|
|
|
Journal of Bacteriology, July 2004, p . 4262-4275, Vol . 186, No . 13
Autoinduction of Bacillus subtilis phoPR Operon Transcription Results
from Enhanced Transcription from E
|
| ABSTRACT |
|---|
The phoPR operon encodes a response regulator, PhoP, and a histidine
kinase, PhoR, which activate or repress genes of the Bacillus
subtilis Pho regulon in response to an extracellular phosphate
deficiency . Induction of phoPR upon phosphate starvation required
activity of both PhoP and PhoR, suggesting autoregulation of
the operon, a suggestion that is supported here by PhoP footprinting
on the phoPR promoter . Primer extension analyses, using RNA
from JH642 or isogenic sigE or sigB mutants isolated at different
stages of growth and/or under different growth conditions, suggested
that expression of the phoPR operon represents the sum of five
promoters, each responding to a specific growth phase and environmental
controls . The temporal expression of the phoPR promoters was
investigated using in vitro transcription assays with RNA polymerase
holoenzyme isolated at different stages of Pho induction, from
JH642 or isogenic sigE or sigB mutants . In vitro transcription
studies using reconstituted E
A,
E
B,
and E
E
holoenzymes identified PA4 and PA3 as E
A
promoters and PE2 as an E
E
promoter . Phosphorylated PhoP (PhoP
P)
enhanced transcription from each of these promoters . E
B
was sufficient for in vitro transcription of the PB1 promoter .
P5 was active only in a sigB mutant strain . These
studies are the first to report a role for PhoP
P
in activation of promoters that also have activity in the absence of
Pho regulon induction and an activation role for PhoP
P
at an E
E
promoter . Information concerning PB1 and P5
creates a basis for further exploration of the regulatory
coordination or overlap of the PhoPR and SigB regulons during
phosphate starvation .
| INTRODUCTION |
|---|
Inorganic phosphate (Pi) is the limiting nutrient for biological
growth in the soil, the natural habitat of Bacillus subtilis .
To thrive in this environment where Pi levels are often 2 to
3 orders of magnitude lower than levels of other required ions
(29), B . subtilis has evolved complex regulatory
systems for utilization of this limiting nutrient . At least three
global regulatory systems are responsible for changes in gene
expression upon phosphate deprivation . One set of genes is controlled
either positively or negatively by the PhoP-PhoR two-component
regulators, genes referred to as the Pho regulon genes (for review,
see reference 12) . Other genes that are induced
upon phosphate limitation are dependent on SigB (1),
an alternative stress sigma factor . A third class of genes is
expressed under phosphate-limiting growth conditions that are
independent of either SigB or PhoP-PhoR (1) . The
regulatory coordination between these three sets of genes is unclear,
although up-regulation of certain Pho regulon genes has been reported
in a sigB mutant strain (12, 33) .
Pho regulon genes are the most extensively studied set of phosphate-regulated
genes in B . subtilis . Identification of genes of known function
that are directly regulated by PhoP-PhoR provides insight into
one strategy B . subtilis may use to deal with conditions of
limiting phosphate . A high-affinity Pi transport system (25,
34, 36) (PstS system) is induced for
the uptake of inorganic phosphate, while a family of alkaline
phosphatases, PhoA, PhoB, and PhoD (5,
6, 14, 15), are secreted
whose activity may function to supply the decreasing Pi
pool . Anionic cell wall polymer turnover (2) is
controlled by PhoP-PhoR, as phosphorylated PhoP (PhoP
P)
directly represses tag genes (23, 35)
that are required for synthesis of the high-phosphate anionic
polymer, teichoic acid (27), and activates the
tua genes (24, 35) responsible
for synthesis of a non-phosphate-containing polymer (39),
teichuronic acid, under phosphate-limiting conditions . One might say
that B . subtilis carries its phosphate reserve on its back, as
teichoic acid is turned over as the teichuronic acid replaces it . The
secreted phosphodiesterases and phosphomonoesterases, PhoD,
PhoB, and PhoA, are believed to have a role in the teichoic acid
degradation, providing an additional phosphate supply for uptake via
the PstS high-affinity transport system . Other genes that require
PhoP-PhoR for activation that may be directly regulated by PhoP
P
include glpQ (1), encoding a glycerophosphodiesterase;
glnQ (28), encoding a glutamine ABC transporter;
ykoL (37), a peptide of unknown function;
and additional genes of unknown function, yhaX, yhbH, yttP
(33) and yycp, ydbH, and yjdB (28) .
The Pho regulon response is controlled at two levels: at the level of phoPR operon transcriptional regulation and by the signal that results in autophosphorylation of PhoR and the subsequent activation of PhoP by phosphorylation via PhoR . Studies reported here focused on transcriptional regulation of the phoPR operon . Previous reports showed that the phoPR operon was expressed at low levels during phosphate-replete growth but was induced two- to threefold upon Pi limitation (16) . That the induced transcription level of phoPR in the wild-type (WT) strain was dependent on the phosphate starvation signal and PhoPR suggested that the operon was autoregulated, perhaps directly . These data raised a question about the preinduction transcription of phoPR, as previously characterized Pho regulon promoters which are directly activated by PhoP (phoA, phoB, phoD, tuaA, and pstS) are silent in vivo under Pi-replete conditions . Further, neither artificially elevating phoPR transcription under phosphate-replete conditions via an inducible promoter (4) nor chromosomal mutation (A . Puri and F . M . Hulett, unpublished data) initiates the Pho response, presumably because the signal is missing . Studies reported here were initiated to determine if phoPR transcription were directly regulated by PhoPR and, if so, what mechanism accounts for expression of phoPR during Pi-replete growth when other Pho regulon promoters are silent .
