Jpn J Antibiot, 1981 Mar, 34(3), 447 - 52 {Studies on cefotaxime (HR 756) concentration in human biliary tract and clinical effect for acute or subacute cholecystitis with cholelithiasis (author's transl)}; Kasai Y et al.; A new antibiotic drug of cephalosporin with marked resistance to beta-lactamase, cefotaxime (HR 756) for parenteral use in 8 patients with acute or subacute cholecystitis with cholelithiasis . Cefotaxime was administrated by intravenous injection or drip infusion at a daily dose of 1-4 g . Clinical response was excellent in 1 case, good in 7 cases, and fair or poor was none . Clinical adverse effect was not recognized . Cefotaxime in a dose of 1 g was given intravenously during operation to those same 8 patients . Tissue specimens of different places were taken from removed organs . The materials of A-bile and B-bile were subsequently taken at intervals . Determination of cefotaxime concentration was performed according to the bioassay method with Micrococcus luteus ATCC 9341 strain . Cefotaxime concentrations in the A-bile increased gradually until 1 hour after the intravenous administration . Cefotaxime was observed in the B-bile through the gallbladder wall after the intravenous injection. J Gen Virol, 1981 Mar, 53(Pt 1), 133 - 43 Latency of herpesvirus of turkey and Marek's disease virus genomes in a chicken T-lymphoblastoid cell line; Hirai K et al.; The properties of latent herpesvirus of turkey (HVT) and Marek's disease virus (MDV) genomes have been studied in virus-non-producer MDCC-BO1(T) cells, a T-lymphoblastoid cell line derived from spleen cells of an HVT-vaccinated chicken . The numbers of the two virus genomes in BO1(T) cells remained stable at 1.6 to 1.8 HVT genome equivalents/cell and 3.4 to 3.8 MDV genome equivalents/cell throughout a number of passages and were not decreased by the presence of phosphonoacetic acid in the culture . When the culture temperature of the MDV-producer MDCC-MSB1 cell line was shifted from 41 to 37 degrees C, the cells cultured at 37 degrees C contained about five times as many virus genomes as those cultured at 41 degrees C . In contrast, the numbers of the two virus genomes in BO1(T) cells were not increased by culture at 37 degrees C . RNA extracted from BO1(T) whole cells and from the polyribosomal fraction hybridized to both MDV and HVT DNAs, indicating the expression of both latent virus genomes . Digestion of cell nuclei with micrococcal nuclease revealed that both latent HVT and MDV genomes possess a nucleosomal structure . Closed circular MDV DNA was demonstrated in BO1(T) by isopycnic centrifugation of DNA in ethidium-bromide-CsCl gradients. Eur J Biochem, 1981 Mar, 114(3), 577 - 83 The mitochondrial genomes of Ustilago cynodontis and Acanthamoeba castellanii; Mery-Drugeon E et al.; Mitochondrial DNA from Ustilago cynodontis has been investigated in several of its properties . Its dG + dC content is equal to 33.5%; its buoyant density (1.698 g/cm3) is higher, by 5 mg/cm3, and its melting temperature (82.5 degrees C) is lower than expected for a bacterial DNA having the same base composition; the first derivative of its melting curve indicates a large compositional heterogeneity, its molarity of elution from hydroxyapatite is high, 0.28 M phosphate, and allows its partial separation from nuclear DNA . Degradation by micrococcal nuclease indicates that about 25% of the DNA is formed by stretches having no more than 15% dG + dC . Finally, the unit size of mitochondrial genome is about 50 X 10(6) . In most of its properties, the mitochondrial genome of U . cynodontis presents strong analogies with that of Saccharomyces cerevisiae . A parallel investigation on mitochondrial DNA from Acanthamoeba castellanii which has as genome unit size of only 27 X 10(6), has shown that this shares with the former the dG + dC content (32.9%), the melting temperature (82.5 degrees C), a large compositional heterogeneity and a very similar pattern of micrococcal nuclease degradation; its buoyant density (1.692 g/cm3) and its molarity of elution from hydroxyapatite (0.25 M phosphate) are, however, normal, probably because of a different short-sequence pattern and the fact that its dA + dT-rich stretches are shorter, on the average. Biokhimiia, 1981 Mar, 46(3), 422 - 34 {Sensitivity of intranuclear glucocorticoid complex from normal rat liver and Zajdela ascites hepatoma to ionic strength and nuclease treatment}; Krasil'nikov MA et al.; After 30 min of intraperitoneal injection of dexamethasone to adrenectomized rats about 15% of the label are incorporated into liver homogenate and only 1% of the cytosol-bound hormone is detected in the cell nuclei . The binding of the "in vitro" injected hormone by the nuclei does not obey the second-order reactions (the Scatchard plots) . This is probably due to the existence of various ancillary mechanisms, which control the translocation of the hormone complex into cell nuclei at the level of cytoplasm and nuclear membranes . DNAase I, micrococcal nuclease and endogenous nucleolysis markedly increase the part of the nuclear hormone complex resistant to 0.4 M NaCl . In hepatocyte nuclei obtained by the collagenase method, the content of the 0.4 M NaCl-resistant receptor complex is also increased . The resistance of 0.4 M NaCl was also found in 80% of the glucocorticoid-insensitive nuclear complex from Zajdela ascite hepatoma cells . The changes in interaction of the hormone-receptor complex with nuclear acceptor sites eventually resulting in impaired sensitivity of host tissues to hormonal control can be due to the damage of chromatin structure induced by different influences and tumour growth. Cancer Res, 1981 Mar, 41(3), 760 - 6 Excision of ultraviolet damage and the effect of irradiation on DNA synthesis in a strain of Bloom's syndrome fibroblasts; Henson P et al.; We have studied repair of ultraviolet light (UV)-induced damage in a strain of Bloom's syndrome cells which we have shown to be defective in host cell reactivation of UV-irradiated herpes simplex virus . Excision repair was monitored by following loss of sensitivity of DNA in permeabilized cells to digestion by the Micrococcus luteus UV endonuclease preparation . The Bloom's syndrome fibroblasts apparently removed endonuclease-sensitive sites from the DNA slightly less efficiently than did normal strains . After 24 hr, 38% of the sites remained in the Bloom's syndrome cells in comparison with 16% in normal fibroblasts . DNA newly synthesized in UV-irradiated Bloom's syndrome cells sedimented less far into alkaline sucrose gradients than did DNA from similarly treated normal cells . In other respects, including the effect of caffeine exposure, DNA synthesis in Bloom's syndrome cells was indistinguishable from that in normal cells . We were therefore able to detect only minor defects in the repair of UV-induced damage in Bloom's syndrome fibroblasts . This is consistent with the normal survival exhibited by these cells . The defect in excision repair may, however, be sufficient to allow the cellular repair capacity to become saturated at high infecting multiplicities of UV-irradiated herpes simplex virus. Biochim Biophys Acta, 1981 Feb 26, 652(2), 245 - 55 Partial characterization of RNA polymerase II complex released by micrococcal nuclease digestion of rat liver nuclei; Hatayama T et al.; Two forms of RNA polymerase II were released from rat liver chromatin by micrococcal nuclease digestion of the nuclei . One from behaved like a free RNA polymerase II and the other like a complex with other nuclear components . Both forms of RNA polymerase II activity were recovered in the 0.16 M NaCl-soluble fraction of the nuclear digest, and the complexed from the RNA polymerase II could transcribe its endogenous template under conditions permitting only of elongation of the RNA synthesis . The RNA polymerase II complex was further purified by gel filtration chromatography and column electrophoresis . Analysis of protein and DNA of the partially purified complex suggested that the RNA polymerase II was bound to mono- or dinucleosomes carrying some characteristic nonhistone proteins . Furthermore, in experiments on tissues from starved rats, the two forms of RNA polymerase II were found to originate from different functional states of the chromatin-bound enzyme in vivo. Biochim Biophys Acta, 1981 Feb 26, 652(2), 283 - 93 ATP-dependent exonuclease V from Micrococcus luteus . The enzyme-DNA complex, the processive mechanism, and the role of ATP; Cerio-Ventura G et al.; Some kinetic predictions of the proposed processive mechanism for the hydrolysis of DNA by the ATP-dependent enzyme exonuclease V have been checked . The method is to trap enzyme molecules not attached to radioactive DNA substrate with an excess of nonradioactive DNA, so that enzyme molecules attached to the radioactive substrate contribute to the liberation of radioactive products only until they dissociate from it . The experiments show that enzyme molecules remain attached to a T7 double-stranded DNA molecule, while hydrolysing it, for about 2 min under our conditions, in agreement with the predictions of the processive mechanism . However, the mechanism of degradation of single-stranded DNA is not processive . Formation of an enzyme-DNA complex is largely dependent on the presence of ATP . This formation does not appear to be synchronous . ATP analogs do not stimulate formation of, nor stabilize, the enzyme-DNA complex . EDTA causes dissociation of enzyme molecules from the DNA complex. Nucleic Acids Res, 1981 Feb 25, 9(4), 831 - 9 The characterisation of a 5-S 'monosome' fraction from chromatin of Physarum polycephalum; Annesley M et al.; A so-called '5-S mononucleosome' fraction was isolated from nuclei of Physarum polycephalum by digestion with micrococcal nuclease and subsequent fractionation by gel filtration . This fraction had electrophoretic and sedimentation properties which were similar to DNA of approximately 140 base pairs in length . It is shown that lysis of the nuclei activates a protease which is resistant to phenyl-methyl sulphonyl fluoride, o-phenanthroline and parachloromercuri benzene sulphonate and which subsequently degrades the nucleosomes. Biochemistry, 1981 Feb 17, 20(4), 910 - 5 Immunochemical detection of chromosomal protein HMG-17 in chromatin subunits; Tahourdin CS et al.; Chromosomal protein HMG-17, purified from calf thymus, has been used to elicit specific antibodies in rabbits . Specific serological reaction between the antigen and the antisera is demonstrated by solid-phase radioimmunoassay and by competitive inhibition assays . The antisera did not cross-react with histones or other chromosomal HMG proteins . The antisera bound specifically to chromatin subunits isolated from HeLa cells, demonstrating that it may be used to study the in situ organization of this chromosomal protein . Chromatin purified from HeLa nuclei was digested with micrococcal nuclease, and the resulting mono- and oligonucleosomes were fractionated on a sucrose gradient . Analyses of the content of chromosomal proteins HMG-1, HMG-17, and H4 in different size nucleosomal particles, by the solid-phase radioimmunoassay, reveal that the distribution of HMG-17 was the same as that of H4, but different from that of HMG-1. Nucleic Acids Res, 1981 Feb 11, 9(3), 473 - 87 Nucleosomal structure of sea urchin and starfish sperm chromatin . Histone H2B is possibly involved in determining the length of linker DNA; Zalenskaya IA et al.; Comparison has been made between sea urchin and starfish sperm chromatin . The only protein by which chromatins from these sources differ significantly is histone H2B . Sea urchin sperm H2B is known to contain an elongated N-terminal region enriched in Arg . Analysis of the micrococcal nuclease digests of sea urchin and starfish nuclei in one- and two-dimensional electrophoresis has shown that sperm chromatin of both animals consists of repeated units similar in general features to those of rat thymus or liver . However, DNA repeat length in chromatin of sea urchin sperm (237 bp) is higher than that of starfish sperm (224 bp), while the core DNA length does not differ and is the same as in the chromatin of rat liver or thymus . A suggestion has been made that the N-terminal region of histone H2B is associated with the linker DNA and is responsible for the increased length of sea urchin linker DNA. Biochemistry, 1981 Feb 3, 20(3), 621 - 30 Structure of chromatin at deoxyribonucleic acid replication forks: location of