Vibriosis

J La State Med Soc, 1991 Dec, 143(12), 27 - 8
Vibrio vulnificus peritonitis . A unique case; Holcombe DJ; Louisiana is justifiably famous for the seafood harvested from its coastal waters . Unfortunately, undesirables accompany this harvest . The author presents a case of peritonitis due to vibrio vulnificus which followed ingestion of raw oysters.

Gene, 1991 Dec 1, 108(1), 31 - 7
Genetic analysis of the export of an extracellular DNase of Vibrio cholerae using DNase-beta-lactamase fusions; Focareta T et al.; A series of C-terminal deletions of the dns-encoded extracellular deoxyribonuclease (DNS) of Vibrio cholerae, fused to the mature form TEM beta-lactamase (Bla) has been used to analyse the export of the DNase in both V . cholerae and Escherichia coli . All hybrid proteins were localized to the periplasmic space in E . coli and V . cholerae, with specific cleavage of the DNS-Bla fusion occurring in V . cholerae . Periplasmic accumulation of wt DNS was also seen in V . cholerae when present on a multicopy plasmid . DNS fusions retaining all six Cys residues of DNS displayed both DNase and Bla enzymatic activity . While hybrid proteins were unable to be secreted across the outer membrane in V . cholerae, the cleaved (active) DNS portion of these proteins was exported . Taken together, these data suggest that the periplasmic form seen in E . coli is a normal intermediate also seen in V . cholerae, and that the lack of secretion machinery in E . coli prevents further export across the outer membrane . Although the DNS portion of the protein fusions must be able to interact with secretion genes, the whole fusion proteins are not exported.

Microb Pathog, 1991 Dec, 11(6), 433 - 41
Identification of a mannose-binding pilus on Vibrio cholerae El Tor; Jonson G et al.; The mannose-sensitive hemagglutinin (MSHA) that is associated with Vibrio cholerae strains of El Tor biotype is identified as a pilus composed of subunits with a molecular mass of approximately 17 kDa . In immunoelectron microscopy, a monoclonal antibody against MSHA that inhibited El Tor vibrio-mediated mannose-sensitive agglutination of chicken erythrocytes or El Tor bacterial binding to mannose-coated agarose beads, bound specifically to repetitive subunits along typical fimbriae extending from the surface of El Tor vibrios . No such pili were seen on the surface of MSHA negative classical vibrios, although non-surface exposed fimbrial subunits could be demonstrated in these bacteria by immunoblotting techniques.

Mol Gen Genet, 1991 Dec, 230(3), 385 - 93
The beta subunit polypeptide of Vibrio harveyi luciferase determines light emission at 42 degrees C; Escher A et al.; The nucleotide sequence of the luxA and luxB genes encoding the alpha beta heterodimeric luciferase from thermotolerant Vibrio harveyi CTP5 was determined . The DNA sequence of the CTP5 luxA and luxB genes is identical to the DNA sequence of the luxA and luxB genes from mesophilic V . harveyi MAV (B 392), with minor exceptions . The sequence differences result in 5 amino acid substitutions in the alpha subunit polypeptide and 7 amino acid substitutions in the beta subunit polypeptide . Escherichia coli cells grown on solid medium and expressing CTP5 or MAV luxAB genes emit similar amounts of light at 37 degrees C, while at 42 degrees C cells containing CTP5 luxAB genes show more than tenfold increased bioluminescence compared to cells with MAV luxAB genes . When grown in liquid medium E . coli cells with CTP5 or MAV luxAB genes emit equivalent amounts of light at 37 degrees C; however, in liquid medium at 42 degrees C cells containing CTP5 luxAB genes show only three times higher bioluminescence than cells with MAV luxAB genes . Expression of T7 promoter-linked hybrid luxAB transcriptional units luxACTP5-luxBMAV and luxAMAV-luxBCTP5 in E . coli reveals that (i) the MAV luxB gene product is responsible for the decreased activity of MAV luciferase at 42 degrees C; (ii) the CTP5 luxB gene encodes the information required for most of the increased activity of CTP5 luciferase relative to MAV luciferase at 42 degrees C; and (iii) E . coli cells containing MAV luxB gene show an increase in bioluminescence when grown in liquid medium at 42 degrees C, which coincides with elevated GroEL chaperonin levels.(ABSTRACT TRUNCATED AT 250 WORDS)

Biochemistry, 1991 Nov 26, 30(47), 11255 - 62
Functional consequences of site-directed mutation of conserved histidyl residues of the bacterial luciferase alpha subunit; Xin X et al.; The available sequences for the different bacterial luciferases reveal five conserved histidyl residues at positions 44, 45, 82, 224, and 285 of the alpha subunit . Ten variants of Vibrio harveyi luciferase were obtained by selective site-directed mutations of these five histidines . The essentiality of alpha His44 and alpha His45 was indicated by 4-7 orders of magnitude of bioluminescence activity reductions resulting from the substitution of either histidine by alanine (alpha H44A or alpha H45A), aspartate (alpha H44D or alpha H45D), or lysine (alpha H45K) . Moreover, alpha H44A and alpha H45A were distinct from the native luciferase in thermal stabilities . Mutations at the other three positions also resulted in activity reductions ranging from a fewfold to 3 orders of magnitude . Despite these widely different bioluminescence light outputs, mutated luciferases exhibited, in nonturnover in vitro assays, light emission decay rates mostly similar to that of the native luciferase using octanal, decanal, or dodecanal as a substrate . This is attributed to a similarity in the catalytic rate constants of the light-emitting pathway for the native and mutated luciferases, but various mutated luciferases suffer in different degrees from competing dark reaction(s) . In accord with this interpretation, the bioluminescence activities of mutated luciferases showed a general parallel with the relative stabilities of their 4a-hydroperoxyflavin intermediate species . Furthermore, the drastically reduced bioluminescence activities for luciferases with the alpha His44 or alpha His45 substituted by aspartate, alanine, or lysine were accompanied by little or no activities for consuming the aldehyde substrate.(ABSTRACT TRUNCATED AT 250 WORDS)

Zh Mikrobiol Epidemiol Immunobiol, 1991 Nov, (11), 11 - 3
{The lipids of phosphorescent Vibrio albensis bacteria}; Lebedev KK et al.; The lipid composition of fluorescent vibrios, V . eltor and nonagglutinating vibrios has been studied . In the fraction of polar lipids phosphatidylethanolamine, phosphatidylinositol and cardiolipin and in the fraction of neutral lipids monoglycerides, free fatty acids, diglycerides, triglycerides, sterol esters have been identified . The fatty acid composition of some classes of neutral lipids have been determined . Both similarity and differences between the strains under study in their lipid and fatty acid composition have been established.

Chem Pharm Bull (Tokyo), 1991 Nov, 39(11), 3067 - 70
Purification and some properties of inducible lysine decarboxylase from Vibrio parahaemolyticus; Yamamoto S et al.; Inducible lysine decarboxylase from Vibrio parahaemolyticus AQ 3627 was purified to apparent homogeneity and characterized . The enzyme displayed a molecular weight of 531000 by gel filtration and 79000 by sodium dodecyl sulfate-polyacrylamide gel electrophoresis . The enzyme required pyridoxal phosphate as a cofactor, and the pH optimum was 5.5 . The Km value for L-lysine was 3.2 mM, and the enzyme was inhibited by 6-aminocaproic acid and alpha-fluoromethyl analogs of cadaverine . delta-Hydroxylysine and S-aminoethyl-L-cysteine was active as substrates to a lesser extent than L-lysine . The amino-terminal amino acid sequence was determined to be Met-Asn-Ile-Phe-Ala-Ile-Leu . These properties were compared with those of other bacterial lysine decarboxylases.

Can J Microbiol, 1991 Nov, 37(11), 840 - 7
Changes in rates of synthesis of individual proteins in a psychrophilic bacterium after a shift in temperature; Araki T; In the psychrophilic bacterium Vibrio sp . strain ANT-300, which has the ability to grow efficiently between 13 and -2 degrees C, with an optimum at 7 degrees C, cells in steady-state growth at 0 and 13 degrees C appeared to exhibit different patterns in the levels of certain individual proteins . With a shift in temperature, the steady-state level of individual proteins was achieved only after dramatic transient changes in the rates of synthesis of a small number of those proteins whose levels would be adjusted . Upon a shift up from 0 to 13 degrees C, the rates of synthesis of at least 25 proteins increased transiently, while increased rates of synthesis of 39 proteins were induced immediately upon a shift down from 13 to 0 degrees C . The proteins of which the levels would be adjusted were synthesized at differential rates, which varied conspicuously with respect to timing after the shifts in temperature . Such changes appear to be active regulatory responses to changes in temperature.

J Clin Microbiol, 1991 Nov, 29(11), 2517 - 21
Polymerase chain reaction for detection of the cholera enterotoxin operon of Vibrio cholerae; Shirai H et al.; We report a set of oligonucleotide primers and amplification conditions for the polymerase chain reaction to detect the ctx operon of Vibrio cholerae . The results of this assay on strains of V . cholerae and related organisms were identical with those obtained by the DNA colony hybridization test with the polynucleotide probe . The detection limit of this system was 1 pg of chromosomal DNA or broth culture containing three viable cells . The polymerase chain reaction method could directly detect the ctx operon sequences in rice-water stool samples from patients with cholera.

FEMS Microbiol Lett, 1991 Nov 1, 68(1), 113 - 7
Adherence of Vibrio parahaemolyticus to rabbit intestinal epithelial cells in vitro; Chakrabarti MK et al.; Kanagawa positive strains of Vibrio parahaemolyticus showed adherence whereas most of the Kanagawa negative strains were non-adhering to rabbit intestinal epithelial cells . Anti-hemolysin antisera did not inhibit the adherence of V . parahaemolyticus strains . Moreover, the adhesive capacity of non-adhering strains was not enhanced by purified hemolysin . Cell surface hydrophobicity remained the same in both Kanagawa positive and negative strains of V . parahaemolyticus . Fetuin strongly inhibited the adherence to rabbit intestinal epithelial cells followed by -mannose and D-glucose.

Mol Gen Genet, 1991 Nov, 230(1-2), 251 - 6
Highly bioluminescent Bacillus subtilis obtained through high-level expression of a luxAB fusion gene; Jacobs M et al.; Bioluminescence levels comparable to those achievable in Escherichia coli have yet to be obtained from luxAB expression in gram-positive bacteria . In this communication we describe the gene engineering required to generate a highly bioluminescent derivative of Bacillus subtilis . The combination of a powerful promoter, Pxyn, a fusion derivative of luxAB from Vibrio harveyi and translational coupling have overcome the previously reported limitations in luxAB expression . The implications for highly bioluminescent gram-positive organisms are discussed.

Mikrobiol Zh, 1991 Nov-Dec, 53(6), 94 - 8
{The use of a CHO cell culture in studying Vibrio cholerae grown under different conditions}; Sal'nikova OI et al.; Studies of biological activity of cholera vibrios in cultures of chinese hamster ovary cells (CHO) have revealed their strong dependence on culture conditions . Elongation of CHO cells is caused only by choleragenic strains . Under stationary conditions of culture the vibrios were found to release haemolisin into the medium and had a cytotoxic effect . Most of cytotoxic supernatants exhibited a neuraminidase activity . Proteolytic activity was less dependent on the vibrio culture conditions . Strains with a high proteolytic activity caused rounding of the CHO cells.

Science, 1991 Nov 1, 254(5032), 710 - 3
An inducible bundle-forming pilus of enteropathogenic Escherichia coli; Giron JA et al.; Enteropathogenic Escherichia coli (EPEC), a cause of childhood diarrhea, grow on the surface of the small intestine and on cultured epithelial cells as colonies of adherent bacteria . When propagated on solid medium containing blood or attached to HEp-2 cells, EPEC express ropelike bundles of filaments, termed bundle-forming pili (BFP), that create a network of fibers that bind together the individual organisms . BFP were found to be expressed by five EPEC serogroups, each harboring a approximately 92-kilobase plasmid previously known to be important for virulence in humans . When two of these strains were cured of this plasmid, they neither expressed BFP nor grew as adherent colonies . An antiserum to BFP reduced the capacity of EPEC to infect cultured epithelial cells . BFP are composed of a repeating subunit of 19,500 daltons, the amino-terminal amino acid sequence of this subunit is homologous to that of the toxin-coregulated pilin of Vibrio cholerae.

Biochemistry, 1991 Oct 29, 30(43), 10551 - 7
Mapping the polarity profiles of general anesthetic target sites using n-alkane-(alpha, omega)-diols; Moss GW et al.; The effects of the homologous series of n-alkane-(alpha, omega)-diols have been studied on the inhibition of the purified firefly luciferase enzyme from Photinus pyralis, the inhibition of the purified bacterial luciferase enzyme from Vibrio harveyi, and the induction of general anesthesia in Xenopus laevis tadpoles . All but one of the diols tested were found to be reversible general anesthetics . The diols inhibited firefly luciferase by competing with its normal substrate firefly luciferin, and they inhibited bacterial luciferase by competing with the substrate n-decanal . For all but the smallest agent (1,4-butanediol), only a single diol molecule was found to be involved in the inhibition of the enzymes . Inhibition constants Ki were determined for the enzymes, and general anesthetic EC50 concentrations were determined for tadpoles . These data were then used in conjunction with previously determined n-alkane and n-alcohol data to calculate, as a function of chain length, the incremental standard Gibbs free energies delta (delta G0) for adding apolar -CH2- groups and for converting apolar terminal -CH3 groups to polar -CH2OH groups . The resulting plots of delta (delta G0) versus chain length gave a consistent mapping of the polarity profiles of the anesthetic-binding pockets . They clearly reveal the existence of two substantial and distinct polar regions in the anesthetic-binding pocket of firefly luciferase but only one such region for bacterial luciferase and for the unknown target sites underlying general anesthesia . The polarities and geometric properties of these different binding sites for straight-chain anesthetics are discussed in terms of simple models.

J Biol Chem, 1991 Oct 25, 266(30), 20094 - 102
Structural analysis and functional role of the carbohydrate component of somatostatin receptors; Rens-Domiano S et al.; SRIF receptors are membrane-bound glycoproteins . To structurally identify the carbohydrate components of SRIF receptors, solubilized rat brain SRIF receptors were subjected to lectin affinity chromatography . Solubilized SRIF receptors specifically bound to wheat germ agglutinin-lectin affinity columns but not to succinylated wheat germ agglutinin . This finding, as well as the ability of the solubilized receptor to interact with a Sambucus nigra L . lectin affinity column suggested that sialic acid residues are associated with SRIF receptors . The inability of the receptor to bind to concanavalin A, Dolichus biflorus agglutinin, Ulex europeaus I, and Jacalin lectin affinity columns suggests that high mannose, N-acetylgalactosamine, fucose, and O-linked carbohydrates are not associated with receptor . To investigate the functional role of the carbohydrate groups in brain SRIF receptors, specific sugars were selectively cleaved from SRIF receptors and the subsequent effect on the specific high affinity binding of the agonist {125I}MK 678 to SRIF receptors was determined . Treatment of the receptor with endoglycosidase D did not affect the specific binding of {125I} MK 678 to the solubilized SRIF receptors, consistent with the finding from lectin affinity chromatography that high mannose-type carbohydrate structures were not associated with SRIF receptors . Treatment of solubilized SRIF receptors with peptide-N-glycosidase F and endoglycosidases H and F reduced {125I}MK 678 binding to SRIF receptors indicating that either hybrid, or a combination of hybrid and complex N-linked carbohydrate structures, have a role in maintaining the receptor in a high affinity state for agonists . Treatment of solubilized SRIF receptors with neuraminidase from Vibrio cholera abolished high affinity agonist binding to the receptors, whereas treatment of the receptor with neuraminidase from Newcastle disease virus did not affect {125I}MK 678 binding to the receptor . These findings suggest that sialic acid residues in an alpha 2,6-configuration have a role in maintaining the SRIF receptor in a high affinity conformation for agonists . This is further indicated by studies on SRIF receptors in the pituitary tumor cell line, AtT-20 . Treatment of AtT-20 cells in culture with neuraminidase (V . cholera) greatly reduces high affinity {125I} MK 678 binding sites, but did not alter the maximal ability of SRIF to inhibit forskolin-stimulated cAMP accumulation in intact AtT-20 cells . This finding suggests that the desialylated SRIF receptor is functionally active and remains coupled to GTP-binding proteins, but exhibits a reduced affinity for agonists . Treatment of AtT-20 cell membranes with neuraminidase from V . cholera was also able to greatly reduce the affinity of SRIF receptors for {125I}MK 678.(ABSTRACT TRUNCATED AT 400 WORDS)

J Vet Med Sci, 1991 Oct, 53(5), 883 - 7
Plasma-dependent chemotactic activity of hemocytes derived from a juvenile estuarine gastropod mollusc, Clithon retropictus, to Vibrio parahaemolyticus and Escherichia coli strains; Kumazawa NH et al.; Hemocytes of adult Clithon retropictus were attracted chemotactically to live Vibrio parahaemolyticus and Escherichia coli strains . The chemotaxis was stimulated by the plasma of adult C . retropictus . Hemocytes of the juvenile specimen were attracted chemotactically to V . parahaemolyticus and E . coli strains in the presence of the plasma of the juvenile and only to E . coli strain in the absence of the plasma . These evidences suggest that hemocytes of juvenile C . retropictus might be defective to recognize V . parahaemolyticus strains and that the hemocytes would display full activities in the presence of the plasma factor(s).

Mol Microbiol, 1991 Oct, 5(10), 2547 - 55
Distinguishing between the extracellular DNases of Vibrio cholerae and development of a transformation system; Focareta T et al.; Vibrio cholerae is known to secrete DNase(s) into the extracellular environment . These proteins have been thought to be responsible for the difficulties in transforming this organism . In this work we demonstrate that the dns and xds genes differ and that their products are solely responsible for the extracellular DNase activity . By site-directed mutagenesis, strains have been constructed which are mutant in one or both genes . These strains have been assessed for their ability to be transformed with plasmid DNA and for their virulence in the infant mouse cholera model . DNase-deficient mutants can be readily transformed and the product of dns appears to be the more significant barrier . No effect on virulence was observed with the mutants.

West J Med, 1991 Oct, 155(4), 400 - 3
Vibrio vulnificus . Hazard on the half shell; Koenig KL et al.; Vibrio vulnificus is an extremely invasive gram-negative bacillus that causes bacteremia and shock . It should be suspected in any patient who is immunocompromised or has liver disease or hemochromatosis . Reduced gastric acidity may also increase the risk of infection if a patient presents with a history of ingesting raw shellfish (especially oysters) or trauma in brackish waters and skin lesions . Patients most commonly present with one of three clinical syndromes: primary septicemia, wound infection, or gastroenteritis . Treatment includes aggressive wound debridement, antibiotic therapy, and supportive care . Rapidly diagnosing and promptly initiating therapy are critical because V vulnificus infection is rapidly progressive and mortality approaches 100% if septic shock occurs.

Am J Vet Res, 1991 Oct, 52(10), 1658 - 64
Effect of endocytic and metabolic inhibitors on the internalization and intracellular growth of Brucella abortus in Vero cells; Detilleux PG et al.; Uptake, transfer to rough endoplasmic reticulum, and intracellular growth of Brucella abortus were studied in Vero cells treated with endocytic and metabolic inhibitors . Infection of Vero cells was suppressed when inhibitors of energy metabolism (iodoacetate, dinitrophenol), receptor-mediated endocytosis (monodansylcadaverine, amantadine, methylamine), or endosomal acidification (chloroquine, ammonium chloride, monensin) were added to the inoculum . Inhibition was not observed when these drugs were added after the inoculation period . Infection of Vero cells by B abortus was inhibited by dibutyryl-cyclic adenosine monophosphate and Vibrio cholerae enterotoxin, but was stimulated by dibutyryl-cyclic guanosine monophosphate and escherichia coli heat-stable enterotoxin a . Uptake of B abortus by Vero cells was not prevented by colchicine, but was abolished by cytochalasin B . Uptake of heat-killed B abortus and noninvasive E coli was similar to that of viable brucellae . Intracellular growth of B abortus was not affected by cycloheximide . Results indicate that: B abortus may be internalized by a receptor-mediated phagocytic process; transfer of B abortus from phagosomes to rough endoplasmic reticulum may require endosomal acidification; and replication of B abortus within the rough endoplasmic reticulum may not depend on protein synthesis by the host cell.

J Wildl Dis, 1991 Oct, 27(4), 706 - 9
Nasitrema sp.-associated encephalitis in a striped dolphin (Stenella coeruleoalba) stranded in the Gulf of Mexico; O'Shea TJ et al.; An immature female striped dolphin (Stenella coeruleoalba) found dead on a northwestern Florida beach in 1988 exhibited severe inflammation bilaterally in the dorsal and mid-thalamus in association with adult trematodes (Nasitrema sp.) and trematode eggs . Numerous specimens of Nasitrema sp . also were present in the pterygoid sinuses . Pneumonia in association with a heavy growth of Vibrio damsela was observed also . This report confirms the occurrence of Nasitrema sp.-associated encephalitis in striped dolphins and in small cetaceans from the Gulf of Mexico.

Zentralbl Bakteriol, 1991 Oct, 275(4), 467 - 73
A polyclonal-monoclonal antibody based sensitive sandwich enzyme linked immunosorbent assay for specific detection of cholera toxin; Bhadra RK et al.; A sensitive sandwich enzyme-linked immunosorbent assay (ELISA) for specific detection of prototype cholera toxin (CT) elaborated by Vibrio cholerae serovar O1 has been developed . The use of a high affinity monoclonal antibody (MAb) for capturing of CT epitopes permitted a high efficiency . Using this ELISA, we sought in vitro production of CT from clinical strains of V . cholerae O1, Non-O1 and from LT-producing E . coli . All culture supernatants of V . cholerae O1 were positive for CT whereas V . cholerae non-O1 and LT producing E . coli were found negative for CT . This ELISA will be particularly useful in specifically designed studies where detection of CT and not of related labile toxins is mandatory.

J Biochem (Tokyo), 1991 Oct, 110(4), 548 - 52
Alpha-macroglobulin-like plasma inactivator for Vibrio vulnificus metalloprotease; Miyoshi S et al.; The metalloprotease produced by Vibrio vulnificus (VVP) is known to be quickly inactivated by plasma proteins which belong to the class of alpha-macroglobulins in vitro at a molar ratio of 1:1 . But the in vivo potential of the inactivators has not been studied . Macroalbumin (MA), a member of alpha-macroglobulins in guinea pig plasma, was found to inactivate VVP by means of physical entrapment in vitro . In vivo actions of VVP, permeability-enhancing and hemorrhagic actions, were greatly augmented by simultaneous injection of the antibody against MA, which had no effect on in vitro proteolytic action toward azocasein . The interstitial-tissue space in the normal guinea pig skin contains a negligible amount of MA . However, sufficient MA was present in the extravascular fluid collected after the intradermal injection of VVP . Besides, in the extravascular fluid, VVP formed a complex with MA and no inactivator other than MA was found . These results indicate that plasma MA leaked from the vascular system owing to the permeability-enhancing and hemorrhagic actions of VVP, resulting in inactivation of VVP in situ.

Genes Dev, 1991 Oct, 5(10), 1834 - 46
Processing of TCP pilin by TcpJ typifies a common step intrinsic to a newly recognized pathway of extracellular protein secretion by gram-negative bacteria; Kaufman MR et al.; Biogenesis of the Vibrio cholerae toxin-coregulated pilus (TCP) requires the activities of at least seven accessory proteins . We demonstrate that a portion of this pathway involves a novel processing step in which a hydrophilic leader peptide is proteolytically removed from TcpA by the gene product characterized in this report, TcpJ, to yield the mature, export-competent form of the pilin . Cleavage of the pilin leader peptide is independent of known signal peptidases as demonstrated by pilin-processing profiles in Escherichia coli strains conditionally defective for production of leader peptidase or grown in the presence of the antibiotic globomycin . Additionally, pilin cleavage did not rely on the SecA protein, as evidenced by TcpA processing in azide-treated cells . These results suggest that TcpJ is representative of a new class of proteins involved in SecA-independent proteolytic cleavage of a set of atypical leader peptides during extracellular export.

J Biolumin Chemilumin, 1991 Oct-Dec, 6(4), 251 - 8
Amplified luminometric assays of alkaline phosphatase using riboflavin phosphates; Harbron S et al.; An assay for alkaline phosphatase is described which is based on the hydrolysis of riboflavin phosphates (5'FMN or 4'FMN) to produce riboflavin . This is converted to 5'FMN using riboflavin kinase, and then assayed using the bacterial bioluminescent system from Vibrio harveyi or V . fischeri . The most sensitive assay is obtained using 4'FMN, which can measure less than 20 amol after a 1-hour incubation.

Biochem Biophys Res Commun, 1991 Sep 30, 179(3), 1200 - 4
T7 infection-dependent selective expression of cloned genes in P1-lysogenic Escherichia coli; Olenik C et al.; Expression systems based on the selective transcription of genes cloned behind a T7 promoter, by T7 RNA polymerase, display a non-negligible basal expression when the T7 RNA polymerase gene is present within the host organism before induction of the system . This is a problem, especially for cloning and controlled expression of genes toxic to the host organism . We have circumvented this problem by taking advantage of abortive T7 infection of E . coli (P1), in the course of which T7 RNA polymerase is synthesized but bacterial growth is not quantitatively impaired . We have tested this system with three reporter genes, the 6-phospho-beta-galactosidase gene of Staphylococcus aureus, the luciferase operon of Vibrio harveyi, and the rabbit beta-globin gene; we have found very low basal levels, while, upon T7 infection, transcription is at least as efficient as in other in vivo T7 RNA polymerase systems in use.

Eur J Biochem, 1991 Sep 15, 200(3), 689 - 98
Chemical structure of the carbohydrate backbone of Vibrio parahaemolyticus serotype 012 lipopolysaccharide; Kondo S et al.; The chemical structure of the saccharide portion of Vibrio parahaemolyticus serotype 012 lipopolysaccharide was studied . Using chemical degradation and modification, as well as methylation analysis in combination with GLC-MS, laser-desorption mass spectrometry and 1H-NMR and 13C-NMR spectroscopy, the carbohydrate backbone of the lipopolysaccharide was characterized as a branched decasaccharide with the following structure: (formula; see text) In the native lipopolysaccharide two additional phosphate groups are present and 3-deoxy-D-threo-hexulosonic acid and D-galacturonic acid are bound via acid-labile linkages.

Biochim Biophys Acta, 1991 Sep 13, 1059(3), 332 - 8
A novel mechanism of cation/substrate cotransport: Na+/H+/adenosine cotransport in Vibrio parahaemolyticus; Okabe Y et al.; Adenosine is actively transported with Na+ in Vibrio parahaemolyticus (Sakai, Y., Tsuda, M., Tsuchiya, T . (1987) Biochim, Biophys . Acta 893, 43-48) . The proton conductor carbonylcyanide m-chlorophenylhydrazone, CCCP, strongly inhibited active transport of adenosine at pH 8.5 as well as at pH 7.0 . This seemed peculiar because the driving force, an electrochemical potential of Na+, is established by the Na(+)-extruding respiratory chain at pH 8.5 in this organism, although it is established by the function of the Na+/H+ antiporter at pH 7.0 . This suggested that H+ might be involved in the adenosine transport . We detected H+ uptake induced by adenosine influx in V . parahaemolyticus cells in the presence of Na+, but not in its absence, suggesting the occurrence of Na+/H+/adenosine cotransport . We isolated formycin A-resistant mutants which showed defective adenosine transport . The mutation resulted in simultaneous losses of Na+ uptake and H+ uptake induced by adenosine . In revertants from these mutants the Na+ uptake and H+ uptake were restored simultaneously . The frequencies of reversion were in the order of 10(-7), indicating that the mutations were single mutations; namely that Na+/adenosine cotransport and H+/adenosine cotransport took place via the same carrier . Thus, we conclude that adenosine is transported by the novel mechanism of Na+/H+/adenosine cotransport in V . parahaemolyticus.

Carbohydr Res, 1991 Sep 2, 216, 61 - 6
2,3-Didehydro-2-deoxysialic acids structurally varied at C-5 and their behaviour towards the sialidase from Vibrio cholerae; Schreiner E et al.; 2,3-Didehydro-2-deoxy-N-trifluoroacetylneuraminic acid (5-trifluoroacetyl-Neu2en) (3) has been synthesised from Neu5Ac2en (1) by hydrazinolysis, to give Neu2en (2), followed by N-trifluoroacetylation . 2,3-Didehydro-2,3-dideoxy-D-glycero-D-galacto-2-nonulopyranoson ic acid (Kdn2en, 8) and 5-azido-2,3-didehydro-2,3,5-trideoxy-D-glycero-D-galacto-2-nonu lopyranosonic acid (5-azido-5-deoxy-Kdn2en, 9) have been prepared from the acetylated methyl esters of Kdn (4) and 5-azido-5-deoxy-Kdn (5) via Zemplen saponification . The behaviour of the above 2,3-didehydro-2-deoxysialic acids towards Vibrio cholerae sialidase has been investigated.

Antimicrob Agents Chemother, 1991 Sep, 35(9), 1864 - 7
Efficacy of a single dose of furazolidone for treatment of cholera in children; Rabbani GH et al.; To test the efficacy and safety of furazolidone given as a single dose for childhood cholera, a randomized double-blind placebo-controlled trial was carried out among 118 culture-positive dehydrated children with diarrhea . Patients were randomly assigned to one of four groups to receive medication orally in liquid suspension: furazolidone at 7 mg/kg/day once, furazolidone at 7 mg/kg/day divided into four doses for 3 days, placebo once, or placebo for 3 days . After 12 patients with furazolidone-resistant infections were excluded from the analysis of efficacy, it was determined that both groups treated with furazolidone showed significantly higher rates of bacteriologic success (stool cultures negative for Vibrio cholerae on days 2 to 4 after start of therapy) and clinical success (cessation of diarrhea within 72 h after start of therapy) than corresponding placebo groups (P less than 0.001) . There were no significant differences between responses to the 3-day and single-dose regimens of furazolidone, but there was a trend toward better clinical responses in patients who received furazolidone for 3 days . No patient treated with furazolidone dropped out because of side effects . These results indicate that furazolidone, given as either a single dose or divided doses for 3 days, is effective treatment for childhood cholera.

J Neurochem, 1991 Sep, 57(3), 748 - 53
Evidence for nonrandom distribution of GD1a ganglioside in rabbit brain microsomal membranes; Palestini P et al.; GD1a is the major ganglioside of rabbit brain microsomal membranes and occurs mainly with two molecular species, containing the C18:1 (62.3%) and C20:1 (37.7%) long-chain bases . The membranes were exposed to Vibrio cholerae (VC) sialidase under conditions where the enzyme hydrolyzed only GD1a (approximately 9%), producing GM1 ganglioside, whereas the other gangliosides remained virtually unaffected . The long-chain-base analysis showed that newly-formed GM1 contained approximately 68% of the C20:1 molecular species . This indicates that VC sialidase did not randomly affect the two molecular species of GD1a but hydrolyzed preferentially the C20:1 one . In similar experiments, GD1a was inserted into the external layer of phosphatidylcholine vesicles and incubated with VC sialidase under conditions producing approximately 10% hydrolysis . Long-chain-base analysis showed that the proportion of C20:1 species in GM1 was 25.1% using vesicles composed of dipalmitoylphosphatidylcholine and 42.3% with egg phosphatidylcholine, whereas it was 39.2% in the starting GD1a . Therefore, in artificial membranes, VC sialidase acted preferentially on the C18:1 or C20:1 molecular species, depending on the length and unsaturation of the phospholipid fatty acids . Because VC sialidase is known to affect molecular dispersions more easily than packed aggregations of the gangliosidic substrate, the data suggest that in rabbit brain microsomal membranes the GD1a ganglioside molecular species carrying C20:1 long-chain base are more molecularly dispersed than those containing C18:1 long-chain base.

Appl Environ Microbiol, 1991 Sep, 57(9), 2750 - 7
Characterization of Vibrio anguillarum and closely related species isolated from farmed fish in Norway; Myhr E et al.; A total of 264 bacterial strains tentatively or definitely classified as Vibrio anguillarum were examined . The strains were isolated from diseased or healthy Norwegian fish after routine autopsy . With the exception of five isolates from wild saithe (Pollachius virens), the strains originated from nine different species of farmed fish . The bacteria were subjected to morphological, physiological, and biochemical studies, numerical taxonomical analyses, serotyping by slide agglutination and enzyme-linked immunosorbent assay, DNA-plasmid profiling, and in vitro antimicrobial drug susceptibility testing . The results of the microbiological studies were correlated to anamnestic information . The bacterial strains were identified as V . anguillarum serovar O1 (n = 132), serovar O2 (n = 89), serovar O4 (n = 2), serovar O8 (n = 1), and not typeable (n = 1) as well as Vibrio splendidus biovar I (n = 36) and biovar II (n = 1), Vibrio tubiashii (n = 1), and Vibrio fischerii (n = 1) . V . anguillarum serovar O1 or O2 was isolated in 176 out of 179 cases of clinical vibriosis in Atlantic salmon (Salmo salar) . V . anguillarum serovar O1 was the only serovar isolated from salmonid fish species other than Atlantic salmon, while V . anguillarum serovar O2 was isolated from all marine fish suffering from vibriosis . A 48-Mda plasmid was isolated from all V . anguillarum serovar O1 isolates examined . Serovar O2 isolates did not harbor any plasmids . Resistance against commonly used antibiotic compounds was not demonstrated among V . anguillarum isolates . Neither V . splendidus biovar I nor other V . anguillarum-related species appeared to be of clinical importance among salmonid fish.(ABSTRACT TRUNCATED AT 250 WORDS)

Appl Environ Microbiol, 1991 Sep, 57(9), 2651 - 5
Use of the polymerase chain reaction in detection of culturable and nonculturable Vibrio vulnificus cells; Brauns LA et al.; Vibrio vulnificus is a human pathogen associated with consumption of raw oysters . During the colder months the organism apparently enters a viable but nonculturable state and thus cannot be cultured by ordinary bacteriological methods . For this reason, another means of detecting this bacterium is necessary . In the present study we utilized the polymerase chain reaction (PCR) to detect V . vulnificus DNA, thus eliminating the problem of nonculturability . DNA from both culturable and nonculturable cells of V . vulnificus was amplified by PCR with primers flanking a 340-bp fragment of the cytotoxin-hemolysin gene . As little as 72 pg of DNA from culturable cells and 31 ng of DNA from nonculturable cells could be detected . Fifty cycles of a two-step reaction (30 s {each} at 94 and 65 degrees C) were found to be optimal as well as more time efficient than the three-step PCR . The total procedure from the point of DNA extraction to observation on a gel required less than 8 h . Possible reasons for the difficulties encountered in amplifying DNA from nonculturable cells, e.g., gene rearrangement or loss of the hemolysin gene, are discussed.

