopR binding or led to unstable complexesthat dissociated during electrophoretic separation, as was foundfor SB198 and SB199 containing nucleotide exchanges in positions241 and 242 of binding site I, respectively [Fig . 4A] . Such exchanges were not found with SELEX II or III . The importanceof the G's in positions 240 and 254 had been demonstrated before[28] . G-to-A exchanges at these two positions abolished bindingor decreased the binding affinity drastically.

Copy numbers of pIP501 derivatives demonstrated that selection in vivo [evolution] was directed at maximal binding efficiency. A set of pIP501 derivatives was constructed to evaluate theeffects of mutated operator sequences on copy number controlin vivo . The corresponding plasmids were introduced into B.subtilis strain DB104 by transformation, and copy numbers weredetermined [Fig . 5 and Table 8].

 
A comparison of the copy numbers of plasmids pPRC333 [wild type]and pPRC334 [T243C symmetric operator] shows that in vivo, asymmetric and an asymmetric operator are equally efficient inregulation and that the slight differences [twofold] in theK_d values do not result in significant effects . In contrast,the copy number of pPRC416 carrying three mutations, the T243Cand 1-bp exchanges in binding sites I and II, was about threefoldhigher, which was in correlation with the K_d value that was threefold higher than that of the asymmetric wild-type and aK_d value even sixfold higher than that of the symmetric wild-type operator, and hence, CopR binding was slightly impaired . Fromthese data, it can be concluded that evolution in vivo was directedat maximal binding . A direct correlation between binding andregulation was also apparent from the analysis of the othersymmetric operator variant and supported the importance of G251in binding site II; the 3- to 4-fold-higher K_d value of KS3was accompanied by a 2.8-fold-higher copy number of pPRC294,i.e., impaired regulation in vivo.

Some of the pIP501 derivatives that carried mutations in the spacer region showed somewhat unexpected results . Whereas pPRC228 that has an 8-bp spacer, for which unstable binding was observed, replicated at a 1.5-fold-higher copy number than pPRC333, andpPRC derivatives with only A or T residues in the spacer behavedlike those of the wild type, pPRC292 carrying only G residuesand pPRC221 carrying only C residues replicated at even lowercopy numbers than did the wild type, which was in strong contrastto the calculated 16- or 10-fold-higher K_d values that indicated significantly impaired binding . Stacking effects within thespacer region or supercoiling effects [see below] might be responsiblefor this unexpected behavior.

In vitro transcription with B . subtilis RNA polymerase confirmed the in vivo data. In order to find out whether the unexpected results of the copynumber determinations with only G or C spacers were due to interactioneffects with RNA polymerase, in vitro transcription experimentswere performed with B . subtilis RNA polymerase in the presenceor absence of purified native CopR . Figure 6 demonstrates thatrepression was performed equally well for the wild type andthe T243C mutation [KS9], which coincides with the results ofthe EMSAs and in vivo copy number determinations [Table 8].For G251A [KS3], a four- to five-fold-lower repression effectwas found, which again was in correlation with the results ofthe EMSA [K_d fourfold higher than that for the wild-type] andcopy number determination [2.8-fold-higher copy numbers] [Table8] . On the other hand, an operator with only C in the spacerregion behaved like the wild type with only 7% transcriptionalread-through upon CopR binding . This coincides with the copynumber regulation, which was also like that of the wild type.Here, factors other than simple binding apparently play a role,since the 10-fold-higher K_d value indicates that binding ofCopR is significantly impaired . The same holds true for theoperator with the spacer with G only, which is only 2-fold worsein repression in the in vitro transcription assay and even showsan approximately 2-fold-lower copy number than that of the wildtype but has a 16-fold-higher K_d value significantly impairedin CopR binding . As the reasons for these discrepancies, supercoilingeffects cannot be excluded, which are not considered in EMSAor SELEX, where linear templates are used . The operator withan 8-bp spacer showed about a fourfold decrease in repression,in line with the formation of an unstable complex in the EMSA[Fig . 4A].