the first nucleosomes on newly synthesized simian virus 40 deoxyribonucleic acid; Herman TM et al.; Exonucleases specific for either 3' ends (Escherichia coli exonuclease III) or 5' ends (bacteriophage T7 gene 6 exonuclease) of nascent DNA chains have been used to determine the number of nucleotides from the actual sites of DNA synthesis to the first nucleosome on each arm of replication forks in simian virus 40 (SV40) chromosomes labeled with {3H}thymidine in whole cells . Whereas each enzyme excised all of the nascent {3H}DNA from purified replicating SV40 DNA, only a fraction of the {3H}DNA was excised from purified replicating SV40 chromosomes . The latter result was attributable to the inability of either exonuclease to digest nucleosomal DNA in native replicating SV40 chromosomes, as demonstrated by the following observations: (i) digestion with either exonuclease did not reduce the amount of newly synthesized nucleosomal DNA released by micrococcal nuclease during a subsequent digestion period; (ii) in briefly labeled molecules, as much as 40% of the {3H}DNA was excised from long nascent DNA chains; (iii) the fraction of {3H}DNA excised by exonuclease III was reduced in proportion to the actual length of the radiolabeled DNA; (iv) the effects of the two exonucleases were additive, consistent with each enzyme trimming only the 3' or 5' ends of nascent DNA chains without continued excision through to the opposite end . When the fraction of nascent {3H}DNA excised from replicating SV40 DNA by exonuclease III was compared with the fraction of {32P}DNA simultaneously excised from an SV40 DNA restriction fragment, the actual length of nascent {3H}DNA was calculated . From this number, the fraction of {3H}DNA excised from replicating SV40 chromosomes was converted into the number of nucleotides . Accordingly, the average distance from either 3' or 5' ends of long nascent DNA chains to the first nucleosome on either arm of replication forks was found to be 125 nucleotides . Furthermore, each exonuclease excised about 80% of the radiolabel in Okazaki fragments, suggesting that less than one-fifth of the Okazaki fragments were contained in nucleosomes . On the basis of these and other results, a model for eukaryotic replication forks is presented in which nucleosomes appear rapidly on both the forward and retrograde arms, about 125 and 300 nucleotides, respectively, from the actual site of DNA synthesis . In addition, it is proposed that Okazaki fragments are initiated on nonnucleosomal DNA and then assembled into nucleosomes, generally after ligation to the 5' ends of long nascent DNA chains is completed. Br J Cancer, 1981 Feb, 43(2), 201 - 9 Successful immunotherapy with micrococcus, BCG or related polysaccharides on L1210 leukaemia after BCNU chemotherapy; Verloes R et al.; The experiments aimed at evaluating the optimal parameters in the chemo-immunotherapeutic treatment of the L1210 lymphoid leukaemia grafted to {female BALB/c (H2d) X male DBA/2 (H2d)}F1 hybrid mice, hereafter referred to as CDF1 mice . In vitro irradiation of leukaemic ascites cells by X- or gamma-rays and subsequent inoculation in mice showed that optimum immunogenicity is radiation dose-dependent . Grafting mice with 10(7) leukaemic ascites cells irradiated at optimum dose (80 GyX- or gamma-rays) delays mortality of the animals when challenged later with untreated L1210 cells, but is unable to cure mice . By contrast, specific immunoprophylaxis induced by Micrococcus, complement-triggering polysaccharides or BCG and irradiated leukaemic cells was able to protect mice against grafts of 10(4) L1210 cells . The i.p . route was notably superior to the i.v . route . When mice bearing advanced L1210 tumour were treated by chemotherapy (12 mg/kg of BCNU) on Day 6.5 after grafting 10(4) L1210 cells and subsequently treated by immunotherapy, a very high percentage (up to 90%) of mice with 10(8) leukaemic cells could be cured by repeated 1mg injections of bacterium or polysaccharide, and challenge with irradiated leukaemic cells was unnecessary . Because of the high cure rate obtained, the very regular response pattern and the non-pathogenicity, the bacterium Micrococcus lysodeikticus would seem a promising new candidate for chemo-immunotherapeutic antitumour strategies. Biosci Rep, 1981 Feb, 1(2), 119 - 23 Influence of pH and ionic strength on the lysis of Micrococcus luteus cells by hen lysozyme at low (20 degree C) and high (physiological, 40 degree C) temperature; Saint-Blancard J et al.; From isoactivity curves (showing activity as a function of Ph and ionic strength) it was found that in the pH domain 6.7-8.6 frequently used in experiments involving hen lysozyme, the pH optimum of lysis of Micrococcus luteus cells at low ionic strength (0.02-0.05) by the high-temperature form (40 degree C, physiological temperature) was one to two pH units lower than that by the low-temperature form (20 degree C). Biokhimiia, 1981 Feb, 46(2), 269 - 75 {Tryptic peptides of maleylated alpha-chain of histidine decarboxylase from Micrococcus sp . n.}; Prozorovskii VN et al.; The maleylated alpha-chain of histidine decarboxylase from Micrococcus sp . n., containing 10 arginine residues was hydrolyzed by trypsin, and 9 peptides were isolated from the tryptic hydrolysate . A comparative study of the amino acid sequence in the tryptic peptides of alpha- and beta-chains of histidine decarboxylase allowed to establish the intramolecular homology in the alpha-chain primary structure and homology between the alpha- and beta-chains. Zh Mikrobiol Epidemiol Immunobiol, 1981 Feb, (2), 23 - 7 {Expression of plasmid R6K in a cell-free coupled transcription-translation system}; Lisenkov AF et al.; The modified method for obtaining E . coli extract S 30 for the coupled transcription--translation system is described . The extract treated with immobilized DNAase and micrococcal nuclease had the minimal endogenous protein synthesis and high activity in respect to exogenous DNA matrices . The synthesis of 9-12 proteins with molecular weights ranging from 14,000 to 178,000 daltons was shown to occur in this system in the presence of the DNA of R6K plasmid . The use of the modification of Novick's method allowed to identify active beta-lactamase coded by the amp-gene of R6K plasmid. Proc Natl Acad Sci U S A, 1981 Feb, 78(2), 852 - 5 Release of 7-methylguanine residues from alkylated DNA by extracts of Micrococcus luteus and Escherichia coli; Laval J et al.; Cell extracts from Micrococcus luteus release both free 3-methyladenine and free 7-methylguanine from alkylated DNA . The glycosylase activity responsible for the liberation of 7-methylguanine is not 3-methyladenine-DNA glycosylase, which, when purified, does not liberate it . Furthermore, the heat inactivation rates of the two enzymatic activities are different . The release of 7-methylguanine by chemical depurination of ethanol-soluble oligonucleotides has been ruled out . A similar activity releasing 7-methylguanine is also found in Escherichia coli. Mol Biochem Parasitol, 1981 Feb, 2(3-4), 167 - 76 Subunit organization of chromatin from trypanosoma cruzi sensitive and resistant to ethidium bromide; Belnat P et al.; The chromatin from Trypanosoma cruzi has been analysed from a nuclear preparation after digestion with micrococcal nuclease . The DNA repeat length is found to be equivalent to 185 +/- 5 base pairs . The organization of chromatin in T . cruzi has been compared with that of sensitive trypanosomes treated with ethidium bromide and trypanosomes resistant to ethidium bromide . No differences were found. Mech Ageing Dev, 1981 Feb, 15(2), 141 - 52 Evidence for an increased level of DNA damage in high doubling level human diploid cells culture; Dell'Orco RT et al.; Excision repair after ultraviolet (UV) irradiation was estimated in human diploid fibroblast-like cells (HDF) by treating DNA with a crude extract from Micrococcus luteus that contained pyrimidine dimer-specific endonucleases . The assays were done before and after the cells had been arrested in an essentially nonmitotic state . When low and high population doubling level (PDL) cells were assayed under these conditions, no age-related difference in the number of UV-induced endonuclease sensitive sites was observed, but the removal of these sites was more rapid in high PDL arrested cells . There was a difference between the calculated number average molecular weights (Mn) of DNA from unirradiated low and high PDL arrested cells . The lower Mn of the DNA from high PDL cells indicated that other enzymes present in the M . luteus extract were acting upon non-UV-induced DNA distortions and that these were present to a greater extent in the chromatin associated regions of older cells . These results support the hypothesis that DNA damage accumulates as HDF progress through their in vitro life span. Eur J Cell Biol, 1981 Feb, 23(2), 295 - 302 Distinctive features of dinoflagellate chromatin . Absence of nucleosomes in a primitive species Prorocentrum micans E; Herzog M et al.; The absence of nucleosome-like structures from purified nuclei of the primitive dinoflagellate Prorocentrum micans was demonstrated by three means . i) Electron microscopy revealed mostly thin, smooth 6-nm nucleofilaments in chromatin incubated at various ionic strengths and either fixed in 0.1% glutaraldehyde or unfixed . No "beads-on-a-string" structure was found . ii) Analysis of nuclear proteins showed that low amounts of basic proteins were present (basis proteins: DNA less than 0.1), the two major one with molecular weights 12 000 and 13 000 and that histones characteristic of eucaryotes were absent . iii) Digestion of the nuclei with micrococcal endonuclease of DNase I did not result in partially digested DNA fragment repeats . Only about 10% of the bulk of the nuclear DNA was digested by micrococcal endonuclease . The high molecular weight of the remainder suggests particular protection against this type of nuclease . In the light of these distinctive nuclear features, we discuss the evolutionary position of the dinoflagellate protists with respect to the procaryotes and eucaryotes. Cell, 1981 Feb, 23(2), 401 - 9 Chromatin structure of the histone genes of D . melanogaster; Samal B et al.; We have examined the chromatin structure of the histone gene repeat of D . melanogaster using an indirect end-labeling technique . Our results show that each DNA segment of the repeat is packaged into a precisely defined and characteristic structure, as follows: the nontranscribed spacers display a "normal" chromatin arrangement, with each nucleosome precisely positioned on the underlying DNA sequence; the 5' ends of all five histone genes are in an exposed configuration, highly sensitive to both micrococcal nuclease and DNAase I; and the genes have an "altered" chromatin structure, as indicated by the weak and irregularly spaced nuclease cuts . This well-defined chromatin arrangement is established early in development and is stably maintained throughout the remainder of the D . melanogaster life cycle. Biochim Biophys Acta, 1981 Jan 29, 652(1), 55 - 63 Competitive binding studies of compounds that interact with DNA utilizing fluorescence polarization; Richardson CL et al.; The increase in the fluorescence polarization of acridine orange upon binding to DNA molecules is used as the basis of a competitive method to study the interaction of a variety of fluorescent and non-fluorescent compounds with DNA . Test compounds that interact with DNA inhibit both the binding of acridine orange to DNA and the accompanying increase in fluorescence polarization . Actinomycin D exhibits a dose-dependent inhibition of acridine orange-DNA binding with Micrococcus luteus DNA, calf thymus DNA, and poly(dG-dC); no detectable inhibition of acridine orange intercalation into poly(dA-dT) is observed . In contrast, proflavine shows similar acridine orange inhibition for poly(dA-dT), calf thymus DNA and M . luteus DNA. Biochemistry, 1981 Jan 20, 20(2), 238 - 44 Synthesis by DNA polymerase I on bleomycin-treated deoxyribonucleic acid: a requirement for exonuclease III; Niwa O et al.; phi X174 RFI DNA treated with bleomycin (BLM) under conditions permitting nicking does not serve as a template-primer for Escherichia coli DNA polymerase I . Purified exonuclease III from E . coli and extracts from wild-type E . coli strains are able to convert the BLM-treated DNA to suitable template-primer, but extracts from exonuclease III deficient strains are not . Brief digestion