Appl Environ Microbiol, 1991 Sep, 57(9), 2640 - 4
Formation of nonculturable Vibrio vulnificus cells and its relationship to the starvation state; Oliver JD et al.; Entry into the viable but nonculturable state by the human bacterial pathogen Vibrio vulnificus in artificial seawater microcosms was studied . In contrast to the long-term culturability exhibited by cells incubated under these starvation conditions at room temperature, cells exposed to a temperature downshift to 5 degrees C exhibited an immediate decrease in culturability . Cells incubated at low temperature exhibited a morphological change from rods to cocci but demonstrated no reductive division . Of 10 factors studied which might affect the nonculturable response in V . vulnificus, only the physiological age of the cells was found to significantly affect the rate at which cells became nonculturable . The nonculturable response appears to be related to the starvation response, as prestarvation at room temperature for 24 h was found to eliminate the nonculturable response of cells subsequently incubated at 5 degrees C . This observation suggests that the synthesis of starvation proteins may repress the viable but nonculturable program displayed during low-temperature incubation . The possible ecological significance of these findings is discussed.

Microb Pathog, 1991 Sep, 11(3), 179 - 88
Epitope differences in toxin-coregulated pili produced by classical and El Tor Vibrio cholerae O1; Jonson G et al.; A toxin-coregulated pilus (TCP), that is important for intestinal colonization of Vibrio cholerae O1, may be produced by vibrios of both classical and EI Tor biotypes . By comparing TCP produced by various strains of the two biotypes in immunoblotting and enzyme-linked immunosorbent assays (ELISA) using monoclonal antibodies (mAbs) and polyclonal antisera against TCP from classical vibrios, we have found biotype-related epitope differences in TCP . Our results indicate that TCP of classical strains has an epitope in the TcpA-subunit (20.5 kDa) that is missing in EI Tor TcpA, and an additional epitope that is more strongly expressed in classical TcpA . A polyclonal antiserum reacted strongly with TcpA from strains of both biotypes in immunoblotting suggesting both the presence of major shared TcpA epitopes and that the low or absent reactivity of EI Tor TcpA with the mAbs was not due to lower production of TcpA by EI Tor strains . Whereas all the TcpA-positive classical strains inhibited the binding of polyclonal antiserum and mAbs to solid phase-bound TCP-positive bacteria in an inhibition ELISA, practically no inhibition was observed with TcpA-positive EI Tor strains . This together with findings in immunoelectron microscopy studies that TCP 'bundles' were only detected on classical strains, suggest that TCP is poorly expressed on EI Tor vibrios.

Vopr Med Khim, 1991 Sep-Oct, 37(5), 28 - 31
{Catalytic properties of neuraminidase of non-cholera vibrios}; Lavrovskii SN et al.; Main catalytic properties of commercially available neuraminidase preparations from noncholeric vibrios were studied . The enzymatic activity was measured using a simple resorcinol procedure . Optimal conditions for neuraminidase effect: pH 5.5-6.0 and buffer composition, were characterized . Affinity of the enzyme to various substrates was studied using 10 natural and synthetic sialoconjugates . Km values were studied for fetuin, ovomucin and transferrin used as optimal substrates . When influence of meta ions, detergents, complexes and other compounds was studied, activation of neuraminidase was found in presence of bivalent metal ions, especially of Ca2+, while chelate-forming complexes and heavy metal salts inhibited the enzyme . These results may be used in studies of the neuraminidase action mechanism and regulation of its activity.

Bioessays, 1991 Sep, 13(9), 463 - 8
Na(+)-coupled alternative to H(+)-coupled primary transport systems in bacteria; Dimroth P; Protons are the most common coupling ions in bacterial energy conversions . However, while many organisms, such as the alkaliphilic Bacilli, employ H(+)-bioenergetics for electron transport phosphorylation, they use Na+ as the coupling ion for transport and flagellar movement . The Na+ gradient required for these bioenergetic functions is established by the secondary Na+/H+ antiporter . In contrast, Vibrio alginolyticus and methanogenic bacteria have primary pumps for both H+ and Na+ . They use the proton gradient for ATP synthesis while other, less energy-consuming membrane reactions are powered by the Na+ gradient . In a third mode, some anaerobic bacteria possess decarboxylases acting as primary Na+ pumps . For instance, in Klebsiella pneumoniae, the Na+ gradient established by oxaloacetate decarboxylase is used for the uptake of the growth substrate citrate, and Propionigenium modestum consumes the energy of the Na+ gradient formed by methylmalonyl-CoA decarboxylase directly for ATP synthesis.

Zhonghua Yi Xue Za Zhi (Taipei), 1991 Sep, 48(3), 232 - 6
Non-0:1 Vibrio cholerae bacteremia: a case report and literature review; Wang K et al.; We reported a case of non-0:1 group Vibrio cholerae septicemia with myelodysplatic syndrome in Taiwan . We also reviewed the other 22 reported cases of non-0:1 Vibrion cholerae septicemia found in the literature regarding its pathogenesis and treatment . The case mortality rate of these 23 cases was 47.8% . Most of them had immunocompromised diseases, particularly liver cirrhosis and hematologic malignancy . Therefore, the most important factor is the host defense . The cholera-like enterotoxin and E1-Tor-like hemolysin also play a major role, but whether the gall bladder plays a role in organ growth is still unclear . The incidence of gastroenteritis is not well understood because of the low incidence of non-0:1 V . cholerae gastroenteritis as compared with other factors such as shell-fish eating . Ampicillin as the sole antibiotic for non-0:1 V . cholerae is not efficacious . Tetracyclines or chloramphenicol is more effective for treatment.

Infect Immun, 1991 Sep, 59(9), 3046 - 52
Regulation of leukotriene B4 generation from human polymorphonuclear granulocytes after stimulation with formyl-methionyl-leucyl phenylalanine: effects of pertussis and cholera toxins; Hensler T et al.; The effects of holotoxins and toxin subunits from Bordetella pertussis and Vibrio cholerae strains on intact and digitonin-permeabilized human polymorphonuclear neutrophils were studied . Our data clearly demonstrate that formyl-methionyl-leucyl-phenylalanine (fMLP)-induced generation of chemotactic active leukotriene B4 was inhibited by both holotoxins as well as by their isolated enzymatic A protomers . In contrast, the respective binding components (B oligomers) did not affect leukotriene formation . Priming of digitonin-permeabilized neutrophils with either guanylylimidodiphosphate or inositol trisphosphate increased subsequent stimulation with fMLP . In contrast, diacylglycerol decreased fMLP-induced leukotriene B4 formation, but inositol trisphosphate and diacylglycerol had no effect on inhibition mediated by the toxins . In addition, pertussis and cholera toxins reduced the specific binding of {3H}fMLP . Scatchard plot analysis revealed that the observed decrease of peptide binding was due to a reduced number of receptor sites . The fMLP-stimulated {3H}guanylylimidodiphosphate binding and GTPase activity used as parameters for the activation of G proteins were decreased in parallel . These results suggest altered chemotactic receptor numbers and G-protein functions responsible for the toxin-dependent suppression of fMLP-mediated response for neutrophils.

Gene, 1991 Aug 30, 105(1), 107 - 11
Transformation of Vibrio cholerae by plasmid DNA; Panda DK et al.; The lack of an efficient transformation system in Vibrio cholerae was a handicap in the genetic manipulation of this important human pathogen . Since V . cholerae cells secrete DNases, this may interfere with the uptake of DNA . The present report describes the approaches taken for transforming V . cholerae cells with plasmid DNA, by overcoming this DNase barrier . The partial success of transforming DNase-negative mutants confirmed the role of DNase in the nontransformability of the wild-type cells . Successful transformation was carried out following removal of DNases from the periplasmic space . This was achieved by treating the cells with Mg2+ and Ca2+ ions to allow the DNase to be released, and then holding them under conditions where the remaining DNase activity was minimized before adding DNA to the competent cells . Transformation efficiencies of the order of 10(-5) per recipient cell were observed.

Biochem Biophys Res Commun, 1991 Aug 30, 179(1), 224 - 8
Na(+)-coupled ATP synthesis in a mutant of Vibrio parahaemolyticus lacking H(+)-translocating ATPase activity; Sakai-Tomita Y et al.; An H(+)-translocating ATPase-defective mutant of Vibrio parahaemolyticus YS-1 grew well on lactate as a sole source of carbon at pH 8.5 under aerobic conditions, but not under anaerobic conditions . Both wild type cells and the mutant cells could grow on lactate at pH 8.5 even in the presence of an H+ conductor, carbonylcyanide m-chlorophenylhydrazone (CCCP), but not at pH 7.5 . Oxidative phosphorylation resistant to CCCP in the mutant occurred at pH 8.5 . These findings suggest the existence of Na(+)-coupled oxidative phosphorylation which is functional at alkaline pHs in V . parahaemolyticus . In fact, we observed ATP synthesis driven by an artificially imposed Na+ gradient in YS-1 cells, which was resistant to CCCP.

Biochim Biophys Acta, 1991 Aug 27, 1090(1), 139 - 41
Nucleotide sequence analysis of the CT operon of the Vibrio cholerae classical strain 569B; Dams E et al.; The complete nucleotide sequence of the Vibrio cholerae classical strain 569B was determined . The results prove the exactness of the amino acid CT B sequence published by Takao et al . (1985, Eur . J . Biochem . 146, 503-508) . A comparison is made with already reported CT genes.

Carbohydr Res, 1991 Aug 20, 215(2), 303 - 14
Structural studies of the Vibrio cholerae O:3 O-antigen polysaccharide; Chowdhury TA et al.; The structure of the Vibrio cholerae O:3 O-antigen polysaccharide has been investigated, mainly by n.m.r . spectroscopy, mass spectrometry, sugar and methylation analysis, and specific degradations, and is proposed to involve the following tetrasaccharide repeating-unit . {formula: see text} . In this structure, D-D-Hep is D-glycero-D-manno-heptose, Asc is 3,6-dideoxy-L-arabino-hexose (ascarylose), and Sug is 2,4-diamino-2,4,6-trideoxy-D-glucose (bacillosamine) in which N-2 is acetylated and N-4 is acylated with a 3,5-dihydroxyhexanoic acid . That the 2,4-diamino-2,4,6-trideoxy-D-glucose residue is linked through O-3 and not through one of the hydroxyl groups in the 3,5-dihydroxyhexanoyl group is indicated but not definitely proved . The configuration of the latter group has not been determined . The f.a.b.-mass spectrum of the methylated O-antigen indicates that the structure given above also represents the biological repeating-unit.

Ugeskr Laeger, 1991 Aug 19, 153(34), 2361 - 2
{Vibrio vulnificus}; Andersen HK; A patient sustained a knife wound while cleaning eels and subsequently severe wound infection developed . Vibrio vulnificus was isolated from the wound and, on the basis of this, the main features of the epidemiology of the bacteria and the typical clinical pictures are reviewed.

FEMS Microbiol Lett, 1991 Aug 15, 66(3), 279 - 85
Effect of lipopolysaccharide core synthesis mutations on the production of Vibrio cholerae O-antigen in Escherichia coli K-12; Morona R et al.; The rfb genes of Vibrio cholerae O1 (Ogawa serotype) were subcloned into a derivative of pBR322 . This plasmid was transformed into several Escherichia coli K-12 mutant strains which produce an incomplete lipopolysaccharide (LPS)-core-oligosaccharide region . The data indicate that the V . cholerae O-antigen is assembled onto the E . coli LPS and that at least two glucoses are needed in the core in order to achieve a high level of production . These data are consistent with the reported presence of glucose in the V . cholerae LPS-core-oligosaccharide region.

Gastroenterology, 1991 Aug, 101(2), 319 - 24
Effects of Vibrio cholerae recombinant strains on rabbit ileum in vivo . Enterotoxin production and myoelectric activity; Lind CD et al.; Previous studies have identified the effects of Vibrio cholerae and its enterotoxin, choleragen (CT A+B+), on the myoelectric activity of rabbit ileal loops in vivo . The response was defined as the migrating action potential complex, the single ring contraction that propels luminal contents aborad . In this study the same rabbit model is used to assess whether migrating action potential complex activity or fluid output is induced by recombinant strains of V . cholerae that produce no subunit of cholera toxin (CT A-B-) or only by the inactive binding subunit (CT A-B+) . Three live strains were studied: El Tor wild-type N16961 (CT A+B+) and recombinant strains CVD106 (CT A-B+) and JBK70 (CT A-B-) . Controls received sterile culture broth . Migrating action potential complex frequency in animals inoculated with CT A+B+ was significantly increased compared with that in all other experimental groups (P less than 0.01) . Fluid output was also increased in animals inoculated with CT A+B+ compared with fluid output in all other groups (P less than 0.05) . Migrating action potential complex frequency and fluid output in rabbits given CT A-B+ or CT A-B- did not differ from activity in controls . How these recombinant strains induce diarrhea is unknown, but the mechanism may involve bacterial colonization or production of an unknown toxin.

Can J Microbiol, 1991 Aug, 37(8), 618 - 23
Seasonal variation in presence of Vibrio salmonicida and total bacterial counts in Norwegian fish-farm water; Enger O et al.; Total bacterial counts and the number of the fish pathogenic bacterium Vibrio salmonicida have been studied in water samples collected twice a month in 12 Norwegian fish farms from October 1988 to June 1989 . Total counts were determined by staining with 4',6-diamidino-2-phenylindole followed by epifluorescence microscopy . Cells of V . salmonicida were enumerated with a fluorescent antibody technique using highly specific monoclonal antibodies . Despite the fact that no outbreak of cold-water vibriosis was reported, V . salmonicida was detected in all 12 farms, in numbers ranging from 12 to 43 bacteria/mL . The number of farms where V . salmonicida was detected was generally highest during the winter . Total bacterial counts in the water samples varied between 4 X 10(4) and 9 X 10(5) bacteria/mL and the lowest numbers occurred during the winter period . The total bacterial counts were comparable with counts in water uninfluenced by fish farming . On the basis of our results, and additional information available about cold-water vibriosis caused by the bacterium V . salmonicida, an asymptomatic carrier state of the disease is proposed.

Kansenshogaku Zasshi, 1991 Aug, 65(8), 897 - 904
{Studies on the enteropathogenic mechanism of non-O1 Vibrio cholerae . IV . Role of hemolysin}; Gyobu Y et al.; The role of hemolysin in the enteropathogenic mechanism of non-O1 V . cholerae was experimentally investigated, in vitro and in vivo . Results are summarized as follows . 1) . A greater majority of enteropathogenic strains produced hemolysin in Eagle MEM medium supplemented with 10% calf serum and in the rabbit ileal loop, while most non-enteropathogenic strains did not under the same conditions . 2) . Non-enteropathogenic mutants derived from enteropathogenic parent strains produced much less hemolysin than that of parent strains . 3) . A significant inhibition of the fluid accumulation in the ligated rabbit ileal loop test with viable cells was noted in rabbit immunized with purified hemolysin . These results indicate that hemolysin is the most important toxin in the enteropathogenic mechanism of non-O1 V . cholerae.

Epidemiol Infect, 1991 Aug, 107(1), 225 - 33
Genetic diversity among toxigenic and nontoxigenic Vibrio cholerae O1 isolated from the Western Hemisphere; Chen F et al.; Multilocus enzyme electrophoresis was used to examine genetic relationships among and between toxigenic and non-toxigenic isolates of Vibrio cholerae O1 obtained from patients and the environment in the US Gulf Coast and surrounding areas . A total of 23 toxigenic and 23 non-toxigenic strains were examined . All the toxigenic and 7 of the non-toxigenic strains had the same alleles at 16 enzyme loci, whereas the balance of the nontoxigenic strains had 9 distinct combinations of alleles . This study suggests that all of the toxigenic strains belong to a single clone, and that while some of the non-toxigenic isolates were related, most were of diverse origin.

Am J Epidemiol, 1991 Aug 1, 134(3), 290 - 7
The risk of Vibrio illness in the Florida raw oyster eating population, 1981-1988; Desenclos JC et al.; In the period 1981-1988, 333 cases of bacteriologically confirmed Vibrio illness were reported in Florida adult residents . A total of 197 patients (59.2%) had consumed raw oysters the week prior to becoming ill, and among those 197, 38 (19.3%) had a liver disease, 13 (6.6%) had past gastric surgery, and 15 (7.6%) were diabetic . To calculate a population-based incidence rate, the authors obtained prevalence estimates of annual raw oyster consumption, liver disease, previous gastric surgery, and diabetes through a random telephone survey of Florida adult residents and applied them to the January 1985 Florida population . The estimated age-standardized annual incidence of Vibrio illness per million was 95.4 for raw oyster eaters with liver disease, 9.2 for raw oyster eaters without liver disease, and 2.2 for non-raw oyster eaters . Those with prior gastric surgery had a moderately increased risk of Vibrio illness . The annual incidence for Vibrio septicemia was 82.8 for raw oyster eaters with liver disease, 2.0 for raw oyster eaters without liver disease, and 0.4 for non-raw oyster eaters . While estimates on which these data are based are subject to a number of potential biases, this is the first study to provide estimates of the risk of Vibrio illness in raw oyster eaters, and it supports the recommendation that raw oyster consumption should be avoided by persons with liver disease.

Arch Intern Med, 1991 Aug, 151(8), 1606 - 9
Hemochromatosis, iron and septicemia caused by Vibrio vulnificus; Bullen JJ et al.; Vibrio vulnificus is killed by normal human blood but grows rapidly in blood from patients with hemochromatosis . It also grows in normal blood if the saturation of the transferrin is increased or if hematin, which contains iron, is added . It is suggested that the increased availability of iron in the blood of patients with chronic iron overload is responsible for their enhanced susceptibility to infection with V vulnificus.

J Pharmacol Exp Ther, 1991 Aug, 258(2), 647 - 51
Purified choleragenoid does not induce migrating action potential complex activity in rabbit ileum in vivo; Lind CD et al.; The migrating action potential complex (MAPC), a single ring contraction that propels luminal contents abroad, is elicited by Vibrio cholerae and its enterotoxin, choleragen (A1A2B5), in rabbit ileal loops in vivo . Choleragenoid (B5; the binding subunit) was shown previously to induce MAPCs without activating the adenylate cyclase system and without stimulating fluid output . We restudied purified B5 (extracted by high-performance liquid chromatography) to assess its effects on the myoelectric activity of rabbit ileum: can MAPC activity can be induced without associated fluid production? Four different B5 preparations and two controls, V . cholerae and sterile saline, were used . MAPC activity and ileal fluid output were significantly increased in animals inoculated with A1A2B5 (V . cholerae-El Tor) compared with all other preparations and controls . Importantly, MAPC activity and fluid output in all B5 groups did not differ from those in saline controls, demonstrating that purified B5 does not induce MAPC activity in rabbit ilium in vivo . The previous study showing B5-induced MAPCs may have resulted from A1A2B5 contamination . These results suggest A1A2B5-induced adenylate cyclase activation; myoelectric activity may be interrelated with holotoxin binding that causes a neural response.

J Bacteriol, 1991 Aug, 173(16), 5054 - 9
Resuscitation of Vibrio vulnificus from the viable but nonculturable state; Nilsson L et al.; Stationary-phase-grown cells of the estuarine bacterium Vibrio vulnificus became nonculturable in nutrient-limited artificial seawater microcosms after 27 days at 5 degrees C . When the nonculturable cells were subjected to temperature upshift by being placed at room temperature, the original bacterial numbers were detectable by plate counts after 3 days, with a corresponding increase in the direct viable counts from 3% to over 80% of the total cell count . No increase in the total cell count was observed during resuscitation, indicating that the plate count increases were not due to growth of a few culturable cells . Chloramphenicol and ampicillin totally inhibited resuscitation of the nonculturable cells when added to samples that had been at room temperature for up to 24 h . After 72 h of resuscitation, the inhibitors had an easily detectable but reduced effect on the resuscitated cells, indicating that protein and peptidoglycan synthesis were still ongoing . Major changes in the morphology of the cells were discovered . Nonculturable cells of V . vulnificus were small cocci (approximately 1.0 micron in diameter) . Upon resuscitation, the cells became large rods with a size of mid-log-phase cells (3.0 microns in length) . Four days after the cells had become fully resuscitated, the cell size had decreased to approximately 1.5 micron in length and 0.7 micron in width . The cells were able to go through at least two cycles of nonculturability and subsequent resuscitation without changes in the total cell count . This is the first report of resuscitation, without the addition of nutrient, of nonculturable cells, and it is suggested that temperature may be the determining factor in the resuscitation from this survival, or adaptation, state of certain species in estuarine environments.

J Infect Dis, 1991 Aug, 164(2), 407 - 11
Antibody responses after immunization with killed oral cholera vaccines during the 1985 vaccine field trial in Bangladesh; Sack DA et al.; Sera collected during the 1985 oral cholera vaccine trial in Matlab, Bangladesh, which demonstrated efficacy of a whole cell combined with cholera B subunit vaccine (WC/BS) and a whole cell only vaccine (WC), were analyzed for antitoxin and vibriocidal antibodies . Before vaccines were given, antitoxin titers were highest in children, especially those with O blood group, whereas vibriocidal titers rose throughout life . Two weeks after three doses of vaccine, geometric mean antitoxin titers were 2.5-4.5 times higher in vaccinees who received the WC/BS vaccine; the vibriocidal titers were 1.3-2.1 times higher in vaccinees who received either vaccine . The titer elevations were relatively brief and were barely detectable 7 months after the third dose even though significant levels of protection persisted greater than or equal to 3 years . Thus, the oral vaccines induced a serum response in this large field trial that was similar to that seen in earlier pilot studies, but the duration of the serum responses was much shorter than the duration of the protection.

Infect Immun, 1991 Aug, 59(8), 2727 - 36
Roles of motility and flagellar structure in pathogenicity of Vibrio cholerae: analysis of motility mutants in three animal models; Richardson K; Wild-type Vibrio cholerae of both El Tor and classical biotypes (strains N16961 and 395, respectively) and nonmotile mutant derivatives with and without flagellar structures were characterized in three different animal models: (i) the rabbit ileal loop, (ii) the removable intestinal tie adult rabbit diarrhea (RITARD) model, and (iii) the suckling mouse model . Both the wild-type strains and nonmotile mutants were toxinogenic in the rabbit ileal loop and the suckling mouse models . However, all of the nonmotile mutants produced significantly less fluid accumulation than did the wild-type parental strains . The two nonmotile mutants of strain N16961 did not adhere to rabbit ileal mucosa, but both nonmotile mutants derived from strain 395 exhibited adherence . In the RITARD model, the motile El Tor strains were more virulent than both the flagellate and aflagellate nonmotile mutants (all infected rabbits died within 18 h), while the nonmotile mutants, when fatalities occurred, required 78 to 105 h to produce a fatal outcome . Likewise, the motile classical parent 395 produced a fatal outcome within ca . 25 h, while nonmotile mutants required 69 to 96 h . The nonmotile flagellate strain KR31 was not significantly more virulent than the nonmotile aflagellate strain KR26 . Of the two classical nonmotile mutants, KR1, which produces a coreless sheathlike structure, was clearly more virulent (5 of 10 rabbits died within 96 h), while KR3 (nonmotile, aflagellate) did not produce fatalities in any of the 10 rabbits tested . Similarly, no significant difference in diarrheagenicity or colonizing ability was detected between the two nonmotile mutants derived from the El Tor strain, but the classical nonmotile mutant with the coreless sheath caused significantly greater diarrhea and colonized for a longer time than did the isogenic nonmotile aflagellate strain, KR3 . No significant differences between the nonmotile mutants were detected in competition studies done with suckling mice . Analysis of the wild-type and mutant strains in these three animal models clearly demonstrated a role for motility in V . cholerae pathogenicity, while analysis of only the nonmotile mutants derived from the classical parent suggested a role for flagellar structures.

Vaccine, 1991 Aug, 9(8), 588 - 94
Amino-terminal domain of the El Tor haemolysin of Vibrio cholerae O1 is expressed in classical strains and is cytotoxic; Alm RA et al.; Previous studies have shown that the classical isolates of Vibrio cholerae possess an 11 bp deletion in the structural gene for the El Tor haemolysin leading to the production of a 27 kDa non-haemolytic truncated product HlyA* compared to the 82 kDa haemolysin, HlyA . These studies were designed to assess whether this truncated product had any biological activity . A KmR cartridge was introduced into the hlyA gene effectively eliminating the haemolysin . This was recombined into the chromosome of a variety of strains and isogenic pairs were examined in a number of systems . These studies suggest that the haemolytic (cytolytic) domain of HlyA resides at the C-terminus and that the N-terminus, which is conserved as HlyA* in classical strains, possesses enterotoxic (cytotoxic) activity . Experiments with the cholera-toxinless vaccine candidate JBK70 and its hlyA::KmR mutant suggest that HlyA* may be responsible for the residual diarrhoea observed in cholera-toxinless vaccine strains.

Appl Environ Microbiol, 1991 Aug, 57(8), 2223 - 8
Isolation and characterization of turbot (Scophtalmus maximus)-associated bacteria with inhibitory effects against Vibrio anguillarum; Westerdahl A et al.; More than 400 isolates from the intestine and the external surface of farmed Scophtalmus maximus as well as from fish food and hatchery water were screened for inhibitory effects against the fish pathogen Vibrio anguillarum HI 11345 and seven other fish pathogens . The bacteria with inhibitory effects were then characterized with regard to their sites of colonization, especially the intestinal regions and sites within each region . Of the total number of bacterial isolates from the intestine, 28% were inhibitory against V . anguillarum HI 11345 . A marine biochemical assay was used to order the inhibitory strains into different phena . Most inhibitory bacteria were found in the rinse and mucus fractions of the gastrointestinal tract . No correlations among the different phena, site of colonization, and inhibitory effect could be found; however, a biochemical diversity was noted in the strains with an inhibitory effect . Of the isolates with an inhibitory effect against V . anguillarum HI 11345, 60% had an inhibitory effect on five other fish-pathogenic serotypes of V . anguillarum . Inhibitory effects of the isolates were also shown against Aeromonas salmonicida and Aeromonas hydrophila.

Appl Environ Microbiol, 1991 Aug, 57(8), 2158 - 63
Occurrence of plasmids in Danish isolates of Vibrio anguillarum serovars O1 and O2 and association of plasmids with phenotypic characteristics; Larsen JL et al.; Two hundred and twenty-eight isolates of Vibrio anguillarum serovar O1 (125 isolates) and serovar O2 (103 isolates) have been characterized with regard to plasmid contents, biochemical properties, and in vitro hemagglutination and hydrophobic properties . Among 74 V . anguillarum isolates from diseased fish, 63 carried only a 67-kb plasmid (pJM1), 9 carried an additional 98-kb plasmid, and 1 isolate carried only the 98-kb plasmid . Only one isolate was without plasmids . In V . anguillarum serovar O1 from nondiseased fish (mucus and gills), plasmids of the same sizes were present in 29 isolates (58%), whereas 21 isolates (42%) were plasmid free . Based on hemagglutination and biochemical properties, V . anguillarum serovar O1 isolates were divided into eight biovars . The plasmid-carrying strains (102 isolates) all fell within biovars 1 and 2, whereas the 23 strains of biovars 3 to 8 were without plasmids . It was tentatively concluded there are two populations of V . anguillarum serovar O1 . One population contains plasmid(s), is hemagglutination negative and trehalose negative, and does not form pellicles in broth cultures, whereas the other population is plasmid free and has the opposite characteristics . The former group is the one related to disease in fish . All 20 V . anguillarum serovar O2 isolates from the environment were without plasmids, whereas 54 (65%) of the isolates from fish (trout and cod) carried plasmids . The biochemical diversity within serovar O2 was pronounced; 13 different biovars were demonstrated . No correlation between the presence of plasmids and biochemical properties was observed.

Appl Environ Microbiol, 1991 Aug, 57(8), 2152 - 7
Cholera enterotoxin production in Vibrio cholerae O1 strains isolated from the environment and from humans in Japan; Minami A et al.; Vibrio cholerae O1 strains isolated from various sources in Japan over the years 1977 through 1987 were examined to confirm the presence or absence of the cholera enterotoxin (CT) gene and production of CT and to determine the kappa-phage type . The CT gene was detected in none of 225 isolates from natural waters but was present in all of the 10 isolates from environmental waters implicated in domestic cholera cases, in 64 strains (26.6%) of the 241 isolates from imported seafoods, in 43 strains (95.6%) of the 45 isolates from domestic cholera cases, and in 119 strains (93.7%) of the 127 isolates from imported cholera cases . The results suggest that the CT gene-positive strains of V . cholerae O1 have been imported into Japan through seafoods and/or by travelers . Sporadic cholera cases have resulted in contamination of the surrounding environment, but the CT gene-positive strains may not have persisted in natural waters to serve as a reservoir for epidemic cholera . The commercially available VET-RPLA kit (a latex agglutination kit for immunological detection of CT) detected production of CT in all of the CT gene-positive strains, indicating that there was no silent CT gene in the test strains . There was a strong correlation between the kappa-phage type and the presence or absence of the CT gene, suggesting a significant clonal difference between CT gene-positive and -negative strains . Five CT gene-negative strains isolated from imported cholera cases (travelers with mild diarrhea) induced a considerable amount of fluid accumulation in rabbit and/or suckling mouse intestines, indicating production of an enterotoxic factor(s) other than CT.(ABSTRACT TRUNCATED AT 250 WORDS)

Mol Microbiol, 1991 Aug, 5(8), 2031 - 8
Transcription of the Vibrio cholerae haemolysin gene, hlyA, and cloning of a positive regulatory locus, hlyU; Williams SG et al.; Transcription of the Vibrio cholerae hlyA gene, which encodes a cytotoxic haemolysin, has been investigated . The hlyA transcript initiates 430 nucleotides (nt) upstream of the translational start site . hlyA-cat transcriptional fusion constructs were active in V . cholerae but not in Escherichia coli . An hlyA-cat fusion was used to select, from a V . cholerae O17 plasmid library, a clone that could activate the hlyA promoter in E . coli . This regulatory locus has been designated hlyU . hlyU appears to be distinct from the previously described hlyR locus.

J Clin Microbiol, 1991 Aug, 29(8), 1684 - 8
Identification of Vibrio vulnificus O serovars with antilipopolysaccharide monoclonal antibody; Martin SJ et al.; A serotyping scheme for Vibrio vulnificus predicated on the detection of lipopolysaccharide (LPS) antigens is proposed . The serovar O typing scheme used to type V . vulnificus employs polyclonal antisera raised in rabbits immunized with heat-killed whole-cell vaccines . Polyclonal typing sera produced in this manner cross-react with heterologous strains . Affinity purification of polyclonal antisera with LPS affinity columns resolved some of these cross-reactions; however, affinity-purified polyclonal antisera still showed cross-reactions that were nonreciprocal . On the basis of the serological patterns that were obtained with affinity-purified polyclonal antisera, V . vulnificus strains were selected as vaccine strains for production of monoclonal antibody . Spleen cells harvested from BALB/c mice immunized with formalin-killed V . vulnificus cells were fused with SP2/O-Ag 14 myeloma cells . Hybridomas were screened by using LPS and whole-cell enzyme-linked immunosorbent assay to identify clones secreting LPS-specific antibodies . Monoclonal antibodies identified five LPS serological varieties of V . vulnificus and a single serovar each for Vibrio damsela and Vibrio hollisae . No cross-reactions between V . vulnificus and V . hollisae or V . damsela were observed.

Antibiot Khimioter, 1991 Aug, 36(8), 37 - 9
{Antibiotic sensitivity of El Tor Vibrio cholerae after exposure to various pesticides and mineral fertilizers}; Ziiaev ShI et al.; The strains of El Tor Vibrio cholerae were exposed to different concentrations of pesticides (fazolone, treflane, prometrine, magnesium chlorate, omait and gardon) and mineral fertilizers (superphosphate, ammophos and carbamide) for 2 to 135 days . The subcultures of various ages were tested for their sensitivity to 16 antibiotics . The whole of 229 cultures were tested . There was a general tendency to lowering of the El Tor vibrio sensitivity to the majority of the antibiotics tested . The vibrio strains resistant to the antibiotics widely used in medical practice i . e . levomycetin, streptomycin, tetracycline, lincomycin, neomycin and kanamycin were isolated.

J Neurosci, 1991 Aug, 11(8), 2443 - 52
Interaction of ganglioside GM1 with the B subunit of cholera toxin modulates growth and differentiation of neuroblastoma N18 cells; Masco D et al.; The present study uses the B subunit of cholera toxin, a protein that binds specifically to ganglioside GM1, to examine the role of endogenous GM1 in the process of growth and differentiation of mouse neuroblastoma N18 cells . Binding of the B subunit to neuroblastoma N18 cells inhibited DNA synthesis with concomitant induction of differentiation . The B subunit induced pronounced morphological changes: an increase in neurite outgrowth with branched neurites and spinelike processes . The distinct morphological alterations and neuritogenesis in response to the B subunit were also revealed by immunofluorescence with fluorescein-labeled B subunit . The mechanism of the B subunit-induced differentiation is different than that of spontaneous differentiation . Thrombin, a serine protease present in normal serum, inhibits neurite outgrowth induced by the removal of serum from the medium . In contrast, thrombin did not cause retraction of the neurites induced by the B subunit . Thus, thrombin or a thrombin-like protease is not involved in the process of neurite outgrowth mediated through endogenous GM1 . The biological effects of the B subunit are due to the binding of the B subunit to ganglioside GM1 and not due to changes in cAMP levels resulting from contaminating A subunit . We used highly purified cloned B subunit that cannot contain any A subunit because it was isolated from a Vibrio cholerae mutant that only expresses the B subunit . Neither the cloned nor commercial preparations of the B subunit induced increases of cAMP in these cells . There was a good correlation between the amount of B subunit bound to the cells and the biological effect . Finally, treatment with neuraminidase, which caused a fourfold increase in the level of membrane GM1 as determined by iodinated cholera toxin binding, enhanced the biological effect of the B subunit . However, neuraminidase treatment alone did not have significant effects, either on DNA synthesis or on morphology of the cells, indicating that elevations in the level of GM1 per se are not sufficient by themselves to cause significant changes in cell growth or differentiation . It seems most likely that the aggregation of endogenous GM1 on the cell surface by the B subunit is responsible for these effects on mouse neuroblastoma N18 cells.

