J Bacteriol, 1990 Jul, 172(7), 3974 - 9 Critical regions of the Vibrio fischeri luxR protein defined by mutational analysis; Slock J et al.; Expression of Vibrio fischeri luminescence genes requires an inducer, termed autoinducer, and a positive regulatory element, the luxR gene product . A plasmid containing a tac promoter-controlled luxR was mutagenized in vitro with hydroxylamine, and luxR mutant plasmids were identified by their inability to complement a luxR deletion mutation in trans . Sixteen luxR mutant plasmids were obtained, ten of which encoded full-length but inactive luxR gene products as demonstrated by a Western immunoblot analysis . The effects of 1 of the 10 mutations could be overcome by the addition of autoinducer at a high concentration . The mutations in each of the 10 mutant plasmids that directed the synthesis of an inactive LuxR protein were identified by DNA sequencing . Of the 10 proteins encoded by the mutant luxR plasmids, 9 differed from the normally active LuxR in only a single amino acid residue . The amino acid residue substitutions in the proteins encoded by the nine mutant luxR genes clustered in two regions . One region around the middle of the polypeptide encoded by luxR was hypothesized to represent an autoinducer-binding domain, and the other region towards the carboxy terminus of the gene product was hypothesized to constitute a lux operator DNA-binding domain or a lux operator DNA recognition domain. Arch Biochem Biophys, 1990 Jul, 280(1), 211 - 6 Further studies on the gangliosidic nature of the cholinergic-specific antigen, Chol-1; Giuliani A et al.; The antigen designated as Chol-1 beta, detected by an antiserum specific for cholinergic neurons, has been purified to homogeneity from ganglioside mixtures extracted from Torpedo electric organ and pig brain . The final products from the two sources behaved identically in a wide range of tests and gave coincident immunopositive and Ehrlich-positive spots after thin layer chromatography in seven different solvent systems; they were thus considered to be identical and to constitute a single, pure chemical species . Gas-chromatographic analysis revealed the presence of long-chain bases, glucose, galactose, N-acetylgalactosamine, and sialic acid in integral molar ratios of 1:1:2:1:3; the compound's reactivity to cholera toxin after Vibrio cholerae sialidase treatment on thin layer chromatography and the recovery of GM1 as sole product of exhaustive sialidase treatment identified it as a member of the gangliotetrahexosyl series . From the products of partial enzymatic desialylation and treatment with beta-galactosidase and a comparison of the compound's immunoreactivity to anti-Chol-1 antisera with that of other trisialogangliosides of defined molecular structure, we were able to assign a disialosyl residue alpha-Neu5Ac-(2----8)-alpha-Neu5Ac-(2----3)- to the inner galactose, and we suggest GalNAc as a possible site of linkage of the third sialic acid. Res Microbiol, 1990 Jul-Aug, 141(6), 645 - 57 Clonal diversity of Vibrio cholerae O1 evidenced by rRNA gene restriction patterns; Koblavi S et al.; The rRNA gene restriction patterns of 89 Vibrio cholerae O1 isolates from different geographic origins were studied . The probe was Escherichia coli 16 + 23S rRNA labelled with "ECL Gene detection system" . A total of 17 rRNA gene restriction patterns were observed after BglI cleavage . Four patterns (B1 to B4) were only given by biotype cholerae (14 strains studied) . Thirteen patterns (B5 to B17) were only given by biotype El Tor (75 strains studied) . There was no correlation between serotypes and rRNA gene restriction patterns . This study provides arguments that (1) strains of biotypes cholerae and El Tor are different clones, (2) a cholera pandemic is not a single world-wide epidemic (due to a single clone) but rather a simultaneous occurrence of several epidemics (several clones involved), and (3) epidemic waves of biotype El Tor could be due to the emergence of new clones. Z Naturforsch {C}, 1990 Jul-Aug, 45(7-8), 902 - 10 Electron microscopic study of the polymyxin treated Vibrio cholerae cells; Mandal TK; Polymyxin B produces dose dependent changes in the surface topography of pathogenic Vibrio cholerae cells . The susceptibilities of various vibrio strains to PB are also studied through analytical techniques . Statistical analysis shows significant differences among the four vibrios with regard to their sensitivities to PB, the classical strains being the most sensitive . Treating the classical strain with subinhibitory concentration of PB, we observed with both SEM and TEM that the normal smooth surface of the cell envelope develops some protruded structures (blebs and crenations) . Further the TEM study of the ultrathin sections reveal that the rod like projections are formed by protrusions of the outer-membrane of the cell wall. Z Naturforsch {C}, 1990 Jul-Aug, 45(7-8), 818 - 22 The primary structure of the presumable BChl d-binding polypeptide of Chlorobium vibrioforme f . thiosulfatophilum; Wagner-Huber R et al.; In addition to the previous isolated and sequenced polypeptides from green photosynthetic sulfur bacteria, which are presumably involved in binding BChl c and e, an analogous polypeptide has been purified from the BChl d-containing bacterium Chlorobium vibrioforme f . thiosulfatophilum . The primary structure of this 6.15 kDa polypeptide was determined . It shows an extremely high homology (98.3%) to the corresponding polypeptide from Pelodictyon luteolum, indicative of an important functional role. Vopr Med Khim, 1990 Jul-Aug, 36(4), 76 - 8 {Immunochemical characteristics of vibrio neuraminidases isolated from aerated culture filtrates}; Lavrovskii SN et al.; Immunochemical analysis of neuraminidases, isolated from choleraic and non-choleraic vibrios, was carried out . Antineuraminidase antiserum was used in procedures of immunoelectrophoresis, diffusion precipitation in agar gel and disc immunoelectrophoresis in polyacrylamide gel . Antigen composition of neuraminidases was shown to be similar both in choleraic and non-choleraic vibrios. Mol Microbiol, 1990 Jul, 4(7), 1057 - 62 Surface-induced swarmer cell differentiation of Vibrio parahaemolyticus; McCarter L et al.; Vibrio parahaemolyticus distinguishes between life in a liquid environment and life on a surface . Growth on a surface induces differentiation from a swimmer cell to a swarmer cell type . Each cell type is adapted for locomotion under different circumstances . Swimmer cells synthesize a single polar flagellum (Fla) for movement in a liquid medium, and swarmer cells produce an additional distinct flagellar system, the lateral flagella (Laf), for movement across a solid substratum, called swarming . Recognition of surfaces is necessary for swarmer cell differentiation and involves detection of physical signals peculiar to that circumstance and subsequent transduction of information to affect expression of swarmer cell genes (laf) . The polar flagellum functions as a tactile sensor controlling swarmer cell differentiation by sensing forces that restrict its movement . Surface recognition also involves a second signal, i.e . nutritional limitation for iron . Studying surface-induced differentiation could reveal a novel mechanism of gene control and lead to an understanding of the processes of surface colonization by pathogens and other bacteria. Kansenshogaku Zasshi, 1990 Jul, 64(7), 767 - 73 {Development and application of enzyme-linked immunosorbent assay using monoclonal antibody against a hemolysin (Vp-TRH) of Vibrio paraheamolyticus--evidence that Vp-TRH producing-Kanagawa phenomenon-negative V . parahaemolyticus is a human pathogen}; Honda T et al.; Although it has been well established that Kanagawa phenomenon-positive Vibrio parahaemolyticus is a human enteropathogen, the Kanagawa phenomenon-negative one has been considered to be probably not pathogenic . We have found, however, an outbreak of gastroenteritis due to Kanagawa phenomenon-negative V . parahaemolyticus which produces a new toxin (Vp-TRH) resembling to Vp-TDH, a responsible toxin of Kanagawa phenomenon . In this study, we developed monoclonal antibodies against Vp-TRH which were used for development of an enzyme-linked immunosorbent assay (ELISA) for specifically detecting Vp-TRH . The ELISA was applied for analysis of production of Vp-TRH by various isolates of V . parahaemolyticus and we found that Vp-TRH-producing strains were derived mostly from human diarrheal stool, and not from the environment or sea foods . The results of the rabbit ileal loop test showed that Vp-TRH-producing (Kanagawa phenomenon-negative) strains, as well as Vp-TDH-producing (Kanagawa phenomenon-positive) strains could induce fluid accumulation . These results indicate the possibility that Vp-TRH-producing Kanagawa phenomenon-negative V . parahaemolyticus is a human enteropathogen. Indian J Med Res, 1990 Jul, 91, 263 - 5 Phage typing of Vibrio cholerae 01 biotype ElT or strains; Ansari MQ et al.; Data accumulated over the past 20 yr (1969-88) on the phage typing of V . cholerae 01 biotype ElT or strains received at the Vibrio Phage Reference Laboratory, were retrospectively analysed to ascertain the frequency of occurrence of the different phage types of Basu and Mukerjee typing scheme . The analysis revealed that phage types 2 and 4 were the most common types not only at the time when the Basu and Mukerjee typing scheme (of 1968) was introduced but also at present . The existing phage typing scheme needs to be improved with the addition of more new phages to obtain more type distinction and better discrimination within biotype ElT or strains for epidemiological studies. FEMS Microbiol Lett, 1990 Jul, 58(2), 205 - 9 Starvation-induced modulations in binding protein-dependent glucose transport by the marine Vibrio sp . S14; Albertson NH et al.; The uptake kinetics of D-glucose were examined in the marine Vibrio sp . S14 during a period of 168 h of complete energy and nutrient starvation . Two glucose transport systems were distinguished in Vibrio sp . S14: a low affinity system (Km = 4.6 +/- 0.9 microM) at the onset of starvation, and a high affinity system (Km = 0.55 +/- 0.15 microM) after 168 h of starvation . Both systems had a narrow substrate specificity, and both were osmotic shock-sensitive. Can J Microbiol, 1990 Jul, 36(7), 464 - 8 Effect of various biophysicochemical conditions on toxigenicity of Vibrio cholerae 01 during survival with a green alga, Rhizoclonium fontanum, in an artificial aquatic environment; Islam MS; Toxigenic and nontoxigenic strains of Vibrio cholerae 01 occur in the natural aquatic environment . It is not clear whether V . cholerae 01 lose toxigenicity and become nontoxigenic during survival in the aquatic environment as a result of the effect of various biophysicochemical conditions (e.g., sunlight, pH, temperature, competition with other bacteria for nutrients, etc.) . Five toxigenic strains were exposed to artificial aquatic environments in the presence of a filamentous green alga . Rhizoclonium fontanum, and recovered after different time intervals (0 and 0.5 h, 3, 6, 9, and 15 days) . This experimental system was exposed to sunlight and the V . cholerae 01 were in competition for nutrients with resident bacterial flora from R . fontanum . The toxigenicity of Vibrio cholerae 01 that were recovered at different time intervals was assessed by tissue culture assay using Vero cells . The toxigenicity of recovered strains was compared with that of the parent strains . The results demonstrated that toxigenic V . cholerae 01 are unlikely to lose their toxigenicity in aquatic environments as a result of the effects of various biophysicochemical conditions . These results are consistent with the hypothesis of environmental reservoirs of V . cholerae. J Biolumin Chemilumin, 1990 Jul-Sep, 5(3), 213 - 7 Bioluminescence decay kinetics in the reaction of bacterial luciferase with different aldehydes; Ismailov AD et al.; At 22 degrees C the bioluminescence decay kinetics in the in vitro reaction catalysed by Vibrio harveyi luciferase in the presence of different aldehydes--nonanal, decanal, tridecanal and tetradecanal did not follow the simple exponential pattern and could be fitted to a two-exponential process . One more principal distinction from the first-order kinetics is the dependence of the parameters on aldehyde concentration . The complex bioluminescence decay kinetics are interpreted in terms of a scheme, where bacterial luciferase is able to perform multiple turnovers using different flavin species to produce light . The initial phase of the bioluminescent reaction appears to proceed mainly with fully reduced flavin as the substrate while the final one results from the involvement of flavin semiquinone in the catalytic cycle. J Bacteriol, 1990 Jul, 172(7), 3701 - 6 Depressed light emission by symbiotic Vibrio fischeri of the sepiolid squid Euprymna scolopes; Boettcher KJ et al.; Bioluminescent marine bacteria of the species Vibrio fischeri are the specific light organ symbionts of the sepiolid squid Euprymna scolopes . Although they share morphological and physiological characteristics with other strains of V . fischeri, when cultured away from the light organ association the E . scolopes symbionts depress their maximal luminescence over 1,000-fold . The primary cause of this reduced luminescence is the underproduction by these bacteria of luciferase autoinducer, a molecule involved in the positive transcriptional regulation of the V . fischeri lux operon . Such an absence of visible light production outside of the symbiotic association has not been previously reported