by exonuclease III is enough to create the template-primer, suggesting that the exonuclease III is converting the BLM-treated DNA by a modification of 3' termini . The exonucleolytic rather than the phosphatase activity of exonuclease III appears to be involved in the conversion . Comparative studies with micrococcal nuclease indicate that BLM-created nicks do not have a simple 3'-P structure . Bacterial alkaline phosphatase does not convert BLM-treated DNA to template-primer . The endonuclease VI activity associated with exonuclease III does not incise DNA treated with BLM under conditions not allowing nicking, in contrast to DNA with apurinic sites made by acid treatment, arguing that conversion does not require the endonuclease VI action on uncleaved sites. Nature, 1981 Jan 15, 289(5794), 198 - 203 Chromatin fine structure of active and repressed genes; Levy A et al.; Study of the structural organization of chromatin during transcription and replication may reveal important aspects of these processes . At the lowest level of organization, chromatin consists of a repeating subunit, the nucleosome (for reviews see refs 1-3) . Electron microscopy indicates that the nucleosomes are arranged helically or form discrete superbeads, generating the familiar 250 A-300-A fibre . It has been suggested that this fibre is further folded into loops containing up to several hundred nucleosomes . Despite extensive study, the significance and fate of these nucleosomes remain obscure . We have used here micrococcal nuclease digestion to compare the structures of actively transcribing and inert chromatin of the genes coding for the major heat-shock protein of Drosophila melanogaster . The repressed hsp 70 genes were considerably more resistant to cleavage by micrococcal nuclease than their flanking regions and the bulk of chromatin . The active genes, previously shown to be more sensitive than the repressed genes, are also more susceptible to the nuclease than their 3'-flanking regions and bulk chromatin. J Biol Chem, 1981 Jan 10, 256(1), 539 - 46 Structure of the filamentous bacteriophage fl . Location of the A, C, and D minor coat proteins; Grant RA et al.; The location within the virion of the A, C, and D minor coat proteins of the filamentous bacteriophage fl has been analyzed . The A protein is present in approximately 5 copies/particle and is located at the tip of normal length phage, miniphage, and fl/pBR322 chimeric phage, a longer than normal length phage . The mole ratios of the A, C, and D proteins are the same for each type of particle, consistent with a model of phage organization in which the minor coat proteins are clustered near or at the ends of the phage . Normal length phage were fragmented by passing them through a French press, and those fragments that contained the A protein were separated from those that did not by treating the mixture with anti-A protein antibody . Analysis of the protein compositions of the two populations of fragments showed that the A and D proteins were found together in one population of fragments and that most, it not all, of the C protein was found in the other . These results show that the D protein is located near or at the A protein end of the phage and that the C protein is located in a region near or at the opposite end . Treatment of the virion with proteases which lowered the infectivity of the phage resulted in particles in which only the A protein was cleaved to any detectable extent . These particles remained resistant to the action of micrococcal nuclease. Nucleic Acids Res, 1981 Jan 10, 9(1), 203 - 13 Transient conformation changes in chromatin during excision repair of ultraviolet damage to DNA; Bodell WJ et al.; DNA labeled for 15 minutes during UV induced repair synthesis is two-fold more sensitive to micrococcal nuclease than the bulk nuclear DNA . As the length of the labeling period increases from 15 minutes to 4 hours the nuclease sensitivity of repair labeled DNA approaches that of bulk chromatin . Pulse-chase experiments indicate that the nuclease sensitivity of the repaired DNA labeled during a brief pulse decreases with a half-life of about 15 minutes . In contrast to previous interpretations, we consider these results to mean that immediately after synthesis, chromatin labeled during repair has a conformation which renders it more susceptible to nuclease digestion than the bulk chromatin . With time these repaired regions are assembled into a nucleosome structure with normal nuclease sensitivity. Vet Med Nauki, 1981, 18(10), 41 - 5 {DNA nucleotide composition of Gram-positive cocci isolated from food products of animal origin}; Gogov I et al.; Studied was the nucleotide composition of 34 strains of gram-positive cocci isolated from slaughtered birds, sheep milk, and milk from mastitis-affected cows and ewes . The differentiation of the strains was carried out in conformity with the instructions of Bergey's Manual of Determinative Bacteriology (1974) on the basis of the following indices: morphology of colonies, morphology and staining of the cells after Gram, catalase, oxydase, respiration type, fermentation of manite, production of plas mocoagulase, thermonuclease, and phosphatase and response to novobiocin . The amount of guanine, adenine, cytosine, and thymine in the investigated strains was determined after the method of Spirin and Belozerskii . On this basis the guanine-cytosine percent was calculated . Results showed that the use of the guanine-cytosine percent made it possible to more accurately differentiate the genus with gram-positive cocci . In 88.24 per cent of the investigated strains there was coincidence between the guanine-cytosine percent and their biochemical characteristics . Two of the strains (guanine-cytosine percent 49.95 and 47.48) were shown to belong to the group of planococci . No typical micrococci (with a guanine-cytosine percent of more than 60.00) were established. Toxicology, 1981-82, 22(4), 353 - 8 Decreased level of lysozyme in rabbit lung lavage fluid after inhalation of low nickel concentrations; Lundborg M et al.; Six rabbits were exposed for 4 months (5 days/week, 6 h/day) and 6 rabbits for 8 months to approx . 0.1 mg/m3 of metallic nickel dust (U.S . threshold limit value (TLV) 1 mg/m3) . Another 8 rabbits were exposed for 4-6 weeks (5 days/week, 6 h/day) to 0.3 mg/m3 (as Ni) of nickel chloride (U.S . TLV 0.1 mg/m3) . After exposure lungs were lavaged . Concentration of lysozyme in the lavage fluid was estimated with the lyso-plate technique (agar plates with heat-killed Micrococcus lysodeikticus) after macrophages had been removed . All 3 exposed groups had markedly lower concentrations of lysozyme than corresponding controls . Mean values in controls and exposed rabbits were: for 4 months metallic nickel dust exposure 2.3 and less than or equal to 0.04 microgram/ml; for 8 months metallic nickel dust exposure 1.4 and less than or equal to 0.5 microgram/ml; and for nickel chloride exposure 1.9 and less than or equal to 0.4 microgram/ml. Mol Biol (Mosk), 1981 Jan-Feb, 15(1), 234 - 42 {Microinjection of non-histone chromatin protein derived from mouse spleen into L cells}; Karavanov AA et al.; Non-histone protein selectively released from mouse spleen nuclei by mild hydrolysis with micrococcal nuclease or DNase I was introduced into L cells by the microinjection method . It is shown that this protein selectively accumulates in cell nuclei . Analysis of the mitotic cells after microinjection of 125I labeled protein demonstrated its location in chromosomes of L cells. Chromosoma, 1981, 84(2), 279 - 90 Different chromatin structures in Physarum polycephalum: a special form of transcriptionally active chromatin devoid of nucleosomal particles; Scheer U et al.; Nonnucleolar chromatin from interphase nuclei of Physarum polycephalum plasmodia occurs in two different structural configurations as seen in electron microscopic spread preparations . While the majority of the chromatin is devoid of nascent ribonucleoprotein (RNP) fibrils and compacted into nucleosomal particles, a minor proportion (10-20%) is organized differently and reveals a smooth contour . It is this form of smooth chromatin which is rich in transcription units (mean length: 1.36 +/- 0.21 micrometer) . Only occasionally are solitary nascent RNP fibrils observed which are associated with beaded strands of chromatin . In transcribed smooth chromatin nucleosomal particles are not only absent from the transcription units but also from their nontranscribed flanking regions, indicating that this special structural aspect is not merely a direct consequence of the transcriptional process . The existence of ca . 10-20% of Physarum chromatin in the smoothly contoured form is discussed in relation to reports of a preferential digestibility of a similar proportion of Physarum chromatin by DNAse I (Jalouzot et al., 1980) and to the altered configuration of "peak A" chromatin subunits after micrococcal nuclease digestion (Johnson et al., 1978 a, b). Acta Biol Med Ger, 1981, 40(4-5), 527 - 33 Translational discrimination between embryonic and adult mouse globin mRNAs in the rabbit reticulocyte lysate system; Farace MG et al.; In the present study mouse adult (alpha, beta) and embryonic globin (x, y, z) mRNas are compared for their capacity of being translated in a micrococcus nuclease treated rabbit reticulocyte lysate . The results of these experiments indicate that: 1) alpha and beta adult RNAs are translated with a higher efficiency as compared to the alpha-like and beta-like embryonic mRNAs; 2) adult beta and embryonic beta-like messengers are translated more efficiently than their corresponding adult alpha and embryonic alpha-like messengers; 3) the alpha/beta synthetic ratio, both for adult and embryonic globins is highly dependent upon the concentration of globin mRNAs . For embryonic globins the ratio decreases from 0.21 at low mRNA concentration to 0.11 at high mRNA concentration . For adult globin mRNAs the alpha/beta chain synthetic ratio decreases from 1.4 to 0.9 within the same range of concentration. J Supramol Struct Cell Biochem, 1981, 15(4), 395 - 402 Heparin-inhibitable lectins: marked similarities in chicken and rat; Roberson MM et al.; Extracts of young rat lung contain a heparin-inhibitable lectin that closely resembles one recently purified from chicken liver . Both lectins interact with heparin and N-acetyl-D-galactosamine, and were purified by gel filtration on Sepharose CL-2B followed by affinity chromatography on heparin-Sepharose . They both behave as high molecular weight aggregates that can be dissociated into two peptides with apparent molecular weights of 13,000 and 16,000 by gel electrophoresis in SDS . Samples of purified lectin contained up to 20% DNA by weight, and the degree of lectin aggregation and hemagglutination activity was greatly reduced by treatment with micrococcal nuclease without inhibiting heparin-binding activity . Association of lectin with DNA is an artifact of homogenization in high salt, since only 2% of the lectin is found associated with a purified nuclear fraction. Cell Biol Int Rep, 1981 Jan, 5(1), 37 - 43 The high mobility group proteins and transcribed nucleosomes; Mathew CG et al.; Monomer nucleosomes released from nuclei during brief micrococcal nuclease digestions are enriched in transcribed sequences (Bloom and Anderson, 1978) . These nucleosomes are depleted in H1 and enriched in three high mobility group proteins HMG14, HMG17 and another HMG-like protein . Analysis of such nucleosomes by polyacrylamide gel electrophoresis reveal that they are heterogenous . Similarly, monomer nucleosomes soluble in 0.1 M NaCl separate on polyacrylamide gels into mainly two types of particle, one of which has HMG14 and HMG17 bound . However, the DNA of the HMG-nucleosomes from chick erythrocytes is not enriched in globin sequences, suggesting that protein rearrangement may have occurred. Can J Biochem, 1981 Jan, 59(1), 22 - 9 Nuclease sensitivity of postreplicated chromatin from Ehrlich ascites tumour cells; Miki BL et al.; Chromatin appears to undergo structural modification after replication and before integration into bulk chromatin . In ascites cells, postreplicated chromatin displays a transient resistance to digestion with micrococcal nuclease . This resistance may be correlated with a shorter DNA repeat length (178 base pairs) than that found in bulk chromatin (187 base pairs) . Selective labelling or selective digestion of DNA sequence classes could