J Immunol, 1991 Aug 1, 147(3), 757 - 66
Cyclic AMP- and inositol phosphate-independent inhibition of Ca2+ influx by cholera toxin in CD3-stimulated Jurkat T cells . A study with a cholera toxin-resistant cell variant and the Ca2+ endoplasmic reticulum-ATPase inhibitor thapsigargin; Gouy H et al.; In this report, we describe a Jurkat cell variant, termed JCT8, the selection of which is based upon its resistance to cell-growth inhibition mediated by the holotoxin of Vibrio cholerae, cholera toxin (CT) . JCT8 cells exhibit normal cAMP production in response to various cAMP inducers, including CT, together with conserved ADP ribosylation in vitro of G-protein Gs alpha by the A subunit of the toxin . However, after a 4-h pretreatment with CT, JCT8 cells have a conserved expression of cell-surface CD3 molecules . These effects are in contrast to those elicited by the toxin in long term PGE2-desensitized Jurkat cells, which remain as sensitive as the wild type to the inhibitory action of CT on cell growth and CD3 cell-surface expression, despite poor responsiveness to CT with regard to cAMP production . In JCT8 cells, Ca2+ mobilization induced via the CD3/TCR is maintained after CT treatment contrasting with its complete suppression in the wild-type and in the PGE2-desensitized cells . However, as in the other cell types, CT still suppresses Ca2+ influx in JCT8 cells . Increase in inositol phosphates by CD3 stimulation of JCT8 cells, including of inositol 1,4,5-triphosphate (I(1,4,5)P3), is only partially antagonized by CT . This suggests either that in JCT8 cells there is a different susceptibility of Ca2+ mobilization and influx to partial inhibition by CT of CD3-triggered phospholipase C (PLC)-induced phosphoinositide hydrolysis or that an additional and PLC-independent suppressive effect of the toxin on Ca2+ influx may exist . To investigate this particular point further, we use Thapsigargin, a Ca(2+)-endoplasmic reticulum ATPase inhibitor that can mobilize in human T lymphocytes I(1,4,5)P3-dependent intracellular Ca2+ pools by a PLC-independent pathway . We demonstrate that the Ca2+ influx triggered in the wild-type Jurkat cells or in JCT8 cells by Thapsigargin is antagonized by CT . The present data are therefore consistent with the idea that CT specifically impairs in the Jurkat T cell model the entry of Ca2+ from extracellular spaces by a mechanism independent not only from cAMP but also in part from inhibition by the toxin of phosphoinositide hydrolysis.

J Bacteriol, 1991 Aug, 173(16), 5036 - 46
Evidence for insertion sequence-mediated spread of the thermostable direct hemolysin gene among Vibrio species; Terai A et al.; The tdh gene of Vibrio parahaemolyticus which encodes the thermostable direct hemolysin has been found in some strains of other Vibrio species . Analysis of seven tdh genes cloned from V . parahaemolyticus, Vibrio mimicus, and non-O1 Vibrio cholerae revealed that all tdh genes were flanked by insertion sequence-like elements (collectively named ISVs) or related sequences derived from genetic rearrangement of ISVs . The ISVs possessed 18-bp terminal inverted repeats highly homologous to those of IS903 (2- to 4-bp mismatch) and were 881 to 1,058 bp long with less than 33.6% sequence divergence . These features and nucleotide sequence similarities among ISVs and IS903 (overall homologies between ISVs and IS903, ca . 50%) strongly suggest that they were derived from a common ancestral sequence . A family of ISVs were widely distributed in Vibrio species, often regardless of the possession of the tdh genes, and one to several copies of the ISVs per organism were detected . A strain of V . mimicus possessed two copies of the ISVs flanking the tdh gene and three copies unrelated to the tdh gene . However, the transposition activity of the ISVs could not be demonstrated, probably because they had suffered from base changes and insertions and deletions within the transposase gene . The possible mode of ISV-mediated spread of the tdh gene is discussed from an evolutionary standpoint.

FEBS Lett, 1991 Jul 29, 286(1-2), 159 - 62
Identification and nucleotide sequence determination of the gene responsible for Ogawa serotype specificity of V . cholerae 01; Ito T et al.; The gene encoding a protein of 27 kDa, which is specifically expressed in Vibrio cholerae of serotype Ogawa, was identified and its nucleotide sequence determined . The plasmid carrying this gene was found to convert serotype specificity from Inaba to Ogawa when introduced into the Escherichia coli DH5(pVCI112) cell which harbors a cloned 20-kilobase genomic DNA fragment of V . cholerae NIH35A3 and expresses the 01 antigen of Inaba serotype.

Gene, 1991 Jul 15, 103(1), 37 - 43
Analysis of two genes encoding heat-labile toxins and located on a single Ent plasmid from Escherichia coli; Murphy GL et al.; A clinical isolate of Escherichia coli harbored two copies of the heat-labile toxin (LT)-encoding gene (elt) on a 157-kb plasmid . The arrangement of the gene copies is different from the cholera toxin-encoding gene duplication described for some strains of Vibrio cholerae . The nucleotide sequences of the elt alleles are not identical (differing by 2 bp) and the duplicated region flanking the alleles extends 314 bp on one side and 1122 bp on the other side of each copy . Different partial copies of IS600 were identified 280 bp 3' to the stop codon of each allele . Partial and complete copies of other IS were also identified near the elt alleles . The data suggest that the regions surrounding the genes are hot spots for IS which would account for the observed heterogeneity in DNA flanking elt genes.

J Gen Microbiol, 1991 Jul, 137 ( Pt 7), 1737 - 42
Purification and some properties of carboxynorspermidine synthase participating in a novel biosynthetic pathway for norspermidine in Vibrio alginolyticus; Nakao H et al.; Carboxynorspermidine synthase, mediates the nicotinamide-nucleotide-linked reduction of the Schiff base H2N(CH2)3N = CHCH2CH(NH2)COOH . This is formed from L-aspartic beta-semialdehyde (ASA) and 1,3-diaminopropane (DAP) and is reduced to carboxynorspermidine {H2N(CH2)3NH(CH2)2CH(NH2)COOH}, an intermediate in the novel pathway for norspermidine (NSPD) biosynthesis . The enzyme was purified to apparent homogeneity from Vibrio alginolyticus and characterized . The overall purification was about 1800-fold over the crude extract, with a yield of 33% . The enzyme displayed an apparent Mr of 93500 +/- 1000 by gel filtration and 45100 +/- 500 by SDS-PAGE, indicating that the native form is probably composed of two subunits of similar size . The specific activity of the purified enzyme was 31.0 mumol carboxynorspermidine produced min-1 (mg protein)-1 . The enzyme was activated by dithiothreitol, and inhibited by SH-reactive compounds . The pH and temperature optima were 7.25-7.5 and 37 degrees C, respectively . The Km value for the Schiff base was 4.68 mM, measured by varying the ASA concentration while keeping the DAP concentration constant . Putrescine was slightly active as a substrate, forming carboxyspermidine (at about 7% of the rate of DAP), but ethylenediamine, cadaverine and D-ASA were inert . The Km value for NADPH was 1.51 mM . NADH was a much poorer cofactor than NADPH . When V . alginolyticus was grown in the presence of 5 mM-NSPD, the specific activity of this enzyme was reduced by approximately 70% . NSPD also repressed two other enzymes responsible for its biosynthesis, 2,4-diaminobutyrate decarboxylase and carboxynorspermidine decarboxylase.

Kansenshogaku Zasshi, 1991 Jul, 65(7), 833 - 7
{Molecular epidemiology of Vibrio cholerae O-1 from outbreak and sporadic patients in Nagoya in 1989}; Mori M et al.; Enterotoxigenic strains of Vibrio cholerae O-1 biotype eltor, isolated from three sporadic cases of cholera in Nagoya in 1989 and an outbreak of cholera in Nagoya in 1989 were analyzed for their similarities . All isolates of V . cholerae O-1 were indistinguishable in bacteriophage types, serovars, biovars and drug resistance patterns . Because the epidemiological investigation based on a primary structure of chromosomal DNA is more reliable, we isolated chromosomal DNA from these isolates and compared electrophoretic patterns of restriction endonuclease-digested DNA fragments . Furthermore, Southern hybridization of the cholera toxin gene was performed . Since no difference among six strains in these sporadic was observed, it was strongly suggested that both the independent cases and the outbreak of cholera were caused by the same strain.

Kansenshogaku Zasshi, 1991 Jul, 65(7), 788 - 93
{Cholera toxin producibility by Vibrio cholerae isolated during the cholera outbreak in the NTT Nagoya Hall}; Matsumoto M et al.; An outbreak of cholera occurred among guests of the NTT Nagoya Hall in September 1989 . Clinical findings showed that all but one were symptomatic infections out of 44 bacteriologically confirmed cases . In relation to the high incidence of symptomatic infections, we examined cholera toxin (CT) producibility of the isolated V . cholerae . 1 . Strains of the NTT case produced 16-256 (mean 130) ng of CT per ml in CAYE-L medium at 30 degrees C and 32-256 (mean 142) ng of CT per ml by Polymyxin B treatment . But strains of past case produced 8-256 (mean 34), 8-128 (mean 44) ng of CT per ml, respectively . Strains of the NTT case produced a larger amount of CT than that of the past cases . 2 . Strains of the NTT case produced 512-4096 (mean 2100) ng of CT per ml in CAYE-L medium at 37 degrees C and 1024-2048 (mean 1600) ng of CT per ml by Polymyxin B treatment . But strains of the past case produced 8-64 (mean 25), 8-128 (mean 45) ng of CT per ml, respectively . Strains of the NTT case produced a larger an amount of CT than them of past case . We observed the same phenomenon in AKI medium at 37 degrees C . The yield of CT in CAYE-L medium was greater at 37 degrees C than 30 degrees C . 3 . Strains of NTT case grew faster than that of the past case in CAYE-L medium at 37 degrees C . But the growth rate was the same as both strains in AKI and CAYE media.(ABSTRACT TRUNCATED AT 250 WORDS)

Kansenshogaku Zasshi, 1991 Jul, 65(7), 781 - 7
{Studies on the enteropathogenic mechanism of non-O1 Vibrio cholerae . III . Production of enteroreactive toxins}; Gyobu Y et al.; Cholera toxin gene and production of enteroreactive toxins were examined in 134 strains of non-O1 V . cholerae . Results obtained were summarized as follows . Frequencies of cholera-toxin-gene-positive strains were 2/58 (3.4%) from human sources and 2/76 (2.6%) from fish and environment . While, frequencies of production of hemolysin, fluid accumulating factor (FAF) related with protease, fluid accumulating factor in the suckling mouse, NAG-rTDH, NAG-ST and Vero toxin were 100, 72, 31, 2, 0 and 0%, respectively, for 58 strains from human sources, and 100, 57, 24, 0, 1.3 and 0%, respectively, for 76 strains from fish and environment . Among the 31 strains used for the injection of viable cells to the ligated rabbit ileal loop, detection frequencies of these enteroreactive toxins in the accumulated fluids were 100% for hemolysin, 3.2% for both FAF and NAG-rTDH and 0% for cholera toxin, Vero toxin or NAG-ST . Hemolysin and the fluid accumulating factor in the suckling mouse seemed to be identical in most strains . These results suggest that cholera toxin, NAG-ST, NAG-rTDH and Vero toxin may not be very important in the enteropathogenic mechanism of a great majority of non-O1 V . cholerae strains, whereas hemolysin may play an important role in the enteropathogenicity.

J Clin Microbiol, 1991 Jul, 29(7), 1407 - 12
Production and characterization of monoclonal antibodies directed against the lipopolysaccharide of Francisella tularensis; Fulop MJ et al.; Two monoclonal antibodies (FT14 and FT2F11) directed against the lipopolysaccharide (LPS) of Francisella tularensis were produced for use in tests to detect the organism in environmental samples and clinical specimens . The specificity of the antibodies was determined by enzyme-linked immunosorbent assay (ELISA) and immunoblotting . Both antibodies detected LPS from F . tularensis by ELISA, but only one antibody, FT14, was serologically active in an immunoblot . Treatment of the LPS with detergents prior to ELISA eliminated its binding to FT2F11 but not FT14 . Qualitatively, both antibodies detected 10 different strains of F . tularensis by ELISA, but quantitatively, FT14 gave a detectable reaction with 10(3) organisms, whereas FT2F11 was able to detect only 10(5) organisms . FT14 did not cross-react with LPS from a range of other gram-negative species of bacteria, whereas FT2F11 cross-reacted against Vibrio cholerae LPS . Neither antibody showed cross-reactions when entire gram-negative organisms were used as antigens . In a competition ELISA, the two monoclonal antibodies were shown to compete for different epitopes . FT14 was strongly inhibited by purified O side chain from F . tularensis LPS, but FT2F11 was only weakly inhibited . It was inferred from those results that FT14 is directed against the O side chain and that FT2F11 is directed against the core.

Rev Argent Microbiol, 1991 Jul-Sep, 23(3), 160 - 5
{Bacterial flora of the digestive tract of specimens of Notothenia neglecta caught in Caleta Potter (South Shetland Archipelago, Antarctica)}; MacCormack WP et al.; A qualitative and quantitative study of the predominant heterotrophic bacterial flora in the stomach and intestine of the Antarctic fish Notothenia neglecta was carried out: 10 newly caught specimens (Potter cove, King George Island, South Shetland Islands) were analyzed . The cultures were made under aerobic and anaerobic conditions . The stomach flora showed variable results between samples which are probably related to the flora ingested with food . The gut flora was composed almost exclusively of Vibrio spp . These results are in agreement with those attributing to Vibrio the nature of indigenous flora of the intestine of marine teleosts and show that this flora had not changed, not even during the adaptation of these fish to the extreme Antarctic environmental conditions.

Trans R Soc Trop Med Hyg, 1991 Jul-Aug, 85(4), 544 - 7
Identification of Vibrio cholerae by enzyme electrophoresis; Salles CA et al.; Zymovar analysis of 260 strains of Vibrio cholerae plus 3 reference strains of V . mimicus, using 13 structural loci, led to the grouping of strains in 73 zymovars (strain or group of strains sharing the same alleles) . Effective separation of strains, distinction of V . cholerae strains from closely related V . mimicus and the detection of 2 vibrio strains, including one with two O1 serovars, in supposedly pure collection cultures, illustrate the potential of zymovar analysis in the identification of V . cholerae isolates . Two El Tor strains from USA, one CT+ and the other CT-, shared the same zymovar 71, while 127 typical El Tor strains belonged to zymovar 14.

Zh Mikrobiol Epidemiol Immunobiol, 1991 Jul, (7), 55 - 8
{The characteristics of the reactogenicity and immunological activity of a new cholera bivalent chemical vaccine based on the results of controlled trials}; Sumarokov AA et al.; The reactogenic properties and immunological potency of modified cholera chemical vaccine (choleragen-toxoid + O-antigens Inaba and Ogawa) were tested in 278 volunteers aged 18 years and over in comparison with those of a commercial batch of monovalent cholera vaccine (choleragen-toxoid + O-antigen Inaba) . The cholera vaccine, enriched with O-antigen Ogawa, was found to be safe; vaccination with this vaccine was not accompanied by the development of systemic and local reactions whose frequency and intensity met the requirements for the reactogenic properties of commercial cholera vaccine . The immunological potency of the bivalent vaccine with respect to strain Inaba was not inferior to that of the commercial vaccine; at the same time in persons immunized with the new preparation the titers of vibriocidal antibodies to strain of serovar Inaba were five-fold higher . The conclusion on the expediency of using cholera chemical vaccine enriched with O-antigen Ogawa was made.

Infect Immun, 1991 Jul, 59(7), 2508 - 12
Immunogenicity of Vibrio cholerae O1 toxin-coregulated pili in experimental and clinical cholera; Hall RH et al.; A functional tcpA gene, encoding the major subunit of toxin-coregulated pili (TCP), is necessary for Vibrio cholerae O1 Ogawa strain 395 to colonize the human intestine and confer protective immunity to virulent challenge . The immunogenicity of TCP and other antigens in experimental and naturally acquired cholera was determined . Seroconversion to cholera toxin (CT), whole cell preparations, and to Ogawa lipopolysaccharide but not to purified native TCP or to a TcpA mimiotope was found in volunteers . Local intestinal secretory immunoglobulin A from volunteers showed conversions to cholera toxin and lipopolysaccharide but not to TCP . Cholera patients in Indonesia showed a seroconversion rate to TCP of 3 of 6 and a seroconversion to a TcpA mimiotope of 1 of 6 . Volunteer and patient sera showed similar vibriocidal seroconversions when assayed against either TCP-positive and TCP-negative V . cholerae O1 strains, suggesting that TCP do not contribute demonstrably to the vibriocidal antigen . We conclude that although seroconversion to TCP can occur in naturally acquired cholera, solid long-term protection can be engendered in the absence of a detectable anti-TCP immune response.

FEBS Lett, 1991 Jun 24, 284(2), 273 - 6
F0F1-ATPase from Vibrio alginolyticus . Subunit composition and proton pumping activity; Dmitriev OYu et al.; An F0F1-ATPase was isolated from the membranes of the marine bacterium Vibrio alginolyticus . Homology between the subunits of the F0-complexes from E . coli and V . alginolyticus was found using antibodies against subunits a, b and c of the E . coli F0F1-ATPase . The F0F1-complex from V . alginolyticus was reconstituted into proteoliposomes, which were competent in ATP-dependent proton uptake . This process was inhibited by triphenyltin, DCCD, and venturicidin . Na+ did not affect proton translocation.

Biochim Biophys Acta, 1991 Jun 19, 1084(1), 13 - 20
The cis/trans isomerization of the double bond of a fatty acid as a strategy for adaptation to changes in ambient temperature in the psychrophilic bacterium, Vibrio sp . strain ABE-1; Okuyama H et al.; The major phospholipid, phosphatidylethanolamine (PE), of Vibrio sp . strain ABE-1 contains a unique trans-unsaturated fatty acid, 9-trans-hexadecenoic acid (16:1(9t}, at the sn-2 position of the glycerol moiety . The major molecular species of PE that contain 16:1(9t) at the sn-2 position have either 9-cis-hexadecenoic acid (16:1(9c} or hexadecanoic acid (16:0) at the sn-1 position . The transition temperatures of the liquid-crystal to the gel phase of 16:1(9c)/16:1(9t)-PE and 16:0/16:1(9t)-PE were -3 degrees C and 38 degrees C, respectively, temperatures that were 31 degrees C and 18 degrees C higher than the corresponding temperatures for 16:1(9c)/16:1(9c)-PE and 16:0/16:1(9c)-PE . The proportion of 16:1(9c)/16:1(9t)-PE and 16:0/16:1(9t)-PE increased significantly in cells grown at 20 degrees C over that in cells grown at 5 degrees C . When cells grown at 5 degrees C were incubated at 20 degrees C in the presence of cerulenin, an inhibitor of the synthesis de novo of fatty acids, the level of 16:1(9t) increased almost in parallel with a concomitant decrease in the level of 16:1(9c) at the sn-2 position . These results suggest that 16:1(9c) is converted to 16:1(9t) by the cis/trans isomerization of the double bond in the fatty acid . This conversion is discussed as a possible strategy for adaptation by bacteria to changes in temperature.

Biochemistry, 1991 Jun 18, 30(24), 6070 - 4
Action of a microbial lipase/acyltransferase on phospholipid monolayers; Hilton S et al.; Vibrio species release a lipase which shares many properties with mammalian lecithin-cholesterol acyltransferase . We have studied the action of the enzyme on phospholipid monolayers . At similar surface pressures, reaction velocities were higher with monolayers of dilauroylphosphatidylcholine than with the corresponding phosphatidylglycerol or phosphatidylethanolamine . The dependence of reaction velocity on molecular density was very similar for phosphatidylcholine and phosphatidylethanolamine monolayers . Lag times were shortest with phosphatidylglycerol at low molecular densities, but maximum velocity was reached at considerably lower densities than with the other two lipids . We have found {Hilton, S., McCubbin, N . D., Kay, C., & Buckley, J.T . (1990) Biochemistry 29, 9072-9078} that nicking of the enzyme with trypsin or other proteases results in an increase in its activity against lipids in membranes . Here we show that trypsin treatment results in a large change in the surface activity of the lipase, allowing it to penetrate monolayers at pressures higher than 40 mN.m-1.

Proc Natl Acad Sci U S A, 1991 Jun 15, 88(12), 5403 - 7
Regulatory cascade controls virulence in Vibrio cholerae; DiRita VJ et al.; Expression of more than 17 virulence genes in Vibrio cholerae is under the coordinate control of the ToxR protein . ToxR is a transmembrane protein that binds to and activates the promoter of the operon encoding cholera toxin . As yet, the ability of ToxR to activate directly other genes in this regulon has not been demonstrated . We have cloned a gene called toxT from V . cholerae 569B; the toxT gene product, like ToxR, can activate the ctx promoter in Escherichia coli . In addition, expression of other genes identified as members of the ToxR regulon (tcpA, tcpI, aldA, and tagA) can be activated in E . coli by the toxT gene product but not by ToxR . When expressed from a constitutive promoter, the toxT gene product partially suppresses the ToxR- phenotype of a toxR deletion mutant of V . cholerae . The level of toxT mRNA is greatly reduced in a toxR mutant of V . cholerae . In addition, growth conditions under which the ToxR regulon is not expressed also repress the synthesis of toxT mRNA . These results suggest that ToxR controls transcription of toxT, whose product in turn is directly responsible for activation of several virulence genes under ToxR control.

Proc Natl Acad Sci U S A, 1991 Jun 15, 88(12), 5242 - 6
Vibrio cholerae produces a second enterotoxin, which affects intestinal tight junctions; Fasano A et al.; Attenuated Vibrio cholerae vaccine strains specifically mutated in genes encoding cholera toxin (CT) are still capable of causing mild to moderate diarrhea . Culture supernatants of V . cholerae strains, both CT-positive and CT-negative, were examined in Ussing chambers, and a toxin was found that increases the permeability of the small intestinal mucosa by affecting the structure of the intercellular tight junction, or zonula occludens . The activity of this toxin is reversible, heat-labile, sensitive to protease digestion, and found in culture supernatant fractions containing molecules between 10 and 30 kDa in size . Production of this factor (named ZOT for zonula occludens toxin) correlates with diarrheagenicity of V . cholerae strains in volunteers and may represent another virulence factor of infectious diarrhea that must be eliminated to achieve a safe and effective live oral vaccine against cholera.

J Bacteriol, 1991 Jun, 173(11), 3311 - 7
Cloning and nucleotide sequence of the Vibrio cholerae hemagglutinin/protease (HA/protease) gene and construction of an HA/protease-negative strain; Hase CC et al.; The structural gene hap for the extracellular hemagglutinin/protease (HA/protease) of Vibrio cholerae was cloned and sequenced . The cloned DNA fragment contained a 1,827-bp open reading frame potentially encoding a 609-amino-acid polypeptide . The deduced protein contains a putative signal sequence followed by a large propeptide . The extracellular HA/protease consists of 414 amino acids with a computed molecular weight of 46,700 . In the absence of protease inhibitors, this is processed to the 32-kDa form which is usually isolated . The deduced amino acid sequence of the mature HA/protease showed 61.5% identity with the Pseudomonas aeruginosa elastase . The cloned hap gene was inactivated and introduced into the chromosome of V . cholerae by recombination to construct the HA/protease-negative strain HAP-1 . The cloned fragment containing the hap gene was then shown to complement the mutant strain.

J Infect Dis, 1991 Jun, 163(6), 1235 - 42
Field trial of oral cholera vaccines in Bangladesh: serum vibriocidal and antitoxic antibodies as markers of the risk of cholera; Clemens JD et al.; The relationship of serum vibriocidal (VC) and IgG anti-cholera toxin (CT) antibodies to the risk of cholera was evaluated during the first year of follow-up of recipients of three oral doses of B subunit (BS)-whole-cell vaccine, whole-cell vaccine, or Escherichia coli K12 strain placebo in Bangladesh . Acute sera from 121 cholera patients were compared with sera from 2592 contemporaneous community controls . Each doubling of VC titer was associated, on average, with a 22%-47% reduction of cholera risk in the three groups . In contrast, in the two groups that did not receive BS, anti-CT titers were directly associated with cholera and thus served as markers of higher cholera risk . Each vaccine conferred approximately 65% protective efficacy against cholera, but antibody titers did not correlate with vaccine efficacy, indicating that serum VC and anti-CT antibodies are poor markers of the longitudinal pattern of vaccine efficacy.

Infect Immun, 1991 Jun, 59(6), 2186 - 8
Purification and characterization of a new heat-stable enterotoxin produced by Vibrio cholerae non-O1 serogroup Hakata; Arita M et al.; The possible production of a heat-stable enterotoxin (Vc-H-ST) by Vibrio cholerae non-O1 serogroup Hakata was investigated, and the purified Vc-H-ST was characterized . It has a unique amino acid sequence, LIDCCEICCNPACFGCLN . This sequence is quite similar to that of the heat-stable enterotoxin (NAG-ST) produced by V . cholerae non-O1 except for one amino acid (leucine) residue excess at the N terminus . Other characteristics, including biological activity, are compatible with those of NAG-ST.

Cell Immunol, 1991 Jun, 135(1), 184 - 94
Preferential reactivity of autoantibodies in murine lupus NZB mice to neuraminidase-treated monosialogangliosides on B cells of mouse spleen; Noguchi M et al.; When analyzed by flow cytometry, reactivity of IgM autoantibodies in sera from NZB mice to spleen B cells, but not to T cells, from BALB/c mice was remarkably increased after treatment of the cells with Vibrio cholerae neuraminidase . By TLC immunostaining with the antibodies, neither neutral nor acidic glycosphingolipids from both BALB/c and NZB mouse spleens were found to be reactive, but after neuraminidase treatment of the TLC plate, prior to the immunostaining, three components became reactive . All of the reactive glycosphingolipids were found to carry a single sialic acid residue and were at a concentration less than 1.3% of the total lipid-bound sialic acids . Their mobilities on TLC plate were close to those of IV3 NeuAcnLc4Cer, IV3 NeuAcII3 NeuAcGg4Cer, and IV3 NeuAcII3 NeuAc2Gg4Cer . In addition, the monosialogangliosides, which became reactive with the autoantibodies after neuraminidase treatment, were found to be predominantly distributed on B cells from BALB/c mice spleen, but not on T cells by TLC immunostaining . These studies demonstrate that the majority of IgM autoantibodies to spleen lymphocytes in sera from NZB mice might react preferentially to terminal sugar residues of three new glycosphingolipids masked by a single sialic acid on B cells, but not on T cells.

Zentralbl Bakteriol, 1991 Jun, 275(2), 256 - 63
Toxin production by atypical strains of Vibrio cholerae E1 Tor under different cultural conditions; Chakrabarti MK et al.; It was observed that at 37 degrees C under in vitro conditions, aerobic culture filtrates of a few strains of Vibrio cholerae biotype El Tor isolated from diarrhoeal cases produced a minute amount of toxin which failed to elicit a positive ileal loop reaction like toxigenic strains . Thus, these strains showed an atypical behaviour in their toxin producing ability . At 25 degrees C and 30 degrees C under aerobic cultural conditions enhanced toxin production was noticed in toxigenic strains, but these temperatures did not affect the toxigenicity of the atypical strains . The atypical Vibrio cholerae El Tor strains exhibited enhanced toxin production only at 37 degrees C under anaerobic conditions and the amount of toxin produced was akin to those of the toxigenic strains . In comparison to aerobic conditions, growth was observed to be comparatively lower under anaerobiosis both in the toxigenic and atpyical V . cholerae strains . Moreover, in contrast to the toxigenic strains, the toxin did not remain membrane-bound in these atypical strains at 37 degrees C and aerobic cultural conditions.

Kansenshogaku Zasshi, 1991 Jun, 65(6), 665 - 71
{Studies on the enteropathogenic mechanism of non-O1 Vibrio cholerae . II . Lethality, adhesion, colonization and cytopathogenicity of enteropathogenic strains}; Gyobu Y et al.; Lethality, adhesion, colonization, hemagglutinable activity, invasiveness and cytopathogenicity of non-O1 V . cholerae were compared between enteropathogenic and non-enteropathogenic strains . The following results were obtained . 1) Minimum lethal doses (MLD) of enteropathogenic strains were significantly lower than those of non-enteropathogenic strains . 2) There were no differences in adhesive and hemagglutinating activities between enteropathogenic and non-enteropathogenic strains . 3) A greater majority of enteropathogenic strains showed cytopathogenic effect on HEp 2 cells, but non-enteropathogenic strains did not . 4) Regardless of enteropathogenicity of viable cells, none of the 13 strains examined were found to be invasive to HEp 2 cells . These results suggest that adhesion and colonization do not draw a clear distinction between enteropathogenic and non-enteropathogenic strains, and that both lethal and cytopathogenic activities of these organisms are correlated with enteropathogenicity.

Zh Mikrobiol Epidemiol Immunobiol, 1991 Jun, (6), 37 - 40
{The 7th cholera pandemic in the world and the USSR}; Narkevich MI et al.; 1,713,057 cases of cholera were registered in the world during the seventh pandemic of the disease at the period of 1961-1989 . The pandemic still continues, being the most prolonged pandemic in comparison with earlier ones . During the period of the seventh pandemic 10,723 cases of cholera were registered in the USSR . Great outbreaks occurred in 1965 and 1970-1974 . At present sporadic cases of cholera can be registered, and wide circulation of mainly avirulent, nontoxigenic strains of cholera vibrios in environmental objects is characteristic of the epidemic situation.

Zh Mikrobiol Epidemiol Immunobiol, 1991 Jun, (6), 25 - 9
{The genomic fingerprinting of the causative agents of sapronoses}; Shaginian IA et al.; The genome polymorphism of the causative agents of sapronoses (Vibrio cholerae, Legionella and Leptospira) has been studied . The use of the method of genome fingerprinting {correction of dactyloscopy} has been shown to permit the differentiation of closely related strains of such causative agents . The epidemically significant strains of the causative agents of sapronoses, isolated in different geographical regions, have been found to be genotypically related, i.e., they are probably of clonal origin . Avirulent and nontoxigenic strains are genotypically heterogeneous and differ both from one another and from epidemically significant strains . Using V . cholerae as an example, the hypothesis of the appearance of potentially dangerous variants at the epidemic period in the absence of their release at the period between epidemics is considered.

Cent Afr J Med, 1991 Jun, 37(6), 186 - 9
Serotype variation in vibrio cholerae el tor diarrhoea in northern Nigeria; Onyemelukwe GC et al.; Serotyping of Vibrio cholerae organisms causing epidemics in Zaria and environs since 1975 to 1986 shows that Hikojima serotype was prevalent from 1976-1978, but Ogawa became prevalent from 1984 till 1986 . The internal and external pressures responsible for these selections are unclear.

Gene, 1991 May 15, 101(1), 45 - 50
Nucleotide sequence and analysis of the Vibrio alginolyticus scr repressor-encoding gene (scrR); Blatch GL et al.; The nucleotide sequence of the Vibrio alginolyticus scr repressor-encoding gene (scrR) was determined . The deduced amino acid sequence of the scr repressor was homologous with the gal, lac and cyt repressors of Escherichia coli and contained a helix-turn-helix DNA binding domain . Although the scrR gene encoded a protein which was required for the regulation of the V . alginolyticus sucrose utilization system, a particular deletion in the scrR gene could not be complemented in trans . The lack of complementation was discussed in terms of the possible involvement of a cis regulatory element or interference by the truncated scr repressor.

Experientia, 1991 May 15, 47(5), 429 - 31
The phenomenon of toxin secretion by vibrios and aeromonads; Hirst TR et al.; Vibrio and Aeromonas species have a remarkable ability to secrete extracellular proteins, including toxins, haemagglutinins and other virulence factors . Here we discuss the pathways and potential mechanisms of toxin secretion through the double-membraned envelopes which surround these organisms.

FEMS Microbiol Lett, 1991 May 15, 64(2-3), 259 - 63
Analysis of the gene of Vibrio hollisae encoding the hemolysin similar to the thermostable direct hemolysin of Vibrio parahaemolyticus; Yamasaki S et al.; The gene (designated as Vh-tdh) of Vibrio hollisae 9041 encoding a hemolysin similar to the thermostable direct hemolysin (TDH) of V . parahaemolyticus contained a 567-base-pair open reading frame (ORF), which was 93.3-93.5% homologous to those of the tdh genes of V . parahaemolyticus, V . cholerae non-01, and V . mimicus encoding TDH or similar hemolysins . Comparative analysis of the nucleotide sequence containing the Vh-tdh ORF with published nucleotide and amino acid sequences suggested that the Vh-tdh gene and other tdh genes diverged from a common ancestral gene, that the divergence was closely associated with the evolutionary divergence of V . hollisae from other species of genus Vibrio, and that strain-to-strain variation of the Vh-tdh gene exists in V . hollisae.