among light organ symbionts of this or any other species of luminous bacteria . Levels of luminescence approaching those of the E . scolopes bacteria in the intact association can be restored by the addition of exogenous autoinducer to bacteria in laboratory culture and are affected by the presence of cyclic AMP . We conclude that some condition(s) specific to the internal environment of the light organ is necessary for maximal autoinduction of luminescence in the symbionts of this squid-bacterial association. J Bacteriol, 1990 Jul, 172(7), 3980 - 7 Use of regulated cell lysis in a lethal genetic selection in Escherichia coli: identification of the autoinducer-binding region of the LuxR protein from Vibrio fischeri ATCC 7744; Shadel GS et al.; A lethal genetic selection utilizing the bacteriophage lambda lysis genes (S, R, RZ) has been developed and used in conjunction with a luminescence screen to allow the isolation and characterization of six missense mutations and two nonsense mutations in the luxR gene from Vibrio fischeri ATCC 7744 . A transcriptional fusion of the lysis genes in operonR downstream of a truncated luxI gene allows control of cell lysis by the addition of synthetic autoinducer to the growth medium . The six missense mutations isolated resulted in changes in the LuxR protein of Asp at position 79 to Asn (hereafter designated as D79N), V82I, V109L, L118F, S123I, and H217Y . Variant LuxR proteins with amino acid changes of D79N, V82I, V82L, and H127Y were shown to require higher concentrations of autoinducer to elicit a certain amplitude response than is required by the wild-type protein . We believe that the clustering of a total of seven randomly generated missense mutations in a 49-amino-acid region of the LuxR primary sequence defines a critical portion of the LuxR protein . The observation that proteins with lesions in this region responded to elevated levels of autoinducer suggests that the autoinducer-binding site is constructed, at least in part, from several amino acid residues within the 79-to-127 region of the LuxR protein. Arq Gastroenterol, 1990 Jul-Sep, 27(3), 141 - 3 {Human gastroenteritis associated with Vibrio fluvialis in Recife}; Magalhaes V et al.; Due to the low number of reports about vibrio gastroenteritis in Brazil, it was decided to report one case of human gastroenteritis from who only Vibrio fluvialis has been found in patient stools . The main clinical epidemiological and microbiological aspects related to that microorganism are discussed . Probably, this is the first report of gastroenteritis caused by Vibrio fluvialis in the country. Diagn Microbiol Infect Dis, 1990 Jul-Aug, 13(4), 285 - 8 Enhancement of virulence of two environmental strains of Vibrio vulnificus after passage through mice; Kaysner CA et al.; The virulence of two environmental strains of Vibrio vulnificus to iron-loaded adult mice was enhanced by passage through mice . Estimates of 50% lethal dose values (LD50) determined by end point titration were reduced 100- and 1000-fold for the two strains . Passage through mice also selected for the opaque colony type phase variation of V . vulnificus, reported by others to be more virulent to mice than a translucent colony type. Infect Immun, 1990 Jul, 58(7), 2352 - 60 Study of epitopes of cholera enterotoxin-related enterotoxins by checkerboard immunoblotting; Kazemi M et al.; Checkerboard immunoblotting, a versatile new technique for examining multiple antigen and antibody interactions simultaneously, was applied in studies of epitopes in the cholera enterotoxin (CT)-related heat-labile enterotoxin (LT) family . The purified antigens used included the following: the B-subunit proteins from two CTs (CT-B-1 and CT-B-2), from classical and El Tor biotype strains of Vibrio cholerae, respectively; human LT-B-1 (H-LT-B-1) and porcine LT-B (P-LT-B) derived from LTs produced by Escherichia coli strains of human (H) and porcine (P) origins, respectively; and genetically engineered chimeric P-LT-Bs with amino acid substitutions from H-LT-B-1 . The antigens were used in native, partially denatured, and CNBr-fragmented forms . The antisera included a variety of mouse monoclonal antibodies against these proteins as well as polyclonal hyperimmune sera and sera from adult American volunteer vaccinees or convalescents from induced cholera . Rabbit antisera against synthetic peptides of the CT-B-1 subunit were also used . In some instances, the effect of GM1 ganglioside on antibody binding was evaluated . The reactivity of the monoclonal antibodies was directed primarily against conformational epitopes: some were specific for homologous antigen; some were promiscuously reactive; and some recognized particular related proteins . Individual amino acids (most notably amino acid 46) exerted a dominant effect on epitope formation--in some instances, in a complementary fashion . Epitope expression was also affected by distant amino acid residues (polar effects) . Some reactions were blocked by GM1 treatment of the immobilized antigen, indicating that the epitope was involved in or affected by GM1 binding . Polyclonal antibody responses varied within and among animal species . Human serum antitoxic responses were higher in convalescents from induced cholera than in recipients of a genetically engineered live vaccine, and the convalescent sera (from El Tor biotype cholera patients) generally preferred CT-B-2 to CT-B-1 . The results demonstrate the potential significance of the differences among these immunologically related enterotoxins and may help provide direction to further vaccine development. Appl Microbiol Biotechnol, 1990 Jul, 33(4), 389 - 94 Production of cholera toxin subunit B by a mutant strain of Vibrio cholerae; van de Walle M et al.; The B subunit (CTB) of cholera toxin (CT) can be used as a carrier protein for conjugate vaccines designed to elicit antipolysaccharide antibodies . A defined medium, AGM4, was designed to grow a high-producing mutant of Vibrio cholerae expressing only the B subunit of CT: V . cholerae 0395-NI . AGM4 contains four amino acids, asparagine, glutamic acid, arginine and serine, salts and a trace element solution . The carbon source is glucose . The fermentations performed in AGM4 indicated that CTB production paralleled the growth of the organism but that there was a maximal release of CTB during the stationary phase . There was a clear optimum of productivity at pH 8.0 and 30 degrees C . The pH had an influence on CTB production and not only on its release . Analysis of the amino acids present in the medium showed a correlation between their consumption rates and CTB productivity. Biochemistry, 1990 Jun 12, 29(23), 5509 - 15 Cloning and expression of the luxY gene from Vibrio fischeri strain Y-1 in Escherichia coli and complete amino acid sequence of the yellow fluorescent protein; Baldwin TO et al.; Vibrio fischeri strain Y-1 (ATCC 33715) emits light with a lambda max of 545 nm rather than the 485-nm emission typical of other strains of V . fischeri . The yellow emission is due to the interaction of the enzyme luciferase with a yellow fluorescent protein (YFP) . On the basis of the N-terminal amino acid sequence of YFP, a mixed-sequence oligonucleotide probe was synthesized and used to isolate a 1.6-kbp HindIII fragment containing the first 208 bases of the gene that codes for YFP (luxY) . Another synthetic oligonucleotide complementary to bases 167-184 of the YFP coding sequence was used to isolate a second (ca . 1.9 kbp) DNA fragment generated by digestion with both EcoRI and ClaI that contained the remainder of the luxY gene . The intact luxY gene, which encoded a 22,211-dalton polypeptide composed of 194 amino acid residues, was reconstructed from the two primary clones and is contained within a 765-bp SspI-XhoII fragment . Both strands of the entire luxY coding sequence were determined from the reconstructed gene, while the region surrounding the junction used in the reconstruction was also determined from the original partial clones . As with other genes that have been studied from V . fischeri, the luxY gene was unusually AT-rich . The sequence of luxY did not bear any apparent similarity to any of the sequences contained in the current GenBank database . Escherichia coli containing a plasmid with the luxY gene expresses a protein that reacts with antibody raised to authentic YFP. Appl Environ Microbiol, 1990 Jun, 56(6), 1977 - 80 Attachment of Vibrio cholerae serogroup O1 to zooplankton and phytoplankton of Bangladesh waters; Tamplin ML et al.; Vibrio cholerae serogroup O1, the causative agent of cholera, is capable of surviving in aquatic environments for extended periods and is considered an autochthonous species in estuarine and brackish waters . These environments contain numerous elements that may affect its ecology . The studies reported here examined physical interactions between V . cholerae O1 and natural plankton populations of a geographical region in Bangladesh where cholera is an endemic disease . Results showed that four of five clinical V . cholerae O1 strains and endogenous bacterial flora were attached preferentially to zooplankton molts (exuviae) rather than to whole specimens . One strain attached in approximately equal numbers to both exuviae and whole specimens . V . cholerae O1 also attached to several phytoplankton species . The results show that V . cholerae O1 can bind to diverse plankton species collected from an area where cholera is an endemic disease, with potentially significant effects on its ecology. Appl Environ Microbiol, 1990 Jun, 56(6), 1750 - 62 Phenotypic study of bacteria associated with the caribbean sclerosponge, Ceratoporella nicholsoni; Santavy DL et al.; Heterotrophic bacteria associated with the Caribbean sclerosponge, Ceratoporella nicholsoni (Hickson), were found to occur extracellularly and were confined to the mesohyl regions of the sponge tissue . Physiological, metabolic, and morphological attributes of the culturable bacteria associated with the sponge were recorded by using numerical taxonomy methods for the analysis of 158 phenotypic attributes . Morphometric methods were used to determine the proportion of the total sponge-associated bacteria that were culturable by the methods employed, with the results ranging from 3 to 11% of the total bacteria inhabiting the sponge . Approximately 78% of the culturable bacteria clustered into four groups or phena, representing two previously undescribed Vibrio spp., an Aeromonas sp., and a coryneform- or actinomycete-like sp . Most of the bacteria were facultative anaerobes, fermenting sucrose and fucose but unusual in an inability to ferment glucose . This study was the first comprehensive study of heterotrophic bacteria associated with a sponge from the Caribbean basin, a region reputed to contain the most prolific sponge populations, with respect to biomass and diversity . The possible significance of these associations is discussed. J Clin Microbiol, 1990 Jun, 28(6), 1473 - 6 Use of a synthetic oligonucleotide probe to detect strains of non-serovar O1 Vibrio cholerae carrying the gene for heat-stable enterotoxin (NAG-ST); Hoge CW et al.; A synthetic oligonucleotide probe was developed to identify the gene for the heat-stable enterotoxin (NAG-ST) of non-serovar O1 Vibrio cholerae . Of 103 non-O1 V . cholerae isolates from Thailand, 31 isolates from Mexico, and 47 isolates from patients in the United States, only 7 (all from Thailand) hybridized with the probe . Probe-positive strains produced significantly higher fluid accumulations in infant mice than probe-negative strains. Br J Cancer, 1990 Jun, 61(6), 813 - 20 Glycosphingolipid expression on murine L1-fibrosarcoma cells: analysis of clonal in vivo and in vitro selected sublines with different lung colonisation potential; Hanisch FG et al.; The patterns of acidic and neutral glycosphingolipids (GSLs) were examined in a syngeneic tumour system in Balb/c mice consisting of closely related cell lines with different colonisation potentials directed to the murine lungs (in vivo selected highly metastatic sublines of L1-fibrosarcoma cells and their WGA-resistant mutants with low metastatic potential) . GSLs were analysed by high-performance thin-layer chromatography and structurally identified by fast atom bombardment mass spectrometry combined with compositional analyses and exo-glycosidase digestion . The results suggest that highly metastatic sublines L1-LM and L1-LM12 derived by in vivo selection from mouse fibrosarcoma cells (cell line L1) exhibit a drastic increase of polar ganglioside expression and a restriction to globo-series GSLs . Contrasting with this the low metastatic mutant cells (L1-LM13WGA) express a reduced portion of acidic GSLs and exhibit a shift to less polar ganglioside components . Total cellular and plasma membrane-integrated GSLs were demonstrated to exhibit largely identical patterns . Concomitant with a significant decrease in LacCer expression a substantial reduction of GM2 and a complete lack of GM3 expression can be assigned to the highly metastatic sublines of L1-cells . On the other hand, the more polar gangliosides GM1a and, to an even greater extent, GD1a (exceeding 70% of total gangliosides) accumulate on L1-LM and their clonal sublines . The shift to acidic GSLs of higher polarity is less pronounced on the low metastatic WGA-resistant mutant cells (L1-LM13WGA) showing a preponderance of GM1a . The portion of GD1a within the fractions of acidic GSLs does not correspond to the cellular activities of CMP-NeuAc/GM1 (alpha 2-3) sialyltransferase measured for high and low metastatic cell variants . Total sialic acid content of the various cell