not account for these observations . In both bulk and postreplicated chromatin, three electrophoretic types of mononucleosomes were found . Postreplicated mononucleosome types showed selective sensitivities to nuclease digestion whereas bulk mononucleosome types did not. Eur J Biochem, 1981 Jan, 113(3), 569 - 73 Turnover of the major polypeptides of 40-S monomer particles; Ivanova E et al.; The pulse-chase experiments with Friend erythroleukemia cells designed to reveal the metabolic properties of the protein complex of 40-S particles showed that the major polypeptides of this complex turn over with half-lives between 19 h and 206 h . the main conclusion from the experiments is that the complex does not degrade as a single unit . Since the individual polypeptides forming the complex live much longer than hnRNA, and in addition degrade at a different rate, we considered the following two modes of degradation as most likely . (1) The complex might not be subjected to a profound degradation at the end of the processing of associated pre-mRNA . In this case it should exist as a long-lived recyclable mosaic of metabolically differing polypeptides whose replacement takes place at a specific rate . (2) Alternatively, the protein complex might be completely degraded at the end of processing, but in a way that liberates free individual polypeptides available for recycling . The further experiments indicate that the 37 000-Mr, 34 000-Mr and 32 000-Mr core proteins in isolated 40-S particles and in particles associated with a nuclear fraction released from chromatin after micrococcal nuclease digestion degrade at different rates . These experiments suggest the existence of at least a metabolic heterogeneity among the population of nuclear particles carrying pre-mRNA. Z Naturforsch {C}, 1981 Jan-Feb, 36(1-2), 149 - 56 Binding of polylysine and ethidium bromide to nucleosomal DNA: comparison of biochemical and electron microscopical results; Marx R et al.; Ethidium bromide and polylysine interact with nucleosomal DNA and lead to change of biochemical properties and to morphological changes as to the distance between the two core particles of a nucleosome dimer . With increasing polylysine concentration, the buoyant density of nucleosomes decrease and the accessibility of the nucleosomal DNA to micrococcal nuclease is lowered . Electron microscopy of polylysine treated nucleosome dimers reveals a shortening of the internucleosomal distance as compared with controls . Treatment of nucleosomes with ethidium bromide leads to an enhanced accessibility of the nucleosomal DNA to micrococcal nuclease . Electron microscopy reveals an increase in length of the DNA connecting the two nucleosome cores in the presence of the dye . Both the binding of polylysine and the treatment with ethidium bromide apparently do not affect the histone arrangement within the nucleosome core as suggested by chemical cross-linking of histones and DNA with formaldehyde, and no obvious morphological change of the nucleosome cores can be observed. Proc Natl Acad Sci U S A, 1981 Jan, 78(1), 83 - 7 Cytoplasmic polyadenylate processing events accompany the transfer of mRNA from the free mRNP particles to the polysomes in Physarum; Adams DS et al.; The relationship between the mRNA in the polysomes and the free cytoplasmic messenger ribonucleoprotein of Physarum polycephalum was studied by microinjection techniques . Labeled free cytoplasmic ribonucleoprotein, prepared from donor plasmodia, was microinjected into unlabeled host plasmodia, and its fat was followed in the host ribonucleoprotein particles . Approximately one-half of the poly(A)-containing RNA {poly(A)+RNA} that originated from the microinjected particles was incorporated into the host polysomes by normal translational processes within 1 hr . Very short poly(A) sequences (approximately 15 nucleotide residues) were found in these poly(A)+RNA molecules . These short poly(A) sequences were sensitive to digestion with micrococcal nuclease, suggesting that they were not associated with protein . Because the poly(A)+RNA molecules of the microinjected free cytoplasmic mRNP had originally contained poly(A) sequences 50-65 nucleotides long and were associated with protein extensive poly(A) degradation and poly(A).protein complex dissociation must have occurred during their incorporation into the polysomes or during their translation . These results demonstrate a precursor-product relationship between free cytoplasmic mRNP and polysomal mRNA and suggest that the incorporation process in Physarum is accompanied by structural modifications in the poly(A) region of mRNA . They also imply that the polysome is a site for disruption of the poly(A).protein complex and poly(A) degradation. J Virol, 1981 Jan, 37(1), 500 - 5 Translation of black beetle virus RNA and heterologous viral RNAs in cell-free lysates derived from Drosophila melanogaster; Guarino LA et al.; A cell-free protein synthesizing system was prepared from cells of Drosophila melanogaster line 1 and made mRNA dependent by treatment with micrococcal nuclease . The system was tested with homologous RNA from black beetle virus propagated in Drosophila cells, with Drosophila heat shock mRNA, and with various heterologous viral mRNA's . Under optimal conditions amino acid incorporation programmed with black beetle virus RNAs was 30-fold higher than endogenous incorporation . RNAs 1 and 2 primarily directed the synthesis of proteins with approximately molecular weights of 120,000 and 46,000, respectively . mRNA's, prepared by transcription from vesicular stomatitis virus or vaccinia virus, were translated efficiently and yielded products that comigrated with authentic viral proteins . Brome mosaic virus RNA and encephalomyocarditis virus RNA were translated poorly . The system retained full activity after freezing. Mol Biol (Mosk), 1981 Jan-Feb, 15(1), 220 - 33 {Properties of protein released from mouse spleen nuclei under conditions of limited hydrolysis with DNase I and micrococcal nuclease}; Karavanov AA et al.; Proteins released by mouse spleen nuclei under conditions of limited hydrolysis with DNase I and micrococcal nuclease were compared . Analysis of these proteins by polyacrylamide gel electrophoresis in the presence of SDS revealed the essential similarity in the qualitative composition of released proteins . Characteristics of the most prominent component were studied in both cases and it was shown that this component is identical . It has a molecular weight of 25 500 according to electrophoresis data and 2300 as determined by equilibrium sedimentation . Amino acids composition and N-terminal amino acid were studied . It was shown that its N-amino acid is arginine. Vopr Med Khim, 1981, 27(4), 538 - 44 {Inhibition of chromatin autolysis in the process of isolating and incubating rat liver cell nuclei}; Khodarev NN et al.; Dependence of endogenous nuclear nuclease/nucleases/ activity on pH value and ion composition of the isolation and incubation media was studied . Change in buffer pH value up to pH 9.0 and addition of Ca2+ instead of Mg2+ significantly inhibited the endogenous nuclease activity in rat liver nuclei . On the basis of these data the procedure for isolation of nuclei developed by Shaveau was modified . Almost complete inhibition of the endogenous nuclease activity was achieved during destruction of chromatin DNA from the isolated nuclei in presence of exogenous nuclease/micrococcal/. Acta Derm Venereol, 1981, 61(3), 267 - 9 The effect of benzoyl peroxide on acne; Cunliffe WJ et al.; A double-blind study of two commonly used (5%) benzoyl peroxide-containing preparations showed that they were equally effective in the treatment of acne . With these treatments there was a reduction in P . acnes, Micrococcaceae and surface-free fatty acids . These data support the continued use of benzoyl peroxide preparations in the treatment of acne. J Biol Chem, 1980 Dec 25, 255(24), 12047 - 50 Comparison of the cleavage of pyrimidine dimers by the bacteriophage T4 and Micrococcus luteus UV-specific endonucleases; Gordon LK et al.; A comparison was made of the activity of the UV-specific endonucleases of bacteriophage T4 (T4 endonuclease V) and of Micrococcus luteus on ultravilet light-irradiated DNA substrates of defined sequence . The two enzymes cleave DNA at the site of pyrimidine dimers with the same frequency . The products of the cleavage reaction are the same, suggesting that the scission of DNA by T4 endonuclease V occurs via the combined actin of a pyrimidine dimer specific DNA glycosylase and an apyrimidinic-apurinic (AP) endonuclease as was recently shown for the M . luteus enzyme . The pyrimidine dimer DNA-glycosylase activity of both enzymes is more active on double-stranded DNA than it is on single-stranded DNA. Nucleic Acids Res, 1980 Dec 20, 8(24), 6069 - 79 Histone H1o: its location in chromatin; Smith BJ et al.; Histone H1o is an H5-like protein found in mammals . Its location in chromatin from animal tissues has been studied by micrococcal nuclease digestion and by quantitation . It was found that H1o occurs in the linker region of chromatin, and replaces H1 there as it does so . As much as a third of the H1 becomes replaced, at least in some tissues . The abundance of H1o was similar in bulk chromatin and in a mononucleosome population which was putatively enriched in transcribed DNA sequences . It was concluded that H1o probably does not suppress transcription. Biochim Biophys Acta, 1980 Dec 11, 610(2), 392 - 9 Structural rearrangement of histone-H1-depleted chromatin during thermal denaturation; Dimitrov SI et al.; The influence of thermal denaturation on the nucleosomal structure of histone-H1-depleted chromatin was studied using psoralen-treated nucleoprotein preparations subjected to partial thermal denaturation . DNA was cross-linked with psoralen to ensure its complete renaturation upon cooling . The structure of the preheated nucleoprotein was investigated by thermal denaturation, kinetics of hydrolysis and DNA fragment pattern obtained upon digestion with micrococcal nuclease . The electron micrographs of the partially denatured nucleohistone showed gross changes in the nucleosomal structure which were consistent with a sliding of histone cores along DNA as recently reported by Tsaneva et al . (Tsaneva, I., Dimitrov, S., Pashev, I . and Tsanev, R., FEBS Lett., (1980) 112, 143-146) . This interpretation is strongly supported by the following features of the partially denatured material: a, increased rate of degradation of DNA by micrococcal nuclease; b, melting of a part of DNA as a protein-free DNA; and c, shortening of the DNA repeat length upon digestion with micrococcal nuclease . The sliding of the core histones is parallelled by the denaturation of histones, which accounts for the very intensive background in the DNA digestion pattern, the loss of nucleosome morphology at higher temperatures, and the disappearance in the melting profile of the transition at 72 degrees C. Biochemistry, 1980 Dec 9, 19(25), 5836 - 42 Carcinogen aflatoxin B1 is located preferentially in internucleosomal deoxyribonucleic acid following exposure in vivo in rainbow trout; Bailey GS et al.; The purpose of this work was to investigate the distribution in chromatin of deoxyribonucleic acid (DNA) adducts of aflatoxin B1, following exposure in vivo . Rainbow trout were injected intraperitoneally with radiolabeled aflatoxin B1, a potent procarcinogen known to readily induced hepatocellular carcinomas in these fish . After maximum incorporation, liver nuclei were prepared and digested with micrococcal nuclease . Mono-, di-, and trinucleosomal fractions were purified from several stages of nuclease digestion, and the lengths and specific activities of their DNA were determined . The results indicate that aflatoxin B1 is approximately 5 times as likely on a per nucleotide basis to localize on internucleosomal (linker) DNA as on nucleosomal core DNA in this system. Eur J Biochem, 1980 Dec, 113(1), 15 - 25 Characterization of poly(ADP-ribose)--histone H1 complex formation in purified polynucleosomes and chromatin; Nolan NL et al.; Poly(ADP-ribose) {poly(ADP-Rib)} polymerase of HeLa nucleosomes has been shown in vitro, to catalyze the synthesis of a complex of histone H1 containing 2 H1 histones and 15-16 units of oligo(ADP-Rib) . The synthesis of the H1 complex in vitro was compared in polynucleosome populations of various sizes (3--16 and greater than 30) released from HeLa nuclei