J Immunol, 1991 May 15, 146(10), 3550 - 6
GTP-binding proteins transduce signals generated via human FC gamma receptor IIIA (CD16); Procopio AD et al.; This study demonstrates that GTP-binding proteins regulate Fc gamma RIII-mediated signal transduction and inositol phosphate (IPn) generation in human NK cells . In addition the cross-linking of CD16 by mAb, guanosine 5'-o-3-thiophosphate induced 1,4,5 inositol trisphosphate (IP3) release in permeabilized NK cells and their membranes . By contrast, guanosine 5'-o-2-thiophosphate, almost completely inhibited IP3 generation induced by cross-linking with anti-CD16 mAb . Pretreatment of NK cells with 10 to 100 ng/ml Vibrio cholerae toxin (Ctx) almost completely inhibited the generation of IP3 and of other Ipn as well as Fc gamma RIII-operated cell functions such as antibody-dependent cell-mediated cytotoxicity against antibody-coated P815 mastocytoma cells . Isolated B subunit of Ctx was inactive . Bordetella pertussis toxin (0.1 to 1 microgram/ml) only marginally affected IP3 release and antibody-dependent cell-mediated cytotoxicity . Ctx increased cAMP levels in NK cells . However, inhibition of IP3 release preceded the rise of cAMP . Moreover, cAMP analogues (8-chlor-cAMP, 8-bromo-cAMP, dibutiryl-cAMP), as well as intracellular cAMP-enhancing agents (PGE1, PGE2, and forskolin) did not mimicked the effects of Ctx on IP3 generation, suggesting that the adenylate cyclase pathway is not responsible for the early effects of Ctx on Fc gamma RIII-mediated signalling . Overall these results demonstrate that signal transduction via Fc gamma RIII is mediated by Ctx-sensitive cellular membrane GTP-binding protein.

Lancet, 1991 May 11, 337(8750), 1125 - 7
Survival of classic cholera in Bangladesh; Siddique AK et al.; During the present cholera pandemic the El Tor biotype of Vibrio cholerae has completely displaced the classic biotype, except in Bangladesh . We studied the distribution of these two biotypes in twenty-four rural districts during epidemics in 1988-89; there was clustering of the classic biotype in the southern region and of the El Tor biotype in all other regions . These findings suggest that the southern coastal region is now (and may always have been) the habitat of classic cholera . The selective distribution of V cholerae O1 biotypes in Bangladesh may have been affected by ecological changes occurring in the countryPIP: Researchers from the International Center for Diarrheal Disease Research, Bangladesh in Dhaka took rectal swabs from 2386 patients with suspected cholera between September 1988-October 1989 . They identified V . cholerae 01 in 951 (40%) cases and it was the most common enteric pathogen in the study . 71% of these were the Inaba serotype . El Tor biotype predominated (81% of the cases) with the Inaba serotype accounting for 86% of these cases . Classic cholera made up the remaining cases (18%) with the Ogawa serotype accounting for 98% . The difference in serotypes between classic cholera and the El Tor biotype was significant (p.001) . 1984-1987 data revealed that the Ogawa serotype made up 96% and 83% of the classic and El Tor biotypes respectively . In the 7 southern districts of Bangladesh, classic cholera predominated (79%) . On the other hand, almost all cases (99%) were El Tor biotype in the 17 northern and middle belt districts . A highly significant difference in distribution of the 2 isolates occurred (p.001) . Even when the researchers included 1984-1987 data, the distribution pattern remained the same . Almost all classic biotypes in the southern region were resistant to tetracycline and the El Tor biotypes were sensitive to it . Previous reports claimed that the classic biotype disappeared from Bangladesh between 1973-1979, yet they only included data from the Matlab and Dhaka treatment centers . in 1982, researchers included samples from the south and found classic cholera . This study suggests that it had always been in the south . The researchers hypothesized that the coexistence of the 2 V . cholerae biotypes may be due to ecological changes including flooding, soil erosion, and construction of barrages and dams especially in the northeastern and middle belt regions .

Chem Pharm Bull (Tokyo), 1991 May, 39(5), 1325 - 7
Formycin A resistant mutants due to defect in adenosine transport system in Vibrio parahaemolyticus; Sakai-Tomita Y et al.; An antibiotic formycin A inhibited growth of Vibrio parahaemolyticus under certain conditions, which suggested that formycin A was taken up by cells under these conditions . We found that formycin A was transported via the adenosine transport system which we previously reported as a Na(+)-coupled cotransport system . We isolated many formycin A resistant mutants, and about half of them grew very poorly on adenosine as a sole source of carbon . Judging from their reversion frequencies, these mutants seemed to have single mutations . Respiration driven uptake of 14C-adenosine was not observed in such mutants; also, Na+ uptake induced by the addition of adenosine or formycin A to a cell suspension was completely abolished in them . Thus we conclude that these mutants possess a defect in the Na+/adenosine cotransport system, and have become formycin A resistant.

J Bacteriol, 1991 May, 173(9), 3000 - 9
Cloning and characterization of the Pseudomonas aeruginosa lasR gene, a transcriptional activator of elastase expression; Gambello MJ et al.; We report the discovery of the lasR gene, which positively regulates elastase expression in Pseudomonas aeruginosa PAO1 . The lasR gene was cloned by its ability to restore a positive elastase phenotype in strain PA103, a strain which possesses the elastase structural gene (lasB) but fails to synthesize the enzyme . Nucleotide sequence analysis revealed an open reading frame of 716 nucleotides encoding a protein of approximately 27 kDa . A labeled LasR protein of 27 kDa was detected in Escherichia coli by using a T7 RNA polymerase expression system . A chromosomal deletion mutant of the lasR gene was constructed in PAO1 by gene replacement . This mutant (PAO-R1) is devoid of elastolytic activity and elastase antigen . The deduced amino acid sequence of LasR is 27% homologous to the positive activator LuxR of Vibrio fischeri and the suspected activator 28K-UvrC of E . coli . Northern (RNA) analysis of total cellular RNA from PAO1, PAO-R1, and PAO-R1 containing the lasR gene on a multicopy plasmid (pMG1.7) revealed that a functional lasR gene is required for transcription of the elastase structural gene (lasB).

J Bacteriol, 1991 May, 173(9), 2842 - 51
Expression of the Vibrio cholerae gene encoding aldehyde dehydrogenase is under control of ToxR, the cholera toxin transcriptional activator; Parsot C et al.; The toxR gene of Vibrio cholerae encodes a transcriptional activator required for the expression of the cholera toxin genes (ctxAB) and more than 15 other genes encoding secreted or membrane proteins . The latter group includes virulence genes involved in the biogenesis of the TCP pilus, the accessory colonization factor, and such ToxR-activated genes as tagA, mutations in which cause no detectable virulence defect in the suckling mouse model . To analyze the regulation of expression and the structure of tagA, we have cloned and sequenced about 2 kb of DNA upstream from a tagA::TnphoA fusion . While the portion of the tagA gene product examined presented no extensive similarity to any known protein, the amino acid sequence deduced from an open reading frame (designated aldA) located upstream from and in opposite orientation to tagA was highly similar to the sequences of eukaryotic aldehyde dehydrogenases . An assay of aldehyde dehydrogenase activity in extracts of a wild-type V . cholerae strainand an aldA mutant confirmed that aldA encodes an aldehyde dehydrogenase . Expression of the aldA gene was studied together with that of tagA in both V . cholerae and Escherichia coli . The expression of both tagA and aldA was environmentally regulated and dependent on a functional toxR gene in V . cholerae, but neither promoter was activated by ToxR in E . coli, suggesting that expression of tagA and aldA requires an additional transcriptional activator besides ToxR . The aldA gene is the first example of a gene encoding a cytoplasmic protein that is under the control of ToxR, and this suggests that metabolic enzymes may constitute novel members of virulence regulons in bacteria.

Kansenshogaku Zasshi, 1991 May, 65(5), 531 - 6
{Studies on the enteropathogenic mechanism of non-O1 Vibrio cholerae . I . Enteropathogenicity of clinical and environmental isolates}; Gyobu Y et al.; Enteropathogenicity and plasmid DNA of clinical and environmental isolates of non-O1 V . cholerae were examined . Results were as follows: 1) . The frequencies of enteropathogenic strains judged by the results from both ligated rabbit ileal loop (RIL) and suckling mouse tests were 36/38 (95%) for isolates from overseas travellers, 15/15 (100%) for isolates from food poisoning, 33/44 (75%) for isolates from fish and sea water, and 1/10 (10%) for isolates from river water . 2) . Plasmid DNA was detected in eight of the 40 isolates examined, but the presence of plasmid did not correlate with enteropathogenicity . These results indicate that approximately three fourths of the strains isolated from fish and sea water are enteropathogenic, and that the genes controlling the enteropathogenicity of this organism probably exist in chromosomal DNA.

FEMS Microbiol Lett, 1991 May 1, 64(1), 23 - 7
Detection of heat-stable enterotoxin in a cholera toxin gene-positive strain of Vibrio cholerae O1; Takeda T et al.; DNA colony hybridization with a polynucleotide clonal DNA probe for heat-stable enterotoxin of Vibrio cholerae non-O1 (NAG-ST) was used to screen 197 isolates of V . cholerae O1 . Under stringent hybridizing and washing conditions, one strain (GP156) reacted with the probe . The concentrated supernatant from V . cholerae O1 GP156, heated at 100 degrees C for 5 min, elicited fluid accumulation in the suckling mice and that could be completely neutralized by an anti-NAG-ST monoclonal antibody (mAb2F) . The preparation from V . cholerae O1 GP156 also inhibited the binding of mAb2F to NAG-ST in a competitive ELISA . V . cholerae O1 GP156 was confirmed to possess a gene encoding cholera toxin (CT) . These results indicate that a heat-stable enterotoxin is produced by certain strains of CT-producing V . cholerae O1.

Appl Environ Microbiol, 1991 May, 57(5), 1286 - 93
Detection of luciferase gene sequence in nonluminescent Vibrio cholerae by colony hybridization and polymerase chain reaction; Palmer LM et al.; Bioluminescence is a trait observed among approximately 10% of Vibrio cholerae isolates . We have demonstrated that not only do some strains of V . cholerae produce low levels of light, undetectable by the human eye, but the luciferase gene sequence is present in strains of V . cholerae which emit no detectable light, evidenced by hybridization with a luciferase DNA probe . Comparisons of the amino acid sequences of luciferase enzymes of marine species have shown that these proteins have diverged to the point where they have only short regions of amino acid identity . The polymerase chain reaction method of DNA amplification with oligonucleotide primers based on these regions was used to isolate a region of the luxA gene from both luminescent and nonluminescent V . cholerae strains . The nucleotide sequence of this region was determined and reveals that nonluminescent V . cholerae have 99.7% nucleotide sequence similarity in this region with the luminescent biovar V . cholerae bv . albensis as well as significant similarity to other species of bioluminescent bacteria, a finding that is in accord with the hypothesis that these species have a common luminescent ancestor, most probably from the marine environment.

J Clin Microbiol, 1991 May, 29(5), 1058 - 9
Restriction fragment length polymorphism analysis of Vibrio cholerae strains associated with a cholera outbreak in Hong Kong; Yam WC et al.; We studied Vibrio cholerae El Tor isolates associated with an outbreak of cholera among Vietnamese refugees interned in Hong Kong . The restriction fragment length polymorphism of the enterotoxin gene was used as an epidemiological marker . All outbreak strains were indistinguishable . They were distinct from strains isolated in Hong Kong prior to the outbreak.

Mol Gen Mikrobiol Virusol, 1991 May, (5), 15 - 9
{Use of transposons for studying the genetic organization of Vibrio cholerae non 01}; Zhuravleva EA et al.; The nonagglutinating vibrions having Tn-elements inserted into the chromosome were obtained as a result of conjugal transfer of vector plasmids carrying the different transposons (Tn9, Tn10, Tn601, Tn5-Mob) and of the consequent isolation of plasmid-free clones of Vibrio cholerae non OI . Identification of auxotrophic mutations induced by the transposons inserted into the bacterial genome made possible the construction of the primary chromosomal map of Vibrio cholerae non OI . The efficient donor strains of Vibrio cholerae non OI were constructed by introducing the transposon Tn5-Mob and the helper plasmid RP-4 . The donors are capable of oriented conjugal transfer of chromosome.

FEMS Microbiol Lett, 1991 Apr 15, 63(2-3), 297 - 301
Protein turnover in exponential and stationary phase Vibrio cells; Car NB et al.; Vibrio strain 14 supports phage alpha 3a growth in standing stationary phase cells but not in shaking (aerated) stationary phase cells . In exponential cells, protein was turned over at 1.8% h-1, and the rate was increased by starvation or inhibition of protein synthesis . In shaking stationary phase cells the rate of protein turnover was low (1.0% h-1) for proteins synthesised during growth but high (20% h-1) for recently synthesised proteins . In contrast recently synthesised proteins in standing stationary phase cells were stable over 60 min and proteins synthesised during growth were turned over at 2.9% h-1 . ppGpp and pppGpp were detected in exponential cells, but were not detected in stationary phase cells.

FEMS Microbiol Lett, 1991 Apr 15, 63(2-3), 179 - 85
A method for studies of an El Tor-associated antigen of Vibrio cholerae O1; Svennerholm AM et al.; A method for studying the biotype El Tor associated mannose-sensitive haemagglutinin (MSHA) of V . cholerae O1 has been developed . By using crude MSHA adsorbed to chicken erythrocytes as solid phase antigen in an enzyme-linked immunosorbent assay (ELISA), antisera against V . cholerae of the El Tor biotype reacted in high titre with the MSHA-coated cells, whereas antisera against vibrios of the classical biotype did not bind significantly, i.e . in higher titre than pre-immune sera . The binding of anti-MSHA serum, or a monoclonal antibody against MSHA, to the MSHA-coated erythrocytes could be efficiently inhibited by crude MSHA as well as by El Tor vibrios whereas neither V . cholerae lipopolysaccharide nor different strains of classical vibrios had any inhibitory effect . These results support the existence of an El Tor-associated immunogen . They also suggest a possibility of determining antibodies against different haemagglutinins in ELISA without having access to purified antigens.

Lancet, 1991 Apr 13, 337(8746), 883 - 4
Biotype as determinant of natural immunising effect of cholera; Clemens JD et al.; To test the hypothesis that clinical Vibrio cholerae O1 infections protect against recurrent cholera, treated cholera episodes in a rural Bangladesh population of 188,153 people who were followed between 1985 and 1988 were analysed . Of the 2214 people with initial episodes of cholera, 7 had a second episode . The incidence of cholera was 61% lower in subjects who had had an earlier episode than in those without such an episode . Whereas initial episodes of classical cholera were associated with complete protection against subsequent cholera, initial episodes of El Tor cholera were associated with negligible protection.

Biochemistry, 1991 Apr 9, 30(14), 3432 - 6
Purification and characterization of a secreted protease from the pathogenic marine bacterium Vibrio anguillarum; Farrell DH et al.; Vibrio anguillarum is a pathogenic marine bacterium which causes the disease vibriosis in salmonid fish, which is characterized by a fatal hemorrhagic septicemia accompanied by massive tissue destruction . In this paper, the purification of the major caseinolytic extracellular protease from V . anguillarum is presented . The purification steps include ammonium sulfate precipitation, DEAE-Sepharose chromatography, Sephacryl S-200 chromatography, and DEAE high-pressure liquid chromatography . The purified protease migrates with Mr = 38,000 upon sodium dodecyl sulfate-polyacrylamide gel electrophoresis . A slightly larger protease of Mr 40,000 is also separated by this procedure, but accounts for only a minor fraction of the caseinolytic activity . The Mr 38,000 protease displays a broad pH activity profile in the neutral to basic range . It is not inhibited by serine, cysteine, or acid protease inhibitors, but is inhibited by EDTA and 1,10-phenanthroline, suggesting that it is a metalloprotease . The activity of the EDTA-inactivated protease could be partially restored by the addition of Ca2+ and Zn2+ together . The molecular weight and inhibition data show some similarities with proteases isolated from other Vibrio species such as Vibrio cholerae and Vibrio vulnificus.

Appl Environ Microbiol, 1991 Apr, 57(4), 1235 - 40
Enzyme immunoassay for identification of Vibrio vulnificus in seawater, sediment, and oysters; Tamplin ML et al.; Historically, methods used to identify Vibrio vulnificus in environmental samples have been inadequate because isolation and identification procedures are time-consuming and fail to separate V . vulnificus from other bacterial species . We describe an enzyme immunoassay (EIA) and culture techniques which identified V . vulnificus in seawater, sediment, and oysters . The EIA used monoclonal antibody FRBT37 to a species-specific epitope of V . vulnificus . No cross-reactions were observed among 72 non-V . vulnificus strains comprising 34 species and 15 genera . In field trials, the EIA identified correctly 99.7% of 348 biochemically confirmed V . vulnificus isolates . The epitope corresponding to FRBT37 was found in cells lysed by Triton X-100, deionized H2O, and ultrasonication but was not found in culture supernatants, indicating that its location was intracellular . In addition, electron micrographs of V . vulnificus labeled with FRBT37-biotin-avidin-gold showed that epitope FRBT37 reacted with fragments of lysed cells but not whole cells . FRBT37 was expressed when V . vulnificus was cultured in different growth media . The minimum level of detection of the EIA was approximately 2,000 V . vulnificus cells per EIA well . Epitope FRBT37 was labile at 70 degrees C for 30 min . Immunoblot and EIA plate formats reduced assay time and facilitated handling large numbers of test samples.

Mol Gen Genet, 1991 Apr, 226(1-2), 41 - 8
PCR based gene engineering of the Vibrio harveyi lux operon and the Escherichia coli trp operon provides for biochemically functional native and fused gene products; Hill PJ et al.; The polymerase chain reaction (PCR) was applied to clone the luxA and luxB genes from Vibrio harveyi, and the trp poL (promoter operator leader) region and the trpB and trpA genes from Escherichia coli . PCR-derived luxA/B and trpB/A genes were shown to express bacterial luciferase and tryptophan synthase respectively, when introduced into E . coli on a plasmid cloning vehicle . The trp poL was used successfully to control the expression of lac alpha, luxAB, trpB and trpA . PCR was also used to construct a functional luxAB translational fusion protein . Primers for this were designed to facilitate precise gene fusion and to provide a silent mutation within an EcoRI site in the luxB gene . Production of functional genes was verified in vitro and in vivo using polyacrylamide gel electrophoresis (PAGE) analysis of transcription-translation products and crude cell extracts, and by monitoring enzyme activity.

Can J Microbiol, 1991 Apr, 37(4), 265 - 9
X-ray inactivation, Weigle reactivation, and Weigle mutagenesis of the lysogenic Vibrio kappa phage; Bhattacharyya SC et al.; Vibrio cholerae lysogenic kappa phage was inactivated by X-ray (60 kV) in a dose-dependent manner, the inactivation dose leading to 37% survival (D37) in phosphate-buffered saline (PBS), pH 7.4, being 0.36 kGy . The phages were significantly protected against X-ray irradiation when histidine or cysteine or both were present in PBS or when phages were irradiated in nutrient broth . Maximum protection was offered when both histidine (10.0 mM) and cysteine (10.0 mM) were present in PBS (dose enhancement factor being 4.17) . The X-irradiated kappa phages also underwent a small but significant Weigle reactivation and also Weigle mutagenesis in the UV-irradiated V . cholerae host H218Smr . The Weigle factor or the frequency of clear-plaque mutants increased with increasing UV dose, attained a maximum at a UV dose of 2.4 J m-2, and thereafter decreased gradually with a further increase of the UV dose . The X-ray dose (D)--survival (S) curves could be empirically described by the equation S = exp{-(aD + bD2)}, where a and b are constants depending on the irradiation conditions, and a good agreement between the theoretical curves and experimental data was obtained.

J Biochem (Tokyo), 1991 Apr, 109(4), 616 - 21
Fluorescence quenching studies on the characterization of energy generated at the NADH:quinone oxidoreductase and quinol oxidase segments of marine bacteria; Kim YJ et al.; Generation of membrane potential (inside-positive) and delta pH (inside-acidic) at two kinds of NADH:quinone oxidoreductase segments, the Na(+)-motive segment and another segment, of Vibrio alginolyticus was examined by monitoring the quenching of fluorescence of oxonol V and that of quinacrine, respectively, with inside-out membrane vesicles . Transient generation of membrane potential at the segment occurred when ubiquinone-1 was added in the presence of KCN and NADH . The membrane potential was resistant to a proton conductor, carbonylcyanide m-chlorophenylhydrazone, indicating that the membrane potential was generated specifically at the Na(+)-motive segment . On the other hand, neither membrane potential nor delta pH was generated at another segment . The Na(+)-motive segment did not generate delta pH, indicating that only Na+ is extruded at this segment . Furthermore, generation of membrane potential and delta pH at the NADH:quinone oxidoreductase segment of V . anguillarum was examined by using the fluorescence quenching technique . This segment of the bacterium was also found to generate delta psi by the extrusion of Na+ but not H+ . These results revealed that the fluorescence quenching technique is useful for the rapid identification and characterization of the respiratory segment involved in Na+ translocation.

Vet Q, 1991 Apr, 13(2), 114 - 8
Toxigenic Vibrio cholerae non-O:1 isolated from a goat in The Netherlands; Visser IJ et al.; A case of enterotoxicosis in a goat at necropsy is described . The animal had died without clinical signs . Toxigenic Vibrio cholerae non-O:1 was isolated from the intestines . This species has not been reported earlier from healthy or diseased farm animals, such as goats, in the Netherlands.

J Gen Microbiol, 1991 Apr, 137 ( Pt 4), 817 - 26
The effect of temperature shifts on protein synthesis by the psychrophilic bacterium Vibrio sp . strain ANT-300; Araki T; In the psychrophilic bacterium Vibrio sp . strain ANT-300, the temperature-related characteristics of protein synthesis in cells grown at 0 degrees C differed from those of cells grown at 13 degrees C . Cells grown at 0 degrees C and 13 degrees C transported amino acids at the same rates, dependent on the temperature at which rates were measured . The rates of protein synthesis in extracts of cells grown at 0 degrees C and at 13 degrees C differed, as a result of the changes in the properties of the soluble fraction involved in protein synthesis . Concurrently, levels of more than 24 polypeptides in the soluble fraction changed considerably . These results suggest that the difference in temperature dependence of protein synthesis in cells grown at various temperatures may be brought about by specific changes in the levels of a small number of polypeptides (less than 15% of the total number of proteins detected by silver-staining) in response to a change in temperature.

Int J Syst Bacteriol, 1991 Apr, 41(2), 290 - 4
Vibrio navarrensis sp . nov., a species from sewage; Urdaci MC et al.; A group of 11 strains, mostly isolated from sewage water in the Province of Navarra, Spain, were found to constitute a DNA relatedness group which is 2 to 39% related to 23 species of the genus Vibrio and 2 to 3% related to two Aeromonas species . Phenotypically, these strains have all of the properties that define the genus Vibrio . However, they differ from the previously described species by three or more properties . The strains are negative for arginine, ornithine, and lysine decarboxylase activities and the Voges-Proskauer test and are unable to utilize putrescine, gluconate, glucuronate, and histidine . They utilize and produce acid from sucrose and grow at 40 degrees C . All strains grow in the presence of 0.5% (wt/vol) NaCl, and seven strains grow weakly in peptone water lacking NaCl . The group of strains which we studied can also be differentiated from other Vibrio species by fatty acid content . The G+C ratio of the DNA is 45 to 47 mol% . The name Vibrio navarrensis sp . nov . is proposed for these strains; strain 1397-6 (= CIP 103381) is the type strain.

Zh Mikrobiol Epidemiol Immunobiol, 1991 Apr, (4), 29 - 30
{The characteristics of a cholera outbreak in Pushkino District, the Azerbaijan SSR}; Grizhebovskii GM et al.; The outbreak of cholera in the Pushkino District of the Azerbaijan SSR, caused by the penetration of Vibrio cholerae into the water of the irrigation system, is described . Altogether 2 cholera patients and 39 Vibrio carriers were detected . The etiological agent of this infection was V . cholerae eltor, serovar Ogawa, with typical phenotype characteristics . From all patients and 37 carriers virulent strains and from 2 carriers faintly virulent strains were isolated . In this outbreak family foci were clearly observed, but the transmission of infection through everyday contacts was practically of no importance . The foci with multiple cases were formed due to the action of one transmission factor: contaminated water.

J Vet Med Sci, 1991 Apr, 53(2), 297 - 300
In vitro attachment of Vibrio parahaemolyticus to hemocytes of two gastropod molluscs; Kumazawa NH et al.; Vibrio parahaemolyticus D-3 was observed to attach to hemocytes of a marine gastropod mollusc, Nerita albicilla, regardless of the presence of N . albicilla serum . The organism attached to hemocytes of an estuarine gastropod, Clithon retropictus, in the presence of C . retropictus serum while the attachment to the hemocytes was decreased significantly in the absence of the serum . These evidences suggest that N . albicilla hemocytes would facilitate the clearance of V . parahaemolyticus from the alimentary tract of the mollusc and that C . retropictus hemocytes would protect C . retropictus against the invasion of V . parahaemolyticus to hemocoel of the mollusc.

J Vet Med Sci, 1991 Apr, 53(2), 263 - 7
Ecological cycle of thermostable direct hemolysin-producing strains of Vibrio parahaemolyticus in a brackish-water area with special reference to molluscs and attached microalgae; Kumazawa NH et al.; Prevalences of thermostable direct hemolysin (TDH)-producing strains in communities of a gastropod mollusc . Clithon retropictus, and a bivalve mollusc, Corbicula japonica, and levels of the strains in attached microalgae and muddy sediments were investigated at a brackish-water area along Hashizu Creek and Togo Pond in Japan, V . parahaemolyticus was detected from attached microalgae at Hashizu Creek in summer months with the highest level of 1.4 x 10(5) cfu/g . Levels of the organism among 20 animals of C . retropictus and C . japonica at the area varied betwen non-detectable level and 10(3) per mollusc in summer months . TDH was detected from culture supernatants of 11-16% of strains isolated from the algae, sediments and C . japonica and 28% of those isolated from C . retropictus at Hashizu Creek . These evidences suggest that C . retropictus would get TDH-positive strains from the algae.

J Vet Med Sci, 1991 Apr, 53(2), 201 - 5
Attachment of Vibrio parahaemolyticus strains to estuarine algae; Kumazawa NH et al.; Attachment of Vibrio parahaemolyticus strains to estuarine microalgae was examined in artificial seawater by viable counts of the organism and direct counts of the bacterial cells after immunoperoxidase staining . Thermostable direct hemolysin (TDH)-producing and TDH-non-producing strains of V . parahaemolyticus were found to attach to five estuarine strains of Navicula (diatom alga) in similar levels . The level of the bacterial attachment depended on salinity and temperature of the water, in which the maximum attachment was observed in 15% artificial seawater at 25 degrees C, a typical condition of Hashizu estuary in Japan during summer months . The attachment was inhibited by pectinase digestion of the algal cells . These evidences confirmed the participation of the microalgae to the ecological cycle of V . parahaemolyticus at the estuary.

Rev Cubana Med Trop, 1991 Apr-Aug, 43(2), 107 - 10
{Identification of species of microorganisms of the genus Vibrio}; Bravo Farinas L et al.; During 1988, a study was made on 61 microorganisms, genus Vibrio, which were received at the National Reference Laboratory for Acute Diarrheic Diseases . Pedro Kouri Institute of Tropical Medicine . Of them, 46 were from children with acute diarrheic disease and 15 were isolated from the environment . By means of biochemical tests . 61 Vibrio cholerae No . 01 . 9 Vibrio parahaemolyticus and 1 Vibrio alginolyticus were identified . Emphasis is placed upon the importance of keeping a systematic surveillance upon these microorganisms in Cuba.

FEBS Lett, 1991 Mar 25, 280(2), 274 - 6
The effect of F0 inhibitors on the Vibrio alginolyticus membrane ATPase; Capozza G et al.; The inhibition of membrane ATPase from the marine alkalotolerant bacterium Vibrio alginolyticus by DCCD, triphenyltin and venturicidin was studied . DCCD proved to be an irreversible inhibitor, while venturicidin and triphenyltin produced a reversible inhibitory effect . The DCCD-binding proteolipid was identified in the membrane preparations . The effect of the inhibitors on ATPase activity and ATP-dependent Na(+)-transport in V . alginolyticus subcellular vesicles is discussed.

J Immunol Methods, 1991 Mar 21, 137(2), 199 - 207
Preparation of a genetically fused protein A/luciferase conjugate for use in bioluminescent immunoassays; Lindbladh C et al.; The genes encoding staphylococcal protein A and bacterial luciferase (Vibrio harveyi) were fused in-frame in order to obtain a general marker enzyme for bioluminescent immunoassays . Two constructs were made where protein A was ligated to the first and the 12th amino acid residue, respectively, of the N terminus of the beta subunit of luciferase . Only the first fusion protein encoding the entire beta subunit was able to form an enzymatically active luciferase complex when expressed together with the alpha subunit . The fusion of protein A to luciferase did not notably alter the emitted wavelength spectrum or its stability to urea treatment . The fusion protein was found to retain at least 50% of the specific bioluminescent activity compared to native luciferase . In preliminary tests, this hybrid protein was shown to be useful in bioluminescent immunoassays.

FEMS Microbiol Lett, 1991 Mar 15, 63(1), 105 - 10
Purification and characterization of a heat-stable enterotoxin of Vibrio mimicus; Arita M et al.; A heat-stable enterotoxin produced by Vibrio mimicus (VM-ST) was studied . VM-ST was purified from a culture supernatant of V . mimicus strain AQ-0915 by ammonium sulfate fractionation, hydroxyapatite treatment, ethanol extraction, column chromatography on both SP-Sephadex C-50 and DEAE-Sephadex A-25, and HPLC, and the recovery rate was about 15% . Purified VM-ST was heat-stable . VM-ST activity was cross-neutralized by anti-STh antiserum . The amino acid composition of the purified VM-ST was determined 17 amino acid residues in the following sequence: Ile-Asp-Cys-Cys-Glu-Ile-Cys-Cys-Asn-Pro-Ala-Cys-Phe-Gly-Cys-Leu-Asn . This composition and sequence were identical to those of V . cholerae non-O1-ST . These results clearly demonstrate the production of a characteristic VM-ST by V . mimicus.

Gene, 1991 Mar 15, 99(2), 255 - 9
Synthesis in Vibrio cholerae and secretion of hepatitis B virus antigens fused to Escherichia coli heat-labile enterotoxin subunit B; Schodel F et al.; A simple and effective electroporation method for the transformation of Vibrio cholerae with nonmobilizable plasmids is described . Expression plasmids directing the synthesis of fusion proteins with the subunit B of Escherichia coli heat-labile enterotoxin B (LT-B) were transformed into nontoxinogenic V . cholerae vaccine strains . A protein consisting of two overlapping immunodominant antibody-binding sites of the hepatitis B virus (HBV) middle surface antigen fused to the C terminus of full-length LT-B was secreted into the supernatant of V . cholerae cultures, whereas two other LT-B/HBV fusion proteins were mostly retained within the cells or rapidly degraded in the culture supernatant . While the secretion of fusion proteins with cholera toxin subunit B (CT-B) from V . cholerae has been described, this is to our knowledge the first report describing extracellular secretion of defined foreign epitopes fused to LT-B in V . cholerae . The fusion of guest epitopes to LT-B or CT-B and secretion in V . cholerae could be an interesting system to rapidly produce pure fusion proteins for immunisation, functional studies or diagnostic procedures . An LT-B/pre-S2 fusion protein purified from the supernatant of recombinant V . cholerae induced serum IgG antibodies against LT-B and against the HBV middle surface antigen in mice after parenteral and oral immunisation.

Biochem Biophys Res Commun, 1991 Mar 15, 175(2), 679 - 84
Identification of the genomic region determining serotype specificity of Vibrio cholerae 01; Ito T et al.; A 2.1-kb genomic region responsible for Ogawa serotype specificity of Vibrio cholerae 01 was identified by cosmid cloning and recombinant plasmid experiments . The plasmid carrying this region derived from Ogawa type Vibrio cholerae NIH 41 coded for a specific protein of 27 kD, and was found to convert serotype specificity from Inaba to Ogawa when co-introduced into the Escherichia coli cells harboring a cloned 20-kilobase genomic DNA fragment of Inaba type Vibrio cholerae 35A3.

Med Hypotheses, 1991 Mar, 34(3), 278 - 81
Cholera and cholera-like diarrhoeal diseases: why the differences in severity?
Abdulkadir SA.
Although Vibrio Cholera and several other enterotoxigenic bacteria such as the enterotoxigenic Escherichia coli produce secretory diarrhoea by exactly the same mechanism, cholera is much more severe . It is proposed that this difference in severity may be because while the alkaline diarrhoeal fluid produced in these conditions is optimal for the growth of Vibrio cholera, E . coli and other enterotoxigenic bacteria are inhibited.

J Am Acad Dermatol, 1991 Mar, 24(3), 397 - 403
Vibrio vulnificus septicemia in Korea: clinical and epidemiologic findings in seventy patients; Park SD et al.; We studied the clinical characteristics and the epidemiology of primary septicemia associated with Vibrio vulnificus in 70 patients . All patients came from the western and southern coastal areas of Korea . Most cases (96%) occurred during the summer months, in men (96%), and in persons 40 or more years of age (90%) . The illness of 46 patients (66%) began with septicemia, often within 2 days of the consumption of raw seafood . Forty-seven patients (67%) had preexisting hepatic disease, and 49 (70%) had a history of alcoholism . Of the 70 patients, 45 (79%) died . The cutaneous lesions that were present on admission in 64 patients (91%) appeared on the legs in 51 of the cases . V . vulnificus was isolated from the blood of 65 patients tested and from the skin lesions of 51 of 55 patients tested . The histopathologic findings differed according to the clinical stage of lesions . Because V . vulnificus septicemia is a highly fatal disease, persons with liver disease or alcoholism should avoid eating or handling raw seafood.