Our data suggest that the phoPR operon is directly autoregulated
by PhoP-PhoR . This regulation is accomplished by up-regulation
of E
A
and E
E
promoters responsible for transcription of the phoPR operon .
Two additional phoPR promoters are not PhoP regulated . This is
the first report of PhoP activation of an E
E
promoter or of a role for PhoP in up-regulation of promoters that
have some activity in the absence of Pho regulon induction .
| MATERIALS AND METHODS |
|---|
Bacterial strains and plasmids. All strains and plasmids used
in this work are listed in Table 1 . Plasmids pSB5
and pSB38 were constructed by amplifying phoPR promoter
regions from JH642 (pheA1 trpC2) chromosomal DNA using a 5'
primer containing an EcoRI site and one of two 3' primers each
containing a BamHI site . Primers FMH202 (5'-GTGAATTC300TCATTGAACTTGAACTG282-3')
and FMH079 (5'-GTGGATCC+92GTAATGACATCATAGCCT+75-3')
or FMH312 (5'-TTGGATC+24CACAACTAAAATTTTCTTGTTC+3-3')
were used to amplify two phoPR promoter fragments that were
each cloned into pCR2.1, creating pSB5 and pSB38, respectively .
(Superscript numbers identify base pair positions 5' [] or 3' [+] of
the PhoP translational start site.) The phoPR promoter
fragments in pSB5 (392 bp) or pSB38 (324 bp) were sequenced, released
from the vector by BamHI and EcoRI digestion, and cloned into the
EcoRI/BamHI sites upstream of the promoterless lacZ in pDH32
to create pSB40, which contains the full-length phoPR promoter
fusion, and pSB39, which contains the same 5' promoter sequence with
a 3' coding region deletion . pSB40 and pSB39 were linearized by Pst1
digestion, transformed into JH642 or MH5600 (phoP
EcoRI),
selecting for Cmr and screened for an amyE
phenotype . Representative pSB40 transformants containing a single
copy of the full-length phoP-lacZ promoter fusion at the
amyE locus in JH642 or MH5600 (phoP
EcoRI)
were called MH5562 and MH5565, respectively . Representative pSB39
transformants containing the 3'-truncated phoPR-lacZ promoter
fusion in JH642 or MH5600 (phoP
EcoRI),
were called MH5559 and MH5567, respectively . MH5580 was constructed
by transforming chromosomal DNA containing the sigE::Ermr
from strain EU8701 into MH5562 and selecting for Erm-resistant
transformants . MH6200 was constructed by transforming chromosomal DNA
from PB344 (sigB::Spcr) into MH5562 and selecting
for Spcr transformants .
|
Media and enzyme assays. For phosphate starvation induction of
Pho reporter enzymes, alkaline phosphatases (APases), or the phoPR
promoter fusions, cells were cultured in low-phosphate defined medium
(LPDM) as described previously (13) . For
sporulation induction conditions, the cells were grown in modified
Schaeffer's sporulation medium with glucose (SSG) (21) .
ί-Galactosidase specific activity was determined by the method of
Ferrari et al . (9) . ί-Galactosidase specific
activity was expressed in units per milligram of protein . The unit
used was equivalent to 0.33 nmol of ortho-nitrophenol produced
per min . APase specific activity was determined as previously
described (13); the units were micromoles of p-nitrophenol
produced per minute at 37°C .
RNA preparation and primer extension analysis. Total RNA was
isolated from B . subtilis cells grown in either LPDM or SSG
medium . Two volumes of RNAprotect bacterial reagent (QIAGEN) was
mixed with 1 volume of bacterial culture and incubated for 5 min at
room temperature . The mixture was centrifuged at 5,000
x g for 10 min . The total RNA was
extracted from the above pellet using the RNeasy Midi kit (QIAGEN) . A
total of 50 ΅g of RNA was used in each primer extension reaction
mixture . The primer extension reactions were performed as described
previously (5) using primer FMH079 (see Fig.
2) . A sequencing ladder was produced by end
labeling the primer FMH079 with [
-32P]ATP
and with pSB5 as template using Sequenase (U.S . Biochemical Corp.)
according to the instructions of the manufacturer .
|
DNase I footprint assays. The phoPR promoter fragment
from pSB5 (Table 1) was digested with either BamHI,
for the coding strand, or EcoRI for the noncoding strand and was end
labeled with Klenow fragment in the presence of [
-32P]dATP .
The insert was then released by digestion with either EcoRI or BamHI .
Purification of the probes and the DNase I footprinting experiments
were performed according to the methods of Liu and Hulett (24) .
In each reaction mixture, 1.4 ΅g of a truncated form of PhoR (*PhoR)
and various amounts of PhoP were used . A final concentration of 4 mM
ATP was added for reactions requiring PhoP
P .
The concentration of PhoP in the reaction mixtures was 55 nM, 275 nM,
1.38 ΅M, and 6.7 ΅M .
Overexpression and purification of proteins . (i)
B.
A DNA fragment containing the entire coding region of
B
was amplified by PCR using chromosomal DNA of JH642 as template .
Oligonucleotide primers were FMH492 (5'-TGCATATG
TTGATCATGACACAACCATCAAAAACT-3') and FMH493(5'-ATGGATCCTTACATTAACTCCATCGAGGGATCTT-3') .