lines differs, but is not associated with the metastatic potential . Gangliosides on L1-cells exhibit a significant substitution of N-glycolyl for N-acetylneuraminic acid (13%) compared to their metastatic sublines and to mutant cells (less than 1%) . A conversion of surface exposed GD1a to GM1a on membranes of metastatic cells by in situ treatment with Vibrio cholerae sialidase is associated with a significant reduction of tumour cell colonisation directed to the murine lungs. J Bacteriol, 1990 Jun, 172(6), 3515 - 8 A trans-unsaturated fatty acid in a psychrophilic bacterium, Vibrio sp . strain ABE-1; Okuyama H et al.; A high level of a trans-unsaturated fatty acid was found in the phospholipids of a psychrophilic bacterium, Vibrio sp . strain ABE-1 . This fatty acid was identified as 9-trans-hexadecenoic acid (C16:19t) by gas-liquid chromatography and infrared absorption spectrometry . C16:1(9)t accounted for less than 1% of the total fatty acids in cells grown at 5 degrees C and reached 12% of the total at 20 degrees C . We suggest that the increase in the level of the trans-unsaturated fatty acid is related to the high growth rate of this bacterium at elevated temperatures . Possible biological roles of the trans-unsaturated fatty acid in the adaptation of the microorganism to the ambient temperature are discussed. Southeast Asian J Trop Med Public Health, 1990 Jun, 21(2), 219 - 24 Relationship of vibriocidal antibodies to history of cholera vaccination in Thai adult volunteers; Pitisuttithum P et al.; Vibriocidal antibodies were determined by microtechnique in 5 groups of Thai adult volunteers who had never received or had received cholera vaccination within one year, more than one to five years ago, more than five to ten years ago and more than ten years ago respectively . Detailed questionnaires about socioeconomic status, educational levels and environmental factors were presented to every volunteer . There were no differences statistically in incomes, educational levels and environmental factors among the groups . It was found that the reciprocal geometric mean titers of antibodies in volunteers who had never received cholera vaccination was generally low . The reciprocal geometric mean titers of the volunteers who had received cholera vaccination within one year were statistically different from other groups (p = 0.05) . There was no correlation between blood groups of volunteers and vibriocidal antibodies. Appl Environ Microbiol, 1990 Jun, 56(6), 1547 - 50 Screening of aquatic samples for Vibrio cholerae serotype O1 by a dot-blot method and a latex agglutination test; Nishikawa Y et al.; A dot-blot, enzyme-linked immunosorbent method and a latex agglutination test were studied for their abilities to detect Vibrio cholerae serotype O1 in aquatic samples by testing artificially contaminated water as well as samples from natural potential sources . Water samples were preenriched with alkaline peptone and then enriched with Monsur peptone water . For the dot-blot test, enriched cultures of organisms in a small portion of the Monsur peptone water were transferred to a polyvinylidene difluoride membrane with a microfiltration apparatus . The enzyme-linked immunosorbent assay was performed by using biotin-labeled antibodies and avidin-biotin-peroxidase complex; brown dots developed in the wells that contained serotype O1 vibrios . Latex agglutination tests were performed by mixing 1 drop of the culture in Monsur with 1 drop of reagent coated with monoclonal antibody specific for antigen A . The sensitivities and specificities of the methods were compared with those of the colony-blot method, which identified individual colonies of V . cholerae O1 in mixed bacterial cultures on isolation media . Our results indicate that the dot-blot method is as sensitive as the colony-blot method and is useful for screening for V . cholerae serotype O1 even in specimens that are heavily contaminated with non-O1 vibrios. Appl Environ Microbiol, 1990 Jun, 56(6), 1926 - 31 Particle agglutination assays to identify fibronectin and collagen cell surface receptors and lectins in Aeromonas and Vibrio species; Ascencio F et al.; A rapid particle agglutination assay (PAA) utilizing latex beads coated with connective tissue and serum proteins was evaluated for its ability to identify fibronectin, collagen (types I and IV), fibrinogen, and transferrin cell surface receptors on Vibrio and Aeromonas strains isolated from diseased fish, human infections, and the environment . Similar tests were performed to screen for cell surface lectins . Vibrio as well as Aeromonas strains were found to bind connective tissue proteins (collagen types I, II, and IV and fibronectin), serum proteins (i.e., fibrinogen), and glycoproteins (bovine submaxillary mucin, hog gastric mucin, orosomucoid, and fetuin) immobilized on the latex particles . The specificity of the agglutination reaction was studied by particle agglutination inhibition assays performed by preincubating bacterial suspensions in solutions containing either gelatin (for the various connective tissue protein PAA reagents) or sialic acid-rich glycoproteins (for the various glycoprotein PAA reagents) . Expression of cell surface receptors for connective tissue proteins was found to depend on culture methods. J Bacteriol, 1990 Jun, 172(6), 2946 - 54 Cloning and nucleotide sequence of luxR, a regulatory gene controlling bioluminescence in Vibrio harveyi; Showalter RE et al.; Mutagenesis with transposon mini-Mulac was used previously to identify a regulatory locus necessary for expression of bioluminescence genes, lux, in Vibrio harveyi (M . Martin, R . Showalter, and M . Silverman, J . Bacteriol . 171:2406-2414, 1989) . Mutants with transposon insertions in this regulatory locus were used to construct a hybridization probe which was used in this study to detect recombinants in a cosmid library containing the homologous DNA . Recombinant cosmids with this DNA stimulated expression of the genes encoding enzymes for luminescence, i.e., the luxCDABE operon, which were positioned in trans on a compatible replicon in Escherichia coli . Transposon mutagenesis and analysis of the DNA sequence of the cloned DNA indicated that regulatory function resided in a single gene of about 0.6-kilobases named luxR . Expression of bioluminescence in V . harveyi and in the fish light-organ symbiont Vibrio fischeri is controlled by density-sensing mechanisms involving the accumulation of small signal molecules called autoinducers, but similarity of the two luminescence systems at the molecular level was not apparent in this study . The amino acid sequence of the LuxR product of V . harveyi, which indicates a structural relationship to some DNA-binding proteins, is not similar to the sequence of the protein that regulates expression of luminescence in V . fischeri . In addition, reconstitution of autoinducer-controlled luminescence in recombinant E . coli, already achieved with lux genes cloned from V . fischeri, was not accomplished with the isolation of luxR from V . harveyi, suggesting a requirement for an additional regulatory component. Infect Immun, 1990 Jun, 58(6), 1769 - 73 Phenotypic evaluation of acapsular transposon mutants of Vibrio vulnificus; Wright AC et al.; Translucent, avirulent spontaneous phase variants of Vibrio vulnificus MO6-24 reverted back to the original opaque, encapsulated phenotype under both in vivo and in vitro conditions . Two translucent, acapsular mutants, which did not show phase variation, were constructed by using the transposon Tn5 IS50L::phoA (TnphoA) . Loss of capsule was accompanied by decreases in virulence, hydrophilicity, and serum resistance . The ability to utilize transferrin-bound iron for growth was lost in only one of the two unencapsulated mutants . Our data emphasize the apparent importance of capsule in the virulence of V . vulnificus and indicate that utilization of transferrin-bound iron is independent of encapsulation. Can J Microbiol, 1990 Jun, 36(6), 395 - 9 Properties of a hemolysin related to the thermostable direct hemolysin produced by a Kanagawa phenomenon negative, clinical isolate of Vibrio parahaemolyticus; Honda T et al.; A hemolytic toxin (Vp-TRH) produced by a Kanagawa phenomenon negative, clinical isolate of Vibrio parahaemolyticus was further characterized . The purified Vp-TRH showed various biological activities, such as fluid accumulation in rabbit ileal loops, increase of rabbit skin vascular permeability, and cardiotoxicity on cultured myocardial cells, all of which are essentially similar to the activities found with thermostable direct hemolysin (Vp-TDH), a pathogenic toxin produced by Kanagawa phenomenon positive V . parahaemolyticus . Immunological similarities of Vp-TRH not only to Vp-TDH but also to hemolytic toxins produced by Vibrio hollisae and Vibrio cholerae non-O1, both of which are also enteropathogens closely related to V . parahaemolyticus, were demonstrated . The amino acid composition and sequence of N-terminal amino acids of Vp-TRH were determined . These results suggest that Vp-TRH has biological and immunological characters similar to Vp-TDH, although they are distinct molecules. J Bacteriol, 1990 Jun, 172(6), 3496 - 9 Construction of broad-host-range plasmid vectors for easy visible selection and analysis of promoters; Farinha MA et al.; We have constructed a series of broad-host-range plasmids which use "visual screens" to detect promoter activity . These plasmids contain the pMB1 and pRO1600 origins of replication and are capable of replicating in a wide range of gram-negative bacteria . The genes encoding beta-galactosidase and alkaline phosphatase from Escherichia coli and bacterial luciferase from Vibrio harveyi supply the promoterless indicator genes . The constructs were tested in E . coli and Pseudomonas aeruginosa. J Infect Dis, 1990 Jun, 161(6), 1231 - 6 Antibodies directed against the toxin-coregulated pilus isolated from Vibrio cholerae provide protection in the infant mouse experimental cholera model; Sun DX et al.; Pathogenic strains of Vibrio cholerae O1 elaborate a toxin-coregulated pilus, designated TCP, that is required for the bacteria to colonize the human intestine and cause disease . The possibility that antibodies directed against TCP might block colonization and thereby potentially prevent infection was investigated . The pilus was purified and polyclonal antiserum raised against it was shown to react preferentially with the 20.5-kDa major pilin subunit, TcpA . This antiserum inhibited attachment of the bacteria to epithelial cells in vitro . In a cholera animal model system, these pilus-specific antibodies efficiently protected infant mice from challenge with virulent V . cholerae strains of different serotypes and biotypes . Western immunoblot analysis of available killed, whole-cell vaccine preparations using TcpA-specific antibodies failed to detect pilin in either preparation . The results suggest that inclusion of TCP in cholera vaccines would provide a common antigen to induce immunity to the strains associated with human infection and potentially increase vaccine efficacy. Infect Immun, 1990 Jun, 58(6), 1640 - 6 Pili of Vibrio cholerae non-O1; Nakasone N et al.; Pili of Vibrio cholerae non-O1 strain S7 were purified and characterized . The pili of S7 were morphologically, electrophoretically, and immunologically (as far as polyclonal antibody was used) indistinguishable from the 16-kilodalton pili of V . cholerae O1 strain 82P7 . The purified pili and organisms had D-mannose- and L-fucose-resistant hemagglutinin . The hemagglutinating activity of the purified pili was inhibited by the Fab fraction of antipilus antibody, but the hemagglutinating activity of live organisms was not inhibited completely . The purified pili or Fab fraction of antipilus antibody did not inhibit the adhesion of V . cholerae non-O1 to rabbit intestines . Therefore, the pili were not regarded as a colonization factor of V . cholerae non-O1 . A total of 148 V . cholerae non-O1 and O1 clinical isolates were screened for the presence of S7 pili by using an agglutination test with anti-S7 pilus serum; 12 of 49 V . cholerae non-O1 strains and 25 of 99 V . cholerae O1 strains were positive for agglutination . These agglutination reactions were not correlated with adhesion of the organisms to intestines. Can J Microbiol, 1990 Jun, 36(6), 409 - 13 Variation in epitopes of the B subunit of Vibrio cholerae non-O1 and Vibrio mimicus cholera toxins; Tamplin ML et al.; Monoclonal antibodies reacting with the B subunit of Vibrio cholerae O1 strain 569B cholera toxin (CT-B) were used to identify unique and common epitopes of V . cholerae non-O1 and Vibrio mimicus CT-B . Vibrio cholerae non-O1 strains produced CT-B showing three monoclonal antibody reaction patterns (epitypes), which corresponded with epitypes described previously for V . cholerae O1 classical biotype CT-B (CT1), El Tor biotype CT-B (CT2), and a unique V . cholerae non-O1 CT-B (CT3), which lacked an epitope located in or near the GM1 ganglioside binding site of 569B CT-B . Vibrio mimicus CT-B was immunologically indistinguishable from 569B CT-B . These and previous results define six epitopes on 569B CT-B, and a fourth epitope in or near the GM1 ganglioside binding site. Biochem Biophys Res Commun, 1990 May 31, 169(1), 116 - 22 Lipid A mutants of Vibrio cholerae: isolation and partial characterization; Paul S et al.; Vibrio cholerae mutants resistant to common antibiotics and neutral and anionic detergents were isolated . Analysis of isolated outer membranes revealed a significant deficiency in the acylation of lipid A in the resistant strains . The content of