Salud Publica Mex, 1991 Mar-Apr, 33(2), 173 - 7
{The prevalence of Vibrio parahaemolyticus and its antibodies in seafood handlers in Mérida, Yucatán}; Franco Monsreal J et al.; We report the prevalence of Vibrio parahaemolyticus and of antibodies against Vibrio parahaemolyticus in the feces and serum of fish and seafood handlers in the city of Merida, Yucatan, Mexico . Between March 1 and August 31, 1989, we studied 81 feces samples and 81 serum samples from an equal number of handlers . Vibrio parahaemolyticus was not isolated in any of the feces studied . We found no statistically significant differences upon comparing our zero per cent isolation in feces samples with the highest percentages reported from available literature (3.85%): chi 2c = 0.36, p greater than 0.05 . In two serum samples, we detected Vibrio parahaemolyticus antibodies to the degree of 2.47 per cent . We found no statistically significant differences upon comparing our 2.47 per cent prevalence of serum antibodies with the 10 per cent prevalence reported in a study done by Molina Garcia, et al: chi 2c = 0.10, p greater than 0.05 . The estimation interval with a confidence level of 95.00 per cent for the percentage in the population of fish and seafood handlers with Vibrio parahaemolyticus antibodies is 0.94% less than or equal to p less than or equal to 4.00% . We conclude that either the asymptomatic carrier stage does not exist, or that it is of a very short duration . On the other hand, based upon our 2.47 per cent serum-positive prevalence, we conclude that there exists both contact with, and infection from, Vibrio parahaemolyticus in fish and seafood handlers.

FEMS Microbiol Lett, 1991 Mar 1, 62(2-3), 227 - 30
Production of monoclonal antibodies against a hemagglutinin/protease of Vibrio cholerae non-01; Honda T et al.; Two hybridoma cell lines producing monoclonal antibodies (MAbs) against a hemagglutinin/protease (HA/P) from Vibrio cholerae non-01 were produced and characterized . The two MAbs contained the kappa light chain and were IgG1 type . They similarly neutralized HA/P protease activity derived from both V . cholerae non-01 and V . cholerae 01, whereas they were unable to neutralize the hemagglutinating activity of HA/P, suggesting that the epitopes for protease and hemagglutination activities are different . Western blotting analysis and the cross-neutralization test with the two MAbs confirmed the identity of HA/P produced by V . cholerae non-01 and 01 . This study also suggests that HA/P of V . cholerae and a protease of V . parahaemolyticus are immunologically unrelated.

Appl Environ Microbiol, 1991 Mar, 57(3), 707 - 11
Polymerase chain reaction identification of Vibrio vulnificus in artificially contaminated oysters; Hill WE et al.; DNAs extracted from Vibrio vulnificus seeded into oyster homogenates were evaluated as templates for the polymerase chain reaction . Several extraction procedures were examined, and it was determined that DNA recovered from cells lysed by guanidine isothiocyanate, extracted with chloroform, and precipitated with ethanol was most suitable for use as a polymerase chain reaction template . The region targeted was a 519-bp portion of the cytotoxin-hemolysin gene of V . vulnificus . This region was amplified only when DNA from this species was present in the homogenate . V . vulnificus seeded into oyster homogenates at an initial level of 10(2) CFU/g of oyster meat was consistently observed after 24 h of incubation in alkaline peptone water.

J Clin Microbiol, 1991 Mar, 29(3), 560 - 4
Aeromonas jandaei (formerly genospecies DNA group 9 A . sobria), a new sucrose-negative species isolated from clinical specimens; Carnahan A et al.; A large numerical taxonomy study conducted in 1988 of 165 mostly clinical Aeromonas strains from diverse geographic sources produced a cluster (S = 84%, SSM) of four sucrose-negative strains that included the DNA definition strain for DNA group 9 A . sobria (CDC 0787-80) . These four strains, together with five additional strains received in 1989, were subjected to DNA-DNA hybridization (hydroxyapatite, 32P, 60 and 75 degrees C), and all eight strains were closely related to the ninth labeled DNA group 9 definition strain CDC 0787-80 (73 to 86% relatedness at 60 degrees C and 68 to 80% relatedness at 75 degrees C; percent divergence, 2.0 to 3.5) . Type strains and DNA definition strains for all other established Aeromonas species were only 35 to 72% related (60 degrees C) to CDC 0787-80 . We propose the name Aeromonas jandaei for this highly related group of nine strains, formerly known as DNA group 9 A . sobria . The type strain was designated ATCC 49568 (CDC 0787-80) . The nine strains were examined at 36 degrees C and were found to be resistant to 0/129 (vibriostatic agent) and uniformly positive for oxidase, gas production from glucose, indole, lysine decarboxylase, arginine dihydrolase, o-nitrophenyl-beta-D-galactopyranoside, motility (25 degrees C), nitrate reduction, citrate utilization, hemolysis on sheep blood agar, and growth in Trypticase soy broth with no added NaCl . They all fermented D-glucose, D-mannitol, and mannose but did not ferment sucrose, cellobiose, L-arabinose, inositol, salicin, or D-sorbitol . They were uniformly negative for esculin and urea hydrolysis, elastase production, ornithine decarboxylation, and the string test . The antibiogram of A . jandaei resembled that of other aeromonads (resistance to ampicillin and cephalothin), but it differed from most other aeromonads because of resistance to single dilution of colistin and differed from clinical A . veronii biogroup sorbria (formerly A . sobria) by its nearly uniform resistance to cephalothin . The esculin-, sucrose-, and cellobiose-negative and colistin-resistant profile distinguished A . jandaei from other Aeromonas species . These A . jandaei strains were isolated from blood (two strains), wounds (two strains), diarrheal stools (four strains), and a prawn (one strain) . The blood and wound isolates, in particular, suggest that there is a possible clinical significance for this species and justify identification of and further research on this group of motile aeromonads.

J Invertebr Pathol, 1991 Mar, 57(2), 184 - 90
Ozone depuration of Vibrio vulnificus from the southern quahog clam, Mercenaria campechiensis; Schneider KR et al.; Southern quahog clams, Mercenaria campechiensis, were dosed with Vibrio vulnificus and placed in a pilot-scale depuration system using ozonated recirculated artificial seawater . Twenty-four hours of treatment with ozone-treated recirculating artificial seawater reduced the numbers of V . vulnificus in the shellfish meats by an average of 2 log units when compared to natural die-off in control clams . The oxidant levels (up to 3 mg/liter) did not adversely affect shellfish pumping during the depuration process.

APMIS, 1991 Mar, 99(3), 249 - 56
Production and characterization of monoclonal antibodies to Vibrio cholerae soluble haemagglutinin; Wikstrom M et al.; Monoclonal antibodies (MAbs) against a protease of Vibrio cholerae, the soluble haemagglutinin (sHA), have been prepared and characterized with regard to their ability to inhibit different biological properties of sHA and to protect against experimental V . cholerae infection . Four fusion experiments yielded two specific immunoglobulin G1 MAbs that reacted with sHA produced by different V . cholerae O1 and non-O1 strains but that differed in their antigen-binding capacity . Both MAbs were capable of inhibiting the haemagglutinating and protease activities of sHA as well as its ability to nick the enterotoxin A subunit, but neither of them had any effect on the mucinase activity of sHA . One of the MAbs significantly inhibited experimental cholera infection induced by sHA-producing V . cholerae O1 in rabbit small intestine.

Proc Natl Acad Sci U S A, 1991 Mar 1, 88(5), 1991 - 5
Direct evidence that ganglioside is an integral component of the thyrotropin receptor; Kielczynski W et al.; Gangliosides were extracted from purified human and porcine thyrotropin (TSH) receptors (TSH-R) and were detected by probing with an 125I-labeled sialic acid-specific lectin, Limax flavus agglutinin . Gangliosides copurified with human and porcine TSH-R migrated between monosialoganglioside GM1 and disialoganglioside GD1a . Ceramide glycanase digestion of the purified human TSH-R-associated glycolipid confirmed its ganglioside nature . It was resistant to Vibrio cholerae sialidase, which digests all gangliosides except GM1, but was sensitive to Arthrobacter ureafaciens sialidase, which digests all gangliosides including GM1 . These findings indicate that the human TSH-R contains ganglioside that belongs to the galactosyl(beta 1----3)-N-acetylgalactosaminyl (beta 1----4)-{N-acetylneuraminyl(alpha 2----3)}galactosyl(beta 1----4) glucosyl(beta 1----1)ceramide (GM1) family . Its intimate association with receptor protein implies a key role for ganglioside in the structure and function of the TSH-R.

J Commun Dis, 1991 Mar, 23(1), 44 - 5
Persistence of Vibrio cholerae in inter epidemic period--preliminary observations on analysis of water; Rai RN et al.; Out of the 61 water samples collected from hand pumps and wells from cholera endemic areas of Varanasi City, Vibrio cholerae non 01 was detected in only one sample . However, seven (18.9 per cent) samples out of 37 samples of river water were positive for V . cholerae non 01 . None of the samples showed Vibrio cholerae . These observations indicate transmission and dilution of Vibrio cholerae bacillus in environment.

J Med Microbiol, 1991 Mar, 34(3), 167 - 73
Production and characterisation of monoclonal antibodies to outer-membrane-protein antigens of Vibrio cholerae O1; Kabir S; Monoclonal antibodies (MAbs) were raised against the major, 46-48-Kda outer-membrane proteins of Vibrio cholerae O1 . The hybridoma clones were screened by enzyme-linked immunosorbent assay (ELISA) with cell-surface proteins of V . cholerae O1 as the coating antigen . Four hybridomas, which secreted anti-V . cholerae cell-surface-protein antibodies, were subcloned by limiting dilution and obtained as ascites in vivo . A MAb of the IgG1 subclass was isolated in good yield from the murine ascites by affinity chromatography with recombinant protein G-Sepharose 4B . It gave positive reactions, as determined by ELISA, against cell-surface proteins prepared from both biotypes (classical and El Tor) and both serotypes (Ogawa and Inaba) of V . cholerae O1 . The MAb did not have any reactivity towards V . cholerae lipopolysaccharide preparations . Immunoblotting studies were performed on cell-surface proteins separated by one-dimensional sodium dodecyl sulphate-polyacrylamide gel electrophoresis (1D SDS-PAGE) and also by two-dimensional (2D) electrophoresis with iso-electric focusing in the first dimension followed by SDS-PAGE in the second dimension . When proteins were separated by 1D SDS-PAGE, only one band at 46-48 Kda reacted with the MAb . This protein appeared to consist of two narrowly-spaced and cross-reactive bands when a nitrocellulose blot, obtained by 2D SDS-PAGE, was exposed to the MAb.

Vopr Med Khim, 1991 Mar-Apr, 37(2), 17 - 9
{Characteristics of various physico-chemical properties of vibrion neuraminidase}; Lavrovskii SN et al.; Some physico-chemical properties of commercially available neuraminidase preparations from non-choleric vibrio were studied . The neuraminidase was shown to be weakly acid glycoprotein with molecular mass 90 +/- 5 kDa, sedimentation constant 5.37 S and pI 5.0 +/- 0.1 . As shown by roentgen-diffractometric technique the neuraminidase preparations possessed a quasi-crystalline structure . All the preparations studied were highly purified, exhibited electrophoretic homogeneity, did not contain any protein and Me+ contaminations.

Vopr Virusol, 1991 Mar-Apr, 36(2), 111 - 4
{The acceleration of experimental influenza B infection under the influence of gangliosides}; Danlybaeva GA et al.; The influence of mono-, di-, and trisialogangliosides on the dynamics of influenza B virus reproduction in human embryo fibroblast (HEF) cell culture and human diploid cells was established . The cells were treated with neuraminidase of non-cholera vibrio for removal of natural receptors followed by treatment with gangliosides . Virus reproduction was assessed by infectious titres for chick embryos and HA test of the culture fluid at certain intervals . Gangliosides restored influenza virus reception and enhanced the infectious process as compared with the controls . Treatment with gangliosides of HEF culture of low sensitivity increased its susceptibility to virus markedly.

Infect Immun, 1991 Mar, 59(3), 977 - 82
New model for analysis of mucosal immunity: intestinal secretion of specific monoclonal immunoglobulin A from hybridoma tumors protects against Vibrio cholerae infection; Winner L 3rd et al.; Secretory immunoglobulin A (sIgA) plays a role in defense against Vibrio cholerae and other microorganisms that infect mucosal surfaces, but it is not established whether sIgA alone can prevent disease . We report here a strategy for identifying the antigen specificities of monoclonal sIgA antibodies that are capable of providing such protection . IgA hybridomas were generated from Peyer's patch lymphocytes after oral immunization with V . cholerae Ogawa 395 . A clone was selected that produced dimeric monoclonal IgA antibodies directed against an Ogawa-specific lipopolysaccharide carbohydrate antigen exposed on the bacterial surface . Hybridoma cells were used to produce subcutaneous "backpack" tumors in syngeneic mice, resulting in secretion of monoclonal sIgA onto mucosal surfaces . Neonatal mice bearing anti-lipopolysaccharide hybridoma backpack tumors were specifically protected against oral challenge with 100 50% lethal doses of virulent Ogawa 395 organisms . Thus, the IgA hybridoma backpack tumor method identifies protective epitopes in the mucosal system and demonstrates that a single monoclonal sIgA can be sufficient to protect against intestinal disease.

Proc Natl Acad Sci U S A, 1991 Feb 15, 88(4), 1125 - 9
Positive transcriptional regulation of an iron-regulated virulence gene in Vibrio cholerae; Goldberg MB et al.; We have previously described a virulence gene in Vibrio cholerae (irgA) that is more than 850-fold regulated in response to iron . Negative regulation of irgA by iron occurred at the transcriptional level, and there was a dyad symmetric nucleotide sequence in the vicinity of the irgA promoter homologous to the Fur binding site in Escherichia coli . When irgA was cloned into E . coli, we showed that transcription of irgA required 900 base pairs of DNA upstream of the irgA promoter that contained an open reading frame in inverse orientation to irgA . In the present study, we show that this upstream region of DNA encodes a gene in inverse orientation to irgA (named irgB) that is also negatively regulated by iron . Insertional inactivation of irgB on the V . cholerae chromosome leads to loss of expression of a chromosomal irgA'-'phoA fusion (in which the primes indicate truncated genes), which is restored to normal by provision of irgB on a plasmid in trans . DNA sequencing of irgB shows that the protein product (IrgB) is homologous to the LysR family of positive transcriptional activators, and secondary structure analysis of IrgB predicts a helix-turn-helix DNA binding motif . The promoters of irgB and irgA are divergent but overlap each other and the previously defined Fur-binding site . We propose a model for iron regulation of irgA expression in V . cholerae . In the presence of sufficient iron, transcription of both irgA and irgB is negatively regulated by a Fur-like protein . In low iron conditions, negative regulation of transcription is removed, and production of IrgB leads to positive transcriptional activation of irgA . It seems likely that the high induction ratio of irgA expression under low- and high-iron conditions (850-fold) relates to the fact that its cognate positive transcriptional activator (irgB) is itself negatively regulated by iron.

Med J Aust, 1991 Feb 4, 154(3), 214 - 5
A case of Vibrio vulnificus septicaemia acquired in Victoria; Maxwell EL et al.; The clinical features and laboratory findings of a case of Vibrio vulnificus septicaemia are reported . The illness occurred in a previously well 68-year-old man who was accidentally spiked in the buttock by the dorsal spine of a flathead caught in Tamboon Inlet, near Mallacoota, Victoria . The clinical picture of an acute septicaemic illness with shock, associated with metastatic cellulitic lesions on the lower limbs progressing to bulla formation, skin necrosis, necrotising fasciitis and myositis, is characteristic of V . vulnificus septicaemia . It would appear that tetracyclines are the drugs of choice . Surgical debridement may be necessary . Clinical recognition of this rare but characteristic illness will facilitate early effective chemotherapy . To our knowledge this is the southern-most case reported in Australia.

Kansenshogaku Zasshi, 1991 Feb, 65(2), 193 - 9
{Surveys on the contamination of marine fish with non-O1 Vibrio cholerae and Vibrio mimicus and food poisoning cases by these organisms}; Kodama H et al.; The present paper describes the relationship between the contamination with non-O1 Vibrio cholerae and Vibrio mimicus of marine fish, with special reference to the seasonal variation and the concentration of contamination, and the actual cases of domestic food poisoning by these organisms . A 10 year survey revealed that non-O1 Vibrio cholerae (non-O1 V . cholerae) strains were frequently isolated from fish during the summer season with some variations from one year to another, and isolates from fish showed similar biological properties to those of isolates from diarrhea cases of over-sea travellers . Experimentally enteropathogenic strains were included among these isolates . Vibrio mimicus (V . mimicus) strains were also isolated from fish, the frequency being not so high as in the case of non-O1 V . cholerae Strains of serovar O-41 which was most predominant among strains from diarrhea cases were also detected among the isolates from fish . The viable cell counts, however, were very small with regard to both non-O1 V . cholerae and V . mimicus From these observations, factors causing food poisoning by non-O1 V . cholerae or V . mimicus seemed to be essentially similar to those by Vibrio parahaemolyticus (V . parahaemolyticus); that is, the food poisoning by non-O1 V . cholerae or V . mimicus is apt to occur in the summer season and is caused by the consumption of raw fish, although the frequency might be significantly low in comparison to that of V . parahaemolyticus . The actual cases of the domestic food poisoning by non-O1 V . cholerae or V . mimicus were retrospectively surveyed by the literature.(ABSTRACT TRUNCATED AT 250 WORDS)

J Appl Bacteriol, 1991 Feb, 70(2), 109 - 12
The protective activity of tea against infection by Vibrio cholerae O1; Toda M et al.; Extracts of black tea exhibited bactericidal activity against Vibrio cholerae O1 . The tea extract inhibited the haemolysin activity of V . cholerae O1, El Tor and the morphological changes of Chinese hamster ovary cells induced by cholera toxin . Tea extract also reduced fluid accumulation induced by cholera toxin in sealed adult mice and by V . cholerae O1 in ligated intestinal loops of rabbits . These findings suggest that tea has protective activity against V . cholerae O1.

J Gen Microbiol, 1991 Feb, 137 ( Pt 2), 253 - 9
Characterization of a new thermostable direct haemolysin produced by a Kanagawa-phenomenon-negative clinical isolate of Vibrio parahaemolyticus; Honda T et al.; The production of two haemolysins, thermostable direct haemolysin (Vp-TDH) and a Vp-TDH-related haemolysin (Vp-TRH), by clinical isolates of Vibrio parahaemolyticus has previously been reported . Here we describe a third type of haemolysin (named Vp-TDH/I), which is produced by a clinical isolate (strain TH012) that is Kanagawa phenomenon negative . Vp-TDH/I was purified by a series of column chromatographies on DEAE-Sephadex A25, hydroxyapatite, Sepharose 4B and Mono Q . By physicochemical, biological and immunological analyses, Vp-TDH/I was demonstrated to be similar, but not identical, to Vp-TDH and Vp-TRH . The gene encoding Vp-TDH/I was cloned and the deduced amino acid sequence of Vp-TDH/I confirmed that Vp-TDH/I has a sequence different from those of previously known Vp-TDH and Vp-TRH . Not only purified Vp-TDH/I but also live cells of the Vp-TDH/I-producing strain induced fluid accumulation in ligated rabbit intestine . We conclude that this clinical isolate produces a new type of Vp-TDH-related haemolysin, which may be involved in the pathogenesis of this organism.

J Trop Med Hyg, 1991 Feb, 94(1), 1 - 7
Practical field epidemiology to investigate a cholera outbreak in a Mozambican refugee camp in Malawi, 1988; Moren A et al.; Of all populations affected by cholera, refugees are at particular risk of infection due to overcrowding and poor sanitation . Between 15 March and 17 May 1988, 951 cases of cholera were registered at the cholera treatment centre in a Mozambican refugee camp in Malawi . The epidemic duration was 65 days . Vibrio cholerae biotype E1 Tor serotype Inaba was isolated . To identify high-risk groups and potential risk of acquiring the disease, an epidemiologic investigation was conducted . The attack rate of recorded cases was 2.6% with a range from 0.9 to 5.1% for different sections of the camp . The case fatality rate was 3.3% and decreased from week 1 to week 6 . The epidemic started in the section near the market place and radiated out . A matched-pair case-control study of food and water consumption was performed early in the outbreak . It showed that cases were more likely to use shallow wells (surface wells) instead of boreholes compared to controls (OR = 4.5, CI = 1.0-20.8, P = 0.04) and that cases were more likely to have had contact with the market than controls (OR = 3.5, CI = 0.7-16.8, P = 0.09) . None of the food items available at the market was more likely to be preferred by cases than controls . Recommendations included early case finding and treatment, temporary closure of the market, tetracycline prophylaxis of contacts, and water chlorination.

FEMS Microbiol Immunol, 1991 Feb, 3(1), 25 - 31
The construction of a monoclonal diagnostic system for the field detection of Vibrio cholerae; al-Riyami A et al.; An enzyme-based double monoclonal field diagnostic system detecting both serotypes of Vibrio cholerae has been developed . The system uses nitrocellulose as a solid support, 1.25% skimmed dried milk as blocking reagent, water as washing reagent, and alkaline phosphatase cross-linked to antibody by means of glutaraldehyde as detecting reagent . The sensitivity of the system was 10(5) vibrios/ml . The biotin-avidin system gave sensitivity an order of magnitude weaker . There were no cross-reactions with the range of other bacteria tested.

Microb Pathog, 1991 Feb, 10(2), 165 - 72
Characterization of thermostable direct hemolysins encoded by four representative tdh genes of Vibrio parahaemolyticus; Yoh M et al.; Four tdh genes encoding thermostable direct hemolysin (TDH) cloned from two representative strains of V . parahaemolyticus (tdh 1 and tdh 2 from a hemolytic strain, tdh3 and tdh4 from a non-hemolytic strain) have different nucleotide sequences (the maximum divergence: 3.3%) . In this study, each tdh gene product was purified from the lysate of Escherichia coli cells carrying the cloned gene and their properties were compared to investigate the influence of the amino acid substitutions caused by these base changes . The four tdh gene products showed different electrophoretic mobilities under non-denaturing conditions . All the gene products had hemolytic activities for various animal erythrocytes, stimulated vascular permeability in the rabbit skin, and were lethal to mice, although their potencies were slightly different . Antigenicities of the four gene products were indistinguishable . These results indicate that the four tdh genes have evolved to maintain a fundamental molecular structure and biological activities of the gene products and minor structural and/or charge differences of the molecules are perhaps responsible for the slight divergence of their biological activities.

Zh Mikrobiol Epidemiol Immunobiol, 1991 Feb, (2), 34 - 6
{The use of immunoenzyme analysis and the vibriocidal antibody reaction in the serological examination of persons who have had cholera and of those in contact with them}; Mareev VI et al.; The preparation of cholera toxin obtained from Vibrio cholerae strain 1310 has been used for producing solid-phase immunosorbent intended for the enzyme immunoassay (EIA) . The use of EIA and the vibriocidal antibody test (VAT) in the serological study of former cholera patients and persons having contacts with them has made it possible to show the excess of the antitoxic activity of sera over their vibriocidal activity in all subjects covered by the dynamic study (from 5-14 days to 8-10 months) . EIA and VAT can be used as auxiliary methods in epidemiological survey and analysis.

Zh Mikrobiol Epidemiol Immunobiol, 1991 Feb, (2), 20 - 3
{The isolation of Vibrio fluvialis on the territory of the USSR}; Libinzon AE et al.; For the first time V . fluvialis strains were detected on the territory of the USSR . The taxonomic position of these vibrios was determined by their nucleotide DNA composition (the content of guanine + cytosine was 49.3-51.0 mole%) and the characteristic features of their phenotype . The individual features of the strains consisted in their capacity for agglutination with cholera antisera, groups 01 and Inaba, in diagnostic dilutions in the presence of differences in genomes and phenotypes with cholera vibrios . Molecular hybridization DNA-DNA also gave no confirmation of their relationship to cholera vibrios (23-26% homology) . The comparative study of V . fluvialis strains from the USSR and other countries by a broader set of their phenotypical signs confirmed their identity.

J Bacteriol, 1991 Feb, 173(3), 1347 - 52
Polypeptides p40, pOM2, and pAngR are required for iron uptake and for virulence of the marine fish pathogen Vibrio anguillarum 775; Singer JT et al.; Insertions were created in three iron uptake genes in plasmid pJM1 of Vibrio anguillarum 775 to assess their in vivo effects on virulence in fish . Insertions that blocked p40, pOM2, and pAngR expression resulted in iron uptake-negative strains and in 4.2 x 10(5)-, 8.8 x 10(5)-, and 2.5 x 10(5)-fold attenuations in virulence, respectively . A strain with an insertion in the pAngR coding region still synthesized significant constitutive levels of the outer membrane protein pOM2 and persisted in fish for at least 14 days postinjection . The results demonstrate a direct relationship between virulence and three pJM1-encoded gene products and also the feasibility of constructing live attenuated strains of V . anguillarum that might be useful in future vaccines.

J Vet Med Sci, 1991 Feb, 53(1), 69 - 71
Survivals of Vibrio parahaemolyticus and Escherichia coli in a gastropod mollusc, Heminerita japonica; Kumazawa NH et al.; Vibrio parahaemolyticus strains D-3 and R-13 were found to be cleared within 7 days from a marine neritid gastropod mollusc, Heminerita japonica, maintained in artificial seawater with salinities of 15, 25 and 35 permil (%) at 25 degrees C . Escherichia coli strain YS-2 survived at a level of 10(2) colony forming units per gram in the mollusc maintained in 15% water for up to 14 days and fell to non-detectable level within 7 days in a 35% salinity group . The ability of H . japonica to clear these organisms seems to be less active than that of a marine species . Nerita albicilla, and more active than that of an estuarine species . Clithon retropictus.

Wei Sheng Wu Xue Bao, 1991 Feb, 31(1), 19 - 24
{Molecular cloning of lipopolysaccharide genes of the Vibrio cholerae in E . coli HB101}; Shao H et al.; A genomic library of the V . cholerae 178 (Eltor biotype, Ogawa serotype) was constructed by using cosmid pHC 79 as a cloning vector . We screened the library with immune agglutination test and colonies solid phase ELISA . 13 positive recombinants which could express the O antigen of the V . cholerae lipopolysaccharide (LPS) were acquired . The LPS was then extracted from a positive recombinant PMM-VO 38 by using hot phenol-water method . It was found that purified LPS specifically reacted to antisomatic serum against the V . cholerae . The restriction endonucleases analysis showed that the molecular weight of the recombination cosmid PMM-VO 38 was about 46 kb.

J Cell Biol, 1991 Feb, 112(3), 491 - 9
GMP-140 binds to a glycoprotein receptor on human neutrophils: evidence for a lectin-like interaction; Moore KL et al.; GMP-140 is a rapidly inducible receptor for neutrophils and monocytes expressed on activated platelets and endothelial cells . It is a member of the selectin family of lectin-like cell surface molecules that mediate leukocyte adhesion . We used a radioligand binding assay to characterize the interaction of purified GMP-140 with human neutrophils . Unstimulated neutrophils rapidly bound {125I}GMP-140 at 4 degrees C, reaching equilibrium in 10-15 min . Binding was Ca2+ dependent, reversible, and saturable at 3-6 nM free GMP-140 with half-maximal binding at approximately 1.5 nM . Receptor density and apparent affinity were not altered when neutrophils were stimulated with 4 beta-phorbol 12-myristate 13-acetate . Treatment of neutrophils with proteases abolished specific binding of {125I}GMP-140 . Binding was also diminished when neutrophils were treated with neuraminidase from Vibrio cholerae, which cleaves alpha 2-3-, alpha 2-6-, and alpha 2-8-linked sialic acids, or from Newcastle disease virus, which cleaves only alpha 2-3- and alpha 2-8-linked sialic acids . Binding was not inhibited by an mAb to the abundant myeloid oligosaccharide, Lex (CD15), or by the neoglycoproteins Lex-BSA and sialyl-Lex-BSA . We conclude that neutrophils constitutively express a glycoprotein receptor for GMP-140, which contains sialic acid residues that are essential for function . These findings support the concept that GMP-140 interacts with leukocytes by a lectin-like mechanism.

Infect Immun, 1991 Feb, 59(2), 726 - 8
Purification and characterization of pili isolated from Vibrio parahaemolyticus Na2; Nakasone N et al.; Pili from Vibrio parahaemolyticus Na2 isolated from a patient with diarrhea were purified and characterized . The organisms were hemagglutinative, but the purified pili were not . Na2 pili were physicochemically and immunologically quite different from the previously described V . parahaemolyticus Ha7 pili . Nevertheless, there was a high degree of homology between their N-terminal amino acid sequences.

Infect Immun, 1991 Jan, 59(1), 192 - 7
The extracellular cytolysin of Vibrio vulnificus: inactivation and relationship to virulence in mice; Wright AC et al.; The ca . 51-kDa extracellular cytolysin of Vibrio vulnificus has been proposed as a virulence factor . We inactivated the structural gene for cytolysin in fully virulent, clinical V . vulnificus strains by both transposon mutagenesis and marker exchange techniques . Inactivation of the cytolysin did not affect virulence in our mouse models . The 50% lethal dose of cytolysin-negative strains was comparable to that of the cytolysin-positive parent strains after intraperitoneal inoculation with and without iron loading . Similar results were obtained after intradermal injection: cytolysin-positive and -negative strains had the same 50% lethal dose and caused comparable tissue damage . While we cannot say that the cytolysin has no effect on the pathogenesis of V . vulnificus infections, its role appears to be of much less importance than are other factors, such as encapsulation.

Microbios, 1991, 66(267), 83 - 93
Electrophoretic analysis of lipopolysaccharide isolated from opaque and translucent colony variants of Vibrio vulnificus using various extraction methods; Bahrani KF et al.; Lipopolysaccharides (LPS) from an opaque and a translucent colony variant of Vibrio vulnificus were isolated by several methods and the electrophoretic profiles were analysed . The phenol-water extraction method provided a better yield compared to the phenol-chloroform-petroleum ether method . In addition, two rapid micro-assays were used to isolate LPS for electrophoretic analysis . The electrophoretic pattern was the same for all LPS extracts and was similar in both variants . No high molecular weight bands, characteristic of smooth LPS, were detected in the LPS of this organism . This was in contrast to the smooth nature of the LPS of another member of the Vibrionaceae examined, V . cholerae . The result of this study showed no correlation between LPS and colony morphology in V . vulnificus.

Br J Pharmacol, 1991 Jan, 102(1), 167 - 73
Probing the molecular dimensions of general anaesthetic target sites in tadpoles (Xenopus laevis) and model systems using cycloalcohols; Curry S et al.; 1 . The series of cycloalcohols C6, C7, C8 and C10 have been used to probe the molecular dimensions of a variety of general anaesthetic target sites . 2 . The general anaesthetic EC50 concentrations of the cycloalcohols were determined for tadpoles (Xenopus laevis) . All of the cycloalcohols tested were found to be potent general anaesthetics (on average EC50/Csat = 0.03) . 3 . The effects of the cycloalcohols on highly purified luciferase enzymes from fireflies (Photinus pyralis) and bacteria (Vibrio harveyi) were also investigated . Both enzymes were inhibited competitively, with the cycloalcohols competing with firefly luciferin for binding to the firefly enzyme and with n-decanal for binding to the bacterial enzyme . 4 . The binding site on the firefly enzyme could accommodate two molecules of cycloalcohols C6 and C7 but only a single molecule of the larger cycloalcohols (C8 and C10), implying a volume of the binding site of about 250 cm3 mol-1 . In contrast, the binding site on the bacterial luciferase could bind only a single cycloalcohol molecule between C6 and C10 . 5 . While all of the cycloalcohols were potent inhibitors of the firefly luciferase enzyme (on average EC50/Csat = 0.015), they were very weak inhibitors of the bacterial luciferase enzyme (on average EC50/Csat = 0.12) . Since both enzymes bind long-chain aliphatic n-alcohols tightly, the differing affinities of the cycloalcohols for the two enzymes is probably a consequence of geometrical factors . 6 . The cycloalcohols produced very small effects on lipid bilayers . At EC50 concentrations which produce general anaesthesia, lipid bilayer phase transitions were shifted, on average, by only 0.43 degrees C.(ABSTRACT TRUNCATED AT 250 WORDS)

Prikl Biokhim Mikrobiol, 1991 Jan-Feb, 27(1), 82 - 5
{Biosynthesis of inducible L-ornithine decarboxylase by bacterial of the Vibrionaceae family}; Ruzgene AV et al.; The biosynthesis of L-ornithine decarboxylase was investigated in 73 strains of the Vibrionaceae family . V . harveyi 1175 was found to be most active . The maximum accumulation of the enzyme was observed after 4-hour cultivation at pH 5.5 and 33 degrees in the presence of 0.8% L-ornithine HCl used as an inducer without aeration . Under these conditions L-ornithine decarboxylase activity was 3.87 units/mg dry cells.

J Biochem (Tokyo), 1991 Jan, 109(1), 24 - 9
Sequence analysis of nutA gene encoding membrane-bound Cl(-)-dependent 5'-nucleotidase of Vibrio parahaemolyticus; Tamao Y et al.; The membrane-bound 5'-nucleotidase of Vibrio parahaemolyticus is unique in requiring Cl- for activity . We cloned the nutA gene encoding the 5'-nucleotidase and sequenced it . It contained an open reading frame consisting of 1,680 nucleotides capable of encoding a protein of 560 amino acid residues . The first 21 amino acid residues of the N-terminal portion of this protein seem to be a signal peptide . The rest of the polypeptide (539 residues) is hydrophilic, and its molecular weight was calculated to be 60,008, which is in good agreement with the value of 63 kDa determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the 5'-nucleotidase derived from the cloned nutA gene . We tried to determine the amino acid sequence of the N-terminal portion of the purified enzyme . However, the N-terminal residue seemed to be blocked . As this 5'-nucleotidase can be solubilized from membrane vesicles with detergent, it may be a lipoprotein . The amino acid sequence around the possible cleavage site of the 5'-nucleotidase had homology with the sequences of the cleavage sites of the lipoproteins of Escherichia coli and other bacteria . The amino acid sequence had high (about 60%) homology with the sequence of periplasmic 5'-nucleotidase (uridine diphosphate sugar hydrolase, the product of the ushA gene) of E . coli . It also contained regions that showed some homology with the nucleotide binding sites of many nucleotide binding proteins.