 
LacZ fusions indicate that discrepancies between K_d values and copy numbers are due to supercoiling effects. To analyze the role of supercoiling for repression in vivo versusthat of repression in vitro [EMSA, SELEX, and in vitro transcription],transcriptional lacZ fusions of the repR promoter pII containingeither wild-type or mutated operators were constructed and integratedinto the amyE locus of the B . subtilis chromosome . Resulting B . subtilis integrant strains DB104::pAC333 [wild type], DB104::pAC334 [T243C, symmetric operator], and DB104::pAC221 [7C spacer] were transformed with plasmid pCOP9 to provide CopR in trans, and ß-galactosidase activities were determined as describedpreviously [7] . The results are shown in Table 9 . A comparisonof ß-galactosidase activities determined in the absenceand presence of CopR revealed different degrees of repression.In the wild-type case [pAC333], about 17-fold repression wasobserved, whereas the repression effect was slightly higher[23-fold] in the case of pAC334 containing the symmetric operatorwhich was selected with SELEX II . This result is in agreementwith the calculated copy numbers, which were identical in bothcases, and indicates that the twofold difference in the K_d valuesdetermined with linear templates is overcome by the supercoilingeffect on a circular template in vivo . For pAC221 comprisingthe 7C spacer region, lacZ values in the absence of CopR wereabout 2.5-fold lower than those of pAC333 and pAC334 . This findingsuggests that the C-rich spacer region upstream of the –35box of pII might lower the transcription efficiency by the RNApolymerase . On the other hand, the four- to sixfold-lower repressioneffect compared to those of the wild-type and symmetric operatorwas in accordance with the calculated 10-fold-higher K_d valuefor this operator determined with EMSA . Apparently, supercoilingeffects are responsible for the decrease of the expected [fromthe K_d values] difference in repression . With these data, thesurprising discrepancies between K_d values and copy numbers for the 7C spacer variant could be explained . The results ofthe lacZ measurements indicate that efficient binding in vivois affected by supercoiling and that the copy numbers are influencedby both the K_d value and supercoiling effects.

 
Evolutionary considerations. One instrument to adjust the copy number of pIP501 is the K_dvalue of the CopR operator complex . Evolution of the copR operatorin vivo apparently resulted in a low copy number of the correspondingplasmid pIP501 [approximately 5 copies] . This copy number, however,is not the lowest that can be obtained, as shown with pPRC221and pPRC292 . However, in these two cases, copy numbers are lowerthan those of the wild-type, since the mutated pII promoterswith C- or G-rich upstream regions are less efficient than thewild-type promoter per se [see above], and the reduced repressioneffect on these weak promoters due to high K_d values of themutated Cop operator complexes is, in a supercoiled context,still sufficient to decrease replication efficiency slightlybelow the wild-type level.

As demonstrated previously with a series of pIP501 derivatives, there seems to be both an upper and a lower limit for copy numbers found in vivo since no derivative could be constructed that replicated at more than 50 to 100 copies/cell with B . subtilis as one of its gram-positive hosts [5] . When pIP501 evolved in its original host, Streptococcus agalactiae, which was living under certain physiological conditions, selection was apparently for low, but not the lowest possible, copy number, which proved to be optimal under the environmental conditions encounteredby this host . This finding is supported by the independent invivo selection of three different [but identical in the bindingsites] operators of the three representatives of the inc18 familyof streptococcal plasmids that replicate via the theta mechanismin a broad range of gram-positive bacteria [4]: pIP501, pSM19035,and pAMß1 . These plasmids are 97% identical on thenucleotide level, and their replication regions reveal the samemodular structure: 5' cop gene, rep gene, and origin . The copgenes [copR [pIP501], copF [pAMß1], and copS [pSM19035]]encode almost identical proteins that differ only in a few aminoacids in the C terminus . Furthermore, the cop operators contain identical binding sites I and II [11, 35] . The only differencesbetween the copR and copS operators are found in the spacerregion [G244A and T247A] and between the copR and copF operatorsin the regions flanking the binding sites [T236G and A260G].These data suggest that during evolution, identical Cop bindingsites emerged in three independent plasmids . The results ofSELEX I, EMSAs with spacer mutations, and copy number determinationswith pPRC227 [T247A] confirmed that the two positions in thespacer region that are different in the copS operator are notrequired for efficient binding or regulation in vivo . Additionally,the results of SELEX IV demonstrated that the sequences of theflanking regions of the cop operator can vary widely so thatthe differences between copR and copF operator are negligible,too.

In summary, in vitro selection of the copR operator proved to result in the same sequences as those found with in vivo selection and demonstrated that evolution was directed at maximal binding affinity . From our experience, SELEX may be, at least in thecase of simple transcriptional repressors, a powerful methodto answer evolutionary questions.

 
We thank E . Birch-Hirschfeld [Institut für Virologie, Jena]for synthesizing the oligodeoxyribonucleotides; Margarita Salas,Madrid, Spain, for kindly providing us with purified B . subtilisRNA polymerase; and Nadja Heidrich [AG Bakteriengentik] forthe purification of native CopR.

This work was supported by grants BR1552/4-2 and BR1552/4-3from the Deutsche Forschungsgemeinschaft [to S.B.].

 
* Corresponding author . Mailing address: Friedrich-Schiller-Universität Jena, Biologisch-Pharmazeutische Fakultät, AG Bakteriengenetik, Hans-Knoll-Str . 2, Jena D-07745, Germany . Phone 49-3641-657507 . Fax: 49-3641-657520 . E-mail: Sabine.Brantl@rz.uni-jena.de.