amide-linked and ester-bound fatty acids in the lipid A of the mutant strains compared to that of the wild type was about 50-56% and 29-37% respectively . This defect was specific for lipid A as there was no change in the acylation of phospholipids . The reduction in fatty acid content of lipid A was reflected in the altered endotoxic properties in the mutant strains. Biochemistry, 1990 May 15, 29(19), 4641 - 52 Effects of general anesthetics on the bacterial luciferase enzyme from Vibrio harveyi: an anesthetic target site with differential sensitivity; Curry S et al.; The effects of a diverse range of 36 general anesthetics and anesthetic-like compounds on a highly purified preparation of the bacterial luciferase enzyme from Vibrio harveyi have been investigated . Under conditions where the flavin site was saturated, almost all of the anesthetics inhibited the peak enzyme activity and slowed the rate of decay . However, a small number of the more polar agents only inhibited at high concentrations, while stimulating activity at lower concentrations . The inhibition was found to be competitive in nature, with the anesthetics acting by competing for the binding of the aldehyde substrate n-decanal . The anesthetic binding site on the enzyme could accommodate only a single molecule of a large anesthetic but more than one molecule of a small anesthetic, consistent with the site having circumscribed dimensions . The homologous series of n-alcohols and n-alkanes exhibited cutoffs in inhibitory potency, but these cutoffs occurred at very different chain lengths (about C10 for the n-alkanes and C15 for the n-alcohols), mimicking similar cutoffs observed for general anesthetic potencies in animals . Binding constants determined from peak height measurements showed that the inhibitor binding site was predominantly hydrophobic (with a mean delta delta G CH2 of -5.0 kJ/mol), but fluctuations in the binding constants with chain length revealed regions in the binding site with polar characteristics . Binding constants to an intermediate form of the enzyme (intermediate II) were also determined, and these confirmed the principal features of the binding site deduced from the peak height measurements . The long-chain compounds, however, bound considerably tighter to the intermediate II form of the enzyme, and this was shown to account for the biphasic decay kinetics that were observed with these compounds . Overall, there was poor agreement between the EC50 concentrations for inhibiting the luciferase enzyme from V . harveyi and those which induce general anesthesia in animals, with bulky compounds being much less potent, and moderately long chain alcohols being much more potent, as luciferase inhibitors than as general anesthetics. Biochemistry, 1990 May 8, 29(18), 4340 - 8 Red shift of absorption maxima in chlorobiineae through enzymic methylation of their antenna bacteriochlorophylls; Bobe FW et al.; The bacteriochlorophyll d producing photosynthetic green sulfur bacteria Chlorobium vibrioforme forma thiosulfatophilum strain NCIB 8327 and C . vibrioforme strain B1-20 respond to reduced light conditions in culture by performing methylations at the 4- and 5-substituents, for example, converting the 4-Et into 4-n-Pr, 4-i-Bu, and even 4-neoPn . During this process, the absorption maximum in living cells of C . vibrioforme strain B1-20 red shifts from 714 to about 728 nm . Eventually, the C . vibrioforme forma thiosulfatophilum strain NCIB 8327 culture carries out a delta-methylation to produce the bacteriochlorophylls c (lambda max ca . 750 nm); the new UC Davis bacteriochlorophyll c culture is named C . vibrioforme forma thiosulfatophilum strain D . It is possible that the homologation process increases hydrophobic interactions between individual BChl molecules, giving rise to larger aggregates in the antenna system . Alternatively, the additional methyl units attached to the 4-position shift the absolute configuration of the 2-(1-hydroxyethyl) group from pure R in the case of 4-Et to pure S in the case of 4-neoPn, which in turn might determine the size of the in vivo aggregates due to the intrinsic nature of the pigment protein system . It is suggested that the bacteriochlorophylls c from Chloroflexus aurantiacus strain J-10-fl and the bacteriochlorophylls e from Chlorobium phaeovibrioides might have undergone similar meso methylation as a response to external environmental pressure such as low light intensity. Biochemistry, 1990 May 8, 29(18), 4348 - 55 Biosynthetic studies of substituent homologation in bacteriochlorophylls c and d; Huster MS et al.; Administration of carbon-13 and carbon-14 labeled glutamate, glycine, and methionine to Chlorobium vibrioforme forma thiosulfatophilum strain D have demonstrated operation of the C5 and C1 metabolic pathways in bacteriochlorophyll c and bacteriochlorophyll d biosynthesis in this organism, with glutamate providing the delta-aminolevulinic acid for macrocycle synthesis and glycine providing the source of the extra homologation at the 4-, 5-, and delta-positions (via S-adenosylmethionine) . Further evidence showing that the bacteria appear to adjust the homologue composition of their antenna bacteriochlorophylls in response to varying growth conditions is presented . Timing of these changes within a single culture is consistent with a light adaptation mechanism, which predicts that degree of alkylation is directly proportional to light intensity in the culture; other factors influencing pigment composition during the lifespan of a single culture may also be operating, and these are discussed. FEBS Lett, 1990 May 7, 264(1), 10 - 2 In vitro protein translocation into inverted membrane vesicles prepared from Vibrio alginolyticus is stimulated by the electrochemical potential of Na+ in the presence of Escherichia coli SecA; Tokuda H et al.; A protein translocation system was reconstituted from inverted membrane vesicles prepared from Na+ pump-possessing Vibrio alginolyticus and purified Escherichia coli SecA . The translocation required ATP and was stimulated by the functioning of the Na+ pump, suggesting that the electrochemical potential of Na+, but not that of H+, is important for protein translocation in Vibrio. Res Microbiol, 1990 May, 141(4), 437 - 52 Characterization of 22 Vibrio species by gas chromatography analysis of their cellular fatty acids; Urdaci MC et al.; The cellular fatty acid compositions of 51 Vibrio strains belonging to 22 species as well as five Aeromonas strains were determined by using capillary gas-liquid chromatography (GLC) . The major fatty acids were most often hexadecenoic, hexadecanoic and octadecenoic acids . Heptadecenoic acid was present in significant amounts in V . alginolyticus, V . natriegens, V . parahaemolyticus and "Vibrio navarrensis" . Twenty fatty acids including branched and hydroxy acids were detected in the genus Vibrio . Quantitative results were treated by principal component analysis to display groups of strains . The first three components (accounting for 69% of the variance) showed the type strains of V . fischeri, V . ordalii, V . damsela, V . mediterranei, V . tubiashii, V . campbellii, V . pelagius, V . gazogenes, and V . nereis to be unclustered . V . alginolyticus (4 strains) and V . parahaemolyticus (4 strains) showed some overlap and the type strain of V . natriegens was in their neighborhood . V . harveyi (4 strains) formed a cluster and V . vulnificus was in its vicinity . V . cholerae (5 strains) overlapped with V . diazotrophicus (3 strains) and was close to the type strain of V . mimicus and V . anguillarum . V . metschnikovii (3 strains) clustered with the type strain of V . cincinnatiensis . A decision tree was devised for the identification of Vibrio species based on qualitative characteristics of fatty acid patterns . However, the following three groups, V . alginolyticus-V . parahaemolyticus-V . natriegens, V . metschnikovii-V . cincinnatiensis and V . cholerae-V . mimicus could not be split into such a decision tree. Zentralbl Bakteriol, 1990 May, 273(1), 24 - 32 Morphology of endotoxin-like particles released by Vibrio cholerae non-O1; Strycek T et al.; The morphology of "free endotoxin" in cell suspensions of Vibrio cholerae non-O1 and in fractions purified from culture filtrate (Fraction 1) was examined at the beginning of the exponential phase of growth in complex medium . The observed structures were compared with those of the lipopolysaccharide obtained by phenol extraction . Blebs, vesicles, and ribbons with a trilaminar, membrane-like structure were observed by electron microscopy of ultrathin sections and negatively stained samples . Endotoxic activity was detected in these samples by the Limulus amoebocyte lysate pyrotest . The free endotoxin appeared as a heterogeneous population of particles in Fraction 1 (20-60 nm in diameter) and in the bacterial suspension (10-40 nm in diameter) while the lipopolysaccharide obtained by phenol extraction of the cells was revealed to be a uniform particle population (45 nm in diameter). J Invertebr Pathol, 1990 May, 55(3), 312 - 8 Number and types of hemocytes in Sunetta scripta and Villorita cyprinoides var . cochinensis (Bivalvia), and leukocytosis subsequent to bacterial challenge; Suresh K et al.; The number and types of hemocytes in four size groups of the clam species Sunetta scripta and Villorita cyprinoides var . cochinensis, and leukocytosis in the 38- to 40-mm-size-group clams of both species subsequent to challenge with Vibrio alginolyticus at a concentration of 1 x 10(8) cells/0.02 ml of sterile 2% saline was investigated . In S . scripta, the mean total hemocyte count in the 42- to 44-mm size group was significantly lower than that of the three other size groups but there was no significant variation in total cell counts in the four size groups of V . cyprinoides var . cochinensis . Only two types of hemocytes, granulocytes and agranulocytes, occur and the percentage of agranulocytes was roughly half of that of granulocytes . The data on the effects of sham injection and Vibrio injection suggest that there is significant leukocytosis early in both clam species as a result of sham injection; the bacterial challenge produces significant leukocytosis in V . cyprinoides var . cochinensis both early (6 and 12 hr) and later (48,96 and 120 hr), but only at 48 hr in S . scripta; and in both clam species there is significant increase in total cell counts in Vibrio-injected ones than in untampered controls at various time intervals. South Med J, 1990 May, 83(5), 500 - 2 Fatalities associated with Vibrio parahaemolyticus and Vibrio cholerae non-O1 infections in Florida (1981 to 1988); Klontz KC; Vibrio infections constitute a continuing source of morbidity and mortality in Florida . Seven fatal infections caused by Vibrio parahaemolyticus or V cholerae non-O1 were reported in Florida between 1981 and 1988 . Review of those seven medical records and Vibrio case investigation forms showed that although all patients died of sepsis, gastrointestinal signs and symptoms characterized the early illness in four patients, whereas the other three initially had painful swelling and/or lesions of the lower extremities . All patients had preexisting chronic diseases . Five patients (71%) had eaten seafood during the week before oneset of illness, including four (57%) who had eaten raw oysters . To reduce the risk of acquiring Vibrio infections, raw or undercooked seafood should be eliminated from the diet, particularly by persons with underlying chronic diseases. J Med Microbiol, 1990 May, 32(1), 33 - 7 Immunobiological relationships of the enterotoxins produced by cholera toxin gene-positive (CT+) and -negative (CT-) strains of Vibrio cholerae O1; Saha S et al.; The optimum rabbit ileal loop (RIL) reacting doses of the new cholera toxin (NCT) produced by cholera toxin gene-negative (CT-) strain X-392 and of the enterotoxin produced by cholera toxin gene-positive (CT+) strain 569B of Vibrio cholerae O1 were found to be 32 micrograms and 22 micrograms respectively . Production of NCT by the CT+ strain, in addition to CT, was confirmed by in-vivo neutralisation tests . Anti-569B-enterotoxin neutralised the optimum RIL reacting activity of NCT completely at 1 in 16 dilution, whereas the activity of 569B enterotoxin was only partially neutralised (44%) by anti-NCT . Similarly, partial neutralisation (66%) was observed when purified anti-CT was mixed with 569B enterotoxin . Therefore, the fluid accumulation produced in the RIL by 569B enterotoxin was the combined effect of both CT and NCT . No antigenic relationship between NCT and CT could be demonstrated in gel-diffusion tests. J Infect, 1990 May, 20(3), 193 - 200 Person-to-person transmission of cholera in a psychiatric hospital; Goh KT et al.; An outbreak of cholera caused by Vibrio cholerae O1, biotype el tor, serotype Ogawa, phage type 4, was reported in a psychiatric hospital in Singapore . A total of 74 inmates (18 symptomatic and 56 asymptomatic) were infected; two of them died . Extensive epidemiological investigations showed that the organism was not transmitted by contaminated food or water but through close person-to-person contact . Early recognition of the outbreak and prompt implementation of epidemic control measures comprising surveillance of diarrhoea, rectal swabbing of all asymptomatic inmates, isolation of those found to be infected, maintenance of a high standard of environmental sanitation and mass chemoprophylaxis with doxycycline, rapidly brought the outbreak under control. Appl Environ Microbiol, 1990 May, 56(5), 1480 - 4 Improved fluorogenic assay for rapid detection of Vibrio parahaemolyticus in foods; Miyamoto T et al.; An improved fluorogenic assay for the rapid detection of Vibrio parahaemolyticus was developed . In the improved assay, the enrichment of V . parahaemolyticus was carried out in arabinose-glucuronate medium (0.5% arabinose, 0.25% glucuronate, 0.1% polypeptone, 0.1% yeast extract, 0.1% ammonium sulfate, 2% NaCl, 2 micrograms of polymyxin B sulfate per ml, pH 8.5) at 37 degrees C . After the cultivation, the trypsinlike activity of the bacteria was measured by fluorescence with the fluorogenic substrate benzoyl-L-arginine-7-aminomethylcoumarin . Even in the presence of 3 x 10(5) cells of Vibrio alginolyticus, 20 cells of V . parahaemolyticus were clearly detected after a 6-h enrichment cultivation by the assay . Fifty contaminated samples of 14 seafoods were examined for V . parahaemolyticus by the fluorogenic assay after enrichment cultivation for 6 or 8 h . The results were then compared with those obtained by the conventional bromothymol blue Teepol agar assay and the most-probable-number method . There was a linear relationship between trypsinlike activity measured by the assay and the number of V . parahaemolyticus cells in seafood as determined by the bromothymol blue Teepol agar and most-probable-number methods . Correlation coefficients were 0.95 and 0.93 after a 6-h cultivation and an 8-h cultivation, respectively . The presence of 10 cells of V . parahaemolyticus per gram of seafood sample was detected after a 10-h total detection time by the fluorogenic assay. Appl Environ Microbiol, 1990 May, 56(5), 1327 - 32 Copper-induced production of copper-binding supernatant proteins by the marine bacterium Vibrio alginolyticus; Harwood-Sears V et al.; Growth of the marine bacterium Vibrio alginolyticus is temporarily inhibited by micromolar levels of copper . During the copper-induced lag phase, supernatant compounds which complex and detoxify copper are produced . In this study two copper-inducible supernatant proteins having molecular masses of ca . 