J Appl Bacteriol, 1991 Jan, 70(1), 89 - 94
A membrane filter procedure for assaying cytotoxic activity in heterotrophic bacteria isolated from drinking water; Lye DJ et al.; Cytotoxic activity assays of Gram-negative, heterotrophic bacteria are often laborious and time consuming . The objective of this study was to develop in situ procedures for testing potential cytotoxic activities of heterotrophic bacteria isolated from drinking water systems . Water samples were passed through 0.45 microns membrane filters which were then placed upon appropriate media incubated . After incubation, each membrane filter was transferred to the surface of Y-1 mouse adrenal cells overlaid with 1% agar . The filters were removed after exposure for 15 min . The Y-1 cells were then incubated at 37 degrees C in 2.5% CO2 for an additional 24 h . The release of putative cytotoxic and cytotonic products from the bacterial colonies was recognized by zones of cellular lysis and injury of Y-1 cells that appeared immediately beneath the membrane . Cytotoxic strains of Aeromonas, Vibrio, Escherichia, and Legionella spp . were readily recognized by this method . About 1% of the bacteria isolated from drinking water also released cytotoxic products . This frequency was dependent upon the primary medium used and the density of bacteria present . The majority of cytotoxic strains isolated from drinking water also expressed protease activity (95%) and haemolytic activity (70%) . This in situ membrane filter procedure is a facile method for simultaneously testing many different bacterial colonies.

J Appl Bacteriol, 1991 Jan, 70(1), 81 - 8
SGAP-10C agar for the isolation and quantification of Aeromonas from water; Huguet JM et al.; Glutamate starch penicillin (GSP) medium was used for the simultaneous isolation of Pseudomonas and Aeromonas . Modifications to reduce the number of Pseudomonas and background flora and to improve the recovery of Aeromonas from water samples are described . The original medium was modified by adding glucose and ampicillin . The addition of 10 micrograms/l of C-glucose to the medium (SGAP-10C) permitted better recuperation of stressed cells of aeromonads and the ampicillin reduced the numbers of Pseudomonas . The best temperature for the recovery of aquatic aeromonads was 28 degrees C . The recovery of different species of Aeromonas on SGAP-10C was 93% . The selectivity of the medium was validated because 95.5% of 28 colonies tested with an Aeromonas-like morphology belonged to the genus Aeromonas . Moreover, when 45 strains of different genera were cultured on the medium, only Vibrio alginolyticus presented a confusing morphology . When the SGAP-10C was compared with GSP with 45 river samples, the new medium gave a significantly better recovery of Aeromonas spp., especially when large numbers of Pseudomonas spp . were present . SGAP-10C used at 28 degrees C and 48 h was an efficient selective medium for the isolation of Aeromonas from fresh waters.

Vaccine, 1991 Jan, 9(1), 53 - 9
Immunogenicity of two formulations of oral cholera vaccines in Thai volunteers; Chongsa-nguan M et al.; A formulation of oral vaccine consisting of Vibrio cholerae lipopolysaccharides (LPS), cell-bound haemagglutinin (CHA) and procholeragenoid (P), namely vaccine A, was compared with another formulation, vaccine B, prepared from killed whole vibrios plus procholeragenoid on their immunogenicity and reactogenicity in Thai male volunteers . Volunteers were randomly allocated into three groups . The first two groups received orally three doses of vaccines A and B, respectively at 14-day intervals . Volunteers in group 3 were controls and received orally 100 ml 5% (w/v) NaHCO3 also at 14-day intervals . Serum samples were collected from all volunteers before each immunization . Intestinal lavage was performed 3 to 7 days before the first dose of vaccine or placebo and 7, 21 and 45 days after the last dose . Serum vibriocidal antibodies were determined and class-specific, antigen-specific antibodies of all serum and lavage samples were assessed by indirect enzyme-linked immunosorbent assay (ELISA) using purified LPS, CHA and cholera toxin (CT) as antigens . Diarrhoea occurred in 10 and 40% of the vaccinees ingesting the vaccines A and B, respectively . The immunogenicity of the vaccine B in terms of seroconversion for vibriocidal antibodies and anti-LPS was higher than the vaccine A . Both vaccines had equal immunogenicity concerning serum anti-CT, while the vaccine A was slightly better than the vaccine B on serum anti-CHA response . The immunogenicity of the two vaccines in evoking intestinal responses was different from the systemic one.(ABSTRACT TRUNCATED AT 250 WORDS)

J Am Osteopath Assoc, 1991 Jan, 91(1), 84 - 6
Pulmonary infiltrates associated with Vibrio vulnificus septicemia; Cunningham LW et al.; In the case described, fatal Vibrio vulnificus primary septicemia was complicated by development of diffuse pulmonary infiltrates . Clinical features of this recently discovered infectious disease are discussed . Various aspects of diagnoses of pulmonary infiltrates in patients with V vulnificus septicemia are also presented . Vibriosis should be suspected in patients with chronic, underlying, predisposing diseases, recent ingestion of raw seafood, and characteristic skin lesions.

J Bacteriol, 1991 Jan, 173(2), 568 - 74
The Vibrio fischeri LuxR protein is capable of bidirectional stimulation of transcription and both positive and negative regulation of the luxR gene; Shadel GS et al.; Regulation of the genes required for bioluminescence in the marine bacterium Vibrio fischeri (the lux regulon) is a complex process requiring coordination of several systems . The primary level of regulation is mediated by a positive regulatory protein, LuxR, and a small diffusible molecule, N-(3-oxo-hexanoyl)-homoserine lactone, termed autoinducer . Transcription of the luxR gene, which encodes the regulatory protein, is positively regulated by the cyclic AMP-CAP system . The lux regulon of V . fischeri consists of two divergently transcribed operons designated operonL and operonR . Transcription of the rightward operon (operonR; luxICDABE), consisting of the genes required for autoinducer synthesis (luxI) and light production (luxCDABE), is activated by LuxR in an autoinducer-dependent fashion . The leftward operon (operonL) consists of a single known gene, luxR . The LuxR protein has also been shown to decrease transcription of operonL through an autoinducer-dependent mechanism, thereby negatively regulating its own synthesis . In this paper we demonstrate that the autoinducer-dependent repression of operonL transcription requires not only LuxR but also DNA sequences within operonR which occur upstream of the promoter for operonL . In the absence of these DNA sequences, the LuxR protein causes an autoinducer-dependent activation of transcription of operonL . The lux operator, located in the control region between the two operons, was required for both the positive and negative autoinducer-dependent responses . By titration of high levels of LuxR supplied in trans with synthetic autoinducer, we found that low levels of autoinducer could elicit a positive response even in the presence of the negative-acting DNA sequences, while higher levels of autoinducer resulted in a negative response . Without these DNA sequences in operonR, LuxR and autoinducer stimulated transcription regardless of the level of autoinducer . These results suggest that a switch between stimulation and repression of operonL transcription is mediated by the levels of the LuxR-autoinducer complex, which in these experiments reflects the level of autoinducer in the growth medium.

Methods Enzymol, 1991, 204, 515 - 36
Genetic analysis in vibrio; Silverman M et al.; Bacteria of the genus Vibrio are remarkably diverse, and until recently the methodology for genetic analysis consisted of a patchwork of different approaches, many of which were narrowly applicable to a single species . The invention of the recombinant DNA technology and the subsequent innovations in transposon mutagenesis and in transductive and conjugative gene transfer techniques have led to the development of very powerful and general strategies for genetic analysis of species of Vibrio . The striking synergy of combining recombinant DNA, transposon, and gene transfer methods is particularly evident in the construction of transposons which generate gene fusions and of broad host range plasmids which deliver transposons and mutated genes and which mobilize chromosomes . With such tools it should be possible to perform advanced genetic analysis on the many undomesticated species of Vibrio still to be explored.

Vet Hum Toxicol, 1991, 33 Suppl 1, 34 - 9
Major diseases of striped bass and redfish; Plumb JA; Diseases of striped bass, their hybrids, and redfish (red drum) are important constraints to the culture of these two species . Since striped bass have been cultured for years the organisms that cause most diseases of these fish are well known, but very little specific disease information exists for redfish . However, it appears that the organisms that cause diseases of striped bass and redfish do not differ greatly from those of other fishes . The most significant viral disease is lymphocystis, but infectious pancreatic necrosis has occurred in striped bass . Vibriosis (Vibrio sp.) and motile Aeromonas septicemia (Aeromonas hydrophila) are the most frequently encountered bacterial diseases . Both species of fish are affected by fungi (usually Saprolegnia) when the fish are injured or stressed . Amyloodinium ocellatum is the most serious protozoan that infects striped bass and redfish, but the other common protozoans (Trichodina, Ichthyophthirius, Cryptocaron, etc.) have also been reported . Treatment of any of these diseases is a problem because of the absence of approved drugs or chemicals for use on striped bass or redfish . The most common therapeutics used on striped bass and redfish are copper sulfate, formalin, salt (in freshwater) and Terramycin.

Toxicon, 1991, 29(7), 837 - 44
Tryptophan 65 is essential for hemolytic activity of the thermostable direct hemolysin from Vibrio parahaemolyticus; Toda H et al.; The effect of modification of aromatic and ionizable amino acid residues on the hemolytic activity of a thermostable direct hemolysin from Vibrio parahaemolyticus was examined . Tryptophan 65, one of the two tryptophan residues per subunit, was specifically modified with N-bromosuccinimide, resulting in complete loss of hemolytic activity . However, neither nitration with tetranitromethane of one of the nine tyrosine residues nor Nlm-ethoxyformylation of two of the four histidine residues caused any change in hemolytic activity . The hemolysin was fully active upon amidation of two reactive carboxyl group . On the other hand, acetylation of amino groups and the modification of one of the three arginine residues with 1,2-cyclohexanedione resulted in a partial loss of the hemolytic activity . The results suggest that Trp65 is essential for the hemolytic activity of V . parahaemolyticus hemolysin.

Microbiol Immunol, 1991, 35(3), 253 - 8
Analysis of the tdh gene cloned from a tdh gene- and trh gene-positive strain of Vibrio parahaemolyticus; Baba K et al.; A variant of the gene (tdh) encoding thermostable direct hemolysin (TDH) was cloned from the chromosome of Vibrio parahaemolyticus AQ3860, which gave positive results in the hybridization tests with the tdh gene probe and the trh (tdh-related hemolysin) gene probe and showed a low level of reaction in an enzyme-linked immunosorbent assay for TDH . Nucleotide sequence analysis of the cloned gene (tdh5) provided no evidence that tdh5 is evolutionally closer to the trh gene than the other tdh genes . The tdh5 gene was flanked by 40 base-pair sequences constituting perfect inverted repeats, which may suggest association of the tdh5 gene with insertion sequence-like structure . These results suggest that the tdh5 gene and the trh gene were not originally produced by gene duplication in AQ3860 but rather that one of the two genes moved into AQ3860 from an external source.

Microbiol Immunol, 1991, 35(1), 49 - 58
Comparative characterization of inducible and virulent Vibrio parahaemolyticus bacteriophages having unique head projections; Koga T et al.; Phage TP1, induced from Vibrio parahaemolyticus K-20 pilot strain by mitomycin C, exhibited a unique hexagonal head with knob-like projections which covered the whole capsid and a noncontractile tail . The appearance of this phage was very similar to those of phages VP3 and VP6, isolated from seawater . The host range of phage TP1 was similar to those of phages VP3 and VP6 . Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) of the three phage particles revealed almost identical patterns with four major polypeptides with apparent approximate molecular masses: 78, 42, 37 and 34.5 kDa . On the basis of HindIII digestion patterns on agarose gel electrophoresis, the lengths of phage TP1 and VP3 DNAs were estimated to be about 65 kilobase pairs (kbp) and that of VP6 DNA was about 74 kbp . The digestion patterns of all three phage DNAs by DraI, BamHI and MspI were very similar . The DNAs of TP1 and VP3 exhibited almost the same digestion patterns with HindIII and EcoRI, whereas the digestion patterns of VP6 DNA were significantly different from those of the former . From these findings, it seems likely that virulent phage VP3 is originated from a lysogenic phage, probably TP1, of V . parahaemolyticus.

Cytobios, 1991, 66(266-267), 143 - 51
Vibrio virulence factors and the quantitative analysis of cytotoxicity elaborated by environmental isolates; Venkateswaran K et al.; Vibrio strains isolated from freshwater environments were screened for the elaboration of haemolysin, cytotoxin and enterotoxins . While characterizing for various toxins, nine strains elaborated 10(3) and more haemolytic units (HU) per ml crude toxin with a maximum of 4.1 x 10(3) HU . About 41.7% of the strains which were tested produced a factor in the culture supernatant which was active in the suckling mouse assay . Cytotoxin studies revealed that all the Vibrio strains did not respond uniformly in the three cell lines tested . The elongation factor of the CHO cell line which was reported to have correlation with the enterotoxic activity, did not with some exceptions correspond to high fluid accumulation ratio in conventional suckling mouse assay . A modified, simple, rapid, sensitive procedure is described to quantify the elaboration of cytotoxic units (CU) . When the HeLa cell line was used to estimate the CU production, 29% of the strains produced 10(2) CU with a maximum of 169 CU per 50 microliters of crude toxin.

J Hyg Epidemiol Microbiol Immunol, 1991, 35(1), 51 - 5
Some differential growth characteristics of Vibrio cholerae and Vibrio metschnikovii in liquid medium; Muic V; Some differential growth characteristics for Vibrio cholerae and Vibrio metschnikovii were examined in a liquid medium with reference to pH and ionic strength, as well as temperature and length of incubation . The purpose was to discover the combination of the above conditions which would enable selective replication of V . cholerae accompanied by suppressed growth of V . metschnikovii . Preliminary routine verification of one combination of conditions which involves a lengthening of incubation to 22 h at a heightened temperature of 41 degrees C in sewage water samples pointed to the possibility of rapid and simple quantitative demonstration of V . cholerae.

Microb Pathog, 1991 Jan, 10(1), 61 - 70
Similarity of the tdh gene-bearing plasmids of Vibrio cholerae non-O1 and Vibrio parahaemolyticus; Baba K et al.; The gene encoding a hemolysin similar to the thermostable direct hemolysin (TDH) of Vibrio parahaemolyticus was previously cloned from a plasmid of Vibrio cholerae non-O1 . The gene (designated as NAG-tdh) was subcloned and its nucleotide sequence was determined and compared with reported sequences of the four tdh gene copies encoding TDH, of which three were cloned from the chromosome and one was cloned from a plasmid of V . parahaemolyticus . In the coding region, the NAG-tdh gene had 100% homology with the plasmid-borne tdh gene (tdh4) whereas the NAG-tdh gene was 96.7-98.6% homologous to the three chromosomal tdh genes . The sequences of the NAG-tdh and tdh4 genes were nearly identical in the further upstream and downstream regions . The entire plasmids carrying the two tdh genes were found to be highly homologous when compared by restriction endonuclease and Southern blot analyses . The results suggest that the tdh gene has been transferred between V . cholerae non-O1 and V . parahaemolyticus by a plasmid, directly or indirectly, and that the nucleotide sequences of the tdh gene-bearing plasmids have undergone minor base changes in the respective genetic backgrounds.

Biol Met, 1991, 4(1), 33 - 5
Regulation of plasmid-mediated iron transport and virulence in Vibrio anguillarum; Tolmasky ME et al.; Iron is essential for bacterial growth and metabolism . In vertebrates this metal is complexed by high-affinity iron-binding proteins, such as transferrin in serum . The fish pathogen Vibrio anguillarum possesses a very efficient iron-uptake system which is encoded in the virulence plasmid pJM1 . This allows the bacterium to utilize the otherwise unavailable iron in the fish host, resulting in the septicemic disease vibriosis . This system includes the siderophore anguibactin and transport components . We have cloned this iron-uptake system and have defined several genetic units by transposition mutagenesis . Nucleotide sequence analysis identified four open reading frames in the transport region, one of these corresponding to the gene for the outer membrane protein OM2 and another to a 40-kDa polypeptide . Complementation analysis indicated that products from all four reading frames are required for the transport of iron-anguibactin complexes . We have also identified positive and negative-acting regulatory elements that modulate in concert the expression of anguibactin biosynthetic genes and iron transport . The deletion or mutation of the positive-acting regulatory genes results in an iron-uptake-deficient phenotype and leads to an attenuation of virulence, underscoring the importance of this iron-uptake system as a virulence attribute of V . anguillarum.

Medicina (B Aires), 1991, 51(2), 148 - 50
{Sepsis due to Vibrio cholerae no 01}; Marcenac FM et al.; Two fatal sepsis cases in two male patients (58 and 14 years old) due to Vibrio cholerae non 01 are described . Their original diseases were hepatic cirrhosis and acute lymphoblastic leukemia in its third complete remission . In this last case, gastroenteritis due to V . cholerae non 01 was also diagnosed . These sepsis presented a rapid evolution and positive hemoculture after 24 and 48 hours of incubation . Both strains isolated presented similar biochemical characteristics and did not agglutinate in the presence of the specific serum against V . cholerae . Both strains were susceptible to most of the antibiotics available . Sepsis due to V . cholerae non 01 is usually associated to other original diseases and to immunodepression . Management of these sepsis is difficult and mortality rates are very high.

Microbiol Immunol, 1991, 35(9), 705 - 15
An aberrant hemolysin of Vibrio cholerae non-O1; Iwanaga M et al.; An aberrant hemolysin produced by a Vibrio cholerae non-O1 strain N037 (N037-hly) was purified and characterized . N037-Hly was antigenically very similar to El Tor hemolysin but differed in molecular weight (48,000 vs . 60,000), interaction with glucose, and hemolytic activity . Of 100 V . cholerae non-O1 strains other than the N037 strain examined, none produced this aberrant hemolysin . The N-terminal amino acid sequence of N037-hly was highly homologous to that of El Tor hemolysin.

Microbiol Immunol, 1991, 35(12), 1073 - 84
Two generalized transducing phages in Vibrio parahaemolyticus and Vibrio alginolyticus; Muramatsu K et al.; Two bacteriophages named phi VP253 and phi VP143 isolated after ultraviolet induction from lysogenic strains of Vibrio parahaemolyticus have been shown to be generalized transducing phages . So far, seven different auxotrophic markers of a V . parahaemolyticus strain could be transduced at the frequencies ranging from 2.2 x 10(-7) to 7.5 x 10(-5) per infected cell at the m.o.i . of approximately 1.0 . The phage phi VP143, but not phi VP253, lysed 20 of the 28 strains of V . alginolyticus and the occurrence of generalized transduction by this phage in this Vibrio species has been confirmed . Molecular size of the genomes of both phages were estimated to be approximately 48 kb as judged from electrophoretic mobilities of the DNAs digested with HindIII endonuclease . The results and similarity of the two phages in morphology and other properties suggest very close relatedness of the phages.

Microbiol Immunol, 1991, 35(12), 1049 - 58
Vascular permeability enhancement by Vibrio mimicus protease and the mechanisms of action; Chowdhury MA et al.; Vibrio mimicus, a causative agent of gastroenteritis, has also been reported to attribute to extraintestinal infections . Recently we have purified a metalloprotease produced by the pathogen: however, the role of the protease in V . mimicus infection has not been documented . The V . mimicus protease (VMP) was found to enhance vascular permeability and form edema when injected into the dorsal skin of guinea pig and rat . The permeability enhancement by VMP was observed in a dose-dependent manner in both guinea pig and rat skin . In guinea pig, an inhibitor of the angiotensin-converting enzyme was found to augment the permeability enhancement reaction . The permeability enhancement was significantly blocked by soybean trypsin inhibitor (SBTI), an inhibitor of plasma kallikrein reaction . In vitro conversion of plasma prekallikrein to kallikrein by VMP was also noted . In rat skin, the permeability enhancement reaction was not blocked by antihistamine or SBTI . However, the reaction was partially blocked when a mixture of antihistamine and SBTI was administered with VMP . It is apparent from the study that in guinea pig skin, VMP enhances vascular permeability through activation of plasma kallikrein-kinin system which generates bradykinin, whereas in addition to the activation of plasma kallikrein-kinin cascade in the case of rat, stimulation of histamine release from mast cells and other unknown mechanism seem to be also a cause of the permeability enhancement reaction . These results suggest that VMP may play a role in extraintestinal infections with edema caused by the pathogen.

J Public Health Policy, 1991 Winter, 12(4), 450 - 63
Environmental health conditions and cholera vulnerability in Latin America and the Caribbean; Witt VM et al.; PIP: Epidemic cholera reached South America in January 1991 and later spread to Central America and the United States . It afflicted 312,000 people and claimed 3200 lives . Since cholera had not been in Latin America for almost 70 years, health authorities allowed environmental health barriers to cholera collapse . For example, the Governments of the Region agreed in 1961 to abide by the Charter of Punta del Este to provide water and sewerage to 70% of the urban population and 50% f the rural population by 1971 . They did not achieve their goals for the rural population . In fact, at the end of 1988, water was piped to 79% of the urban households and an additional 11% of the urban population had access to a public water source . Sewerage services served 49% of the urban population and, with other methods of excreta disposal, 80% of the population had adequate excreta disposal . On the other hand, only 55% of rural inhabitants had access to either piped water or public standpipes . Further sanitary excreta disposal services only covered 32% . Besides the water quality of existing water supply systems was poor . Since feces of infected people have as many as 1 billion Vibrio cholerae and , in some of Vibrio, up to 80% of carriers exhibit only mild symptoms or no symptoms at all, it is easy to understand how cholera took hold in Latin America . Researchers identified the points of contamination responsible for the cholera outbreak in Piura and Trujillo, Peru to be wells, distribution systems, and house . Annual population growth in Latin America at 2.6% poses specific problems to providing enough water and sanitation services to all in need, especially those in marginal areas around the cities (who will make up 40% of the population by 2000) .

Indian J Pathol Microbiol, 1991 Jan, 34(1), 26 - 9
Non 01 Vibrio cholerae in intestinal and extra intestinal infections in Vellore, S . India; Jesudason MV et al.; Non 01 V.cholerae is known to cause gastroenteritis and extra intestinal manifestations, including septicemia . We report here our isolation of non 01 V.cholerae from various clinical specimens . Although most of the isolates are from faeces samples from patients with diarrhoea, we have three isolates from blood culture in patients with underlying liver disease . The highest incidence occurred in 1982-1983 and 1987 and 1988.

DNA Seq, 1991, 1(3), 189 - 96
Sequence and features of the tryptophan operon of Vibrio parahemolyticus; Crawford IP et al.; The nucleotide sequence of the trp operon of the marine enteric bacterium Vibrio parahemolyticus is presented . The gene order E, G, D, C(F), B, A is identical to that of other enterics . The structural genes of the operon are preceded by a long leader region encoding a 41-residue peptide containing five tryptophan residues . The organization of the leader region suggests that transcription of the operon is subject to attenuation control . The promoter-operator region of the V . parahemolyticus trp operon is almost identical to the corresponding promoter-operator of E . coli . The similarities suggest that promoter strength and operator function are identical in the two species, and that transcription initiation is regulated by repression . The operon appears to lack the internal promoter within trpD that is common in terrestrial enteric species.

Microbiol Immunol, 1991, 35(9), 775 - 87
Comparison of immunochemical specificities of Vibrio parahaemolyticus O10 and O12 antigens using monoclonal antibodies; Ogawa S et al.; The monoclonal antibodies against Vibrio parahaemolyticus O10 and O12 antigens (lipopolysaccharide, LPS) were prepared and specificities of the antibodies were examined . Five of six anti-O10 antibodies reacted with O10 antigen, but none of them reacted with O12 antigen . On the contrary all of the five anti-O12 antibodies reacted with O10 antigen as well as homologous O12 antigen . O10 and O12 antigens were subjected to alkali treatment or periodate oxidation, and reactivities of these chemically modified preparations with the monoclonal antibodies were examined . Reactivities of O10 with anti-O10 and anti-O12 antibodies were reduced by the above two chemical treatments, but that of O12 with anti-O12 was not . O-Deacetylation of O10 LPS by the alkaline treatment was confirmed by NMR spectroscopy . These results suggest contributions to O10-specificity of O-acetyl group and periodate sensitive sugar residue . Inhibition experiments of O10 and O12 homologous precipitations were also carried out with various sugars . From the results we concluded that O10 and O12 antigenic determinants were distinct entities, although O10 and O12 antigens have been reported to be similar and cross-reactive.

Arch Microbiol, 1991, 156(6), 444 - 8
Construction of stable, single-copy luciferase gene fusions in Escherichia coli; Guzzo A et al.; A ColE1-based plasmid for transcriptional gene fusions was constructed that contains both the promoterless luxAB genes of Vibrio harveyi and a tet marker within the inverted repeats of a left end-truncated Tn5 element . Introduction of this plasmid into an Escherichia coli strain containing a plasmid (pTF421) that over-produces ColE1 RNA1 (and thus inhibits replication of the ColE1 plasmid) allowed selection for cells that had a single copy of the luxAB operon transposed into the chromosome beginning 5 days post-transformation . The long latent period necessary for Tn5 transposition is analogous to that found in other systems, where transposition frequencies and mutation rates increase in a time-dependent manner when selected for upon prolonged incubation on Petri dishes under bacteriostatic conditions.

Lab Delo, 1991, (10), 57 - 8
{Determination of the cytotoxic activity of Vibrio cholerae}; Kiselev IuL et al.; Cytotoxic activities of broth culture supernatants of 39 V . cholerae strains 01 and non 01 were studied in L-929 cell cultures . The examined strains differed by the cytotoxic factor production, which factors were identified (with the use of anti-cytolysin serum) as cytolysin . The strains capable of choleric enterotoxin secretion did not produce cytolysin.

Lab Delo, 1991, (5), 61 - 2
{An immunoenzyme method of detecting Vibrio cholerae cytolysin}; Babitsyn SN et al.; Enzyme immunoassay was used in detection of V . cholerae cytolysin . Conjugate of immunoglobulins to purified cytolysin with horseradish peroxidase was used, obtained by the periodate technique . The method sensitivity is 2 ng/ml of purified cytolysin . The results of hemolytic activity measurements in supernatants of 40 V . cholerae strains and enzyme immunoassay findings were in high correlation.

Lab Delo, 1991, (5), 59 - 60
{The effect of the growth period of a culture of L-929 cells on its sensitivity to the action of Vibrio cholerae cytolysin}; Kiselev IuL et al.; The activity of purified V . cholerae cytolysin was estimated from its cytotoxic effect on L-929 cells in various growth phases . The period of target cell development was supposed to influence the sensitivity of the test . Cytolysin preparation is thermolabile, and its effect is neutralized with homologous antiserum.

Lab Delo, 1991, (5), 57 - 9
{The use of micromethods for the identification of Vibrios}; Khaitovich AB et al.; The authors recommend micromethods for laboratory studies of Vibrio; such methods may be widely used at bacteriologic laboratories for examinations of biochemical characteristics of these microorganisms, for rapid identification of V . cholerae 01, and for serologic identification (typing) of V . cholerae non 01, since they accelerate the diagnosis and are much simpler than macromethods.

Infect Immun, 1991 Jan, 59(1), 114 - 8
Localization of protective epitopes within the pilin subunit of the Vibrio cholerae toxin-coregulated pilus; Sun DX et al.; From a collection of monoclonal antibodies (MAbs) that recognize the native structure of the toxin-coregulated pilus of Vibrio cholerae, two protective MAbs (16.1 and 169.1) were used to localize the corresponding epitopes on the pilus . These MAbs were shown to specifically recognize the carboxyl half of the TcpA pilin subunit, as determined by their recognition of proteolytic fragments and hybrid pilin proteins . The positions of the epitopes were precisely determined through the use of overlapping synthetic peptides corresponding to this region of the pilin . The MAbs were found to recognize adjacent peptides, delineating a region between residues 157 and 199 . Since the protective nature is specific for these two antibodies, the findings suggest that this region defines a domain that participates in toxin-coregulated pilus-mediated colonization and therefore represents a target for studies of its potential as an immunogen for incorporation into a component cholera vaccine.

Microbiol Immunol, 1991, 35(8), 675 - 80
Chemical structure of the 2-keto-3-deoxyoctonate (KDO) region of the lipopolysaccharide isolated from O1 Vibrio cholerae NIH 4IR (Ogawa); Kondo S et al.; The chemical structure of the 2-keto-3-deoxyoctonate (KDO) region of the lipopolysaccharide (LPS) isolated from O1 V . cholerae NIH 41R (Ogawa) was elucidated by dephosphorylation, periodate oxidation and methylation analysis . Methylation analysis of KDO in the dephosphorylated LPS revealed the presence of 5-O-acetyl-1,2,4,6,7,8-hexa-O-methyl-3-deoxy-octitol and 2-keto-3-deoxy-heptulosonic acid was detected in the methanolysate of the periodate-oxidized and dephosphorylated LPS . These results indicated that the site of binding of KDO to the core oligosaccharide is position C5 as in enteric gram-negative bacterial LPS, while only one molecule of the KDO residue carrying phosphate on position C4 is present in the inner core region of the LPS in contrast to enteric gram-negative bacterial LPS in which one molecule of KDO carrying KDO or KDO2----4KDO disaccharide instead of the phosphate group at position C4 is present in its main chain.

Biodegradation, 1991, 2(1), 33 - 41
Anaerobic degradation of sorbic acid by sulfate-reducing and fermenting bacteria: pentanone-2 and isopentanone-2 as byproducts; Schnell S et al.; Strictly anaerobic bacteria were enriched and isolated from freshwater sediment sources in the presence and absence of sulfate with sorbic acid as sole source of carbon and energy . Strain WoSo1, a Gram-negative vibrioid sulfate-reducing bacterium which was assigned to the species Desulfoarculus (formerly Desulfovibrio) baarsii oxidized sorbic acid completely to CO2 with concomitant stoichiometric reduction of sulfate to sulfide . This strain also oxidized a wide variety of fatty acids and other organic compounds . A Gram-negative rod-shaped fermenting bacterium, strain AmSo1, fermented sorbic acid stoichiometrically to about equal amounts of acetate and butyrate . At concentrations higher than 10 mM, sorbic acid fermentation led to the production of pentanone-2 and isopentanone-2 (3-methyl-2-butanone) as byproducts . Strain AmSo1 fermented also crotonate and 3-hydroxybutyrate to acetate and butyrate, and hexoses to acetate, ethanol, hydrogen, and formate . The guanine-plus-cytosine content of the DNA was 41.8 +/- 1.0 mol% . Sorbic acid at concentrations higher than 5 mM inhibited growth of this strain while strain WoSo1 tolerated sorbic acid up to 10 mM concentration.

Mo Med, 1990 Dec, 87(12), 881 - 3
Vibrio infections in Kansas City; Hoff G et al.; In August 1989, the Kansas City Health Department declared vibrio infections a reportable disease . The authors present a report discussing cases of vibriosis reported between 1980 and 1989.

J Bacteriol, 1990 Dec, 172(12), 6797 - 802
A new Vibrio fischeri lux gene precedes a bidirectional termination site for the lux operon; Swartzman A et al.; The DNA downstream of the lux structural genes in the Vibrio fischeri lux operon has been sequenced and a new lux gene (luxG) has been identified . A hairpin loop that begins with a poly(A) region and ends with a poly(T) region and thus can function as a bidirectional termination site for luxG and a convergent gene is located immediately downstream of luxG . 3' S1 nuclease mapping has demonstrated that the luxG mRNA was induced in a cell-density-dependent fashion consistent with it being part of the lux system and that the lux mRNA terminated immediately after the hairpin loop . The mRNA coded by an open reading frame convergent to luxG on the complementary strand was also shown by S1 nuclease mapping to overlap the lux mRNA for at least 20 nucleotides before termination . Expression of DNA containing the hairpin loop, placed between a strong promoter and a reporter gene and transferred by conjugation into luminescent bacteria, demonstrated the very high efficiency of termination by this hairpin loop oriented in either direction . These results also demonstrate that the organization of the genes at the 3' ends of the lux operons of V . fischeri and V . harveyi has clearly diverged.

Infect Immun, 1990 Dec, 58(12), 4159 - 62
Purification and characterization of a protease produced by Vibrio mimicus; Chowdhury MA et al.; A protease produced by Vibrio mimicus was purified to apparent homogeneity by ammonium sulfate fractionation and successive column chromatography on Sephacryl S-100 and Mono Q Monobeads . The sodium dodecyl sulfate-polyacrylamide gel electrophoresis (PAGE) of the final preparation of the enzyme revealed the homogeneity of the purified enzyme . Conventional PAGE showed that the purified protease migrated as a single band with protease activity . The molecular weight of the protease was estimated to be about 31,000 on the basis of its mobility on sodium dodecyl sulfate-PAGE . The purified protease had both proteolytic and hemagglutination (HA) activities . The proteolytic and HA activities were inhibited by metalloprotease inhibitors and heat treatment . V . mimicus protease therefore appeared as a heat-labile, bifunctional molecule capable of mediating proteolysis and HA . The immunodiffusion analysis showed that the proteases produced by Vibrio cholerae and V . mimicus are immunologically cross-reactive.

Infect Immun, 1990 Dec, 58(12), 4142 - 4
Molecular cloning and nucleotide sequence analysis of cholera toxin genes of the CtxA- Vibrio cholerae strain Texas Star-SR; Brickman TJ et al.; The ctx operons from the Vibrio cholerae El Tor strain 3083 and its CtxA- derivative Texas Star-SR were cloned, and their nucleotide sequences were compared . A single missense mutation in the Texas Star-SR ctxA cistron which results in the substitution of threonine for alanine at position 191 of the 258-amino-acid CtxA precursor was identified . Immunoblot analysis detected the mutant CtxA intracellularly early in the culture cycle but not extracellularly at any growth stage.