These primers contained NdeI and BamHI sites, respectively . The PCR
product was cloned into pET16b (Novagen) at the same sites, to
generate pSP200 . Escherichia coli BL21(DE3)pLysS cells containing
pSP200 were grown in Luria-Bertani medium (1,000 ml) containing
ampicillin (100 ΅g/ml) at 30°C . When the optical density at 540 nm
was 0.6, isopropyl-ί-D-thiogalactopyranoside
(1 mM) was added to the culture and the cells were collected by
centrifugation at 8,000 x g for 15
min after a 3-h incubation period . The pellet fraction was suspended
in 30 ml of sonication buffer (50 mM Tris [pH 8], 500 mM NaCl, 5 mM
MgCl2, and 20% glycerol), to which 1 mM
phenylmethylsulfonyl fluoride was added directly before the cells
were disrupted by sonication and separated by centrifugation at
120,000 x g for 1 h at 4°C . The
supernatant fraction was applied to a 2.5-ml nickel-nitrilotriacetic
acid-agarose (QIAGEN) affinity column (the Ni-nitrilotriacetic acid
resin was previously equilibrated with sonication buffer in a 1.0-
by 10-cm Econo column [Bio-Rad]) . The column was sequentially
washed with the sonication buffer (20 times with 2.5 ml) followed by
30 mM imidazole in sonication buffer (twice with 2.5 ml) at 4°C . The
bound protein was eluted using a stepwise imidazole concentration
gradient from 100 to 500 mM in the sonication buffer at 4°C . The
eluted proteins were dialyzed overnight against 2x
storage buffer (10 mM Tris [pH 8.0], 10 mM MgCl2, 100 mM
KCl, 0.1 mM EDTA, and 50% glycerol) at 4°C . The protein concentration
was determined with the Bio-Rad protein assay (Bio-Rad Laboratories)
using bovine serum albumin as the standard .
(ii)
E.
A DNA fragment that contains the mature
E
protein-coding region (sigE) without the N-terminal
27-amino-acid-coding region of pro-
E
(20a) was generated by PCR using JH642 chromosomal DNA
as template . The following primers were made with the restriction
sites for NdeI and BamHI: FMH490 (5'-TGCATATGGGCGGGAGTGAAGCCCTGCCGCCTCCAT-3')
and FMH491(5'-CTGGATCCTTACACCATTTTGTTGAACTC-3') . The PCR product
was cloned into pET16b at the same site (Novagen), generating
pSP201 . pSP201 was transformed into E . coli BL21(DE3) pLysS,
and a representative transformant was used as a
E-overexpressing
strain . The
A-overexpressing
strain was provided by M . Fujita and Y . Sadaie.
E
and
A
were overexpressed and purified as described above .
(iii) PhoP and *PhoR. PhoP and *PhoR were purified as previously described (22) . *PhoR is a soluble, truncated form of PhoR (38) .
(iv) RNAP and core polymerase. B . subtilis MH5636 (34) or B . subtilis MH5654 was grown in either LPDM or SSG medium, and the RNA polymerase (RNAP) and the core polymerase were purified as described previously (34) .
In vitro transcription. Linear template DNA used in the in
vitro transcription assays was released from pSB5 by EcoRI digestion,
releasing a 409-bp DNA fragment containing the full-length phoPR
promoter region . These DNA fragments were purified from a 1% agarose
gel with a QIAquick gel extraction kit (QIAGEN) according to the
manufacturer's directions . The transcription reaction mixture (20-΅l
final volume) consisted of a 2 nM concentration of template,
various concentrations of PhoP or PhoP and *PhoR, 1 mM ATP, and 0.4
pmol of purified B . subtilis RNAP (34) . The
transcription buffer contained 100 mM potassium glutamate, 10 mM Tris
(pH 8.0), 0.1 mM EDTA, 50 mM KCl, 1 mM CaCl2, 5 mM MgCl2,
10 ΅g of bovine serum albumin per ml, 1 mM dithiothreitol, and 5%
glycerol . Either PhoP alone or a mixture of PhoP-*PhoR (equal
molar) and ATP (1.0 mM) was incubated with the template at 37°C for
10 min . RNAP or the core polymerase containing required sigma factors
was then added to the reaction mixture, and incubation continued at
37°C for 15 min . A single round of transcription was initiated by the
addition of a transcription buffer containing ATP, GTP, and CTP at
100 ΅M each, 10 ΅M UTP, 5 ΅Ci of [
-32P]UTP
(Amersham), and heparin at 50 ΅g/ml . After incubation at 37°C for 15
min, reactions were stopped by the addition of 10 ΅l of loading dye
(7 M urea, 100 mM EDTA, 5% glycerol, 0.05% xylene cyanol, and 0.05%
[wt/vol] bromophenol blue) . Samples were analyzed on 8 M urea-6%
polyacrylamide gels . Dried gels were analyzed by using a
PhosphorImager (Molecular Dynamics) .
| RESULTS |
|---|
PhoP or PhoP
P
binds to three sites in the phoPR promoter region and one site in the
coding sequence for PhoP. Previous data showed that induction of the
phoPR operon upon phosphate-limited growth was dependent on PhoP
and PhoR . DNase I footprinting experiments were performed to
determine whether regulation of the phoPR operon by the
PhoP-PhoR two-component system might be direct . Either PhoP (in the
presence of *PhoR but the absence of ATP) or PhoP
P
(in the presence of *PhoR and ATP) protected multiple regions
positioned similarly on the coding and noncoding strands (Fig.