following micrococcal nuclease digestion . Poly(ADP-Rib) was synthesized from {32P}NAD and the poly(ADP-ribosyl)ation of H1 was studied by selective H1 extraction, gel electrophoresis and autoradiography . Quantitative differences in H1 complex formation occurred when either chromatin concentration or polynucleosome length was varied . The data indicated that H1 complex formation in vitro was favored in polynucleosomes 16 nucleosomes long as compared to 8 nucleosomes . A series of partially ADP-ribosylated H1 species was also detected . Partially modified H1 species migrate more slowly than pure H1 in dodecylsulfate gels . The reduced mobility is a function of the number of attached ADP-Rib moieties . Thus, molecules containing one molecule of H1 and various numbers of ADP-Rib residues can be separated . When the partially modified H1 species were incubated in alkali to cleave the linkage of ADP-Rib to protein, (ADP-Rib1-15) were detected by chain length analysis on 15% polyacrylamide gels . The intermediate H1 species could be chased, in vitro, into as H1 complex with NAD and thus were determined to be successive precursors in the formation of the H1 complex . Evidence is presented that the H1 complex is synthesized in intact cells permeabilized with lysolecithin. Biochem J, 1980 Dec 1, 191(3), 729 - 42 Binding of quinoline analogues of echinomycin to deoxyribonucleic acid . Role of the chromophores; Fox KR et al.; Two novel antibiotics were isolated, designated compounds 1QN and 2QN respectively, having quinoline rings in place of one or both of the quinoxaline chromophores of echinomycin . Each removes and reverses the supercoiling of closed circular duplex DNA from bacteriophage PM2 in the fashion characteristic of intercalating drugs . For compound 1QN, the unwinding angle at I0.01 is almost twice that of ethidium, whereas for compound 2QN the value is indistinguishable from that of ethidium . Binding of both analogues produced changes in the viscosity of sonicated rod-like DNA fragments corresponding to double the helix extension found with ethidium, a feature characteristic of bifunctional intercalation by quinoxaline antibiotics . These results suggest that both compounds 1QN and 2QN behave as bifunctional intercalators but that compound 2QN produces only half the helix unwinding seen with compound 1QN and the natural quinoxalines . Binding curves for the interaction of both analogues with a variety of synthetic and naturally occurring nucleic acids were determined by solvent-partition analysis . Values for compound 2QN were also obtained by a fluorimetric method and found to agree well with the solvent-partition measurements . Compound 1QN bound most tightly to Micrococcus lysodeikticus DNA and, like echinomycin, exhibited a broad preference for (G + C)-rich DNA species . For compound 2QN no marked (G + C) preference was indicated, and the tightest binding among the natural DNA species studied was found with DNA from Escherichia coli . The two analogues also displayed different patterns of specificity in their interaction with synthetic nucleic acids . Compound 2QN bound to poly(dA-dT) slightly more tightly than to poly-(dG-dC), whereas compound 1QN displayed a large (approx . 11-fold) preference in the opposite sense . There was evidence of co-operativity in the binding to poly(dA-dT) . It may be concluded that the chromophore moieties play an active role in determining the capacity of quinomycin antibiotics to recognize and bind selectively to specific sequences in DNA. Can J Microbiol, 1980 Dec, 26(12), 1408 - 11 Unusual polar lipids of Micrococcus radiodurans strain Sark; Thompson BG et al.; The polar lipids of Micrococcus radiodurans strain Sark appear to be unique in that common bacterial phospholipids such as phosphatidylethanolamine, phosphatidylserine, phosphatidylcholine, and phosphatidylinositol are absent . Of the 13 polar lipids detected, 5 contain phosphorus and carbohydrate, 4 contain carbohydrate and no phosphorus, and 1 contains phosphorus as well as sulfur . None of the polar lipids contain free choline or amino groups and none are sensitive to phospholipases C or D . Of eight selected polar lipids tested, all were found to be labile to milk alkali, suggesting the presence of ester linkages . It is suggested that the unusual lipid profile of M . radiodurans strain Sark may be useful in taxonomic considerations. J Bacteriol, 1980 Dec, 144(3), 1061 - 7 Prophage induction in a permeabilized cell system: induction by deoxyribonucleases and the role of recBC-deoxyribonuclease; Irbe RM et al.; Permeabilized cells able to induce prophage were obtained by plasmolysis and preincubation of the cells in a reaction mixture which allows protein synthesis . These cells became permeable to low-molecular-weight proteins and oligonucleotides . We found that deoxyribonucleases (pancreatic deoxyribonuclease and micrococcal nuclease) triggered prophage (phi 80) induction . This deoxyribonuclease-triggered induction was completely dependent upon the presence of functional recBC genes in the lysogen, regardless of the recombination proficiency determined by recBC and sbcB genes . The possible role of recBC-deoxyribonuclease in prophage induction and recombination is discussed. Jpn J Antibiot, 1980 Dec, 33(12), 1294 - 300 {Studies on cefoperazone concentration in human biliary tract and clinical effect for acute cholecystitis and cholangitis (author's transl)}; Hirasawa S et al.; A new antibiotic drug of cephalosporin, with marked resistance to beta-lactamase, cefoperazone (CPZ) for parenteral use was used in 10 patients with acute cholecystitis or cholangitis with cholelithiasis . CPZ was given by drip intravenous injection at a daily dose of 1 to 4 g . Clinical response was excellent in 1 case, good in 7 cases, fair in 2 cases and poor was none . Clinical adverse effect was not recognized . And CPZ in a dose of 1 g was given intravenously during the operation to 6 of those patients . Tissue specimens of different sites were taken from removed organs . The materials of A-bile and B-bile were subsequently taken at intervals . Determination of CPZ concentration was performed according to paper disk method with Micrococcus luteus ATCC 9341 strain . CPZ concentrations in the A-bile increased quickly soon after injection, and reached high level peak at 30-min . to 1 hour, then they were very slow decline . CPZ was observed in the B-bile through the gallbladder wall, and reached high level concentration comparative quickly after intravenous injection . CPZ concentration in the gallbladder wall, was directly proportional to the degree of pathological changes of inflammation . On the CPZ concentration in patients with acute cholecystitis, the concentration in A-bile, B-bile and gallbladder wall were observed extremely higher than the MIC or CPZ for Escherichia coli . CPZ therefore will be a very useful drug when used for chemotherapy of biliary tract infection. Cell Biophys, 1980 Dec, 2(4), 373 - 404 The quinternary chromatin-DNA structure . Three-dimensional reconstruction and functional significance; Kendall FM et al.; Nuclear DNA-space images from Feulgen-stained HeLa cells synchronized at 1, 3, 5, 8, 12, 15, and 18 h following mitosis are digitized and their densitometric-geometric patterns are analyzed by means of a Quantimet 720-D image analyzer on line with a PDP11/40 computer . Frequency distributions of picture point optical densities for the phases and subphases as seen in nuclear images show that DNA packing changes are evident by means of ordinary optical microscopy . Radii of gyration of the images, and optical density profiles and distributions for several squashes of similar cells reveal that in particular instances chromatin DNA is distributed mostly towards the periphery, and usually with high circular isotropy . Cross power spectra of individual scan lines suggest that existence of higher order "quinternary" periodic structure for chromatin that modulates during the cell cycle . Three-dimensional reconstruction 2- micrometer sections of intact, Feulgen-stained mammalian tumor tissue show stainable material only toward the nuclear perimeter and not in the center (compatible with the evidence that initial thymidine incorporation in HeLa cells is generally at the nuclear border) . Densitometric properties of reconstructed interphase chromatin-DNA bodies are highly coupled with similar properties of the whole nucleus, showing that a more condensed nucleus is always accompanied by a more condensed interphase chromatin DNA . The effect of micrococcal nuclease digestion on the digitized nuclear images is also presented . All the above data are then discussed in terms of a quinternary chromatin-DNA structure and its modulation during the cell cycle. Nucleic Acids Res, 1980 Nov 25, 8(22), 5363 - 75 Different repeat lengths in rat satellite I DNA containing chromatin and bulk chromatin; Omori A et al.; The nucleosome repeat structure of a rat liver chromatin component containing the satellite I DNA (repeat length 370 bp) was investigated . Digestion experiments with micrococcal nuclease, DNAase II, and the Ca2+/Mg2+-dependent endogenous nuclease of rat liver nuclei revealed a repeat unit of 185 nucleotide pairs which is shorter by approximately 10 bp than the repeat unit of the bulk chromatin of this cell type . The difference seems not to be related to the histone composition which was found to be similar in the two types of chromatin. Nucleic Acids Res, 1980 Nov 25, 8(22), 5317 - 31 Organizational changes in chromatin at different malignant stages of Friend erythroleukemia; Leonardson KE et al.; The chromatin structure of morphologically-similar, but increasingly-malignant erythroleukemia cells was investigated using milk micrococcal nuclease digestion of isolated nuclei . The maximum solubilization of chromatin was unique for each of the three cell types: the least malignant (our Stage II) released 61% of its chromatin DNA, the most malignant (Stage IV), 46%, and the intermediate (Stage III) released 36% . An analysis of the nucleosome oligomers liberated by digestion also demonstrated differences . After 15 minutes of digestion when release was reaching its maximum, a greater proportion of large nucleosomal oligomers (sizes > trinucleosome) was released from Stage II nuclei than from Stage III or IV nuclei . The cell types also differed in the relative amount of H1-depleted mononucleosomes released . Analysis of the size of the double-stranded DNA associated with mononucleosomal particles showed that Stage III mononucleosomes were smaller (148 bp) than Stage IV (167 bp) or Stage II (190 bp) . In addition, while the DNA of mononucleosomes depleted in H1 was smaller than that in the H1-containing species, relative size differences among the different cell types were retained . These data suggested that the difference in the mononuocleosome particle size resistant to nuclease digestion was independent of histone H1 . Differences in nucleosome repeat length were also noted among the cell types . These studies have demonstrated dramatic differences in chromatin structure associated with malignant potential of an otherwise morphologically identical cell type . These findings may reflect changes in the relative amounts of H2a variants which we have previously described among the different malignant cell types. Nucleic Acids Res, 1980 Nov 25, 8(22), 5423 - 6 The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus; Hori H et al.; The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH . When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. J Biol Chem, 1980 Nov 25, 255(22), 10671 - 5 Binding of the high mobility group protein, H6, to trout testis chromatin; Kuehl L et al.; When 125I-labeled H6 was incubated with trout testis nuclei under conditions of pH and ionic strength approximating those in vivo, the radioactivity bound nearly quantitatively to the chromatin . Under comparable conditions, most non-nuclear proteins do not bind . Binding was neither tissue- nor species-specific, and HMG-17, a mammalian homolog of H6, behaved similarly to H6 . The labeled and the endogenous H6 molecules were equivalent by several criteria: 1) Both were released nearly quantitatively upon treatment of the chromatin with DNase I, whereas neither was released by digestion with micrococcal nuclease, suggesting that the labeled molecules, like those of endogenous H6, were bound primarily to the core particles in transcriptionally competent portions of the genome . 