J Bacteriol, 1990 Dec, 172(12), 6863 - 70
Transcriptional regulation by iron of a Vibrio cholerae virulence gene and homology of the gene to the Escherichia coli fur system; Goldberg MB et al.; We have previously described an iron-regulated virulence determinant in Vibrio cholerae . Strain MBG40, which contains a TnphoA insertion mutation in the iron-regulated gene irgA, has reduced virulence in a newborn mouse model and has lost the major 77-kDa iron-regulated outer membrane protein . We report here the cloning of the irgA'-'phoA gene fusion, the sequencing of the 5'-proximal portion of irgA, and the definition of its promoter region by primer extension . The deduced amino acid sequence of the amino-terminal portion of IrgA is homologous to the ferrienterochelin receptor of Escherichia coli (FepA), suggesting that IrgA may be the iron-vibriobactin outer membrane receptor . Iron regulation of irgA in an E . coli background and that of the E . coli gene slt-IA in a V . cholerae background are reciprocal, suggesting a common mechanism of iron regulation . Regulation of irgA by iron in V . cholerae occurs at the transcriptional level, and there is an interrupted dyad symmetric sequence in the vicinity of the promoter that is homologous to Fur binding sites of E . coli . Unlike iron-regulated genes in E . coli, however, transcription of irgA requires an additional 900 bp of upstream DNA that contains an open reading frame in inverse orientation to irgA.

Infect Immun, 1990 Dec, 58(12), 4106 - 16
Two-step processing for activation of the cytolysin/hemolysin of Vibrio cholerae O1 biotype El Tor: nucleotide sequence of the structural gene (hlyA) and characterization of the processed products; Yamamoto K et al.; Vibrio cholerae O1 biotype El Tor produces and secretes a 65-kDa cytolysin/hemolysin into the culture medium . We cloned the structural gene (hlyA) for the cytolysin from the total DNA of a V . cholerae O1 El Tor strain, N86 . Nucleotide sequence analysis of hlyA revealed an open reading frame consisting of 2,223 bp which can code for a protein of 741 amino acids with a molecular weight of 81,961 . Consistent with this, a 79-kDa protein was identified as the product of hlyA by maxicell analysis in Escherichia coli . N-terminal amino acids of this 79-kDa HlyA protein and those of a 65-kDa El Tor cytolysin purified from V . cholerae were Asn-26 and Asn-158, respectively . The 82- and 79-kDa precursors of the 65-kDa mature cytolysin were found in V . cholerae by pulse-chase labeling and Western blot (immunoblot) analysis of hlyA products . Hemolytic activity of the 79-kDa HlyA protein from E . coli was less than 5% that for the 65-kDa cytolysin from V . cholerae . Our results suggest that in V . cholerae, the 82-kDa preprotoxin synthesized in the cytoplasm is secreted through the membranes into the culture medium as the 79-kDa inactive protoxin after cleavage of the signal peptide and is then further processed into the 65-kDa active cytolysin by release of the N-terminal 15-kDa fragment.

Proc Natl Acad Sci U S A, 1990 Dec, 87(24), 9898 - 902
Expression of ToxR, the transcriptional activator of the virulence factors in Vibrio cholerae, is modulated by the heat shock response; Parsot C et al.; The toxR gene of Vibrio cholerae encodes a transmembrane, DNA-binding protein that positively controls transcription of the genes for cholera toxin, TCP pili, and other proteins important in cholera pathogenesis . Nucleotide sequence analysis of the toxR upstream region has revealed that the heat shock gene htpG, encoding the bacterial homologue of the eukaryotic Hsp90 protein, was located immediately upstream and was divergently transcribed from toxR . Using lacZ transcriptional fusions, we have shown that neither toxR nor htpG expression was regulated by ToxR . However, the growth temperature had a coordinate but reciprocal effect on the expression from both the toxR and htpG promoters in V . cholerae; the decrease of toxR expression between 22 degrees C and 37 degrees C was proportional to the increase of htpG expression observed within that temperature range . A similar pattern of expression of the htpG and toxR promoters was observed in the heterologous host Escherichia coli, where this regulation was controlled by the level of the E . coli rpoH (htpR) gene product, sigma-32 . Consistent with the temperature-regulated expression of the V . cholerae htpG promoter in E . coli, a sequence similar to the consensus sequence of the E . coli heat shock promoters was detected upstream from the V . cholerae htpG gene . We propose a model in which the regulation of toxR expression by temperature is controlled by the level of sigma-32 (RpoH) RNA polymerase.

Infect Immun, 1990 Dec, 58(12), 4011 - 5
Comparison of the Vibrio cholerae hemagglutinin/protease and the Pseudomonas aeruginosa elastase; Hase CC et al.; The soluble hemagglutinin/protease (HA/protease) produced by Vibrio cholerae and the elastase of Pseudomonas aeruginosa are both zinc/calcium-dependent proteases . In the present study the two enzymes are compared immunologically and functionally . The N-terminal amino acid sequences of the proteins had 65% identity within the first 20 amino acids . Polyclonal antisera against each purified protein recognized the enzyme of the other species in enzyme-linked immunosorbent assay, checkerboard immunoblot, and Western blot analyses and inhibited the protease activity of both enzymes in milk and elastin agars . Like the HA/protease, the elastase hemagglutinated "responder" but not "nonresponder" chicken erythrocytes, degraded ovomucin, lactoferrin, and fibronectin, and nicked the A subunit of the cholera toxin-related heat-labile enterotoxin from Escherichia coli . Whereas none of the three proteases tested (elastase, HA/protease, or pronase E) had any obvious effect in ileal loop tests in rabbits at doses up to 50 micrograms, all three produced some detectable skin reactions at a dose of 0.1 micrograms and necrosis at a higher dose (i.e., 5 micrograms) . We conclude that the V . cholerae HA/protease and the P . aeruginosa elastase are structurally, functionally, and immunologically related.

Zh Mikrobiol Epidemiol Immunobiol, 1990 Dec, (12), 6 - 10
{The effect of immune antibodies and the xanthine oxidase-xanthine enzymatic link on Vibrio cholerae}; Adamov AK et al.; As revealed in experiments on V . cholerae, highly diluted cholera antiserum enhanced the inhibitory action of the enzymatic link xanthine oxidase-xanthine-Fe2+ on the multiplication of V . cholerae, while low dilutions of the antiserum weakened this action . Normal rabbit serum produced no such effect . The antivibrionic effectiveness of the immune molecular cycle, viz . antiserum--the xanthine oxidase enzymatic link, was found to depend also on the concentration of xanthine . Immune antibodies to cholera antigens activated the bacteriostatic action of the enzymatic link at the concentration of xanthine oxidase equal to 0.0125 g/l and its bactericidal action at the concentration of xanthine oxidase equal to 0.025 g/l . In this article the values of the specificity indices of immune interaction and immunological effectiveness, characterizing the effectiveness of immune molecular cycles (antibodies--the xanthine oxidase enzymatic link), are presented.

Zh Mikrobiol Epidemiol Immunobiol, 1990 Dec, (12), 55 - 62
{The determination of the optimal inoculation dose of an oral cholera chemical bivalent vaccine in a controlled experiment}; Sumarokov AA et al.; 276 volunteers aged 19 years and over were placed under observation in the course of the trial of oral cholera vaccine in tablets, containing choleragen toxoid, O-antigens of serovars Inaba and Ogawa and a number of Vibrio cholerae exoenzymes, for safety, reactogenic properties and immunological effectiveness . The vaccine was found to produce no reactions in a dose of 1-4 tablets; the administration of 3 tablets (300,000 binding units of the toxoid and 10,000 units of O-antigens, serovars Inaba and Ogawa) was shown to induce the most intensive synthesis of both antitoxins and vibriocidal antibodies in the blood sera of volunteers, as well as IgA coproantibodies . The oral vaccine was found to have an advantage over parenteral vaccines due to the absence of reactogenic properties and the formation of local immunity: coproantibodies appeared in 80% and 9% of the vaccinees respectively.

Asian Pac J Allergy Immunol, 1990 Dec, 8(2), 87 - 94
Immunogenicity of liposome-associated oral cholera vaccine prepared from combined Vibrio cholerae antigens; Chaicumpa W et al.; Liposomes were prepared from bovine brain sphingomyelin and cholesterol . They were reinforced by incorporation of osmium tetroxide to prevent their immediate degradation inside the host . Combined Vibrio cholerae antigens (lipopolysaccharide, crude cell-bound hemagglutinin and procholeragenoid) were orally administered to experimental rats either as free or liposome-associated . A total of 70 experimental rats was utilized in experiments comparing the immune responses of rats to liposome-associated vaccine, free vaccine, liposomes, or placebo, and to vaccines where the lipid or antigen levels were reduced . Immediately after feeding with sodium bicarbonate to lower the gastric acidity, they were fed either cholera vaccines or placebo . Results from serum ELISA revealed that the liposomes localized the immune response to the intestinal mucosa . They displayed an adjuvant property in terms of evoking a higher immune response to V . cholerae antigens, as measured by the appearance of specific antibody-producing cells in the intestinal mucosa, than when the antigens were fed alone . The adjuvanticity was found to be lipid dose dependent . Liposomes prepared with high lipid content enhanced immunogenicity of the admixture antigens to a greater degree.

Vaccine, 1990 Dec, 8(6), 577 - 80
Randomized double-blind placebo controlled trial to evaluate the safety and immunogenicity of the live oral cholera vaccine strain CVD 103-HgR in Swiss adults; Cryz SJ Jr et al.; A randomized, double-blind, placebo controlled trial was conducted in 50 healthy Swiss adults to assess the safety and immunogenicity of the live oral attenuated cholera vaccine candidate strain Vibrio cholerae CVD 103-HgR (classical, Inaba) . A single dose of 5 x 10(8) viable CVD 103-HgR organisms, administered in a buffered liquid formulation, was well tolerated as compared with individuals who received an equivalent amount of heat-killed Escherichia coli K-12 placebo . Eighty-eight percent of subjects receiving CVD 103-HgR mounted a significant (greater than fourfold) rise in Inaba vibriocidal titre while 68% did so for the heterologous Ogawa serotype . The magnitude of the vibriocidal antibody response (as measured by peak geometric mean titre and by fold-rise in titre over baseline) was greater for the homologous Inaba serotype . Nineteen out of 25 volunteers (76%) responded with a significant (p less than 0.05) rise in serum antitoxin levels . No vaccinee who received the E . coli K-12 placebo mounted a significant rise in either vibriocidal or antitoxin antibody levels . These results corrobrate the safety and immunogenicity of CVD 103-HgR in healthy adult volunteers.

J Diarrhoeal Dis Res, 1990 Dec, 8(4), 163 - 5
An outbreak of food poisoning suspected to be caused by Vibrio fluvialis; Thekdi RJ et al.; A small outbreak of gastroenteritis was reported in June 1981 from Arangaon village of Maharashtra State, India . Of the 34 participants who took lunch in a religious ceremony, 14 became suddenly sick 4 to 6 hours after the meal with clinical manifestations of food poisoning . Of the 14 stool samples examined, one from each patient, Vibrio fluvialis was isolated from nine without the growth of any other enteropathogenic bacteria . Although any left-over portions of food were not available for bacteriological examination, the results do suggest that the food, probably contaminated with the organism, was the source of infection in the disease outbreak.

Mol Gen Genet, 1990 Dec, 224(3), 405 - 12
Regions of the cloned Vibrio cholerae rfb genes needed to determine the Ogawa form of the O-antigen; Morona R et al.; The O-antigen of the lipopolysaccharides of Vibrio cholerae 01 can exist in two forms termed Inaba and Ogawa . We used a complementation system to demonstrate that the Ogawa phenotype is dominant over the Inaba phenotype . By using a set of deletions affecting the Ogawa rfb genes, we identified two regions which are needed to confer the Ogawa phenotype . In vitro mutagenesis of the cloned Ogawa rfb genes resulted in the isolation of variants with the Inaba phenotype . The results are interpreted with respect to previous studies demonstrating interconversion between the two forms of the V . cholerae O-antigen.

J Bacteriol, 1990 Dec, 172(12), 7085 - 97
Responses to multiple-nutrient starvation in marine Vibrio sp . strain CCUG 15956; Nystrom T et al.; The response of marine Vibrio sp . strain S14 (CCUG 15956) to long-term (48-h) multiple-nutrient starvation (i.e., starvation for glucose, amino acids, ammonium, and phosphate simultaneously) can be described as a three-phase process . The first phase, defined as the stringent control phase, encompasses an accumulation of guanosine 5'-diphosphate 3'-diphosphate (ppGpp) and decreases in RNA and protein synthesis during the first 40 min . In the second phase, there is a temporary increase in the rates of RNA and protein synthesis between 1 and 3 h paralleling a decrease in the ppGpp pool . The third phase includes gradual decline in macromolecular synthesis after 3 h . Using two-dimensional gel electrophoresis of pulse-labeled proteins, a total of 66 proteins were identified as starvation inducible (Sti), temporally expressed throughout the three phases of starvation . The inhibition of protein synthesis during the first phase of starvation partly disrupted the subsequent temporally ordered synthesis of starvation proteins and prevented the expression of some late starvation proteins . It was also found that the early temporal class of starvation proteins, which included the majority of the Sti proteins, was the most essential for long-term survival . Vibrio sp . strain S14 cultures prestarved (1 h) for glucose, amino acids, ammonium, or phosphate as well as cultures exposed (1 h) to CdCl2 exhibited enhanced survival during the subsequent multiple-nutrient starvation in the presence of chloramphenicol or rifampin, while heat or the addition of cyclic AMP or nalidixic acid prior to starvation had no effect . It was demonstrated that amino acid starvation and CdCl2 exposure, which induced the stringent response, were the most effective in conferring enhanced survival . A few Sti proteins were common to all starvation conditions . In addition, the total number of proteins induced by multiple-nutrient starvation significantly exceeded the sum of those induced by starvation for each of the individual nutrients.

J Biol Chem, 1990 Nov 25, 265(33), 20346 - 50
Intracellular Na+ kinetically interferes with the rotation of the Na(+)-driven flagellar motors of Vibrio alginolyticus; Yoshida S et al.; To understand the mechanism of Na+ movement through the force-generating units of the Na(+)-driven flagellar motors of Vibrio alginolyticus, the effect of intracellular Na+ concentration on motor rotation was investigated . Control cells containing about 50 mM Na+ showed good motility even at 10 mM Na+ in the medium, i.e . in the absence of an inwardly directed Na+ gradient . In contrast, Na(+)-loaded cells containing about 400 mM Na+ showed very poor motility at 500 mM Na+ in the medium, i.e . even in the presence of an inwardly directed Na+ gradient . The membrane potential of the cells, which is a major driving force for the motor under these conditions, was not detectably altered, and consistently with this, Na(+)-coupled sucrose transport was only partly reduced in the Na(+)-loaded cells . Motility of the Na(+)-loaded cells was restored by decreasing the intracellular Na+ concentration, and the rate of restoration of motility correlated with the rate of the Na+ decrease . These results indicate that the absolute concentration of the intracellular Na+ is a determinant of the rotation rate of the Na(+)-driven flagellar motors of V . alginolyticus . A simple explanation for this phenomenon is that the force-generating unit of the motor has an intracellular Na(+)-binding site, at which the intracellular Na+ kinetically interferes with the rate of Na+ influx for motor rotation.

Appl Environ Microbiol, 1990 Nov, 56(11), 3615 - 9
Vibrios associated with red tides caused by Mesodinium rubrum; Romalde JL et al.; Vibrios were isolated from red tides caused by Mesodinium rubrum and also throughout the year in the Ria de Pontevedra, Spain . The isolates were grouped into 14 phena by numerical toxonomy . Strains associated with red tides were restricted to four phena: phena I and II were Vibrio alginolyticus, and phena III and IV were Vibrio tubiashii and Vibrio anguillarum, respectively . V . anguillarum-like strains (phena V through XI) predominated throughout the year outside the red tide areas . Cytotoxicity assays conducted in different poikilothermic and homoiothermic cell lines showed that cytotoxin production was not necessarily associated with the species selected during the red tides.

Appl Environ Microbiol, 1990 Nov, 56(11), 3439 - 44
Natural plasmid transformation in a high-frequency-of-transformation marine Vibrio strain; Frischer ME et al.; The estuarine bacterium Vibrio strain DI-9 has been shown to be naturally transformable with both broad host range plasmid multimers and homologous chromosomal DNA at average frequencies of 3.5 X 10(-9) and 3.4 X 10(-7) transformants per recipient, respectively . Growth of plasmid transformants in nonselective medium resulted in cured strains that transformed 6 to 42, 857 times more frequently than the parental strain, depending on the type of transforming DNA . These high-frequency-of-transformation (HfT) strains were transformed at frequencies ranging from 1.1 X 10(-8) to 1.3 X 10(-4) transformants per recipient with plasmid DNA and at an average frequency of 8.3 X 10(-5) transformants per recipient with homologous chromosomal DNA . The highest transformation frequencies were observed by using multimers of an R1162 derivative carrying the transposon Tn5 (pQSR50) . Probing of total DNA preparations from one of the cured strains demonstrated that no plasmid DNA remained in the cured strains which may have provided homology to the transforming DNA . All transformants and cured strains could be differentiated from the parental strains by colony morphology . DNA binding studies indicated that late-log-phase HfT strains bound {3H}bacteriophage lambda DNA 2.1 times more rapidly than the parental strain . These results suggest that the original plasmid transformation event of strain DI-9 was the result of uptake and expression of plasmid DNA by a competent mutant (HfT strain) . Additionally, it was found that a strain of Vibrio parahaemolyticus, USFS 3420, could be naturally transformed with plasmid DNA . Natural plasmid transformation by high-transforming mutants may be a means of plasmid acquisition by natural aquatic bacterial populations.

Infect Immun, 1990 Nov, 58(11), 3731 - 6
Identification and characterization of a zinc metalloprotease associated with invasion by the fish pathogen Vibrio anguillarum; Norqvist A et al.; An invasiveness-defective mutant of the fish-pathogenic bacterium Vibrio anguillarum was isolated . Compared with the wild type, this mutant had a 1,000-fold higher 50% lethal dose after immersion infection of rainbow trout, Oncorhynchus mykiss, while after intraperitoneal infection, the mutant had only a 10-fold higher 50% lethal dose . In addition, the mutant showed a lower level of protease activity . Two forms of the protease (Pa and Pb) were found after sodium dodecyl sulfate-polyacrylamide gel electrophoresis of nonheated samples . Pa was found predominantly in protease preparations of the wild type, while Pb was the predominant form in the mutant . Conversion of Pb to Pa was observed in protease preparations after incubation at 4 degrees C . Characterization of the protease showed that it was an elastolytic enzyme which required Zn2+ for activity and Ca2+ for stability . The molecular mass of the protease was 36 kilodaltons . N-terminal amino acid sequence analysis of the protease of V . anguillarum revealed homology to the elastase of Pseudomonas aeruginosa and the protease of Legionella pneumophila.

Infect Immun, 1990 Nov, 58(11), 3698 - 705
Purification and characterization of a novel hemagglutinin from Vibrio cholerae; Banerjee KK et al.; A lectin with strong hemagglutinating activity toward erythrocytes of several animal species was isolated from an 18-h culture supernatant of a diarrheagenic strain, V2, of non-O1 Vibrio cholerae . The hemagglutinin (HA) was purified free of lipopolysaccharide by salt fractionation followed by gel filtration, hydrophobic interaction chromatography, and, finally, gel filtration in the presence of urea and deoxycholate . The purification procedure resulted in an HA preparation with 80-fold enhancement of specific activity . The HA consisted of noncovalently bound subunits of Mr 62,000 and behaved essentially as a single component with pI 6.0 . Nonpolar and acidic amino acids contributed 46 and 24%, respectively, to the total amino acid residues . Electron micrographs of the HA showed it to consist of large, nonstoichiometric aggregates' of disklike molecules of 10-nm diameter . Inhibition of the HA by the glycoproteins fetuin, asialofetuin, and mucin, but not by ovalbumin and simple sugars, suggested the specific requirement of complex carbohydrates for binding . Rabbit antisera to the purified HA inhibited the hemagglutinating activities of the crude cell-free HA preparations, but not cell-associated HA activities of the parent (V2) or of other O1 and non-O1 V . cholerae strains . This suggested that the released and cell-associated HA activities were mediated by antigenically distinct components . Immunoblotting experiments showed that the antisera recognized a polypeptide component of Mr 62,000 in the cell envelope preparations of the parent and several other V . cholerae O1 and non-O1 strains . These data suggested that the HA was a nonfimbrial lectin of somatic origin with no protease activity and was apparently distinct from V . cholerae HAs described so far.

Infect Immun, 1990 Nov, 58(11), 3633 - 9
High-frequency spontaneous mutation of classical Vibrio cholerae to a nonmotile phenotype; Mostow P et al.; The species Vibrio cholerae contains within it two biotypes, classical and El Tor, both of which are motile . Phenotypic expression of motility was unaffected by type of growth medium, salt concentration, pH, or temperature of incubation . However, seven strains of classical V . cholerae produced spontaneous nonmotile mutants at an unusually high frequency (ca . 10(-4)), while no mutants were detected for all three El Tor strains examined . No revertants of these nonmotile mutants were detected . Four independent mutants of classical strain 395 were isolated to characterize this phenomenon . By transmission electron microscopy, one of the nonmotile mutants was found to be flagellated, while the other three were found to be aflagellate . Chromosomal DNA from the mutants and parental wild-type strain 395 was examined by Southern blot analysis with, as probes, V . cholerae mutagenic prophages VcA-1 and VcA-2 and six cloned motility gene regions isolated from transposon insertion motility mutants of strains 395 and N16961 (El Tor, Inaba) . The parental wild-type strain and all of the mutants exhibited the same pattern of bands when probed with VcA-1 and VcA-2 DNAs . Four of the cloned motility gene regions hybridized to the same fragments of DNA in both the wild-type and mutant isolates . However, two other probes detected a new fragment for a single aflagellate mutant . The observations that spontaneous nonmotile mutants occurred at a high frequency and that these mutants did not revert at a detectable frequency suggested that a genetic event is involved . The phenomenon appears to be limited to classical V . cholerae and may explain why classical V . cholerae is only sporadically associated with disease in the current pandemic.

Infect Immun, 1990 Nov, 58(11), 3568 - 73
Molecular epidemiologic evidence for association of thermostable direct hemolysin (TDH) and TDH-related hemolysin of Vibrio parahaemolyticus with gastroenteritis; Shirai H et al.; The Kanagawa phenomenon induced by the thermostable direct hemolysin (TDH) of Vibrio parahaemolyticus is almost exclusively associated with clinical strains, and TDH has been considered an important virulence factor . However, Kanagawa phenomenon-negative strains isolated from patients with diarrhea have recently been shown to produce TDH-related hemolysin (TRH) . We studied the distribution of the tdh gene encoding TDH and the trh gene encoding TRH in vibrios by hybridization analyses . The presence or absence of the tdh gene and the trh gene in 285 strains of V . parahaemolyticus was examined by the DNA colony hybridization test with a tdh gene-specific probe and a newly constructed trh gene-specific probe . For assessment of the importance of TRH, many Kanagawa phenomenon-negative clinical strains (35.4% of all strains) were included . Of 214 clinical strains of V . parahaemolyticus, 112 strains (52.3%) had the tdh gene only, 52 strains (24.3%) had the trh gene only, and 24 strains (11.2%) carried both the tdh and the trh gene . The coexistence of the tdh and trh genes in these 24 strains was confirmed by Southern blot hybridization analysis . Of 71 environmental strains, 5 strains (7.0%) hybridized very weakly with the trh gene probe and none hybridized with the tdh gene probe . These results suggest that TRH as well as TDH is an important virulence factor of V . parahaemolyticus . Among 118 strains of other Vibrio species examined for the trh gene, only 1 strain of Vibrio furnissii gave a very weak hybridization signal . Among 48 representative trh gene-positive strains of V . parahaemolyticus, only 18 strains (37.5%) were found to produce TRH in culture medium when examined by a sensitive enzyme-linked immunosorbent assay method.

Antonie Van Leeuwenhoek, 1990 Nov, 58(4), 271 - 5
Characterization of two sulfate-reducing bacteria from the gut of the soil-feeding termite, Cubitermes speciosus; Brauman A et al.; Two sulfate-reducing bacteria (SRB) were isolated from a mixed culture enriched with benzoate obtained from gut homogenate of the soil-feeding higher termite, Cubitermes speciosus . The organisms were vibrioid rods, staining Gram-negative, which performed incomplete substrate oxidation . They differed in several features . The smaller one, strain STp, was motile with a single polar flagellum . This strain differed from Desulfovibrio desulfuricans only by its inability to oxidize malate and pentanol . The bigger one, strain STg, differed from Desulfovibrio giganteus only by its nonmotility and a lower length . It is the first evidence of the presence of SRB in termite gut.

Nippon Saikingaku Zasshi, 1990 Nov, 45(6), 913 - 9
{Relationship between the anti-hemolysin activity and the structure of catechins and theaflavins}; Ikigai H et al.; We examined the corresponding isomers of catechins and theaflavins for anti-hemolysin activities against Staphylococcus aureus alpha-toxin and Vibrio cholerae O1 hemolysin . Catechins and theaflavins showed anti-hemolysin activities in a dose-dependent manner . Among the catechins tested, (-)catechin gallate, (-)epicatechin gallate and (-)epigallocatechin gallate having galloyl groups in their molecules showed more potent anti-hemolysin activities against both toxins . On the other hand, free catechins, i . e . (-)catechin, (-)gallocatechin, (-) epicatechin and (-)epigallocatechin had low anti-hemolysin activities against alpha-toxin . Although (-)catechin or (-)gallocatechin had no effect on cholera hemolysin, (-) epicatechin and (-)epigallocatechin were slightly inhibitory . Among dextrocatechins, (+) epicatechin and (+)epigallocatechin proved to be more effective than (+)catechin and (+) gallocatechin . The anti-hemolysin activities of theaflavins against alpha-toxin and cholera hemolysin were dependent on the number of the galloyl group in their structure . These results suggest that the tertiary structure of the catechin or theaflavin and the active site of hemolysin, that affects the interaction between them, plays an important role in the anti-hemolysin activity.

Cancer Biochem Biophys, 1990 Nov, 11(4), 275 - 87
DNA damage and cell killing by nitrofurantoin in relation to its carcinogenic potential; Mukherjee U et al.; Nitrofurantoin inhibited growth and produced loss of viability of Vibrio cholerae cells in a dose-dependent manner, the 10% (D10) and 37% (D37) survival doses being 18.0 and 5.5 micrograms/ml x hr . respectively . The drug also caused filamentation of the cells in a very significant manner . Ultraviolet absorption data and thermal chromatography through hydroxyapatite column revealed that nitrofurantoin treatment of Vibrio cholerae cells produced a maximum amount of 55% of DNA reversibly bihelical due to the formation of inter-strand cross-links . Helix-coil transition studies carried out by viscometric and also, spectrophotometric methods revealed that the nitrofurantoin-induced cross-links in Vibrio cholerae DNA, imparted to this DNA greater thermal stability than that of native DNA . The quantitative aspect and also the mode of nitrofurantoin action on DNA of Vibrio cholerae and Escherichia coli cells vis-a-vis the carcinogenic potential of the drug were discussed.

Eur J Biochem, 1990 Oct 24, 193(2), 395 - 9
Sequence of subunit c of the sodium ion translocating adenosine triphosphate synthase of Propionigenium modestum; Ludwig W et al.; The 30 N-terminal amino acid residues of the purified ATPase c subunit of Propionigenium modestum have been determined . An oligonucleotide mixture was derived from this sequence and used as probe for cloning the corresponding gene in Escherichia coli . The nucleotide sequence of the gene has been determined and compared with those of ATPase c subunits from other bacteria and chloroplasts . Peculiar sequence similarities are found only at the C-terminus between the c subunits of the ATPases from P . modestum and from Vibrio alginolyticus, another putative Na(+)-translocating ATPase.

FEMS Microbiol Lett, 1990 Oct, 60(1-2), 163 - 7
Incidence of Vibrio vulnificus in northern New England water and shellfish; O'Neill KR et al.; Vibrio vulnificus, an autochthonous inhabitant of the estuarine environment, was detected in water and oysters from the Great Bay Estuary System of New Hampshire and Maine . Previously, it had not been detected north of Boston Harbor on the east coast of the United States . V . vulnificus was detected in water and shellfish samples at five out of ten sites, and only in areas that were not open to recreational shellfishing . Although samples were collected from May into December, V . vulnificus was only detected in shellfish in July and August . Water sampling began in August, and V . vulnificus persisted at one site into October.

Int J Syst Bacteriol, 1990 Oct, 40(4), 331 - 6
Taxonomy of four marine bacterial strains that produce tetrodotoxin; Simidu U et al.; Four strains of tetrodotoxin-producing bacteria isolated from a red alga and from pufferfish were characterized . Two of these strains are members of the genus Listonella MacDonell and Colwell . The phenotypic characteristics, guanine-plus-cytosine contents, and base sequences of the 16S rRNAs of these organisms indicated that they are members of Listonella pelagia (Vibrio pelagius) biovar II . The other two strains are members of the genus Alteromonas Baumann et al . and the genus Shewanella MacDonell and Colwell . These two strains are mutually distinct and distinct from the previously described Alteromonas and Shewanella species and therefore are placed in new species . The names Shewanella alga and Alteromonas tetraodonis are proposed for these organisms; the type strains are strains OK-1 and GFC, respectively.

Kansenshogaku Zasshi, 1990 Oct, 64(10), 1330 - 6
{Development and testing of cholera enterotoxin gene probe for detection of toxigenic Vibrio cholerae O1}; Seto K et al.; A DNA probe was developed for the genetic detection from cholera enterotoxin (CT) producing Vibrio cholerae O1 and other organisms . The structural genes of CT (ctx) were cloned from chromosomal DNA of CT producing V . cholerae O1 569B . We subcloned a 552-base-pair fragment encoding a part of CT A-subunit for use of the CT-probe, and made the recombinant plasmid called pSKM24 which has eight copies of the CT-probe . The 32P-labeled CT-probe detected ctx in 72 isolates such as V . cholerae O1, V . cholerae non-O1 and other species of bacteria, but did not react heat-labile enterotoxin genes in enterotoxigenic Escherichia coli (ETEC) by DNA hybridization . The colony hybridization test using the CT-probe is specific, rapid and useful technique for detection of ctx and identification of CT producing V . cholerae.

Kansenshogaku Zasshi, 1990 Oct, 64(10), 1323 - 9
{Detection of toxigenic Vibrio cholerae O1 using polymerase chain reaction for amplifying the cholera enterotoxin gene}; Kobayashi K et al.; A rapid and simple procedure using polymerase chain reaction (PCR) was developed for the detection of cholera enterotoxin (CT) producing character . This method is based on amplifying a 380 base pair (bp) segment of the CT gene (ctx) which controls the production of CT . Two single-stranded oligonucleotides, synthetized to be complementary to the known nucleotide sequences of genes encoding the A-subunit of ctx, were used as extension primers . The oligonucleotide sequences are 5'TCAAACTATATTGTCTGGTC (CT-1) and 5'CGCAAGTATTACTCATCGA (CT-2) . As template DNA was used 5 microliter of boiled bacterial culture broth at 95 degrees C for 5 min without the need for DNA extraction . The amplified target DNA were confirmed with only CT producing Vibrio cholerae O1 but not with CT non-producing organisms such as heat labile enterotoxin producing Escherichia coli by electrophoretic analysis of PCR mixture after amplification . A few isolates of CT producing V . mimicus and V . cholerae non-O1 were identified.

Vaccine, 1990 Oct, 8(5), 469 - 72
Field trial of oral cholera vaccines in Bangladesh: evaluation of anti-bacterial and anti-toxic breast-milk immunity in response to ingestion of the vaccines; Clemens JD et al.; In a field trial conducted in Bangladesh, ingestion of either B subunit-killed whole cell (BS-WC) or killed whole cell (WC) oral cholera vaccines by mothers was associated with a 47% reduction of the risk of cholera in their non-vaccinated children aged under 36 months . Because vaccine-induced breast-milk immunity seemed a possible explanation for these findings, we evaluated anti-lipopolysaccharide (LPS) and anti-cholera toxin (CT) IgA antibody responses in breast milk collected during the trial from 53 lactating women who ingested three doses of BS-WC, WC, or an Escherichia coli K12 strain (K12) . Despite induction of moderate vibriocidal (1.4 to 2.0-fold) and anti-CT (4.5-fold) serum antibody responses, the vaccines did not elicit significant rises of anti-LPS or anti-CT IgA breast-milk antibodies . The failure of the vaccines to elicit significant levels of breast-milk anti-cholera antibodies suggests an alternative explanation for protection of young children by maternal vaccination, such as interruption of maternal-child transmission of Vibrio cholerae 01.

J Med Microbiol, 1990 Oct, 33(2), 107 - 14
Plasmids and factors associated with virulence in environmental isolates of Vibrio cholerae non-O1 in Bangladesh; Barja JL et al.; Plasmid profiles and factors associated with toxigenicity in 51 strains of Vibrio cholerae non-O1 isolated from water samples collected in Bangladesh were analysed . Eleven (21.5%) strains were found to harbour at least one plasmid of 1.7-115 Mda; seven of these strains shared a 115-Mda plasmid . Six of 13 strains tested gave positive cytotoxic and enterotoxic responses . However, two non-cytotoxic strains were enterotoxigenic . Only three of the six cytotoxic and enterotoxic strains caused haemagglutination of human erythrocytes which indicated that toxin production and haemagglutinating activity were unrelated in these V . cholerae non-O1 strains . Conjugal transfer assays demonstrated that the 115-Mda plasmid harboured by some of the toxigenic V . cholerae non-O1 strains carried genes coding for antibiotic resistance and cytotoxin production but not for enterotoxin production . However, this plasmid was also carried by non-toxigenic strains . Some other strains carrying no plasmids or only small-mol.-wt plasmids, were found to be toxigenic . Therefore, toxin production is not plasmid-mediated in all V . cholerae non-O1 strains . Regardless of their pathogenic potential, V . cholerae non-O1 strains possessed the capacity to grow in conditions of iron limitation and, under these conditions, synthesis of at least two new outer-membrane proteins was induced.

J Clin Microbiol, 1990 Oct, 28(10), 2175 - 7
Recombinant fusion protein for simple detection of Escherichia coli heat-stable enterotoxin by GM1 enzyme-linked immunosorbent assay; Sanchez J et al.; A recombinant gene fusion protein composed of an Escherichia coli heat-stable enterotoxin (STa) peptide epitope fused to the amino end of the cholera toxin B subunit was used to detect STa produced by clinical isolates of enterotoxigenic E . coli (STa-ETEC) by a single monoclonal antibody-based inhibition GM1 enzyme-linked immunosorbent assay . In this test, 100% sensitivity and 100% specificity were observed for use of the recombinant protein in either its purified form or as crude Vibrio cholerae culture supernatants in detection of STa-ETEC.