1 and 2) . Phosphorylated PhoP
extended the PhoP-protected region primarily on the noncoding strand
between two PhoP binding regions from 150 to 213 and directly 5' of
the PhoP-protected region on the coding strand within the PhoP-coding
sequence (+39 to +25) . Only PhoP
P
protected a region on the coding strand between 9 and 22
or a region between 245 and 280 on the noncoding strand . All
regions protected by both phosphorylated and unphosphorylated PhoP
contained appropriately spaced (4 to 6 bp apart) repeated consensus
sequences for PhoP dimer binding (6), TT(A/C/T)A(C/T)A
(Fig . 2) . The consensus repeats positioned 5' of the
coding region were on the noncoding strand, while the repeat within
the coding region was on the coding strand . A number of
DNase-hypersensitive sites were evident on the coding and the
noncoding strands upon PhoP binding (Fig . 1) .
|
The PhoP binding site in the PhoP-coding region is required for full
induction of the phoPR promoter during phosphate deprivation.
Three PhoP-activated Pho regulon promoters have secondary binding
sites in addition to a core binding region between approximately 20
and 60, relative to the transcription start site, that binds two
PhoP dimers . The secondary binding sites are located either >177 bp
5' of the transcription start site (6) or 3' within
the coding region (25) . In the phoD promoter,
a 5' secondary binding site was essential for 95% of the promoter
function . Two other PhoP-activated promoters, phoA and pstS,
had PhoP and/or PhoP
P
binding regions within the coding region of the activated gene that
were required for full expression of either promoter . To assess the
importance of the 3' PhoP binding site for phoPR promoter
expression, phoPR promoter activity in JH642 (parental strain,
MH5562) or a phoP mutant strain (MH5565) containing a
full-length phoP-lacZ promoter fusion was compared to
that of a JH642 strain (MH5559) or a phoP mutant strain (MH5567)
with a phoP-lacZ promoter fusion containing a deletion of the
3' binding site, as shown in Fig . 2 (deletion of bp +25
to +92) . Figure 3A shows low expression from the
full-length phoPR promoter in JH642 (MH5562) during
exponential growth under phosphate-replete conditions (1 to 4 h)
followed by induction (5 to 8 h), initiated as the culture entered
stationary phase due to Pi limitation . The same promoter
fusion in the phoP mutant strain (MH5565) showed little
induction upon phosphate limitation, but lacZ expression
increased slightly during late stationary phase (10 to 12 h) .
Expression of the phoP promoter fusion with the 3' truncation
in JH642 (strain MH5559) or in the phoP mutant background
(MH5567) was reduced >5-fold compared to the full-length promoter in
JH642, indicating the importance of this PhoP binding site within the
PhoP coding sequence to phoPR operon promoter function during
phosphate starvation .
|
The same four strains plus a sigE mutant strain (MH5580) containing
the full-length phoPR-lacZ promoter fusion were cultured in
a high-phosphate medium (SSG; 43 mM Pi), which was designed
to induce sporulation and development, to assess post-exponential
phoP promoter expression independent of Pi limitation, a
condition where PhoP would be predicted to be unphosphorylated . The
phoP-lacZ expression pattern (Fig . 3B) from
the full-length promoter fusion, either in the parent strain (MH5562)
or in the phoP mutant strain (MH5565) was similar . Expression
in either strain was low during the first 7 h of growth, followed by
a threefold induction that peaked between 9 and 10 h . Because there
was no difference in the ί-galactosidase accumulation in the phoP+
versus the phoP strain, it would appear that there is no
significant role for PhoP in phoPR transcription under these
conditions . The full-length promoter fusion in the sigE mutant
background (MH5580) failed to induce during late stationary growth .
Induction of the 3'-truncated phoP promoter-lacZ fusion
in the phoP mutant strain (MH5567) was similar to that of the
complete promoter, but expression was reduced in JH642 (MH5559),
suggesting a possible repressor role for the unphosphorylated PhoP .
Expression of the 3'-deleted promoter in either the WT or
phoP background was reduced during the first 7 h compared to
the full-length promoter .
The difference in PhoP requirement under different phoPR induction conditions might be explained by multiple promoters, as was determined for phoB (encoding APase B), which was shown to have a vegetative promoter that required PhoP under Pi-limiting growth conditions and a second promoter for induction during sporulation (5) .
The phoPR operon is transcribed from multiple promoters. Primer extension was performed to identify the promoter(s) responsible for expression of the phoPR operon . Figure 4A shows the results of the primer extension analysis on RNA isolated during Pho regulon expression under phosphate starvation conditions . Three 5' ends (labeled P1, P3, and P4) were identified (Fig . 4A, lane 1) by using RNA isolated from cells approximately 1 h after phoPR induction, T1 . An additional 5' end (P2) was observed (Fig . 4A, lane 2) by using RNA isolated from cells 3 h into phosphate starvation induction, T3 . The concentration of P2 increased relative to P3 and P4 concentrations in RNA from cells 4 h after phoPR induction (Fig . 4A, lane 3), while P1 continued to increase but remained the least abundant of the 5' ends . Because we show below that the same 5' ends were found in vitro using purified RNAP, we will refer to them as transcription start sites .
|
To explore the transcriptional regulation of the phoPR operon
under sporulation conditions, we performed primer extension analysis
of the phoPR operon with total RNA isolated from post-exponential-stage
cells grown in SSG at sporulation stage 4, T4 . Under
sporulation conditions, the major 5' end for the phoPR operon
(Fig . 4B, lane 2) was identical to the above P2
promoter identified in RNA from cells that entered stationary phase
due to Pi starvation (above and Fig . 4B,
lane 1) . A low concentration of P1 was also observed .