21 and 19 kilodaltons (CuBP1 and CuBP2) were identified; these proteins were, respectively, 25 and 46 times amplified in supernatants of copper-challenged cultures compared with controls . Experiments in which chloramphenicol was added to cultures indicated that there was de novo synthesis of these proteins in response to copper . When supernatants were separated by gel permeation chromatography, CuBP1 and CuBP2 coeluted with a copper-induced peak in copper-binding activity . CuBP1 and CuBP2 from whole supernatants were concentrated and partially purified by using a copper-charged immobilized metal ion affinity chromatography column, confirming the affinity of these proteins for copper . A comparison of cell pellets and supernatants demonstrated that CuBP1 was more concentrated in supernatants than in cells . Our data are consistent with a model for a novel mechanism of copper detoxification in which excretion of copper-binding protein is induced by copper. Infect Immun, 1990 May, 58(5), 1481 - 4 Diminished immunogenicity of a recombination-deficient derivative of Vibrio cholerae vaccine strain CVD103; Ketley JM et al.; To address potential concerns over the release of genetically engineered live bacterial vaccines, we constructed a recombination-deficient derivative of the Vibrio cholerae O1 vaccine strain CVD103 (CVD103RM) . Oral immunization of adult volunteers with CVD103RM showed that the recA mutation significantly diminished colonization ability and immunogenicity of the vaccine strain. Jpn J Med, 1990 May-Jun, 29(3), 313 - 9 A successfully treated case of Vibrio vulnificus septicemia with shock; Kikawa K et al.; Vibrio vulnificus infection often causes serious or fatal disease . Recently, in Japan there have been numerous reports of Vibrio vulnificus infection . Here, we report a successfully treated case of Vibrio vulnificus septicemia with shock, disseminated intravascular coagulation (DIC) and necrotizing cellulitis in a middle-aged heavy drinker with chronic alcoholic liver disease . On reviewing 38 cases in Japan including ours, the overall mortality rate was 68% . Although the incidence is relatively low, it is recommended to warn patients in the high risk category, such as liver disease patients, to avoid raw fish and shellfish and limit sea water exposure. Trans R Soc Trop Med Hyg, 1990 May-Jun, 84(3), 422 - 4 Survival of toxigenic Vibrio cholerae O1 with a common duckweed, Lemna minor, in artificial aquatic ecosystems; Islam MS et al.; Cholera epidemics occur twice a year in Bangladesh . During epidemics, Vibrio cholerae O1 are isolated from patients, as well as from the surface water, but the bacteria disappear during inter-epidemic periods . Their reservoirs or sites of survival and multiplication during inter-epidemic period are still unknown . The present survival study in the laboratory explored the role of an aquatic plant, Lemna minor (duckweed), as a possible reservoir . L . minor was added to sea-salt solution at pH 8.5, containing V . cholerae . Survival of V . cholerae on L . minor, in water on which L . minor was floating, and in control water (without L . minor) was monitored at regular intervals . Survival of both environmental and clinical strains of V . cholerae was assessed by viable counts on thiosulphate-citrate-bile salt-sucrose agar . It was observed that both strains survived better on L . minor than in water on which L . minor was floating or in control water . It is suggested that plants may serve as an effective environmental reservoir for V . cholerae either through a non-specific association or by interaction with V . cholerae in commensal relationship. Mikrobiol Zh, 1990 May-Jun, 52(3), 16 - 20 {A comparative study of the oxidation processes in the cells of typical forms and L forms of Vibrio cholerae}; Golubkova LA et al.; A comparative study of metabolic processes in cells of typical forms and L-forms of cholera vibrios has determined a change in the intensity of oxidative processes demonstrated through a decrease in the activity of respiration enzymes (dehydrogenases and diaphorases) and through a restricted transport of electrons along the respiration chain . The facts established evidence for the transition of L-transformed cells into a physiological state with a deficit of substrates and energy as well as with retarded processes of vital activity and repressed mechanisms of reparation of structural elements of a cell. Mikrobiol Zh, 1990 May-Jun, 52(3), 10 - 6 {The composition of a population of cloned cultures of revertant Vibrio cholerae L forms}; Danilkina EB et al.; The process of L-transformation and L-transformed state duration have been studied for their effect on variability of main characters of revertant cultures of choleric vibrions L-forms at the population level with the use of cloned cultures of the choleric vibrions . The study was conducted on two strains of the choleric vibrion of the eltor biovar in different periods of storage in the L-transformed state (1, 3, 6 months) . It has been revealed that characters of the species and biovar remained stable despite the influence of L-transforming agents . The characters of clone cultures characterizing virulence (sensitivity to KhDF phages, hemolytic activity, toxin production and virulence for sucking rabbits proved to be subjected to variability to the greatest extent with simultaneous preservation of the toxin-production gene . A resistant change of the serovar (from Inaba to Ogava) is observed only in one revertant-subculture of the virulent strain. Antimicrob Agents Chemother, 1990 May, 34(5), 939 - 40 Double-blind, randomized, controlled clinical trial of norfloxacin for cholera; Bhattacharya SK et al.; In a double-blind, randomized clinical trial with 78 adults with acute watery diarrhea and severe dehydration, 37 subjects were positive for Vibrio cholerae . In conjunction with rehydration therapy, 13 patients received norfloxacin, 12 received trimethoprim-sulfamethoxazole (TMP-SMX), and 12 received a placebo . Norfloxacin was superior to TMP-SMX and to the placebo in reducing stool output, duration of diarrhea, fluid requirements, and vibrio excretion . TMP-SMX was no better than the placebo. J Clin Microbiol, 1990 May, 28(5), 872 - 5 Vibrio cholerae serogroup O1 in northeast Thailand; Kuyyakanond T et al.; Strains of Vibrio cholerae serogroup O1 biotype El Tor that are susceptible to Mukerjee cholera bacteriophage group IV (S . Mukerjee, Bull . W.H.O . 28:333-336, 1963) were found . Cholera vibrios isolated from epidemics in northeast Thailand were characterized, and 57 of 60 strains isolated in 1986 were susceptible to cholera phage IV . However, all 113 strains isolated in 1988 were not susceptible to the phage . All isolates in both epidemics revealed behaviors typical of El Tor vibrios, except phage IV susceptibility in the 57 strains . Although the plaques of phage IV were generally translucent, plaques on some isolates looked transparent, just like those on classical vibrios . The organisms grown in the plaques were lysogenized . If this kind of strain is frequently isolated, the biotype of V . cholerae O1 should be reconsidered. Appl Environ Microbiol, 1990 May, 56(5), 1367 - 72 Thymidine uptake, thymidine incorporation, and thymidine kinase activity in marine bacterium isolates; Jeffrey WH et al.; One assumption made in bacterial production estimates from {3H}thymidine incorporation is that all heterotrophic bacteria can incorporate exogenous thymidine into DNA . Heterotrophic marine bacterium isolates from Tampa Bay, Fla., Chesapeake Bay, Md., and a coral surface microlayer were examined for thymidine uptake (transport), thymidine incorporation, the presence of thymidine kinase genes, and thymidine kinase enzyme activity . Of the 41 isolates tested, 37 were capable of thymidine incorporation into DNA . The four organisms that could not incorporate thymidine also transported thymidine poorly and lacked thymidine kinase activity . Attempts to detect thymidine kinase genes in the marine isolates by molecular probing with gene probes made from Escherichia coli and herpes simplex virus thymidine kinase genes proved unsuccessful . To determine if the inability to incorporate thymidine was due to the lack of thymidine kinase, one organism, Vibrio sp . strain D19, was transformed with a plasmid (pGQ3) that contained an E . coli thymidine kinase gene . Although enzyme assays indicated high levels of thymidine kinase activity in transformants, these cells still failed to incorporate exogenous thymidine into DNA or to transport thymidine into the cells . These results indicate that the inability of certain marine bacteria to incorporate thymidine may not be solely due to the lack of thymidine kinase activity but may also be due to the absence of thymidine transport systems. Mutat Res, 1990 May, 244(1), 55 - 60 DNA damage and prophage induction and toxicity of nitrofurantoin in Escherichia coli and Vibrio cholerae cells; Sengupta S et al.; Repair-deficient and repair-proficient strains of E . coli K12 were sensitive to nitrofurantoin treatment to varying degrees with the double mutant strain (uvrA 6, recA 13) being most sensitive . Ultraviolet absorption data and thermal chromatography through a hydroxyapatite column revealed that nitrofurantoin treatment of V . cholerae strain OGAWA 154 produced a maximal amount of 55% reversibly bihelical DNA at a nitrofurantoin dose of 120 micrograms/ml/h, which indicated the formation of inter-strand cross-links in DNA . Nitrofurantoin also produced prophage-lambda induction in E . coli K12 strain GY 5027: envA, uvrB, ampA 1, strA (lambda), in a dose-dependent manner, the maximum induction being highly significant (P less than 0.001) . Previously published mutation data coupled with the prophage induction data presented here suggest that the genotoxic properties of nitrofurantoin are mediated through the SOS pathway. J Med Microbiol, 1990 May, 32(1), 39 - 43 Cytolytic action of Vibrio vulnificus haemolysin on mast cells from rat peritoneal cavity; Yamanaka H et al.; The mode of action of Vibrio vulnificus haemolysin (VVH) on mast cells from the peritoneal cavity of the rat was examined . VVH induced histamine release, and damage to the mast cells, in a dose-dependent fashion . When 1 microgram of VVH was added to c . 