Infect Immun, 1990 Oct, 58(10), 3415 - 24
Development of an in vitro model for study of non-O1 Vibrio cholerae virulence using Caco-2 cells; Panigrahi P et al.; Non-O1 Vibrio cholerae strains have been reported as a causative agent of diarrhea throughout the world . We recently reported that non-O1 V . cholerae strains cause diarrhea in human volunteers . In this study we evaluated the virulence of three strains of non-O1 V . cholerae in a Caco-2 cell adherence assay by light and electron microscopy . A-5 is an environmental isolate which failed to colonized volunteers and did not cause diarrhea . It exhibited low numbers of organisms adherent to Caco-2 cells, leaving the microvilli intact . Strain 2076-79, isolated from a patient with diarrhea, colonized human volunteers without producing disease . It adhered to Caco-2 cells in moderate numbers without producing any damage to the microvilli . Strain NRT36S, a clinical isolate, colonized human volunteers and produced significant diarrhea disease . This strain adhered in very large numbers to Caco-2 cells and caused damage to the brush borders . Membrane-bound bacteria were also seen within the cytoplasm of these cells . Scanning electron microscopy confirmed the generalized adherence of NRT36S to the microvilli of Caco-2 cells . The three strains did not appear to compete with each other for binding sites on Caco-2 cells and were not adherent when assays were conducted at 4 degrees C . Our results with strains A-5, 2076-79, and NRT36S correlate well with observations in human volunteer studies, suggesting that Caco-2 cells provide an appropriate in vitro system for further investigation of the pathogenesis of non-O1 V . cholerae gastroenteritis.

Infect Immun, 1990 Oct, 58(10), 3375 - 9
Vibrio cholerae HlyA hemolysin is processed by proteolysis; Hall RH et al.; The leukocidal activity of the Vibrio cholerae hemolysin (HlyA) was utilized to detect, enrich, and clone hybridoma cells expressing neutralizing monoclonal antibody in a new survivor selection protocol . A bank of 550 hybridoma clones was obtained from a mouse immunized with hemolysin by using standard techniques . The hybridoma bank was treated with a dose of HlyA hemolysin lethal to nonimmune clones . Five surviving hybridoma clones (X1 through X5) which possessed anti-HlyA activity were obtained . Western immunoblot analysis of V . cholerae culture supernatants with monoclonal antibody from clone X1 identified proteins with Mrs of 83,200, 71,600, and 60,300 . Amino-terminal sequence analysis of the 71,600-Mr and 60,300-Mr forms showed homology with the published predicted sequence of HlyA . Our data indicate that proteolytic cleavage occurs between residues 120 and 121 (Glu-Leu) of the 83,200-Mr form, producing the 71,600-Mr form with the terminus NH2-L-L-F-T-P-F-D-Q-A-E-E- . Cleavage between residues 150 and 151 (Gly-Phe) releases the 60,300-Mr form with the terminus NH2-F-A-S-P-A-P-A-N-S-E- . Calculations based on the DNA sequence and the N termini indicated that the actual molecular masses of the 83,200-, 71,600-, and 60,300-Mr forms were, respectively, 79.4 kilodaltons (kDa), 68.6 kDa, and 65.3 kDa . Survivor selection and amino-terminal microsequencing offer powerful tools for the analysis of leukotoxic agents.

Infect Immun, 1990 Oct, 58(10), 3325 - 9
Cloning and nucleotide sequence of a heat-stable enterotoxin gene from Vibrio cholerae non-O1 isolated from a patient with traveler's diarrhea; Ogawa A et al.; We determined the nucleotide sequence of the heat-stable enterotoxin (STa) gene of the Vibrio cholerae non-O1 strain NRT36 isolated from a patient with traveler's diarrhea . The gene is chromosomally encoded and the presumed product is 78 amino acids in length, with a molecular weight of 8,814, though the genes of Escherichia coli STa(s) (STh and STp) are encoded in plasmid DNA and both products are 72 amino acids in length . The first 18 amino acids at the NH2 terminus were hydrophobic, suggesting that this region of the polypeptide acts as a signal sequence for the toxin . The last 17 amino acids at the COOH terminus were identical to those deduced from the toxin (NAG-ST) produced by V . cholerae non-O1 strain A-5 isolated from a frozen shrimp . The deduced amino acid sequence of the NAG-ST precursor had 50 and 46% homology to those of E . coli STh and STp, respectively . The hydropathy plot analysis of each predicted protein revealed similar profiles between them, suggesting that the NAG-ST precursor has structural similarity to those of E . coli STa(s).

Appl Environ Microbiol, 1990 Oct, 56(10), 3130 - 2
Restriction fragment length polymorphism of the Vibrio anguillarum serovar O1 virulence plasmid; Olsen JE et al.; Seventy-eight strains of Vibrio anguillarum serovar O1, all harboring one 65- to 70-kilobase plasmid, were typed according to restriction fragment length polymorphism of the plasmid . Six types, three of which comprised 96% of the strains examined, were produced with the restriction endonuclease BamHI . The fragment length polymorphism type did not correlate to any of 12 different phenotypic properties tested.

Biochem Biophys Res Commun, 1990 Sep 28, 171(3), 1175 - 81
Penicillin binding proteins of Vibrio cholerae; Sengupta TK et al.; Eleven penicillin binding proteins (PBPs) of Vibrio cholerae have been identified using {125I} labelled p-hydroxybenzyl penicillin (PenX) . These proteins are localised in the inner membrane and have molecular weights ranging from 97,000 to 22,000 . Neutral hydroxylamine released the labelled PenX from the PBPs and pretreatment with cold benzyl penicillin inhibited labelling completely . The PBP 4 is the most sensitive target for cephaloridine and aztreonam . Cephaloridine also binds to three other high molecular weight PBPs, 1, 2 and 3 . Aztreonam, in addition to PBP 4, has affinity for another low molecular weight PBP, PBP 7 . Mecillinam has affinity for PBPs 1, 4 and 11.

J Biol Chem, 1990 Sep 25, 265(27), 16581 - 7
Nucleotide sequence, expression, and properties of luciferase coded by lux genes from a terrestrial bacterium; Szittner R et al.; The lux genes required for expression of luminescence have been cloned from a terrestrial bacterium, Xenorhabdus luminescens, and the nucleotide sequences of the luxA and luxB genes coding for the alpha and beta subunits of luciferase determined . The lux gene organization was closely related to that of marine bacteria from the Vibrio genus with the luxD gene being located immediately upstream and the luxE downstream of the luciferase genes, luxAB . A high degree of homology (85% identity) was found between the amino acid sequences of the alpha subunits of X . luminescens luciferase and the luciferase from a marine bacterium, Vibrio harveyi, whereas the beta subunits of the two luciferases had only 60% identity in amino acid sequence . The similarity in the sequences of the alpha subunits of the two luciferases was also reflected in the substrate specificities and turnover rates with different fatty aldehydes supporting the proposal that the alpha subunit almost exclusively controls these properties . The luciferase from X . luminescens was shown to have a remarkably high thermal stability being stable at 45 degrees C (t 1/2 greater than 3 h) whereas V . harveyi luciferase was rapidly inactivated at this temperature (t 1/2 = 5 min) . These results indicate that the X . luminescens lux system may be the bacterial bioluminescent system of choice for application in coupled luminescent assays and expression of lux genes in eukaryotic systems at higher temperatures.

FEMS Microbiol Lett, 1990 Sep 15, 59(3), 319 - 23
Nucleotide sequence of the thermostable direct hemolysin gene (tdh gene) of Vibrio mimicus and its evolutionary relationship with the tdh genes of Vibrio parahaemolyticus; Terai A et al.; The gene encoding a hemolysin similar to the thermostable direct hemolysin (TDH) of Vibrio parahaemolyticus was previously cloned from the chromosome of Vibrio mimicus . The nucleotide sequence of the hemolysin gene was determined in this study . The gene proved to be a variant of the thermostable direct hemolysin gene (tdh gene) and was designated as Vm-tdh because the sequence divergences between the Vm-tdh gene and four tdh genes of V . parahaemolyticus were 2.1-3.0%, while the sequence divergences among the four tdh genes of V . parahaemolyticus ranged between 1.4 and 3.3% . Analysis of these five tdh genes revealed that they evolved from a common ancestor in discrete and understandable order by sporadic base substitutions.

J Bacteriol, 1990 Sep, 172(9), 5236 - 44
Ion selectivity of the Vibrio alginolyticus flagellar motor; Liu JZ et al.; The marine bacterium, Vibrio alginolyticus, normally requires sodium for motility . We found that lithium will substitute for sodium . In neutral pH buffers, the membrane potential and swimming speed of glycolyzing bacteria reached maximal values as sodium or lithium concentration was increased . While the maximal potentials obtained in the two cations were comparable, the maximal swimming speed was substantially lower in lithium . Over a wide range of sodium concentration, the bacteria maintained an invariant sodium electrochemical potential as determined by membrane potential and intracellular sodium measurements . Over this range the increase of swimming speed took Michaelis-Menten form . Artificial energization of swimming motility required imposition of a voltage difference in concert with a sodium pulse . The cation selectivity and concentration dependence exhibited by the motile apparatus depended on the viscosity of the medium . In high-viscosity media, swimming speeds were relatively independent of either ion type or concentration . These facts parallel and extend observations of the swimming behavior of bacteria propelled by proton-powered flagella . In particular, they show that ion transfers limit unloaded motor speed in this bacterium and imply that the coupling between ion transfers and force generation must be fairly tight.

Infect Immun, 1990 Sep, 58(9), 3129 - 34
Role of the P plasmid in attenuation of Vibrio cholerae O1; Bartowsky EJ et al.; The conjugative plasmid P of Vibrio cholerae has been shown to have a suppressive effect on the virulence of hypertoxigenic strains like 569B . In this study, we have sought to analyze this phenomenon . Utilizing the infant mouse cholera model, we have demonstrated that the presence of P increases the 50% lethal dose of V . cholerae classical Inaba 569B by more than 300-fold . No effect of P on cholera toxin (CT) production, whether measured by GM1 enzyme-linked immunosorbent assay, by CT activity in ligated rabbit ileal loops, or by transcription from the CT promoter, could be discerned . Colonization of the intestine by P+ derivatives was dramatically reduced although only a minor effect could also be demonstrated on in vitro attachment to intestinal strips . Electron microscopic examination suggested that the P plasmid was affecting the production of the TCP pilus . Another conjugative plasmid, V, has also been examined, but it had no effect on virulence.

J Diarrhoeal Dis Res, 1990 Sep, 8(3), 94 - 6
A cholera outbreak associated with eating uncooked pork in Thailand; Swaddiwudhipong W et al.; In a village near Chiangmai, Thailand, during October 1987, there was an outbreak of cholera following a funeral in which 264 attendants were served food . The present article is a report of an epidemiological study performed to identify the source of infection and the mode of its transmission . All the attendants were screened for infection by bacteriological examination of their rectal swabs and were kept under diarrhoeal surveillance . Of them, 20 patients and 40 matched controls were interviewed about the details of their eating foods served at the funeral . Vibrio cholerae 01, Inaba, El Tor was detected from 24 persons (9.1%), 15 of whom suffered from mild diarrhoea and the rest 9 had inapparent infections . There was no death . Except one butcher whose rectal swab was positive for the same strain of V . cholerae, 3 other butchers and 4 women who had prepared food were free from the infection . Food remnants were not available for culture . The water used for cooking and the water from the cement well used for slaughter were negative for the organism . The only significant association (p less than .01, odds ratio = 15) was found between an attack of cholera and eating laebmoo--an uncooked pork preparation with Thai spices and chili . The transmission of cholera appeared to have occurred through eating the uncooked pork presumably due to its contamination with V . cholerae shed by the infected butcher . He was known to have earlier visits to Chiangmai where cholera epidemic was going on.

Gene, 1990 Sep 1, 93(1), 9 - 15
Cloning and expression of two genes encoding highly homologous hemolysins from a Kanagawa phenomenon-positive Vibrio parahaemolyticus T4750 strain; Iida T et al.; We have cloned and sequenced the gene encoding thermostable direct hemolysin (TDH), a possible virulence factor in Vibrio parahaemolyticus gastroenteritis, from a Kanagawa-phenomenon-positive strain, T4750 . This strain was found to contain two sequences (tdhA and tdhS) homologous to the tdh gene previously reported by Nishibuchi and Kaper {J . Bacteriol 162 (1985) 558-564} and Taniguchi et al . {Microb . Pathog . 1 (1986) 425-432} . Sequence homology of the coding regior between tdhA and tdhS was 97.2% . The deduced amino acid (aa) sequence of TdhA, excluding the putative signal peptide was identical to that of TDH protein purified from V . parahaemolyticus {Tsunasawa et al., J . Biochem . 101 (1987) 111-121} except for Glu118 instead of Gln118 . Although the aa sequence deduced from the second gene, tdhS, differed in eight residues from the TDH protein, it agreed with the sequence of Tdh deduced from the previously cloned tdh gene . Both tdhA and tdhS expressed biologically active hemolysins in Escherichia coli . While the apparent molecular size of TDH purified from a culture supernatant of V . parahaemolyticus T4750 was identical to TdhA protein synthesized in E . coli, it was larger than TdhS . Only one band was detected in the culture supernatant of V . parahaemolyticus T4750 by Western blotting; its mobility was indistinguishable from that of purified TDH . These data suggest that tdhA is the structural gene for TDH found in the culture supernatant of V . parahaemolyticus T4750, and that there was only partial, if any, tdhS expression in the strain T4750 under the test conditions employed.

Gene, 1990 Sep 1, 93(1), 143 - 6
Construction of cloning vectors using the Vibrio harveyi luminescence genes luxA and luxB as markers; Sevigny P et al.; A synthetic oligodeoxyribonucleotide harboring four new restriction sites was inserted into the luxB gene of Vibrio harveyi . This insertion did not disrupt the reading frame . An active beta-subunit was synthesized since a plasmid with both the luxA and mutated luxB genes conferred upon Escherichia coli the bacterial luciferase (Lux) phenotype in the presence of an aldehyde . Ligation of a piece of foreign DNA at these new cloning sites in the vector extinguish the Lux phenotype of the transformed bacteria . Therefore, the plasmid was used as a cloning vector, and recombinant DNA-containing bacteria were detected by the loss of bioluminescence . To create more versatile plasmids, the intergenic region of phage f1 was inserted outside of the lux genes . The selection by loss of bioluminescence presents several advantages over the white/blue selection of the lacZ gene on indicator plates.

J Bacteriol, 1990 Sep, 172(9), 4749 - 57
Monitoring of naphthalene catabolism by bioluminescence with nah-lux transcriptional fusions; Burlage RS et al.; We have demonstrated the efficacy of a light-generating genetic construction in describing the induction of a nah operon for the catabolism of naphthalene . A fragment from plasmid NAH7, which contains the promoter for the upper pathway of degradation, was transcriptionally fused to the lux genes of Vibrio fischeri . A Pseudomonas strain containing this construction is inducible to high levels of light production in the presence of a suitable substrate and the nahR regulatory gene product . This system was used to examine catabolic activity in a unique manner under a variety of growth conditions . Induction of bioluminescence was demonstrated to coincide with naphthalene degradation in all cases through the use of mineralization assays . A significant delay in bioluminescence and biodegradation was observed when naphthalene was added to batch cultures that were growing exponentially . These results suggest that the metabolism of naphthalene by this Pseudomonas strain is optimal when the growth rate of the culture is slow and is greatly reduced during exponential growth.

Mol Gen Mikrobiol Virusol, 1990 Sep, (9), 14 - 8
{Purification and various properties of Vibrio cholerae NON-01 cytolysin}; Tsittser AO et al.; A new method for isolation and purification of Vibrio cholerae non-01 cytolysin has been elaborated . It includes the steps of concentration by ammonium sulphate, ion exchange chromatography on DE-52-cellulose, gel filtration via ultragel AsA-44 and chromatography on Mono Q . Cytolysin is shown to be a 60 kD and pI 6.2 protein . It is not inactivated by thiol-restoring agents and induces the production of precipitating antibodies . In contrast to choleragen the protein cytolytically affects erythrocytes and cells of the line L-929 . It also possesses the lethal and oedematous effect and demonstrates the enteropathogenic effect on nursing rabbits.

Res Microbiol, 1990 Sep-Oct, 141(7-8), 921 - 9
Delivery of the cholera toxin B subunit by using a recombinant Yersinia enterocolitica strain as a live oral carrier; Sory MP et al.; The gene ctxB encoding the cholera toxin B subunit was subcloned to design its production by Yersinia enterocolitica . It was joined in two ways to yopH, a gene of the virulence plasmid pYV specific to this genus . This gene encodes one of the major Yop proteins (YopH) secreted by bacteria incubated at 37 degrees C in a Ca(2+)-deprived medium . In a first construction, an operon fusion was obtained between ctxB and yopH so that CT-B and a truncated YopH protein were produced . The recombinant CT-B from Y . enterocolitica was structurally and antigenically similar to CT-B produced by Vibrio cholerae . In another construction, the fusion gene obtained directed the production of YopH'/CT-B hybrid proteins that were secreted by Y . enterocolitica . In both cases, Y . enterocolitica directed the production of the recombinant proteins only when the bacteria were incubated in conditions of Yops production . When bacteria carrying the operon fusion were given orally to mice, a clear serum antibody response against CT-B was detected by ELISA . According to immunoblot analysis, this response was only directed against the polymeric form of the B subunit.

Res Microbiol, 1990 Sep-Oct, 141(7-8), 901 - 6
Recombinant attenuated Vibrio cholerae strains used as live oral vaccines; Kaper JB et al.; Although great strides have been made in the development of recombinant attenuated Vibrio cholerae vaccine strains, the task has not been as simple as once imagined . The initial vaccine candidates proved to be unexpectedly reactogenic but further derivatives, such as CVD103-HgR, are well-tolerated, immunogenic and protective after a single dose . In addition, this strain carries a selectable marker to distinguish it from wild strains and has been evaluated in a practical, lyophilized formulation (Levine et al., 1988b) . While CVD103-HgR is being further evaluated in expanded trials, we are also investigating a new secretogenic factor which could possibly explain the diarrhoea seen with the earlier vaccine strains . Hopefully, these studies will achieve the long-sought goal of a safe and effective vaccine for the prevention of cholera.

J Commun Dis, 1990 Sep, 22(3), 151 - 9
Epidemiological profile of outbreaks of cholera in India during 1975-1989; Datta KK et al.; Cholera has been present in India since antiquity . Six pandemics originated in Indian subcontinent . The present seventh pandemic caused by El Tor Vibrio cholerae started from Indonesia (Sulawesi) in 1961 and entered India in 1964 . By the end of 1965 it has replaced the age old classical V . cholerae . Many of the States which never had cholera or were free from it for a long time got infected and became endemic foci of El Tor infection . This article reviews the epidemiological features of important outbreaks reported after 1975 in India.

Infect Immun, 1990 Sep, 58(9), 3042 - 9
Vibrio cholerae O395 tcpA pilin gene sequence and comparison of predicted protein structural features to those of type 4 pilins; Shaw CE et al.; Vibrio cholerae O1 expresses a pilus that is coordinately regulated with cholera toxin production and hence termed TCP, for toxin-coregulated pilus . Insertion of Tn5 IS50L::phoA (TnphoA) into the major pilin subunit gene, tcpA, has previously been shown to render the strain avirulent as a result of its inability to colonize . One such insertion was isolated and used as a probe to screen for clones containing the intact tcpA gene . The DNA sequence of tcpA was determined by using the intact gene and several tcpA-phoA gene fusions . The deduced protein sequence agreed completely with that previously determined for the TcpA N terminus and with the size of the mature pilin protein . The reported homology with N-methylphenylalanine (type 4) pilins near the N terminus was extended and shown to include components of the atypical leader peptide as well as overall predicted structural similarities in other regions of the pilins . In contrast to the modified N-terminal phenylalanine residue found in all characterized type 4 pilins, the corresponding position in tcpA contains a Met codon, thus implying that the previously uncharacterized amino acid corresponding to the N-terminal position of the mature TcpA pilin is a modified form of methionine . Except for this difference, mature TcpA has the overall predicted structural motifs shared among type 4 pilins.

J Gen Microbiol, 1990 Sep, 136 ( Pt 9), 1839 - 47
Purification of El Tor cholera enterotoxins and comparisons with classical toxin; Dubey RS et al.; In 55 clinical isolates of Vibrio cholerae biotype El Tor, cholera toxin (CT) production was higher after growth in liquid medium first under relatively anaerobic conditions followed by excessive aeration (AKI conditions) as compared with growth under the optimal conditions for CT production from V . cholerae of classical biotype (median toxin level being 400 ng ml-1 and 1 ng ml-1 respectively, for the two different growth conditions) . Large growth volumes further enhanced El Tor toxin production to levels at or above 3-5 micrograms ml-1 from several strains, which allowed for easy purification of toxin by salt precipitation, aluminium hydroxide adsorption and/or GM1 ganglioside affinity chromatography . However, such purified El Tor CT completely lacked the A subunit when examined by SDS-PAGE or by monoclonal anti-A subunit antibody GM1-ELISA . In contrast, when El Tor CT was prepared from bacteria grown in the presence of specific antiserum against soluble haemagglutinin/protease it contained the A subunit (unnicked) in the same proportion to the B subunit (1A:5B) as classical CT . Immunodiffusion-in-gel tests revealed that the B subunits of El Tor and classical CTs share major epitopes but also have one or more weaker biotype-specific epitopes . The two types of toxin were practically indistinguishable in various GM1-ELISA tests, and antisera raised against El Tor and classical CT, respectively, could also completely neutralize the heterologous as well as the homologous toxin activity in vivo . The results indicate that CTs from El Tor and classical V . cholerae, despite demonstrable epitope differences, are predominantly cross-reactive and give rise to antisera with strong cross-neutralizing activity.

Infect Immun, 1990 Sep, 58(9), 2755 - 9
Production of a monoclonal antibody to Vibrio cholerae non-O1 heat-stable enterotoxin (ST) which is cross-reactive with Yersinia enterocolitica ST; Takeda T et al.; A monoclonal antibody (MAb) against synthetic heat-stable enterotoxin of Vibrio cholerae non-O1 (NAG-ST) was produced . The MAb, namely, 2F, belonged to the immunoglobulin G1 class . Ascitic fluid drawn from pristane-primed BALB/c mice injected with a 2F-producing clone demonstrated anti-NAG-ST activity which could be detected in enzyme-linked immunosorbent assay even at a dilution of 1:128,000 . Fifty-fold-diluted ascitic fluid could completely neutralize the activity of NAG-ST (synthetic and native) and Vibrio mimicus ST (identical to NAG-ST) in suckling mice . In the same assay, 2F could also neutralize Yersinia enterocolitica ST (Y-ST) but did not neutralize Escherichia coli STh and STp . A similar pattern of reactivity occurred in a competitive enzyme-linked immunosorbent assay with homologous and heterologous toxins . Competitive inhibition curves with synthetic peptides representing NAG-ST and its shorter analogs revealed that aspartic acid located at position 2 from the N terminus of NAG-ST was the essential residue of the recognized epitope . Significantly, in Y-ST, to which 2F cross-reacted, aspartic acid is in the corresponding position as that of NAG-ST, thereby confirming our conclusions that the epitope defining this MAb is aspartic acid.

Appl Environ Microbiol, 1990 Aug, 56(8), 2277 - 81
The unique stability of Vibrio proteolyticus neutral protease under alkaline conditions affords a selective step for purification and use in amino acid-coupling reactions; Durham DR; A procedure is described for the purification of a neutral protease from fermentation broths of Vibrio proteolyticus . The key feature of the purification scheme is the selective, irreversible inactivation of a contaminating exoenzyme, aminopeptidase, by alkali treatment, rather than removal of this enzyme by conventional chromatographic methods . Fermentation broths or concentrates were brought to pH 11.5 to 11.7 by Na2CO3-NaOH addition and incubated at 25 degrees C until aminopeptidase activity was diminished . The alkali treatment resulted in greater than 99% reduction of aminopeptidase activity with minimal loss of neutral protease activity . The neutral protease could be further purified to apparent homogeneity by QA-52 cellulose chromatography . The alkali treatment of fermentation concentrates was also useful for preparation of V . proteolyticus neutral protease to effect the coupling of N-protected aspartic acid and phenylalanine methyl ester for the production of N-aspartylphenylalanine methyl ester, a precursor for the sweetener aspartame.

J Bacteriol, 1990 Aug, 172(8), 4725 - 7
A cyanide-aldehyde complex inhibits bacterial luciferase; Makemson JC; Cyanide at high (millimolar) concentrations inhibited in the in vitro Vibrio harveyi luciferase reaction . Cyanide reacted with free aldehyde to form an inhibitor . Inhibitor formation was accelerated by alkaline conditions and bovine serum albumin.

Infect Immun, 1990 Aug, 58(8), 2706 - 9
The cytolysin gene of Vibrio vulnificus: sequence and relationship to the Vibrio cholerae E1 Tor hemolysin gene; Yamamoto K et al.; A cytolysin of ca . 56 kilodaltons has been suggested as a possible virulence factor in Vibrio vulnificus infections . We sequenced the DNA encoding cytolytic activity and found that the sequence contained two open reading frames, vvhA and vvhB . vvhA encoded the structural gene for the cytolysin and contained the N-terminal amino acid sequence previously reported for the protein . Regions of the vvhA gene showed homology to the structural gene for the Vibrio cholerae E1 Tor hemolysin.

Zh Mikrobiol Epidemiol Immunobiol, 1990 Aug, (8), 3 - 5
{The antimicrobial action of the xanthine oxidase-xanthine system on the causative agent of cholera}; Adamov AK et al.; As revealed in experiments on V . cholerae, the enzymatic link xanthine oxidase-xanthine produces a vibriostatic effect at the concentration of xanthine oxidase equal to 0.0125 g/l and a vibriocidal effect at the concentration of xanthine oxidase equal to 0.025 g/l in a medium with pH 7.5-7.6 . In the presence of protein the antivibrionic activity of the xanthine oxidase link is decreased . The introduction of bivalent iron into the enzymatic link xanthine oxidase-xanthine enhances its vibriocidal action on V . cholerae.

Appl Environ Microbiol, 1990 Aug, 56(8), 2370 - 3
Detection of Vibrio cholerae O1 in the aquatic environment by fluorescent-monoclonal antibody and culture methods; Huq A et al.; Vibrio cholerae O1 in plankton samples collected from ponds and rivers between February 1987 and January 1990 in Matlab, Bangladesh, was detected by the fluorescent-monoclonal antibody (FA) technique . Samples were collected at sites which were monitored fortnightly (fixed sites) as well as at sites that were part of a case-control study . FA results were compared with those obtained by conventional culture methods (CM) . A total of 876 samples were collected; V . cholerae O1 was detected in 563 samples (64.27%) by the FA method and in 3 samples (0.34%) by CM . Of the fixed-site plankton samples, 439 (63.62%) were positive by FA and none were positive by CM . Of the 93 case sites sampled on the day after the occurrence of a case of cholera, 73 (78.49%) were positive for V . cholerae O1 by FA and 3 (3.2%) were positive by CM . In comparison, of the 93 first-day sample collections at control sites at the time a case of cholera occurred, only 51 (54.83%) were positive by FA and none were positive by CM . From the data, it is concluded that V . cholerae O1 is present throughout the year in the ponds and rivers of Bangladesh that were examined in this study and that V . cholerae can be detected by FA but not always by CM . The FA procedure was found to be very useful in detecting V . cholerae in plankton, with which it was associated and often occurred in large numbers in the nonculturable stage . Thus, studies investigating the significance of the role of environmental factors in the epidemiology of cholera can be performed effectively by using FA . Such studies are in progress.

Nippon Juigaku Zasshi, 1990 Aug, 52(4), 753 - 7
Migratory deficiency of Clithon retropictus hemocytes to Vibrio parahaemolyticus and Escherichia coli; Kumazawa NH et al.; Hemocytes of a marine gastropod, Nerita albicilla, but not those of an estuarine gastropod, Clithon retropictus, were observed to migrate to live and heat-killed cells of Vibrio parahaemolyticus and Escherichia coli through Nucleopore membrane in Blind well chamber . The defective migration of C . retropictus hemocytes might reflect, at least in part, the survival of V . parahaemolyticus in the estuarine gastropod.

Zh Mikrobiol Epidemiol Immunobiol, 1990 Aug, (8), 62 - 6
{The epidemiological importance of Vibrio cholerae isolated from different ecological systems}; Moskvitina EA et al.; The analysis of the data on the isolation of V . cholerae from different ecological systems indicates that V . eltor do not constantly inhibit the rivers and sea at the territory under control . Hemolytically active V . cholerae without the vct gene, found to be faintly virulent and avirulent when studied on suckling rabbits used as a model and when evaluated by the complex method, show no tendency towards epidemic spread in the presence of conditions for the realization of the transmission of vibrios by the water route.

Biochem Biophys Res Commun, 1990 Jul 31, 170(2), 407 - 15
The nucleotide sequence of the luxA and luxB genes of Xenorhabdus luminescens HM and a comparison of the amino acid sequences of luciferases from four species of bioluminescent bacteria; Johnston TC et al.; The luxA and luxB genes of bioluminescent bacteria encode the alpha and beta subunits of luciferase, respectively . Sequences of the luxA and luxB genes of Xenorhabdus luminescens, the only terrestrial bioluminescent bacterium known, were determined and the amino acid sequence of luciferase deduced . The alpha subunit was found to contain 360 amino acids and has a calculated molecular weight of 41,005 Da, while the beta subunit contains 327 amino acids and has a calculated molecular weight of 37,684 Da . Alignment of this luciferase with the luciferases of three marine bacteria showed 196 (or 55%) conserved residues in the alpha subunit and 114 (or 35%) conserved residues in the beta subunit . The highest degree of homology between any two species was between the luciferases of X . luminescens and Vibrio harveyi with 84% identity in the alpha subunits and 59% identity in the beta subunits.

Biochim Biophys Acta, 1990 Jul 17, 1018(1), 18 - 22
Rapid purification and characterization of F1-ATPase of Vibrio parahaemolyticus; Sakai Y et al.; The F1 portion of H(+)-translocating ATPase as purified from membrane vesicles of Vibrio parahaemolyticus by a rapid procedure . The whole purification process (from culture of cells to purification of the enzyme) could be completed in 1 day . The F1-ATPase consists of five subunits (alpha, beta, gamma, delta and epsilon) like F1 of Escherichia coli and other microorganisms . The F1-ATPase of V . parahaemolyticus showed some interesting properties . Its activity was greatly stimulated by high concentrations (about 0.5 M) of SO4(2-), SO3(2-) and CH3COO-, their effects decreasing in this order . Among the anions tested, Cl- and NO3- were ineffective, or rather inhibitory, and cations had no significant effects . Ethanol (or methanol) stimulated the activity 2- to 3-fold . The activity was inhibited by 4-acetamido-4'-isothiocyanostilbene 2,2'-disulfonate (SITS) (an anion exchanger inhibitor), tetrachlorosalicylanilide (TCS) (an H+ conductor), azide and N-ethylmaleimide . Zinc inhibited the activity only slightly, although it strongly inhibited the ATPase activity in membrane vesicles.

J Invertebr Pathol, 1990 Jul, 56(1), 15 - 9
Interactions between different strains of Vibrio alginolyticus and hemolymph fractions from adult Mytilus edulis; Nottage AS et al.; The juvenile-bivalve pathogen Vibrio alginolyticus NCMB 1339 was toxic, in vitro, to hemocytes from adult Mytilus edulis . Toxicity was mediated by both washed bacterial cells and culture supernates . Washed cells of an environmental isolate of V . alginolyticus, Strain PS-1, were 2.5 times less toxic to Mytilus hemocytes, but this strain did produce a lethal extracellular factor(s) in broth culture, albeit at lower levels than V . alginolyticus NCMB 1339 . Hemolymph fractions from Mytilus exerted a reciprocal toxic effect on the bacteria . Hemocytes were responsible for most of this bacteriocidal activity and toxic oxygen intermediates were involved in the phagocytic defense mechanisms of these cells.

What Is Staphylococcus Aureus?, What Is Activated Sludge?, What Is Amino Acid?, What Is Biotechnology?, What Is Prokaryote?, o, Microorganisms, e, Microbe, n, Microbes, e, Bacteriology, e, Bacteria, n, Escherichia coli, i, Salmonella, o, Enterobacters, s, Escherichia coli, i, Escherichia coli, a, Functional genomics, s, Cryptococci, e, Streptomycin, c, Antibiotics, a, Pseudomonas, o, Microbiological, i, Streptococci, c, Sepsis, c, Escherichia coli, n, Functional genomics, s, Escherichia coli, r, Pasteurella, o, Multidrug resistant, a, Schizosaccharomyces, i, Cryptococci, n, Salmonella

Scientific Publications - Work Done by Microbiology Reader Bioscreen C
Agricultural Microbiology Anaerobic Microbiology Antimicrobial Susceptibility Artificial Atmosphere Bioassay of Antibiotics Biofilm Microbiology Bioreactor Technology Biotechnology Cell Biology Clinical Microbiology Environmental Microbiology Experiments with Yeast	Fermentation Food Microbiology Functional Genomics Gene Technology Growth Media Development Growth Rate and Lag Time Industrial Microbiology Medical/Pharmaceutical Field Microbiological Assay Microbiological Research Microbiology of Cosmetics go to a specific theme...	Military Microbiology Molecular Microbiology Mutagenicity and Genotoxicity Oral Microbiology Patents Postantibiotic Studies Soil Microbiology Spore Microbiology Veterinary Microbiology Waste/Wastewater Treatment Water Microbiology Wine Microbiology

� 2005 Transgalactic Ltd (manufacturer of Bioscreen C software) | Privacy Statement | P.O. Box 1393, 00101 Helsinki, Finland, phone: +358 9 85172920, fax: +358 9 8749481, e-mail: microbiology@bionewsonline.com

Last modified: May 25, 2005