2) Salt extraction curves were similar for both the labeled and unlabeled proteins, although about 15% of the labeled molecules were bound to the chromatin more loosely than those of the endogenous H6 . Taken together, these results suggest that chromatin contains specific, well defined sites to which H6 binds . Upon increasing the concentration of H6 in the incubation mixture, progressively greater numbers of low affinity, presumably nonspecific binding sites become occupied . This observation has important implications for studies in which nucleases are employed to probe chromatin structure, since they suggest that H6 molecules released from specific, high affinity sites by the action of the nuclease might rebind more loosely to other regions of the chromatin. Nucleic Acids Res, 1980 Nov 25, 8(22), 5377 - 90 Non-random arrangement of nucleosomes in satellite I containing chromatin of rat liver; Igo-Kemenes T et al.; The location of nucleosomes on the nucleotide sequence of rat satellite I DNA was investigated using micrococcal nuclease, exonuclease III, and restriction nucleases as tools . Hae III cleaved the satellite DNA containing chromatin very preferentially in the linker region . Nucleosomes were found predominantly in three defined positions on the 370 bp satellite I monomer unit . This type of arrangement occurs on not more than half of the satellite DNA containing chromatin while the rest of this chromatin is arranged differently . The arrangement of nucleosomes with high probability in preferred frames and with low probability in less preferred frames may be a general phenomenon which can be discussed as a possible mechanism to modulate sequence recognition. Nucleic Acids Res, 1980 Nov 25, 8(22), 5275 - 88 Selective release of HMG nonhistone proteins during DNase digestion of Tetrahymena chromatin at different stages of the cell cycle; Hamana K et al.; The possible role of LG-1, a Tetrahymena specific HMG protein found in the macronuclear chromatin (Hamana, K . and Iwai, K . (1979) J . Biochem . 86, 789-794), was examined in relation to the chromatin structure . The chromatin isolated from cells synchronized at different stages of the cell cycle contained about one molecule of LG-1 per nucleosome . Limited digestion of the chromatin with DNase I or micrococcal nuclease selectively released LG-1 with the nucleosomal core histones and H1 remained insoluble, bound to the resistant DNA . Depending on the cell stages several types of chromatin structure were distinguished by their nuclease sensitivity . However, the chromatin at different stages exhibited the similar behavior of the LG-1 release with the nucleases as a function of the degree of chromatin solubilization . The results suggest that LG-1 proteins play a role in the chromatin organization which is rather independent of the cell stages. Nucleic Acids Res, 1980 Nov 25, 8(22), 5143 - 55 Nuclease sensitivity of active chromatin; Gazit B et al.; The active regions of chicken erythrocyte nuclei were labeled using the standard DNase I directed nick translation reaction . These nuclei were then used to study the characteristics and, in particular, the nuclease sensitivity of active genes . Although DNase I specifically attacks active genes, micrococcal nuclease solubilizes these regions to about the same degree as the total DNA . On the other hand micrococcal nuclease does selectively cut the internucleosomal regions of active genes resulting in the appearance of mononucleosomal fraction which is enriched in active gene DNA . A small percentage of the active chromatin is also released from the nucleus by low speed centrifugation following micrococcal nuclease treatment . The factors which make active genes sensitive to DNase I were shown to reside on individual nucleosomes from these regions . This was established by showing that isolated active mononucleosomes were preferentially sensitive to DNase I digestion . Although the high mobility group proteins are essential for the maintenance of DNase I sensitivity in active regions, these proteins are not necessary for the formation of the conformation which makes these genes preferentially accessible to micrococcal nuclease . The techniques employed in this paper enable one to study the chromatin structure of the entire population of actively expressed genes . Previous studies have elucidated the structure of a few special highly prevalent genes such as ovalbumin and hemoglobin . The results of this paper show that this special conformation is a general feature of all active genes irregardless of the extent of expression. Nucleic Acids Res, 1980 Nov 11, 8(21), 5057 - 70 Ribonucleotide sequences non-adjacent to poly(A) participate in the poly(A)-protein complex in 15S duck globin mRNP particles; Goldenberg S et al.; The study of the interaction between mRNA and proteins in the polyribosomal 15 S duck globin messenger ribonucleoprotein complex showed that proteins protect specific mRNA sequences against digestion by the nonspecific micrococcal nuclease (Nucleic Acids Research 6 (8) 2787, 1979) . Here we report the isolation of the poly(A)-protein RNP complex from nuclease digested 15 S mRNP by two different methods: sucrose gradient sedimentation and oligo(dT)-cellulose chromatography . We show by fingerprint analysis, that aprt from the periodically fragmented poly(A) segment, mRNA sequences adjacent and non-adjacent to the poly(A) segment are protected by the poly(A) binding proteins against nuclease digestion . The duck globin poly(A)-protein RNP complex, with a sedimentation coefficient between 7 S and 10 S, shows a characteristic protein composition, with a major 73,000 MW polypeptide and some minor components . The results are discussed in view of a dynamic ribonucleoprotein structure. Nucleic Acids Res, 1980 Nov 11, 8(21), 4955 - 68 Single-strand DNA binding protein from rat liver: interactions with supercoiled DNA; Bonne C et al.; As shown by competition experiments, the single-strand DNA binding protein from normal rat liver (S25) interacts preferentially with supercoiled DNA compared to relaxed DNA duplexes . When followed both by sedimentation analysis and by nitrocellulose filter assay, the binding of S25 to SV40 supercoiled DNA (FI) appears to be non-cooperative . Saturation is reached at a protein to DNA weight ratio of about 2 . The S25-DNA complexes prefixed with glutaraldehyde appear as beaded structures having an average of 14 to 16 beads per SV40 DNA molecules . Cross-linking of S25 bound to SV40 DNA by dimethyl suberimidate allows to detect oligomeric structures containing a maximum of twenty monomers of S25 . When complexes are treated by glutaraldehyde, 10% of the genome become resistant against micrococcal nuclease . Moreover, S25 affects the DNA helical structure . Superhelical forms are generated by the association of S25 with SV40 DNA, in the presence of nicking-closing enzyme. J Biol Chem, 1980 Nov 10, 255(21), 10542 - 5 An endonuclease activity of chicken erythrocyte nuclei and mononucleosomes; Kalinski A et al.; Endogenous nuclease is present in the nuclear sap of chicken erythrocyte nuclei . This enzyme resembles the nuclease of mammalian nuclei in requirements for bivalent cations and in production of large chromatin fragments that gradually decrease in size, but differs in that the products do not go through the stage of discrete bands on gel electrophoresis . Endogenous nuclease and micrococcal nuclease are also detectable in mononucleosomes prepared from chicken erythrocytes with the aid of micrococcal nuclease . Both nucleases are extractable with 0.35 M NaCl, and both are inhibited by pTp . In the absence of Ca2+, the micrococcal nuclease is totally inactive, whereas the endogenous nuclease shows a low level of activity. Eur J Biochem, 1980 Nov, 112(2), 353 - 62 Acetylation of nucleosomal histones in vitro; Bohm J et al.; A new histone-specific acetyltransferase, which is closely associated with nucleosomes prepared from lymphocyte nuclei by treatment with micrococcal nuclease, is described . The acetylating enzyme transfers {3H}acetyl groups from {3H}acetyl-coenzyme A to the endogenous histones H2A, H2B, H3 and H4 in nucleosomes as well as to free histones added to the reaction mixture . Histone H1 is not acetylated by this enzyme . The acetyltransferase was partially purified by DEAE-Sephadex and DNA-cellulose chromatography . The nucleosome-associated enzyme binds to DNA cellulose at low salt concentrations (DNA-binding acetyltransferase), while the previously described histone-specific acetyltransferases have no affinity to DNA under these conditions . This high affinity for DNA may explain the association of DNA-binding acetyltransferase with nucleosomes. J Endocrinol, 1980 Nov, 87(2), 225 - 40 Distribution of acceptor sites for androgen-receptor complexes between transcriptionally active and inactive fractions of rat ventral prostate chromatin; Davies P et al.; Rat ventral prostate chromatin was separated into two main fractions by controlled digestion with micrococcal nuclease . The soluble fraction obtained after lysis of digested nuclei with EDTA (1 mmol/l), the S2 fraction, represented approximately 17% of the original nuclear DNA, and showed properties consistent with transcriptional activity, i.e . enrichment in nascent RNA, non-histone protein and endogenous RNA polymerase B activity as well as depletion in histones . The fraction sedimented after lysis of nuclei, fraction P, comprised approximately 60% of nuclear DNA, was depleted in nascent RNA, non-histone proteins and endogenous RNA polymerase B activity, but had a higher content of histones . In an attempt to relate the concentration of acceptor sites for androgen-receptor complexes with transcriptional activity, it was shown that the S2 fraction was enriched in these acceptor sites . However, if measurements were based on the intact cell the transcriptionally inactive portion contained 2.5--3 times as many 'acceptor' sites, although these sites had lower affinity for androgen-receptor complexes than had those in the transcriptionally active fraction. Biokhimiia, 1980 Nov, 45(11), 2013 - 8 {Structural organization of chromatins from two divisions of rat brain, using micrococcal nuclease}; Grumbkova LO et al.; The cell nuclei of cerebellum and large hemispheres of rat brain were treated with micrococcal nuclease (EC 3.1.4.7); the resulting DNA fragments were separated in 4% polyacrylamide gel . The experimental data are indicative of differences in the structural organization of chromatins from different divisions of the brain: the average value of the repeating DNA sequences of chromatin from the large hemispheres was 184 base pairs against 199 in case of cerebellar chromatin . The DNA fragment incorporated into the nucleosomal nucleus contained 140 base pairs in both chromatin preparations . The dependence of the size of the DNA "bridge" between the vicinal nucleosomal nuclei on the protein composition and template activity of chromatin preparations is discussed. Can J Biochem, 1980 Nov, 58(11), 1261 - 9 Characterization of mononucleosomes and associated glycoproteins from Ehrlich ascites tumour cells; Miki BL et al.; Mononucleosomes generated by the digestion of ascites nuclei with micrococcal nuclease were resolved into three types by polyacrylamide gel electrophoresis . All three types were present in early and late digest and a precursor-product relationship was not apparent . Each mononucleosome type was associated with a unique pattern of subnucleosome DNA fragments and differences were apparent in histone and nonhistone proteins . On the basis of reactivity ot 125I-labelled concanavalin A and labelling with {3H}glucosamine, glycoproteins were identified as components of two of the mononucleosome types . The principal glycoprotein species associated with mononucleosomes had an apparent molecular weight of 130 000. Proc Natl Acad Sci U S A, 1980 Nov, 77(11), 6443 - 7 Aggregation of small oligonucleosomal chains into 300-A globular particles; Jorcano JL et al.; Chicken erythrocyte oligonucleosomes (trimers to about 20-mers) are able to interact with each other through the very lysine-rich histones (H1 and H5) and form heterogeneous globular particles with a mean diameter of about 300 A . These particles assemble spontaneously during micrococcal nuclease digestion of chromatin in the presence of 30 mM NaCl and contain approximately 25 nucleosomes . They are sensitive to ionic strength and unfold at lower salt