10(5) mast cells at 37 degrees C, histamine release was observed after a lag period of 5-10 s, and was complete within 5 min . The action was temperature-dependent, and was not induced at 4 degrees C . Disodium cromoglycate, a membrane stabiliser for mast cells, inhibited the histamine release significantly, but the effect was not dose-dependent . Moreover, leakage of lactate dehydrogenase from VVH-treated mast cells was observed . These results suggest that VVH acts on the cell membrane of mast cells and is cytolytic. Zh Mikrobiol Epidemiol Immunobiol, 1990 Apr, (4), 54 - 8 {Groups of the species Vibrio cholerae having different epidemic importance}; Semiotrochev VL; Subdivision of V . cholerae 01 into toxins on the basis of the whole complex of signs characteristic of this species does not make it possible to judge on their epidemic importance and to use the data on identification of V . cholerae for solving practical problems . Classification of V . cholerae by their capacity for producing toxin (choleragen and hemolysin of type 1, subtype beta) removes these difficulties. J Comp Pathol, 1990 Apr, 102(3), 291 - 7 Myocarditis in the common cuttlefish (Sepia officinalis); Reimschuessel R et al.; This report describes five cases of myocarditis in the common cuttlefish, Sepia officinalis . Both the systemic heart and the branchial hearts exhibited inflammatory lesions . Vibrio species were isolated from four of these cases. J Clin Microbiol, 1990 Apr, 28(4), 823 - 4 Biotype-specific probe for Vibrio cholerae serogroup O1; Alm RA et al.; The O1 serogroup of Vibrio cholerae can be divided into two biotypes, El Tor and Classical . Current tests to distinguish between these biotypes are often difficult to interpret . On the basis of the difference in sequence of the hlyA gene in these biotypes, we have developed a simple probe that can easily and reliably differentiate between the two biotypes. Am J Epidemiol, 1990 Apr, 131(4), 719 - 28 Epidemic cholera in West Africa: the role of food handling and high-risk foods; St Louis ME et al.; During an epidemic of cholera in Guinea, West Africa, in 1986, the authors conducted two studies of risk factors for transmission . In the capital city, 35 hospitalized cholera patients were more likely than 70 neighborhood-matched controls to have eaten leftover peanut sauces (odds ration (OR) = 3.1, 95% confidence interval (CI) 1.2-8.2), but less likely to have eaten tomato sauces (OR = 0.2, 95 percent CI 0.1-0.9) . Hand washing with soap before meals by all family members protected against cholera (OR = 0.2, 95 percent CI 0.02-0.96), suggesting that persons asymptomatically infected with Vibrio cholerae 01 may have been the initial source for contamination of the leftover foods . Laboratory studies demonstrated that V . cholerae multiplied rapidly in peanut sauce (pH 6.0), but not in the more acidic tomato sauce (pH 5.0) . In an outbreak of cholera-like illness after a rural funeral, illness was strongly associated with eating a rice meal served over many hours without reheating . These studies demonstrated that, in this epidemic, many cases of severe cholera were associated with eating specific cooked foods that could support bacterial growth after contamination of these foods with V . cholerae within the household . Epidemic control efforts should include identification of high-risk foods and promotion of simple changes in food handling behaviors to lower the risk of foodborne transmission. Biull Eksp Biol Med, 1990 Apr, 109(4), 371 - 4 {Morphological changes caused by the dermonecrosis factor of the causative agents of cholera and various other intestinal infections}; Isupov IV et al.; Intra- or subepithelial focal purulent inflammation with necrosis of exudating leucocytes during 1-2 days is developed in consequence of intradermal injection of the living cholera vibrios, cultured on membrane agar, or their supernatants . Sometimes coagulative necrosis of cover epithelium arises without preliminary purulent inflammation stage from the very beginning . Intradermal injection of living cholera vibrios leads to the development of coagulative necrotic foci in derma too . The vascular genesis of alterations mentioned above is supposed. APMIS, 1990 Apr, 98(4), 353 - 7 Binding of bacteria to carbohydrates immobilized on beads to demonstrate the presence of cell-associated hemagglutinins in Vibrio cholerae; Sanchez J et al.; We describe a phase contrast microscopy method for direct observation of classical and El Tor vibrios to agarose beads containing covalently attached L-fucose or D-mannose . Binding of the vibrios to L-fucose beads was found to correlate with fucose-sensitive agglutination of human O erythrocytes, while binding of bacteria to beads with D-mannose was consistent with mannose-sensitive agglutination of chicken erythrocytes . Furthermore, vibrios expressing both fucose and mannose-sensitive hemagglutinins adhered equally to L-fucose and D-mannose-containing beads . Because this procedure is neither subject to biological variations in different populations of erythrocytes nor affected by other factors known to interfere with hemagglutination tests, it offers a suitable, more robust and specific alternative to detect functional adhesins in Vibrio cholerae and other bacteria. J Biolumin Chemilumin, 1990 Apr-Jun, 5(2), 99 - 106 Control of the lux regulon of Vibrio fischeri; Shadel GS et al.; Regulation of expression of bioluminescence from the Vibrio fischeri lux regulon in Escherichia coli is a consequence of a unique form of positive feedback superimposed on a poorly defined cis-acting repression mechanism . The lux regulon consists of two divergently transcribed operons . The leftward operon contains only a single gene, luxR, which encodes a transcriptional activator protein . The rightward operon contains luxI, which together with luxR and the 218 base pairs separating the two operons comprises the primary regulatory circuit, and the five structural genes, luxC, luxD, luxA, luxB and luxE, which are required for the bioluminescence activity . Transcription of luxR from PL is stimulated by binding of the E . coli crp gene product to the sequence TGTGACAAAAATCCAA upstream of the presumed promoter . Binding of pure E . coli CAP protein in a cAMP-dependent reaction to the V . fischeri lux regulatory region has been demonstrated by in vitro footprinting . The luxI gene product is an enzyme which catalyses a condensation reaction of cytoplasmic substrates to yield the autoinducer, N-(3-oxo-hexanoyl) homoserine lactone . Accumulation of autoinducer, which is freely diffusible, results in formation of a complex with LuxR . The complex binds to the sequence ACCTGTAGGATCGTACAGGT upstream of PR to stimulate transcription of the rightward operon . Increased transcription from PR should yield increased levels of LuxI and higher levels of autoinducer which would further activate LuxR . The LuxR binding site is also a LexA binding site, as demonstrated by in vitro footprinting . Basal transcription from both PL and PR is repressed by sequences within the luxR coding region.(ABSTRACT TRUNCATED AT 250 WORDS) J Bacteriol, 1990 Apr, 172(4), 2046 - 54 Transcriptional regulation of lux genes transferred into Vibrio harveyi; Miyamoto CM et al.; Past work has shown that transformed Escherichia coli is not a suitable vehicle for studying the expression and regulation of the cloned luminescence (lux) genes of Vibrio harveyi . Therefore, we have used a conjugative system to transfer lux genes cloned into E . coli back into V . harveyi, where they can be studied in the parental organism . To do this, lux DNA was inserted into a broad-spectrum vector, pKT230, cloned in E . coli, and then mobilized into V . harveyi by mating aided by the conjugative plasmid pRK2013, also contained in E . coli . Transfer of the wild-type luxD gene into the V . harveyi M17 mutant by this means resulted in complementation of the luxD mutation and full restoration of luminescence in the mutant; expression of transferase activity was induced if DNA upstream of luxC preceded the luxD gene on the plasmid, indicating the presence of a strong inducible promoter . To extend the usefulness of the transfer system, the gene for chloramphenicol acetyltransferase was inserted into the pKT230 vector as a reporter . The promoter upstream of luxC was verified to be cell density regulated and, in addition, glucose repressible . It is suggested that this promoter may be the primary autoregulated promoter of the V . harveyi luminescence system . Strong termination signals on both DNA strands were recognized and are located downstream from luxE at a point complementary to the longest mRNA from the lux operon . Structural lux genes transferred back into V . harveyi under control of the luxC promoter are expressed at very high levels in V . harveyi as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis: the gene transfer system is thus useful for expression of proteins as well as for studying the regulation of lux genes in their native environment. Jpn J Med Sci Biol, 1990 Apr, 43(2), 37 - 41 A new selective, differential agar medium for isolation of Vibrio cholerae O1: PMT (polymyxin-mannose-tellurite) agar; Shimada T et al.; A new selective and differential agar medium, polymyxin-mannose-tellurite (PMT) agar was devised to differentiate easily colonies of Vibrio cholerae O1 from those of V . cholerae non-O1 . The differentiation between colonies of the two vibrios is based on mannose-fermentation . Colonies of V . cholerae O1 on the agar are agglutinated with O1 antiserum of V . cholerae much more easily than those on thiosulfate-citrate-bile salts-sucrose (TCBS) agar. Appl Environ Microbiol, 1990 Apr, 56(4), 1033 - 7 Plasmid profiling of Vibrio salmonicida for epidemiological studies of cold-water vibriosis in Atlantic salmon (Salmo salar) and cod (Gadus morhua); Sorum H et al.; In 1988, a new plasmid profile was observed for Vibrio salmonicida isolated from cod (Gadus morhua) and Atlantic salmon (Salmo salar) in fish farms in northern Norway . This new plasmid profile, which consisted of plasmids of 61, 21, 3.4, and 2.8 megadaltons, is 1 of 11 plasmid profiles which have so far been observed for V . salmonicida . Plasmid profiling and plasmid DNA hybridization were used in epidemiological studies of cold-water vibriosis . Our results indicate that V . salmonicida was transmitted from Atlantic salmon to cod and vice versa . The 61-megadalton plasmid was found exclusively in V . salmonicida strains originating from northern Norway, which is the only area in which this plasmid has ever been observed . Plasmid DNA hybridization and restriction endonuclease analysis show that the plasmid DNA of V . salmonicida remained stable throughout a 7-year survey. J Biolumin Chemilumin, 1990 Apr-Jun, 5(2), 89 - 97 Fusion of LuxA and LuxB and its expression in E . coli, S . cerevisiae and D . melanogaster; Almashanu S et al.; Luciferase from Vibrio harveyi is encoded by two adjacent genes, luxA and luxB . The two genes were fused by replacing a segment extending from near the end of luxA into the N-terminal end of luxB by a synthetic oligonucleotide . The construction removed the TAA stop codon at the end of luxA, the intervening region of 26 base pairs, and the initial methionine of luxB . A Smal site was included at the junction between the two genes and an AatII site was created near the end of luxA without altering its amino acid sequence . In Escherichia coli the fused luxAB gene could be expressed to produce functional luciferase that gave about 20% of the activity in cells without the fusion . An out-of-frame ATG exists close to and preceding the ATG of the luxA gene . This was removed and the entire fused gene bracketed by several restriction enzyme sites . The fused luxAB gene was successfully expressed in Saccharomyces cerevisiae and Drosophila melanogaster by transferring it to appropriate plasmid vectors. J Trop Med Hyg, 1990 Apr, 93(2), 133 - 9 Long-term persistence of toxigenic Vibrio cholerae 01 in the mucilaginous sheath of a blue-green alga, Anabaena variabilis; Islam MS et al.; Cholera epidemics occur twice a year in the endemic area of Bangladesh . Vibrio cholerae 01 can be isolated from the environment only during the epidemics and the question of possible interepidemic environmental reservoirs of V . cholerae remains open . The present laboratory-based studies investigate the role of an aquatic alga, Anabaena variabilis, as a possible reservoir . Persistence of V . cholerae inside the mucilaginous sheath of A . variabilis was observed by phase-contrast and fluorescent microscopy for more than 15 months after inoculation. J Neurochem, 1990 Apr, 54(4), 1310 - 20 Neuroblastoma differentiation involves the expression of two isoforms of the alpha-subunit of Go; Brabet P et al.; The regulation of GTP-binding proteins (G proteins) was examined during the course of differentiation of neuroblastoma N1E-115 cells . N1E-115 cell membranes possess three Bordetella pertussis toxin (PTX) substrates assigned to alpha-subunits (G alpha) of Go (a G protein of unknown function) and "Gi (a G protein inhibitory to adenylate cyclase)-like" proteins and one substrate of Vibrio cholerae toxin corresponding to an alpha-subunit of Gs (a G protein stimulatory to adenylate cyclase) . In undifferentiated cells, only one form of Go alpha was found, having a pI of 5.8 Go alpha content increased by approximately twofold from the undifferentiated state to 96 h of cell differentiation . This is mainly due to the appearance of another Go alpha form having a pI of 5.55 . Both Go alpha isoforms have similar sizes on sodium dodecyl sulfate-polyacrylamide gels, are recognized by polyclonal antibodies to bovine brain Go alpha, are ADP-ribosylated by PTX, and are covalently myristylated in whole N1E-115 cells . In addition, immunofluorescent staining of N1E-115 cells with Go alpha antibodies revealed that association of Go alpha with the plasma membrane appears to coincide with the expression of the most acidic isoform and morphological cell differentiation . In contrast, the levels of both Gi alpha and Gs alpha did not significantly change, whereas that of the common beta-subunit increased by approximately 30% over the same period . These results demonstrate specific regulation of the expression of Go alpha during neuronal differentiation. J Gen Microbiol, 1990 Apr, 136 ( Pt 4), 717 - 25 Transposon-induced non-motile mutants of Vibrio cholerae; Richardson K et al.; Non-motile mutants of Vibrio cholerae were isolated after transposon insertion mutagenesis with either Tn5 on a plasmid or Tn10ptac mini-kan in bacteriophage lambda . The physical location and number of transposon insertions was determined . Eighteen Tn5 insertion mutants and 11 Tn10ptac mini-kan insertion mutants had single unique insertion sites . The 18 Tn5 insertions were contained within six different EcoRI fragments and the 11 Tn10ptac mini-kan insertions were contained within eight different fragments of V . cholerae chromosomal DNA . These data suggest that