The transcription start sites P1, P2, P3,
and P4 are located 23, 34/37, 48/49, and 69
bp upstream of the translational start site (ATG), respectively
(Fig . 2) . The 10 and 35 regions of each promoter
were analyzed for sequence similarity to established sigma factor
binding consensus sequences (10) . Sequence alignments (Fig .
4C) provided putative promoter assignments for P1,
P2, P3, and P4 as
B,
E,
A,
and
A,
respectively . Hereafter, we refer to the four promoters as PB1,
PE2, PA3, and PA4 . Putative 10 and
35 sequences for each promoter are indicated in Fig . 2 .
Temporal expression of the phoPR promoters investigated using
in vitro transcription assays with RNAP isolated at different times during
induction. RNAP was purified from B . subtilis (MH5636,
His-tagged rpoC strain) grown in LPDM as the cells
transitioned from exponential growth to stationary phase at T0
and 3 or 4 h later (T3 and T4),
or from strain MH5654 (sigE rpoC His tagged) at stage T4 .
In vitro transcription reactions were carried out with each
RNAP in the presence of PhoP
P
(Fig . 5A) . The in vitro transcription pattern
differed considerably depending on the stage of growth of the cells
from which the RNAP was isolated (Fig . 5A) .
|
Primer extension (Fig . 5B) was used to identify the T4
RNAP (WT or sigE) in vitro transcript start sites (Fig.
5A, lanes 3 and 4) . PA4 and PB1
transcripts were identified in the in vitro-generated mRNA using T4
RNAP isolated from the sigE deletion strain . PB1
and PE2 were identified in the T4 RNAP from the
WT strain . Both in vitro-generated mRNAs identified a transcription
start site (PBxl) not observed in total RNA from cells cultured
under the conditions previously tested . The PBX1 transcription
start site and putative 10 and 35 sequences for
B
are indicated in Fig . 2 .
The in vitro-generated PA4 and PA3 transcripts (Fig. 5A, lane 1) decreased in reactions using later-stage T3 or T4 RNAP from a WT strain (lanes 2 and 3) but were most prominent (Fig . 5A, lane 4) in the reaction using stage T4 sigE RNAP . Conversely, the PE2 transcript that was absent in the reaction using WT T0 RNAP (Fig . 5A, lane 1) was apparent in T3 RNAP reactions and increased dramatically in reactions using stage T4 WT RNAP (Fig . 5A, lane 3) . PE2 was not transcribed by the T4 RNAP missing the SigE subunit (Fig. 5A, lane 4), suggesting that PE2 is dependent on SigE (directly or indirectly) . The quantity of both the PB1 and PBxl transcripts increased with later-stage RNAP but showed no difference with RNAP isolated from WT or sigE stage T4 cells (Fig . 5A, lanes 3 and 4), suggesting that the sigE mutation did not affect the form of RNAP required for their transcription . Thus, the number of transcripts obtained varied, as did the relative concentration of each transcript, depending on the growth stage and the strain from which the RNAP was isolated .
Promoters PE2 and PA4 require phosphorylation
of PhoP (PhoP
P)
for maximum expression. To determine the role of PhoP and PhoP
P
in transcription from PB1, PE2, PA3,
and PA4, in vitro transcription reactions were done using
the full-length promoter as template and WT T4 RNAP
or sigE T4 RNAP in the absence of PhoP or with varying
concentrations of PhoP or PhoP
P .
Figure 6A shows the results of the in vitro
transcription using WT T4 RNAP . Lanes 1 and 5 showed that
significant amounts of PE2 and Pxl transcripts
were generated in the absence of PhoP . Reaction mixtures with
increasing PhoP concentrations from 1 to 5 pmol (Fig .
6A, lanes 2 to 4) indicated that these concentrations of PhoP did
not significantly affect transcription from PE2 and PBxl .
Similar reactions that included *PhoR and ATP for phosphorylation of
PhoP (lanes 6 to 8) indicated that PhoP
P
(1 to 5 pmol) enhanced PE2 transcription but not transcription
of PBXl .
|
Similar experiments were carried out with sigE T4 RNAP (Fig .
6B) to examine PB1, PA3, and PA4,
as the data in Fig . 5A (lane 4) had shown the
highest transcription levels of these promoters with that sample of
RNAP . A control to mark the position of PE2 and PBxl
was included in lane 1 from a reaction mixture identical to that in
Fig . 6A, lane 8 . Lanes 2 and 5 contained
transcripts generated from the phoPR promoter by sigE T4
RNAP alone . Unphosphorylated PhoP (Fig . 6B, lanes 3
and 4) did not significantly affect transcription of PB1,
PA3, or PA4 . PhoP
P
(2.5 to 5 pmol) increased the PA4 transcript severalfold (Fig .
6B, lanes 6 and 7) . PB1 and PA3
showed little enhanced transcription by PhoP
P
(Fig . 6B, lanes 6 and 7) . PhoP
P
did not affect transcription from the PBX1 promoter .
In vitro transcription using core RNAP plus purified sigma factors
identifies
A,
B,
and
E
phoPR operon promoters. Data from Fig . 4 and
5 suggested that the different phoPR promoters
likely required different forms of RNAP holoenzymes for transcription .