1. Andreola, M.-L., F . Pileur, C . Calmels, M . Ventura, L . Tarrago-Litvak, J.-J . Toulmé, and S . Litvak. 2001 . DNA aptamers selected against the HIV-1 RNase H display in vitro antiviral activity . Biochemistry 40:10087-10094.
2. Becker, E . C., and R . J . Meyer. 2000 . Recognition of oriT for DNA processing at termination of a round of conjugal transfer . J . Mol . Biol . 30:1067-1077.
3. Bianchi, A., R . M . Stansel, L . Fairall, J . D . Griffith, D . Rhodes, and T . de Lange. 1999 . TRF1 binds a bipartite telomeric site with extreme spatial flexibility . EMBO J . 18:5735-5744 .
4. Brantl, S., D . Behnke, and J . C . Alonso. 1990 . Molecular analysis of the replication region of the conjugative Streptococcus agalactiae plasmid pIP501 in Bacillus subtilis. Comparison with plasmids pAMß1 and pSM19035 . Nucleic Acids Res . 18:4783-4790.
5. Brantl, S., and D . Behnke. 1992 . Copy number control of the streptococcal plasmid pIP501 occurs at three levels . Nucleic Acids Res . 20:395-400.
6. Brantl, S., E . Birch-Hirschfeld, and D . Behnke. 1993 . RepR protein expression on plasmid pIP501 is controlled by an antisense RNA-mediated transcription attenuation mechanism . J . Bacteriol . 175:4052-4061.
7. Brantl, S. 1994 . The CopR protein of plasmid pIP501 acts as transcriptional repressor at the essential repR promoter . Mol . Microbiol . 14:473-483.
8. Brantl, S., and E . G . H . Wagner. 1994 . Antisense RNA-mediated transcriptional attenuation occurs faster than stable antisense/target RNA pairing: an in vitro study of plasmid pIP501 . EMBO J . 13:3599-3607.
9. Brantl, S., and E . G . H . Wagner. 1997 . Dual function of the copR gene product of plasmid pIP501 . J . Bacteriol . 179:7016-7024.
10. Burden, A . D., and N . Osheroff. 1999 . In vitro evolution of preferred topoisomerase II DNA cleavage sites . J . Biol . Chem . 274:5227-5235 .
11. Ceglowski, P., R . Lurz, and J . C . Alonso. 1993 . Functional analysis of pSM19035-derived replicons in Bacillus subtilis . FEMS Microbiol . Lett . 109:145-150.
12. Czernik, P . J., D . S . Shin, and B . K . Hurlburt. 1994 . Functional selection and characterization of DNA binding sites for trp repressor of Escherichia coli . J . Biol . Chem . 269:27869-27875 .
13. Ellington, A . D., and J . W . Szostak. 1990 . In vitro selection of RNA molecules that bind specific ligands . Nature 346:818-822.
14. Emmerich, R., P . Strehler, H . Hennecke, and H.-M . Fischer. 2000 . An imperfect inverted repeat is critical for DNA binding of the response regulator RegR of Bradyrhizobium japonicum . Nucleic Acids Res . 28:4166-4171 .
15. Estrem, S . T., T . Gaal, W . Ross, and R . L . Gourse. 1998 . Identification of an UP element consensus sequence for bacterial promoters . Biochemistry 95:9761-9766.
16. Gaal, T., W . Ross, S . T . Estrem, L . H . Nguyen, R . R . Burgess, and R . L . Gourse. 2001 . Promoter recognition and discrimination by E^S RNA polymerase . Mol . Microbiol . 42:939-954.
17. Goodman, S . D., N . J . Velten, Q . Gao, S . Robinson, and A . M . Segall. 1999 . In vitro selection of integration host factor binding sites . J . Bacteriol . 181:3246-3255 .
18. Göringer, H . U., M . Homann, and M . Lorger. 2003 . In vitro selection of high-affinity nucleic acid ligands to parasite target molecules . Int . J . Parsitol . 33:1309-1317.
19. He, Y.-Y., P . G . Stockley, and L . Gold. 1996 . In vitro evolution of the DNA binding sites of Escherichia coli methionine repressor, MetJ . J . Mol . Biol . 255:55-66.
20. Heidrich, N., and S . Brantl. 2003 . Antisense-RNA mediated transcriptional attenuation: importance of a U-turn loop structure in the target RNA of plasmid pIP501 for efficient inhibition by the antisense-RNA . J . Mol . Biol . 333:917-929.
21. Johnston, W . K., P . J . Unrau, M . S . Lawrence, M . E . Glasner, and D . P . Bartel. 2001 . RNA-catalyzed RNA polymerization: accurate and general RNA-templated primer extension . Science 292:1319-1325 .