multiple genes are involved in motility . Immunoblot analysis of non-motile mutants with antibody to wild-type flagellar core protein indicated that two of the non-motile mutants made flagellar core protein . Three additional mutants reacted weakly with the antibodies . However, these mutants with immunopositive reactions did not produce any structures which resembled flagella by transmission electron microscopy . In addition, none of the other non-motile mutants produced wild-type flagella . However, five mutants which did not react in the immunoblot produced a structure which resembled a flagellar sheath without the internal flagellar core . In addition to having no filamentous core, the sheaths often extended from the sides of the bacteria, rather than from the poles where the flagellum is normally located . The data suggest that sheath formation is independent of flagellar filament formation, but that proper positioning of the sheath may require the flagellar filament. Appl Environ Microbiol, 1990 Apr, 56(4), 1140 - 7 Surface and virulence properties of environmental Vibrio cholerae non-O1 from Albufera Lake (Valencia, Spain); Amaro C et al.; A total of 140 environmental Vibrio cholerae non-O1 isolates, together with several culture collection strains from both environmental and clinical sources, were studied in relation to hemagglutination, surface hydrophobicity, and the enzymatic, hemolytic, cytotoxic, and enterotoxic activities of their extracellular products . A total of 78 and 62% of the strains produced hemagglutinins and exohemagglutinins, respectively . Four different hemagglutinating and two exohemagglutinating activities were found by using eight sugars in the inhibition assays . Cell-bound mannose-sensitive hemagglutination was detected mainly in chicken blood, whereas fucose-sensitive hemagglutination was recorded only in human blood . Cell-bound hemagglutinin resistant to all sugars tested was the only one related to surface hydrophobicity . The surface properties varied along the growth curves . The non-O1 strains displayed strong enzymatic and hemolytic activities, except for esculin hydrolysis . Of 26 non-O1 isolates selected for cytotoxin and enterotoxin production, 23 showed a wide spectrum of cytotoxic effects on cell lines of poikilothermic and homoiothermic species, but they were weakly enterotoxigenic in the infant mouse test . All extracellular products of cytotoxic strains were proteolytic, lipolytic, and hemolytic, and a high percentage produced hemagglutination of chicken blood . The cytotoxic factors in the non-O1 strains analyzed were not R plasmid mediated. J Biol Chem, 1990 Mar 15, 265(8), 4200 - 3 Elicitation of an oxidase activity in bacterial luciferase by site-directed mutation of a noncatalytic residue; Xi L et al.; Flavin-dependent external monooxygenases and oxidases could catalyze the same flavin oxidation reaction involving distinct mechanisms . To gain insights into enzyme structure-function relationship, site-directed mutagenesis was carried out for Vibrio harveyi luciferase, a monooxygenase . The substitution of the alpha subunit cysteine 106 by alanine shows unambiguously that the alphaCys106 is not essential to catalysis . The corresponding substitution by valine resulted in a substantial reduction of the bioluminescence activity correlatable with the induction of a new flavin oxidation activity typical for oxidases . These findings indicate that mutation of a single noncatalytic residue at the active center of a flavoenzyme could transform one enzyme type to another, thus highlighting the subtlety of enzyme active site structure in relation to catalysis and the versatility of enzyme evolution. J Bacteriol, 1990 Mar, 172(3), 1656 - 9 Cloning and expression of a structural gene from Chlorobium vibrioforme that complements the hemA mutation in Escherichia coli; Avissar YJ et al.; Escherichia coli SASX41B carries the hemA mutation and requires delta-aminolevulinic acid for growth . Strain SASX41B was transformed to prototrophy with pYA1, a plasmid vector carrying a 5.8-kilobase insert of genomic DNA from the green sulfur bacterium Chlorobium vibrioforme . Cell extracts prepared from transformed cells are able to catalyze transfer of label from {1-14C}glutamate or {3,4-3H}glutamyl-tRNA to delta-aminolevullinic acid at rates much higher than extracts of wild-type cells can, whereas extracts prepared from untransformed strain SASX41B cells lack both activities . By comparing the relative abilities of glutamyl-tRNAs derived from several heterologous cell types to function as substrates for the dehydrogenase reaction in extracts of HB101 and SASX41B cells transformed by pYA1, it was determined that the expressed dehydrogenase in the transformed cells resembled that of C . vibrioforme and not that of E . coli . Thus it can be concluded that plasmid pYA1 contains inserted DNA that codes for a structural component of C . vibrioforme glutamyl-tRNA dehydrogenase which confers glutamyl-tRNA substrate specificity. Nippon Saikingaku Zasshi, 1990 Mar, 45(2), 561 - 6 {Antibacterial and anti-hemolysin activities of tea catechins and their structural relatives}; Toda M et al.; Among catechins tested, (-)epigallocatechin (EGC), (-)epicatechin gallate (ECg), (-) epigallocatechin gallate (EGCg) inhibited the growth of Staphylococcus aureus, Vibrio cholerae O1 classical Inaba 569B and El Tor Inaba V86 . S . aureus was more sensitive than V . cholerae O1 to these compounds . EGCg showed also a bactericidal activity against V . cholerae O1 569B . Pyrogallol showed a stronger antibacterial activity against S . aureus and V . cholerae O1 than tannic and gallic acid . Rutin or caffein had no effect on them . ECg and EGCg showed the most potent anti-hemolysin activity against S . aureus alpha-toxin, Vibrio parahaemolyticus thermostable direct hemolysin (Vp-TDH) and cholera hemolysin . Among catechin relatives, only tannic acid had a potent anti-hemolysin activity against alpha-toxin . These results suggest that the catechol and pyrogallol groups are responsible for the antibacterial and bactericidal activities, while the conformation of catechins might play an important role in the anti-hemolysin activity. J Med Assoc Thai, 1990 Mar, 73(3), 136 - 9 Vibrio bacteremia in Siriraj Hospital; Thamlikitkul V; From January 1983 to March 1988, 26 isolates of Vibrio spp . were recovered from the blood of patients admitted to Siriraj Hospital . Thirteen strains were identified as non 0-1 Vibrio cholerae, 3 were Vibrio vulnificus and 10 were Vibrio spp . The medical records of 20 patients were available for clinical analysis . Most of them were adult men with cirrhosis . Clinical features included fever, abdominal pain, diarrhea, peritonitis, shock and skin lesions . Some patients had a history of seafood consumption or seawater exposure . The isolates were sensitive to commonly used antibiotics . All patients except one received at least one antibiotic that was sensitive in vitro . However, the case fatality rate was still high, 50 per cent . Clinicians should be aware of the clinical syndrome caused by Vibrio spp . in order to manage those patients promptly and appropriately. Indian J Med Res, 1990 Mar, 91, 120 - 3 Physical demonstration of a high molecular weight bacteriocin plasmid in Vibrio cholerae by genetic transformation process; Basu S et al.; Bacteriocinogeny was transferred at high frequencies from bacteriocinogenic (Bac+) V . cholerae strains to non-bacteriocinogenic (Bac-) recipients in the in situ genetic transformation system on agar surface . DNA extracted from samples of growth of bacteria transformed to Bac+ were obtained at 2 h intervals following contact with the sterile agar surface where the donor had grown previously . This showed acquisition of a high molecular weight plasmid which could be physically demonstrated best in the 6 h sample of the Bac+ transformants; their 4 h samples failed to show this specific plasmid, while it was demonstrable only as a faint band in the 8 h samples. Anal Biochem, 1990 Mar, 185(2), 220 - 9 Recovery of components of fluorescence spectra of mixtures by intensity- and anisotropy decay-associated analysis: the bacterial luciferase intermediates; Lee J et al.; Reaction of FMNH2 and O2 with bacterial luciferase followed by blue light irradiation results in a product previously claimed to have the same fluorescence spectral distribution as the bioluminescence . Preparations of this "high fluorescence" intermediate, however, contain two fluorescent components, one from the intermediate and the other its breakdown product, FMN . Since the intermediate has a fluorescence lifetime of around 10 ns and a rotational correlation time in the range of 100 ns, compared to 5.0 and 0.15 ns, respectively, for the FMN, the two components can be successfully resolved from the total fluorescence by an anisotropy decay- and fluorescence decay-associated analysis employing simultaneous global computational methods . The fluorescence spectra of the intermediates from two types of luciferase were analyzed in this way; one luciferase was from Vibrio harveyi and the other was from an unusual type of V . fischeri that had an in vivo bioluminescence maximum at 505 nm, a wavelength almost 20 nm longer than that of the V . harveyi bioluminescence . For V . harveyi the true fluorescence of the intermediate is distinct from the bioluminescence, being found at a wavelength about 10 nm longer . For the type of V . fischeri examined, any difference in the two spectra is less certain . A control experiment with the dye 8-amino-1- naphthalenesulfonate bound to BSA and mixed with FMN recovered the original spectrum of the bound dye accurately. FEMS Microbiol Lett, 1990 Mar 1, 56(1-2), 167 - 70 Production of monoclonal antibody against a hemolysin (Vp-TRH) produced by Vibrio parahaemolyticus; Honda T et al.; The antigenicity of a hemolysin (Vp-TRH: Vp-TDH related hemolysin) produced by Kanagawa phenomenon-negative clinical isolates of Vibrio parahaemolyticus was studied using monoclonal antibodies (MAbs) . A total of 12 hybridoma clones which produced MAbs against Vp-TRH were established . All MAbs contained the Kappa light chain and were IgG type . These MAbs were divided into a minimum of 5 different specificity groups, including antibodies specific to Vp-TRH and common to both Vp-TRH and Vp-TDH, a possible pathogenic toxin of Kanagawa phenomenon-positive V . parahaemolyticus . These results clearly show the immunological similarity and dissimilarity (specificity) of Vp-TRH and Vp-TDH. FEMS Microbiol Lett, 1990 Mar 1, 56(1-2), 155 - 8 Analysis of the 2-keto-3-deoxyoctonate (KDO) region of lipopolysaccharides isolated from non-01 Vibrio cholerae 05R; Kondo S et al.; Phosphorylated 2-keto-3-deoxyoctonate (KDO) has been detected in the strong-acid hydrolysates of lipopolysaccharides (LPS) of family Vibrionaceae including Vibrio cholerae . Structural analysis of LPS isolated from a rough mutant of non-01 V . cholerae 05 by dephosphorylation, periodate oxidation and methylation analysis revealed that the inner core region of the LPS molecule contains only one mole of KDO in contrast to enteric Gram-negative bacterial LPS, and that the phosphate group on the KDO molecule resides in the C4 position, while the site of binding of KDO to heptose, a constituent of the distal part of the inner core region, is the C5 position as in the enteric bacterial LPS. FEMS Microbiol Lett, 1990 Mar 1, 56(1-2), 149 - 54 Effects of DNase production, plasmid size, and restriction barriers on transformation of Vibrio cholerae by electroporation and osmotic shock; Marcus H et al.; Attempts to transform wild type strains of V . cholerae with plasmid DNA by traditional osmotic shock methods were not successful . A mutant of V . cholerae that was deficient in extracellular DNase was transformed with plasmid DNA by osmotic shock, demonstrating directly that extracellular DNase is a major barrier to transformation of V . cholerae . Transformation of wild type and DNase-negative strains of V . cholerae was accomplished by electroporation . Efficiency of transformation by electroporation increased with field strength, decreased with plasmid size, and was relatively insensitive to changes in the electrolyte composition of the buffer as long as isotonic sucrose was present . Host-controlled modification/restriction systems also affected transformation efficiency in V . cholerae. J Clin Microbiol, 1990 Mar, 28(3), 603 - 4 Vibrio cholerae bacteremia associated with gastrectomy; Toeg A et al.; Bacteremia due to Vibrio cholerae is rare . Each of 15 cases previously reported in the English language literature occurred in the setting of immune deficiency . We describe an instance of non-serogroup O1 V . cholerae septicemia in an otherwise healthy patient . Susceptibility to such infection may have been enhanced by a prior gastrectomy for duodenal ulcer. South Med J, 1990 Mar, 83(3), 356 - 7 Primary Vibrio vulnificus sepsis in Kentucky; Ali MB et al.; Vibrio vulnificus is associated with infection acquired during contact with sea water or with seafood, and is seldom suspected by physicians in noncoastal states . The ease of transportation of fresh raw seafood has facilitated this organism's capacity to produce disease in geographic areas in which it was previously unseen . We have reported a case of fatal Vibrio vulnificus sepsis acquired from ingestion of fresh oysters in the inland United States. J Clin Invest, 1990 Mar, 85(3), 697 - 705 Experimental non-O group 1 Vibrio cholerae gastroenteritis in humans; Morris JG Jr et al.; In this study, 27 volunteers received one of three non-O group 1 Vibrio cholerae strains in doses