To reconstitute specific RNAP holoenzymes, B . subtilis sigma
factors were expressed in E . coli and purified as described
in Materials and Methods, and core polymerase was prepared from
RNAP holoenzyme as described previously (34) .
Figure 7A shows phoPR promoter transcripts generated
using the reconstituted E
A .
An in vitro transcription reaction using core RNAP, PhoP
P,
and the phoPR promoter template yielded no transcripts (lane
6) . The reaction with reconstituted E
A
(lanes 1 and 7) identified PA4 and PA3 as
A
promoters . The PA4 promoter showed enhanced transcription
with increasing concentrations of PhoP
P
(lanes 8 to 13) but little change with unphosphorylated PhoP
(lanes 2 to 5) . The PA3 promoter was very weak with PhoP (lanes
2 to 5) or without (lanes 1 and 7) but showed enhanced transcription
with PhoP
P
(lanes 8 to 13) .
|
The PE2 promoter is a
E
promoter that is enhanced by PhoP
P
(Fig . 7B) . The reaction using the same promoter
template and same the core enzyme as above for reconstituted
E
RNAP holoenzyme resulted in transcription from the PE2
promoter (lane 1) that was little affected by increasing PhoP
concentrations between 0.5 and 5 pmol (lanes 2 to 4) . Reactions
containing PhoP
P
(lanes 5 to 8) yielded increasing PE2 transcripts with
increasing PhoP concentrations between 0.25 and 5 pmol, indicating
that the E
E
PE2 promoter is PhoP
P
activated . A control experiment (Fig . 7B, lanes 9
through 12) that was carried out with a well-characterized E
E
promoter (41, 42), spoIIID,
indicated that the spoIIID transcripts were not affected by
PhoP or PhoP
P .
These data suggest that PhoP
P
activation of E
E
promoters is specific to the phoPR PE2 promoter .
Reconstituted E
B
in reactions with the phoPR template (Fig . 8A)
yielded transcripts from PB1 and PBX1 (lane 1) . Neither
promoter appeared to require PhoP (lanes 2 to 5) or PhoP
P
for transcription (lanes 6 to 9), as neither promoter showed a
dose-dependent transcription increase, and any variation in
transcription appeared to be within experimental error .
|
RNAP holoenzyme isolated from a sigB mutant strain cannot catalyze
PB1 transcription (Fig . 8) . To further test PB1
and PBX1 promoter dependence on SigB, we isolated RNAP
from a sigB mutant strain (MH6200) at stages T0
and T4 for in vitro transcription studies (Fig.
8B) . Lane 1 shows transcription products from the phoPR
promoter template using RNAP from a sigE mutant as position
markers for PBX1, PB1, PA3, and PA4 .
Lane 2 shows PB1 and PBX1 transcripts from the
same template using reconstituted E
B .
Neither PB1 nor PBX1 was transcribed when using
the SigB-deficient T0 RNAP with PhoP or PhoP
P
(lanes 3 and 4, respectively), in marked contrast to that observed in
the control reactions using T0 RNAP from a sigE
mutant strain (lane 1) or reconstituted E
B
(lane 2) . The SigB-deficient T0 RNAP yielded an
increased level of PA4 transcript with PhoP
P
(lane 4) compared to that with unphosphorylated PhoP (lane 3) . No PB1
transcript was detected using T4 RNAP holoenzyme
from a sigB mutant (lanes 5 to 7), while PA4 and PE2
transcripts were enhanced with PhoP
P,
consistent with previous experiments . Interestingly, a transcript was
detected at the PBX1 position using T4
RNAP holoenzyme from a sigB mutant .
Together, these studies suggest that the four promoters identified
by primer extension using in vivo total RNA from JH642 (Fig .
4) included two
A
promoters (PA4 and PA3), one
E
promoter (PE2), and one
B
promoter (PB1) . The reconstituted RNAP studies suggest
that PhoP
P
enhances transcription from E
A
promoters, PA4 and PA3, and from the E
E
promoter, PE2, but not from the E
B
promoter, PB1 .
The PE2 promoter was not transcribed in a sigE
strain; P5 was identified in RNA from a sigB mutant strain.
To further analyze phoPR promoter expression under phosphate
starvation in a sigE (EU8701) or sigB (PB344) mutant strain,
RNA was isolated at various times during promoter induction .
Primer extension analysis indicated that PE2 was not expressed
in the sigE mutant strain (Fig . 9), consistent
with the fact that in vitro transcription studies using RNAP
holoenzymes from a sigE mutant strain failed to transcribe PE2
and that in experiments using reconstituted E
E
the only transcript from the phoPR template was PE2 .
|
The role of SigB in phoPR transcription was more complex . Primer
extension located an additional 5' end of a message in RNA from
the sigB mutant that was located upstream of PA4 and was the
most abundant transcript at T0 (identified as P5
in Fig . 9) . By T1 the relative
abundances of P5, PA4, and PA3 were nearly
equal, as relative concentrations of P5 decreased compared to
products of the two SigA promoters (PA3 and PA4) . By
T2 the PE2 E
E
transcript was most abundant and continued to be through T4 .
The form of RNAP required for P5 transcription is not known .