concentrations but can be reconstituted by restoring the initial salt concentration . Even at 30 mM NaCl, the particles remain dynamic structures, being in equilibrium with their oligonucleosomal components as revealed by the fact that particle stability depends on the concentration of oligonucleosomes. Proc Natl Acad Sci U S A, 1980 Nov, 77(11), 6425 - 8 Protein p3 is linked to the DNA of phage phi 29 through a phosphoester bond between serine and 5'-dAMP; Hermoso JM et al.; To investigate the role of protein p3 in bacteriophage phi 29 initiation of replication, we have studied the nature of the covalent linkage between protein p3 and phi 29 DNA . The protein-DNA compound was digested with micrococcal nuclease and pronase resulting in a nucleotidyl-peptide that was further digested by alkaline phosphatase and snake venom phosphodiesterase yielding 5'-dAMP . The DNA-protein linkage is sensitive to alkali . Treatment of the nucleotidyl-peptide with 0.1 M NaOH at 37 degrees C for 3 hr after phosphatase digestion released 5'-dAMP . Hydrolysis of the nucleotidyl-peptide with 5.8 M HCl at 110 degrees C for 90 min yielded O-phosphoserine . These results, together with the sensitivity of the DNA-protein linkage to snake venom phosphodiesterase and its resistance to hydroxylamine, indicate that protein p3 is covalently linked to phi 29 DNA through a phosphoester bond between L-serine and 5'-dAMP, namely a O,5'-deoxyadenylyl-L-serine bond. Cell, 1980 Nov, 22(2 Pt 2), 387 - 92 Chromatin structure of the 5S RNA genes of D . melanogaster; Louis C et al.; The 5S RNA gene cluster of Drosophia melanogaster is a tandem array of a repeat unit made up of a 135 bp gene plus a 238 bp spacer . The length of the 5S repeat (373 bp) equals the average length of a Drosophila dinucleosome . Digestion of Drosophila nuclei with micrococcal nuclease generates discrete 5S RNA gene subfragments when the purified DNA is further cleaved with a single-cut restruction enzyme . We have mapped four micrococcal nuclease-sensitive sites within the 5S repeat: A1, centered at bp--110 (+1 being the G:C bp at the start of the gene); A1', at bp--80; A2, at bp +80, within the intragenic control region; and B, at --190 bp . These findings suggest that nucleosomes can be positioned on the 5S gene repeat in one of two possible phases, A or B . In the A phase a potential regulatory sequence near the center of the gene is exposed in one of the two linkers of the repeat . In the B phase, in contrast, one of the linkers includes the 5' end of the gene. J Gen Virol, 1980 Nov, 51(Pt 1), 45 - 59 The structure of herpes simplex virus type 1 DNA as probed by micrococcal nuclease digestion; Leinbach SS et al.; Micrococcal nuclease digestion was used to probe the structures in which herpes simplex virus type I (HSV-I) DNA is found during virus replication . Parental DNA, progeny DNA and DNA in nucleocapsids were analysed . Parental DNA was examined after infection of Vero cells with 32P- or 3H-thymidine-labelled HSV-I . Progeny DNA was examined after HSV-I-infected Vero cells were pulse-labelled with 3H-thymidine during HSV-I DNA synthesis . In both cases, nuclei were isolated and digested with micrococcal nuclease . Digestion products were analysed by agarose or polacrylamide gel electrophoresis (PAGE) . Most parental DNA remained as intact molecules . However, a small amount was degraded into fragments which were heterogeneous in size or the size of nucleosomal cell DNA . These two classes of fragments were also produced upon digestion of progeny DNA . The heterogeneous fragments and nucleosomal fragments comprised major and minor fractions, respectively, of digested progeny DNA . When digested DNA from HSV-I-infected cells was transferred from composite polyacrylamide-agarose gels to diazobenzyloxymethyl paper, nucleosomal fragments hybridized to 32P-labelled HSV-I DNA as well as to 32P-labelled Vero cell DNA. . Therefore, nucleosomal fragments contained HSV-I DNA sequences . HSV-I DNA in nucleocapsids was analysed by micrococcal nuclease digestion after nucleocapsids were disrupted with PH 9.3 buffer, pyridine, Sarkosyl or NcCl/urea . Only fragments of heterogeneous size were produced . Thus, HSV-I DNA is found predominantly in structures other than nucleosomes during virus replication. Cell, 1980 Nov, 22(1 Pt 1), 269 - 76 E . coli and M . luteus DNA topoisomerase I can catalyze catenation of decatenation of double-stranded DNA rings; Tse Y et al.; Escherichia coli and Micrococcus luteus DNA topoisomerase I are found to promote catenation of double-stranded DNA rings . At low DNA concentration dimeric catenanes are the major catenated products; at high DNA concentration or when spermidine is present, catenanes containing more than two rings are formed . There is no requirement of extensive sequence homology between the conponent rings forming a catenane; dimeric catenanes between Pseudomonas phage PM2 DNA and E . coli plasmid pBR322 are readily formed . The formation of a dimeric catenane by these type I topoisomerases, however, requires the presence of at least one preexisting single-chain scission in one of the two component rings . This is in contrast to the cases with the type II DNA topoisomerases which can form catenanes made of covalently closed rings only . The catenanes formed by the type I enzymes can be unlinked by the same enzymes, or by DNA gyrase, a type II enzyme, upon dilution of the isolated catenanes . The catenation and decatenation of duplex DNA rings adds a fourth type of reaction promoted by these type I DNA topoisomerases to the three reported previously: relaxation of superhelical DNA, interconversion between single-stranded DNA rings with and without knots and the intertwining of single-stranded DNA rings of complementary sequences into a covalently closed duplex ring with a high linking number . All four topoisomerization reactions involve the crossing of one DNA strand through a transient break of another DNA strand . The new reaction reported here suggests that such a crossover event might not require pairing of complementary nucleotide sequences. Biochemistry, 1980 Oct 28, 19(22), 5024 - 9 Micrococcus luteus endonucleases for apurinic/apyrimidinic sites in deoxyribonucleic acid . 2 . Further studies on the substrate specificity and mechanism of action; Pierre J et al.; Two endonucleases specific for DNA-containing apurinic or apyrimidinic sites (AP-endonucleases A and B) have been isolated from Micrococcus luteus and highly purified . These enzymes have no exonuclease activity . Both AP-endonucleases hydrolyze DNA-containing apurinic or apyrimidinic sites at the 5' end of the lesion, thus generating 3'-hydroxyl and 5'-phosphoryl end groups . DNA-containing pyrimidine dimers, introduced at low doses of UV, are not hydrolyzed, whereas DNA-containing lesions, introduced at high doses of UV or by gamma irradiation are nicked by either AP-endonuclease . During hydrolysis of apurinic DNA, neither of the AP-endonucleases acts as a processive enzyme. Biochemistry, 1980 Oct 28, 19(22), 5018 - 24 Micrococcus luteus endonucleases for apurinic/apyrimidinic sites in deoxyribonucleic acid . 1 . Purification and general properties; Pierre J et al.; Two chromatographically distinct endonucleases from Micrococcus luteus, specific for apurinic and apyrimidinic sites (AP-endonucleases A and B), have been extensively purified and characterized . Both are free from DNA glycosylase, unspecific endonuclease, and phosphatase activities . The two enzymes behave as monomeric proteins of approximately 35000 daltons . In addition to their different chromatographic properties on CM-cellulose, P-cellulose, hydroxylapatite, and DNA--Sepharose, both AP-endonucleases can be distinguished as follows: AP-endonuclease A has an isoelectric point of 4.8, shows a half-life of 4 min at 45 degrees C, reacts optimally at pH 7.5 and has a KM value of 2.3 X 10(-6) M . AP-endonuclease B has a pI of 8.8, is more stable at 45 degrees C (half-life of 10 min), and reacts optimally between pH 6.5 and pH 8.5; its KM value is 3.7 X 10(-6) M. J Biol Chem, 1980 Oct 25, 255(20), 9659 - 65 Oligothymidylate analogues having stereoregular, alternating methylphosphonate/phosphodiester backbones . Synthesis and physical studies; Miller PS et al.; Two decathymidylate analogues, d-(TpTp)4TpT-isomer 1 and isomer 2, having stereoregular, alternating methylphosphonate/phosphodiester backbones were prepared . The phosphodiester linkages of d-(TpTp)4TpT are cleaved slowly by snake venom phosphodiesterase in a stepwise manner, while slow random cleavage occurs with micrococcal nuclease which hydrolyzes isomer 2 faster than isomer 1 . The CD spectra of isomer 1 and d-(Tp)9T are identical suggesting they have similar conformations, while that of isomer 2 shows an overall reduction of {theta} . Isomer 1 forms a 1T . 1A complex with poly(dA) and both 1T . 1A and 2T . 1A complexes with poly(rA), while isomer 2 forms a 2T . 1A complex of low thermal stability with poly(dA) and no complex with poly(rA) . The Tm values of the partially nonionic d-(TpTp)4TpT . polynucleotide complexes are less dependent on salt concentration than are those of d-(Tp)9T . The stoichiometry and CD spectra of the complexes suggest that poly(dA) . isomer 1 duplex assumes a B-type geometry while isomer 2 . poly(dA) . isomer 2 triplex and the isomer 1 . poly(rA) complexes have an A-type geometry . Although there are no apparent differences between steric restrictions to rotation about the backbones of either isomer 1 or 2, or steric restrictions to complex formation, the results suggest that the configuration of the methylphosphate linkage controls: 1) interaction with nucleases, 2) oligomer conformation, and 3) interaction with polynucleotides . The latter effects may result from differences in solvation of the two isomers. J Biochem (Tokyo), 1980 Oct, 88(4), 1185 - 91 A new lysozyme assay based on fluorescence polarization or fluorescence intensity utilizing a fluorescent peptidoglycan substrate; Maeda H; A new sensitive, rapid and simple method for lysozyme assay is described which is based on either fluorescence polarization or fluorescence intensity using fluorescein-labeled peptidoglycan as a substrate . The peptidoglycan was obtained from Micrococcus lysodeikticus after extensive digestion with Pronase and washing with Triton X-100 followed by various solvents . Subsequently, it was labeled with fluorescein isothiocyanate (FITC) at the amino group of the peptide . When the FITC-labeled substrate was subjected to lysozyme digestion, an increase of fluorescence intensity or a decrease of fluorescence polarization value (P value) was apparent in five minutes at a lysozyme concentrations as low as 0.1 or 0.01 micrograms/ml, respectively . The effect of other hydrolytic enzymes including alpha-mannosidase, proteases and RNase on the P value was found to be negligible . The measured values represented the specificity and dose of lysozyme added . Apparent Vmax and Km values for two different lysozymes, chicken egg white and human, could be determined by this method. Eur J Biochem, 1980 Oct, 111(1), 237 - 44 Localization of phosphoproteins and of protein kinases in chromatin from hepatoma tissue-cultured cells; Kitzis A et al.; An important role in the control of gene expression has been attributed to phosphoproteins present among chromatin non-histone proteins . In a previous work we have shown that at least part of these phosphoproteins are associated with nucleosomes . In this work we wanted to establish whether this association occurs with all nucleosomes or with the nucleosomes present in fragments preferentially released by a mild micrococcal nuclease digestion, which originated essentially from active parts of chromatin . Phosphoproteins were labelled in vivo by incubating hepatoma tissue-cultured cells with {32P}phosphate and chromatin was submitted to a limited micrococcal nuclease digestion . The released fragments were fractionated by preparative gel electrophoresis . {32P}Phosphoproteins were essentialy found in the smallest released fragments: monomers and dimers of nucleosomes . The same result was obtained when the phosphoproteins were labelled in vitro by incubating each fragment obtained by the preparative electrophoresis in the presence of {gamma-32P}ATP . It indicates that part of the protein kinase activity was strongly bound to the particles . The bound phosphoproteins were analysed by sodium dodecylsulfate/polyacrylamide gel electrophoresis . Two main