22. Kuhn, K., K . Steinmetzer, and S . Brantl. 2000 . Transcriptional repressor CopR: the structured acidic C terminus is important for protein stability . J . Mol . Biol . 300:1021-1031.
23. Kuhn, K., K . Steinmetzer, and S . Brantl. 2001 . Transcriptional repressor CopR: dissection of stabilizing motifs within the C terminus . Microbiology 147:3387-3392.
24. Lee, N., Y . Bessho, K . Wei, J . W . Szostak, and H . Suga. 2000 . Ribozyme-catalyzed tRNA aminoacylation . Nat . Struct . Biol . 7:28-33.
25. Manuel, M., M . Rallu, M.-T . Loones, V . Zimarino, V . Mezger, and M . Morange. 2002 . Determination of the consensus binding sequence for the purified embryonic heat shock factor 2 . Eur . J . Biochem . 269:2527-2537 .
26. Sambrook, J., E . F . Fritsch, and T . Maniatis. 1989 . Molecular cloning: a laboratory manual, 2nd ed . Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
27. Sanger, F., S . Nicklen, and A . R . Coulson. 1977 . DNA sequencing with chain terminating inhibitors . Proc . Natl . Acad . Sci . USA 74:5463-5467.
28. Steinmetzer, K., and S . Brantl. 1997 . Plasmid pIP501 encoded transcriptional repressor CopR binds asymmetrically at two consecutive major grooves of the DNA . J . Mol . Biol . 269:684-693.
29. Steinmetzer, K., J . Behlke, and S . Brantl. 1998 . Plasmid pIP501 encoded transcriptional repressor CopR binds to its target DNA as a dimer . J . Mol . Biol . 283:595-603.
30. Steinmetzer, K., A . Hillisch, J . Behlke, and S . Brantl. 2000 . Transcriptional repressor CopR: structure model-based localization of the deoxyribonucleic acid binding motif . Proteins Struct . Funct . Genet . 38:393-406.
31. Steinmetzer, K., A . Hillisch, J . Behlke, and S . Brantl. 2000 . Transcriptional repressor CopR: amino acids involved in forming the dimeric interface . Proteins Struct . Funct . Genet . 39:408-416.
32. Steinmetzer, K., K . Kuhn, J . Behlke, R . Golbik, and S . Brantl. 2002 . Transcriptional repressor CopR: single amino acids involved in dimerization are also important for folding of the monomer . Plasmid 47:201-209.
33. Steinmetzer, K., J . Behlke, S . Brantl, and M . Lorenz. 2002 . CopR binds and bends its target DNA: a footprinting and fluorescence resonance energy transfer study . Nucleic Acids Res . 30:2052-2060 .
34. Stülke, J., I . Martin-Verstraete, M . Zagorec, M . Rose, A . Klier, and G . Rapoport. 1997 . Induction of the Bacillus subtilis ptsGHI operon by glucose is controlled by a novel antiterminator, GlcT . Mol . Microbiol . 25:65-78.
35. Swinfield, T . J., J . D . Oultram, D . E . Thompson, J . K . Brehm, and N . P . Minton. 1990 . Physical characterisation of the replication region of the Streptococcus faecalis plasmid pAMß1 . Gene 87:79-90.
36. Tuerk, C., and L . Gold. 1990 . Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase . Science 249:505-510.
37. Wen, J.-D., C . W . Gray, and D . M . Gray. 2001 . SELEX selection of high-affinity oligonucleotides for bacteriophage Ff gene 5 protein . Biochemistry 40:9300-9310.

Free Online Full-text Article

What is Food Microbiology?, What Is Molecular Microbiology?, What Is Biofilm?, What Is Bioengineering?, What Is Protein?, i, Bacteriology, r, Microorganism, e, Microorganisms, c, Bacteria, c, Bacterium, c, Microorganisms, i, Vibriosis, c, Growth media, r, Pasteurella, n, Escherichia coli, i, Candida albicans, r, Gram negative, i, Pseudomonas, r, Antibiotic treatment, i, Microorganism, r, Antimicrobials, c, Denitrifying, i, Corynebacter, s, Escherichia coli, s, Streptomycin, e, Escherichia coli, r, Antimicrobial, n, Candida albicans, e, Escherichia coli, e, Antimicrobial, n, Microorganisms




 

© 2005 Transgalactic Ltd (manufacturer of Bioscreen C software) | Privacy Statement | P.O. Box 1393, 00101 Helsinki, Finland, phone: +358 9 85172920, fax: +358 9 8749481, e-mail: microbiology@bionewsonline.com
 

Last modified: May 25, 2005