Although a sequence similar to a SigH consensus was seen upstream
of P5 (Fig . 2), the P5 primer
extension product was observed by using RNA from a sigH sigB
double mutant, suggesting that it is not transcribed by E
H
(data not shown) . Further complicating the SigB analysis, a 5' end of
a message was detected by primer extension analysis at approximately
the same position as the SigB-dependent transcript, PB1,
that was identified in vitro using reconstituted E
B
and that failed to be transcribed in vitro using RNAP holoenzymes
that were isolated from a sigB mutant strain . It is not clear
if this accurately represents the 5' end of PB1
transcription initiation or if it results from message processing
from one of the upstream phoPR promoters, or if it is the
product of premature termination of the reverse transcriptase
reaction .
| DISCUSSION |
|---|
Analysis of autoregulation of the phoPR operon identified two new
roles for PhoP in promoter activation. Because PhoP
P
was required for full induction of the phoPR operon during Pi
limitation (Fig . 3A) (15, 16),
it was important to determine if the regulation were direct and, if
so, which promoter(s) was involved . Analysis of data presented here
suggests that the mechanism of PhoP autoregulation differs from that
required for activation of other Pho regulon promoters in two
important ways .
Previous data that established a direct role for PhoP
P
at a particular promoter also showed that E
A
holoenzyme was required for transcription from that promoter (34) .
Here we show that PhoP
P
can also function with E
E
holoenzyme to enhance transcription at the PE2 promoter of
phoPR . Two additional B . subtilis response regulators,
ResD and Spo0A, are known to function with multiple RNAP holoenzymes .
ResD, a paralogue of PhoP, activates two ctaA promoters; one
is a E
A
promoter and the second promoter requires a developmental sigma
factor (30) that we have recently shown to be
E
(S . Paul and F . M . Hulett, unpublished data) . Spo0A
P
activates the spoIIA promoter, whose transcription depends on
E
H,
and also activates the sigE or spoIIE promoters, whose
transcription depends on E
A
(19, 43, 44) .
Secondly, PhoP was essential for any detectable promoter function
in vivo (on-off switch), and PhoP
P
was required for any transcription regulation in vitro at previously
studied PhoP-activated promoters (34,
35) . In contrast, the role of PhoP
P
in autoregulation is to enhance the otherwise-lower transcription
from three phoPR promoters, PE2, PA3,
and PA4 . Two of these promoters, PA4 and PE2,
have well-conserved sequences at both the 10 and 35 sequences for
SigA and SigE, respectively, which may explain the PhoP-independent
transcription . In vivo, SigE-dependent stationary-phase induction of
phoPR in SSG was independent of PhoP (Fig . 3),
supporting the in vitro transcription data, which showed that E
E
was sufficient for PE2 transcription and that the increase
in PE2 expression by PhoP was phosphorylation dependent .
The in vivo data are consistent with the absence of a phosphate
deficiency signal for Pho regulation in this high-phosphate medium,
SSG, and with the identification of phoPR among genes
controlled by E
E
in a recent genome-wide study (8) .
At least part of the temporal expression pattern for each promoter
was explained by the identification of the RNAP holoenzyme required
by that promoter using previous knowledge concerning when these RNAP
holoenzymes function and how null mutations in one sigma factor
affect the RNA holoenzyme pool (17; for review see reference
20) . Prolonged
A
promoter (PA3 and PA4) transcription levels in
the sigE mutant strain (Fig . 5) are consistent with the
observation that if
E
is not made,
A
remains associated with the core, whereas in the WT strain when
E
is activated in the mother cell most of the
A
is no longer associated with the core RNAP . Similarly,
stationary-phase transcription from PE2 (Fig . 5) is
consistent with the timing of
E
activation in the mother cell during development (11,
18, 26, 31) .
The PhoP binding pattern for autoregulation shows similarities and
differences when compared to the binding pattern at other PhoP-regulated
promoters. PhoP binding to the phoPR promoter shared certain
characteristics observed in PhoP binding patterns at other activated
Pho regulon promoters, such as (i) binding unphosphorylated or
phosphorylated PhoP to certain promoter regions with extension of DNA
protection adjacent to these regions by phosphorylated PhoP (7,
25), (ii) having tandemly repeated consensus
sequences for PhoP dimer binding in sequences protected by both PhoP
and PhoP
P
(7) or (iii) possessing PhoP binding sites within
the coding sequence of the promoter-proximal gene that affect
promoter function (25) . As with the phoA or
pstS promoters, the PhoP binding site within the PhoP coding
region was very important for phoPR induction during Pi
limitation (Fig . 3A, LPDM), but not for postexponential
induction during development (Fig . 3B, SSG) under
phosphate-replete conditions .
The PhoP binding pattern upstream of PhoP-stimulated promoters (PE2
or PA4) is different than that observed for other Pho
regulon-activated promoters (tuaA, phoA, phoB,
pstS, or phoD), where PhoP or PhoP
P
protected a core binding region from approximately 20 to 60
that contained two dimer binding consensus repeats on the coding
strand (6, 24) . PhoP or PhoP
P
protected the PA4 E
A
promoter upstream of 35 in a region that contained a single PhoP
dimer consensus repeat on the noncoding strand .
The PE2 promoter, which has a higher enhanced transcription
in vitro with PhoP
P
compared to PA4, differs from PhoP regulon-activated
promoters not only in PhoP binding pattern but also in the holoenzyme
required for transcription, E
E .
As with PA4, the PE2 PhoP binding consensus
repeats are on the noncoding strand, but the PhoP-protected region
extends from 1 to 35 upstream of the PE2 transcription
start site . Transcription of this promoter during development (T3
in SSG) was the same in a phoP mutant strain as in the parent
strain, indicating that the level of transcription was not dependent
on PhoP (Fig . 3) under these phosphate-replete
conditions .