as high as 10(9) CFU . Only one strain (strain C) caused diarrhea: this strain was able to colonize the gastrointestinal tract, and produced a heat-stable enterotoxin (NAG-ST) . Diarrhea was not seen with a strain (strain A) that colonized the intestine but did not produce NAG-ST, nor with a strain (strain B) that produced NAG-ST but did not colonize . Persons receiving strain C had diarrhea and abdominal cramps . Diarrheal stool volumes ranged from 154 to 5,397 ml; stool samples from the patient having 5,397 ml of diarrhea were tested and found to contain NAG-ST . The median incubation period for illness was 10 h . There was a suggestion that occurrence of diarrhea was dependent on inoculum size . Immune responses to homologous outer membrane proteins, lipopolysaccharide, and whole-cell lysates were demonstrable with all three strains . Our data demonstrate that V . cholerae of O groups other than 1 are able to cause severe diarrheal disease . However, not all strains are pathogenic for humans: virulence of strain C may be dependent on its ability both to colonize the intestine and to produce a toxin such as NAG-ST. J Bacteriol, 1990 Mar, 172(3), 1352 - 60 Specific inhibition of antenna bacteriochlorophyll synthesis in Chlorobium vibrioforme by anesthetic gases; Ormerod JG et al.; The green sulfur bacterium Chlorobium vibrioforme contains two types of bacteriochlorophyll (Bchl) . The minor pigment, Bchl a, is associated primarily with the cell membrane and its reaction centers; and the major light-harvesting antenna pigment, Bchl d, is found primarily in the chlorosomes, which are attached to the inner surface of the cell membrane . Anesthetic gases, such as N2O, ethylene, and acetylene, were found to inhibit the synthesis of Bchl d, but not of Bchl a, thus allowing the cells to grow at high light intensities with a greatly diminished content of antenna pigment . Chlorosomes were absent or sparse in inhibited cells . Porphyrins accumulated in the inhibited cells . The major one was identified as the Bchl precursor magnesium-protoporphyrin IX monomethyl ester (Mg-PPME) by comparative absorption and fluorescence spectroscopy and thin-layer chromatography of the porphyrin and its derivatives with those of authentic protoporphyrin IX . Small amounts of Mg-PPME were present in control cells, but the addition of inhibitor caused a rapid increase in the Mg-PPME concentration, accompanying the inhibition of Bchl d synthesis . Cells grown in the presence of ethephon (as a source of ethylene) and allowed to stand in dim light for long periods accumulated large amounts of PPME and other porphyrins and excreted or released porphyrins, which accumulated as a brown precipitate in the culture . Inhibition of Bchl d synthesis was relieved upon removal of the inhibitor . These results suggest that the gases act at a step in pigment biosynthesis that affects the utilization of Mg-PPME for isocyclic ring formation . Synthesis of Bchl d and Bchl a may be differentially affected by the gases because of compartmentation of their biosynthetic apparatus or because competition for precursors favors Bchl a synthesis . An ethephon-resistant mutant strain was isolated by selection for growth in dim, long-wavelength light . The mutant cells were also resistant to acetylene, but not to N2O . The ability to reversibly generate viable Chlorobium cells that lack antenna pigments may be useful in photosynthesis research . The ethephon- and acetylene-resistant strain may be useful in the study of the enzymes and genes that are involved in the biosynthetic step that the gases affect. J Commun Dis, 1990 Mar, 22(1), 35 - 8 Cholera outbreak in Delhi--1988; Khanna KK et al.; Delhi experienced an outbreak of cholera during July-August 1988 which affected residents from all walks of life . A total of 1824 laboratory confirmed cholera cases were detected in two months period at I.D . Hospital, Delhi alone . The number of cholera cases in July-August 1988 was 5-10 times that of the same period during the previous years in the Capital . The outbreak was caused by Vibrio cholerae Ogawa biotype ElTor . Majority of the laboratory confirmed cases (about 74 per cent) were seen in children under the age of 15 years . Though the cases were spread all over Delhi, almost three-fourths of total cases were reported from two specific zones (Shahdara and Civil Lines) . Most of the isolates were sensitive to all antibiotics tested . The proportion of isolates resistant to furazolidone during this outbreak was substantially higher than in previous years suggesting that the outbreak may have been caused by the introduction of a new strain rather than proliferation of endemic strain . The salient features of the outbreak are discussed. J Diarrhoeal Dis Res, 1990 Mar-Jun, 8(1-2), 24 - 6 Clinical and epidemiological features of sporadic infections with Vibrio fluvialis in Florida, USA; Klontz KC et al.; The clinical and epidemiological features of sporadic illness were investigated in 12 persons from whom Vibrio fluvialis was recovered and who were reported to the Florida Department of Health and Rehabilitative Services between 1982 and 1988 . All 12 patients lived in Florida and denied any recent travel out of the state prior to the onset of their illness . V . fluvialis was recovered from the stools of 10 patients who presented clinically with gastroenteritis, from a wound in one patient, and from a caecostomy drainage specimen in one patient . Eight of the 10 patients with gastroenteritis reported eating seafood during the week before becoming ill: raw oysters (five patients), shrimp (two patients), and cooked fish (one patient) . This represents the largest clinical series of V . fluvialis cases described in the United States. Zh Mikrobiol Epidemiol Immunobiol, 1990 Mar, (3), 6 - 10 {The capacity to produce cholera exotoxin in natural strains of Vibrio cholerae}; Smirnova NI et al.; The study of 27 V . cholerae strains, isolated from cholera patients and found to be hemolytically inactive, with a view to establish their capacity for the production of cholera toxin has revealed that 4 strains (V . cholerae cholerae Dacca 35, V . cholerae cholerae Dacca 3, V . cholerae cholerae B1307, V . cholerae cholerae J89) produce this protein . The quantitative determination of enterotoxin has been made with the use of GM1 ELISA technique . Strain Dacca 35 has been found to be highly toxigenic and, as regards the amount of exotoxin it produces, no different from V . cholerae cholerae strain 569B, a well-known producer of cholera toxin . In strain Dacca 35 correlation between the capacity of the cells for toxin production and the morphology of colonies has been established . The study has revealed that the chromosome of strain Dacca 35 contains two copies of gene vctAB responsible for the synthesis of cholera toxin. Mol Microbiol, 1990 Mar, 4(3), 413 - 25 Characterization of the hlyB gene and its role in the production of the El Tor haemolysin of Vibrio cholerae O1; Alm RA et al.; El Tor strains of Vibrio cholerae are capable of producing a haemolysin which they actively secrete into the growth medium . This requires translation to produce the protein at the surface of the cytoplasmic membrane and translocation across this membrane, the periplasmic space and the outer membrane . The mechanism by which this occurs is poorly understood . In addition to the structural gene for the haemolysin (hlyA), we have cloned a second adjacent gene, hlyB . By site-directed mutagenesis, specific hlyB mutants have been constructed . These mutants are defective in the secretion of HlyA in the early to mid-exponential phase of growth and the haemolysin becomes trapped within the cell and is only released in stationary phase . Nucleotide sequence analysis and cell fractionations reveal HlyB to be a 60.3 kD putative outer membrane-associated protein. J Bacteriol, 1990 Mar, 172(3), 1634 - 9 Specific inhibition of the Na(+)-driven flagellar motors of alkalophilic Bacillus strains by the amiloride analog phenamil; Atsumi T et al.; Amiloride, a specific inhibitor for the Na(+)-driven flagellar motors of alkalophilic Bacillus strains, was found to cause growth inhibition; therefore, the use of amiloride for the isolation of motility mutants was difficult . On the other hand, phenamil, an amiloride analog, inhibited motor rotation without affecting cell growth . A concentration of 50 microM phenamil completely inhibited the motility of strain RA-1 but showed no effect on the membrane potential, the intracellular pH, or Na(+)-coupled amino acid transport, which was consistent with the fact that there was no effect on cell growth . Kinetic analysis of the inhibition of motility by phenamil indicated that the inhibition was noncompetitive with Na+ in the medium . A motility mutant was isolated as a swarmer on a swarm agar plate containing 50 microM phenamil . The motility of the mutant showed an increased resistance to phenamil but normal sensitivity to amiloride . These results suggest that phenamil and amiloride interact at different sites on the motor . By examining various bacterial species, phenamil was found to be a specific and potent inhibitor for the Na(+)-driven flaggellar motors not only in various strains of alkalophilic Bacillus spp . but also in a marine Vibrio sp. Antibiot Khimioter, 1990 Mar, 35(3), 23 - 4 {Antibiotic sensitivity of Vibrio parahaemolyticus isolated in the Turkmene SSR}; Razvykh VM et al.; Sensitivity of 82 cultures of parahemolytic vibrios to 8 antibiotics was studied . It was shown that the majority of the strains were highly sensitive to levomycetin and gentamicin, sensitive to tetracycline, rifampicin, streptomycin, neomycin and kanamycin and resistant to ampicillin. Appl Microbiol Biotechnol, 1990 Mar, 32(6), 715 - 20 Degradation of thiophene-2-carboxylate, furan-2-carboxylate, pyrrole-2-carboxylate and other thiophene derivatives by the bacterium Vibrio YC1; Evans JS et al.; A bacterium of the genus Vibrio, capable of degrading thiophene derivatives, was isolated from enrichment cultures inoculated with oil-contaminated estuarine mud . Of the thiophene derivatives tested, only thiophene-2-carboxylate (T2C), thiophene-2-acetate and thiophene-2-carbonyl chloride supported growth, but a total of seven were significantly oxidised by resting cells . Furan-2-carboxylate (F2C) and pyrrole-2-carboxylate (P2C) also supported growth and were oxidised . The heteroatoms of T2C and P2C were released into the media as sulphate and ammonia and served as sole sources of sulphur and nitrogen for growth . Mutants defective in T2C utilisation (Thc-) were isolated, many being also defective in F2C and P2C utilisation. J Biol Chem, 1990 Feb 25, 265(6), 3513 - 7 Delineation of the transcriptional boundaries of the lux operon of Vibrio harveyi demonstrates the presence of two new lux genes; Swartzman E et al.; The 5' and 3' ends of the lux mRNA of Vibrio harveyi, which extends over 8 kilobases, have been mapped, and two new genes, luxG and luxH, were identified at the 3' end of the lux operon . Both S1 nuclease and primer extension mapping demonstrated that the start site for the lux mRNA was 26 bases before the initiation codon of the first gene, luxC . The promoter region contained a typical -10 but not a recognizable -35 consensus sequence . By using S1 nuclease mapping the mRNA was found to be induced in a cell density- and arginine-dependent manner . The DNA downstream of the five known V . harveyi lux genes, luxCDABE, was sequenced and found to contain coding regions for two new genes, designated luxG and luxH, followed by a classical rho-independent termination signal for RNA polymerase . luxG codes for a protein of 233 amino acids with a molecular weight of 26,108, and luxH codes for a protein of 230 amino acids with a molecular weight of 25,326 . The termination signal is active in vivo as demonstrated by 3' S1 nuclease mapping, confirming that the two genes are part of the V . harveyi lux operon . Comparison of the luxG amino acid sequence with coding regions immediately downstream from luxE in other luminescent bacteria has demonstrated that this gene may be a common component of the luminescent systems in different marine bacteria. Genetika, 1990 Feb, 26(2), 206 - 14 {Inheritance and expression of cholera toxin genes introduced into Vibrio cholerae el tor cells in a hybrid plasmid}; Smirnova NI et al.; Two replicons, pOX38 (in F-factor derivative lacking all IS elements) and pCT105 (containing cholera toxin operon cloned in pBR322) have been fused to produce recombinant plasmid, pCO109, which was then introduced into Vibrio cholerae eltor by conjugation . Restriction analysis showed pCO109 to dissociate in V . cholerae cells at a higher frequency than in Escherichia coli strains, its pOX38 component being lost, while the pCT105 component demonstrated relative stability . V . cholerae eltor RV79 (pCT105) produced 4-5 micrograms/ml of cholera toxin . Occasional insertion of cloned vctA, B operon into RV79 chromosome was also observed. FEMS Microbiol Lett, 1990 Feb, 55(3), 339 - 45 Cloning and characterization of a gene encoding a new thermostable hemolysin from Vibrio parahaemolyticus; Taniguchi H et al.; A new thermostable hemolysin (delta-VPH) gene was cloned from a Kanagawa-negative Vibrio parahaemolyticus strain into vector pBR322 in Escherichia coli K12 . The nucleotide and amino acid sequences had no homology with those of the thermostable direct hemolysin (TDH) which causes the Kanagawa phenomenon, and of the thermolabile hemolysin (TLH) of V . parahaemolyticus . The gene was present in all V . parahaemolyticus strains tested and also in one strain of V . damsela. FEMS Micr