The PA3 promoter is protected by PhoP and PhoP
P
from 23 to +10, with PhoP consensus binding sites on the noncoding
strand opposite the +1 site for transcription and the 10 promoter
sequence . The PA3 promoter has a very poor
A
35 consensus and appears to be a relatively stronger promoter in
vivo than in vitro, suggesting that an additional unknown protein may
function in vivo that is absent from our in vitro experiments .
This could be a transcription activator or a DNA binding protein that
changes the DNA conformation to enhance PA3 transcription .
It occurred to us that ResD might be that activator, but in vitro
transcription with ResD or ResD
P
did not increase the PA3 transcript (Paul and Hulett,
unpublished) .
Thus, none of the three phoPR promoters that are activated by
PhoP
P
have the usual core binding region for PhoP between 20 and 60
relative to their transcription start site . These differences in PhoP
binding pattern during autoregulation suggest that the mechanism for
PhoP activation of these promoters may be different from that for
other Pho regulon promoters and may involve differences in the
PhoP-RNAP interaction .
Regulatory coordination between phosphate deficiency response global
regulators, PhoP-PhoR and SigB. Results reported here provide insight
into the interdependent regulation between these two global
regulators, but more investigation is required to fully characterize
the promoters involved . SigB is activated via the energy stress
pathway during phosphate-limited growth; thus, both the PhoPR operon
and SigB contribute to the B . subtilis phosphate deficiency
response . It is likely that the stress from Pi limitation
is increased in the sigB mutant strain due to the absence of
SigB-regulated genes . Our data suggest that this additional stress is
responsible for induction of P5 . The dramatic appearance
of an upstream 5' mRNA end (referred to as P5) in RNA
isolated from a sigB mutant strain during phosphate starvation
may account for the increased transcription of phoPR observed
in a sigB mutant during Pi limitation (33) .
Assuming that this 5' end identifies a fifth phoPR operon
promoter, the sigma factor for the putative P5 promoter is
in question . If P5 expression required only a sigma factor
that is present in a sigB mutant strain during phosphate
deficiency stress, then one might expect in vitro transcription from
P5 using RNAP holoenzyme isolated from a sigB
mutant strain . That P5 was not expressed in vitro using
sigB RNAP, with or without PhoP or PhoP
P,
may suggest that P5 requires an activator protein that is
not PhoP .
In vitro data for transcription with E
B
RNAP holoenzyme or RNAP holoenzyme from a sigB mutant strain
indicate that PB1 is a sigB promoter . That mRNA
5'ends were mapped to the PB1 position in RNA from a
sigB mutant strain places the in vitro data in question and
requires further experimentation for clarification .
A recent report concerning phoPR transcription (32)
contains elements that both agree and differ with the work presented
here . The two
A
promoters Pragai et al . identified correspond to PA3 and PA4 .
Why only two promoters were observed is not clear . Strain differences
cannot be the reason, as we have observed all four promoters,
including PB1 and PE2, in primer extension
studies using RNA from B . subtilis 168 (data not shown) in addition
to JH642 . Differences observed in PhoP footprints and PhoP DNA
binding affinity to the phoPR promoter in this and the previous
study (32) have logical explanations . The phoPR
promoter fragment used in the previous study (32)
does not include either the 3' or 5' PhoP/PhoP
P
binding sites shown in Fig . 1 and 2 . The
very high concentrations of PhoP/PhoP
P
required for phoPR promoter protection and differences in the
PhoP protection pattern are consistent with the absence of the 3' and
5' PhoP binding sites, which were found here and in earlier studies (6,
25, 34) to be important for in
vivo promoter activity, PhoP binding affinity, and cooperative
binding between PhoP dimers at other Pho regulon promoters .
In conclusion, the data presented in this study reveal a complex phoPR promoter, the complexity of which likely evolved as a consequence of the limited phosphate availability in the soil . The multifaceted transcriptional control suggests the importance of this two-component signaling system to cellular physiology under a wide range of conditions that include phosphate starvation during growth (PA4 and PA3) and development (PE2) as part of development under phosphate-replete conditions (PE2) and as part of the energy stress response (PB1 and P5) . The data presented here provide a basic understanding of phoPR transcriptional control onto which additional levels of regulation are likely layered . As such, it should prove an invaluable basis for exploring the proposed roles of ResD (40), AbrB (40), CcpA (3, 12), and SigB (12, 33) in Pho regulation, should they act directly at the transcriptional level of phoPR or affect the Pho regulon signal that in turn affects the transcriptional level of phoPR via autoregulation .
| ACKNOWLEDGMENTS |
|---|
We thank C . Price and C . P . Moran for strains and W . Abdel-Fattah for
providing purified RNAP core enzyme . We thank Y . Chen for PhoP
protein and for the helpful discussions .
This work was supported by Public Health Service grant GM 33471 from the National Institutes of Health .
| FOOTNOTES |
|---|
* Corresponding author . Mailing address: Laboratory for
Molecular Biology, Department of Biological Sciences, University of Illinois at
Chicago, 900 S . Ashland Ave . (M/C 567), Chicago, IL 60607 . Phone: (312)
996-5460 . Fax: (312) 413-2691 . E-mail:
Hulett@uic.edu .
Present address: NFRP/TSCRP Program, Congressionally Directed Medical
Research Programs, Science Applications International Corp., Ft .
Detrick, MD 21702 .
Present address: Genencor International, Inc., Palo Alto, CA 94304 .
| REFERENCES |
|---|