polypeptides were characterized: phosphopeptide a, Mr 41000, present in all small fragments; phosphopeptide b, Mr 31000, present in all small fragments, except in the fastest moving nucleosomes . Phosvitin kinase was found associated with the small released fragments, its specific activity was by far the highest in the fraction which includes the dimers of nucleosomes . It is concluded that phosphoproteins and protein kinases are associated with the nucleosomes of the active parts of chromatin, which suggests a role of these proteins in the control of gene expression. Cell, 1980 Oct, 21(3), 751 - 60 Nonrandom alignment of nucleosomes on 5S RNA genes of X . laevis; Gottesfeld JM et al.; Mild digestion of Xenopus nuclei with micrococcal nuclease results in the cleavage of oocyte-type 5S RNA genes once every four nucleosomes, or about once per tandem repeating unit of 5S DNA . This specific cleavage pattern is observed with nuclei from somatic cells where oocyte-type 5S genes are never transcribed (blood and liver) and with cultured cell nuclei where these genes are in a DNAase I-sensitive chromatin conformation and low level transcription is observed . Cleavage of protein-free DNA with micrococcal nuclease does not result in a specific digestion pattern . The similarity of the nuclease-generated repeat length and the sequence repeat length of oocyte-type 5S genes suggested a sequence-specific arrangement of nucleosomes on these DNA sequences . Restriction endonuclease analysis indicates that micrococcal nuclease preferentially cleaves in a restricted region within the 5S repeating unit, about 200 bp from the single Hind III site . Using specific end-labeled DNA probes derived from cloned 5S DNA we can recognize at least four possible modes of organization of the nucleosomes on 5S DNA . In each of these phase arrangements, functionally significant regions of the 5S gene (start of transcription, middle control region and transcription termination site) are found in or near nucleosome linkers. J Cell Biol, 1980 Oct, 87(1), 227 - 36 Histone gene expression and chromatin structure in mammalian cell hybrids; Hsiung N et al.; DNA isolated from mammalian cell nuclear reveals discrete size patterns when partially digested with micrococcal nuclease . The DNA repeat lengths from different tissues within a species or from different species may vary . These differences have been attributed to the presence of different species of histone H1 . To examine the nature of regulation of DNA repeat lengths and their possible relationship to histone H1, we have selected several mouse and human cell lines that differ in their DNA repeat lengths and examined them and their cell hybrids . 24 mouse X human and five mouse X mouse hybrid cell lines were analyzed . All the interspecific hybrids exhibited the repeat pattern characteristic of the murine parent . The mouse intraspecific hybrids had a repeat pattern of only one of the parents . We conclude that the partial human chromosome complements retained in the hybrids assume the repeat lengths exhibited by the mouse cells . Because H1 histones have been implicated in the determination of DNA repeat lengths, we also investigated the regulation of H1 histone expression in these cell hybrids . Purified H1 histones were radioactively labeled in vitro, and individual subfractions were subjected to proteolysis followed by gel electrophoresis . The resulting partial peptide maps off H1 histone subfractions A and B were distinguishable from one another and from different cell lines . In the mouse X human hybrids analyzed, only the mouse H1 histones were detected . These observations were extended to H2b by analysis of the hybrid cell histone by Triton-acid-urea gels . Neither the DNA repeat length nor histone expression is affected by the presence of any specific human chromosome . The fact that human genes are expressed in these hybrids suggests that the H1 histones of one species is able to interact with the chromatin of another species in a biologically funtional conformation . Analysis of the intraspecific PG19 X B82 (mouse X mouse) hybrids reveals the presence of H1 histone subfractions of the B82 mouse cells . Because these hybrids exhibit the nucleosome repeat length only of the PG19 cells, it appears that if histone H1 plays a role in determining the repeat length it does so in consort with other nonhistone chromosomal proteins. Biokhimiia, 1980 Oct, 45(10), 1871 - 80 {A serine proteinase from Thermoactinomyces vulgaris, strain INMI-4a}; Stepanov VM et al.; A serine proteinase was isolated from the cultural filtrate of the thermophylic actinomycet Thermoactinomycet vulgaris, strain INMI-4a . The purification procedure included affinity chromatography on bacitracin-Sepharose, ion-exchange separation on aminosilochrome, and gel-filtration on Sephadex G-25, resulting in a 194-fold purification and the 55% yield of the enzyme . The molecular weight of the enzyme as determined by polyacrylamide gel electrophoresis in the presence of Na-SDS as well as by gel-filtration on Sephadex G-75 is equal to 28 000; the amino acid composition is: Lys11, His4, Arg5, Asp33, Thr22, Ser24, Glu16, Pro16, Gly30, Ala38, Cys1-2, Val20, Met1, Ile14, Leu8, Tyr16, The4, Trp6-7 . The isoelectric point lies at pH 8--9; the pH optimum for the peptide substrate hydrolysis is Z-L-Ala-L-Ala-L-Leu-pNA is at 8.2 . The enzyme is stable at pH 7--9 . The temperature optimum of the proteolytic activity lies at 55 degrees; however, the enzyme is stable to heating for 1 h at 37 degrees . The proteinase is completely inactivated by the serine proteinase specific inhibitors--phenylmethylsulphofluoride and the protein inhibitor IT-AjT from Actinomyces, as well as by p-chloromercuribenzoate . The enzyme shows lytic activity against the cells of E . coli, Micrococcus lysodeicticus and of the yeasts . The Thermoactinomyces vulgaris serine proteinase, being definitely different from the serine proteinases from Actinomyces griseus, also reveals specific differences when compared to bacterial serine proteinases, e . g . subtilisins . There are some indications to the enzyme relationship with the family of carboxypeptidase Y-like serine proteinases. Biophys J, 1980 Oct, 32(1), 271 - 82 DNA-histone interactions in nucleosomes; Van Holde KE et al.; We have utilized micrococcal nuclease digestion and thermal denaturation studies to investigate the binding of DNA to the histone core of the nucleosome . We conclude that a total of approximately 168 base pairs (bp) of DNA can interact with the histone core under appropriate solution conditions, even in the absence of lysine-rich histones . The interactions in this total length of DNA can be divided into three classes: (a) approximately 22 bp at the ends is bound only at moderate ionic strength . It is easily displaced, and its removal yields the 146 bp core particle . (b) approximately 46 bp near the ends of the core DNA are quite weakly bound to the core, and are displaced at quite moderate temperatures . (c) The remaining central 100 bp are strongly bound, and interact with all of the sites on the histones which strongly protect DNA against DNAse I digestion . A theoretical analysis of the cleavage of nucleosomal DNA by DNAse I has been used to develop evidence that the pattern of protection offered by the histone core is very similar in nuclei to that in isolated core particles. J Gen Virol, 1980 Oct, 50(2), 293 - 307 the influence of the host cell on the inhibition of virus protein synthesis in cells double infected with vesicular stomatitis virus and mengovirus; Otto MJ et al.; The ability of mengovirus to inhibit the synthesis of vesicular stomatitis virus (VSV) proteins and of VSV to inhibit the synthesis of mengovirus proteins during double infection in three different cell lines was investigated . Although cellular protein synthesis was inhibited after infection of cells by each virus, the ability of one virus to decrease translation of the mRNA species of the co-infecting virus varied with the cell type . Superinfection of mengovirus-infected L-929 cells by VSV resulted in essentially no inhibition in the synthesis of either mengovirus or VSV proteins . In HeLa cells and CHO cells the synthesis of both VSV and mengovirus proteins was inhibited under conditions of simultaneous or sequential infection . The inhibition of VSV protein synthesis after infection of HeLa cells by mengovirus was not a result of a modification or inactivation of virus mRNAs . When extracted from double infected cells, the VSV mRNAs manifested normal biological activity, as determined by their ability to stimulate the synthesis of VSV proteins in a micrococcal nuclease-treated cell-free system from L cells . The interference of non-interference of one virus by another in different cell lines was also measured by quantifying the number of infectious particles produced in each cell line . The results were similar to those reported above for protein synthesis inhibition . These experiments suggest that the interference of mengovirus with VSV mRNA translation in HeLa cells is not necessarily reflective of the mechanism by which mengovirus inhibits cellular protein synthesis . Also, the host cell appears to influence the extent or nature of the interference of one virus by the other. Eur J Biochem, 1980 Oct, 111(1), 211 - 5 Purification and properties of a DNase inhibitor from Nicotiana tabacum cell cultures; Szopa J et al.; Extraction of Nicotiana tabacum cell cultures, chromatography on DEAE-cellulose and gel filtration resulted in a homogeneous protein (Mr = 14500), which strongly reduces the hydrolysis of Escherichia coli DNA by DNase I . DNA degradation by micrococcal nuclease is not inhibited . The inhibitor protein interacts with DNase I in the absence of DNA, as determined by the partial quenching of protein intrinsic fluorescence; a 1:1 stoichiometry is deduced . From the reduction of DNase I activity with increasing inhibitor concentration apparent equilibrium constants for the inhibitor X DNase-I complex have been calculated . This interaction is strongly temperature-dependent; at 20 degrees C and 26 degrees C dissociation constants of 5 nM and 110 nM, respectively, were determined . As a consequence a rather high enthalpy of interaction can be estimated. Endocrinology, 1980 Oct, 107(4), 994 - 9 3,5,3'-triiodothyronine receptor-containing chromatin fragments: production by nuclease digestion; Gruol DJ; Nuclear thyroid hormone (T3) receptors are nonhistone proteins which are tightly bound to rat liver chromatin . The solubilization of the T3 receptors by micrococcal nuclease was studied using an assay which allows the delection of in vitro hormone binding and which is independent of the state of solubility of the chromatin . Nuclease digestion produces a receptor containing moiety which sediments at a rate of 5--6S . This form of the receptor is different than that released from chromatin at high ionic strength (3.8S) and potentially represents the stable association of the receptor which other elements of chromatin . Partial release of chromatin compaction by the use of dilute buffer solutions increases the rate of nuclease digestion, facilitates the release of the (5--6S) T3-receptor complex, and allows the isolation of sucrose gradient fractions which are enriched with receptor. Biochim Biophys Acta, 1980 Sep 19, 609(2), 246 - 56 The DNA polymerase beta reaction with ultraviolet-irradiated DNA incised by correndonuclease; Nowak R et al.; Covalently closed circular Col E1 DNA was ultraviolet-irradiated with a dose of 60 J/m2, thus introducing about 3.2 pyrimidine dimers per DNA molecule . Treatment of irradiated Col E1 DNA with Micrococcus luteus correndonuclease resulted, in the vicinity of pyrimidine dimers, in an average of 3.3 incisions per DNA molecule, and converted DNA to the open circular form . Incised Col E1 DNA stimulated no reaction with calf thymus DNA polymerase alpha but was recognized as a template by DNA polymerase beta . The latter enzyme incorporated about 1.6 molecules of dTMP (corresponding to 6 molecules od dNMP) per one correndonuclease incision . The length of the DNA polymerase beta product was comparable to the anticipated length of the DNA region within which the hydrogen bonds were disrupted owing to dimer formation . The enzyme required Mg(2)=nd four dNTPs for reaction and was resistant to N-ethylmaleimide or p-mercuribenzoate . The average numbers of deoxynucleotides incorporated per one DNAase I incision or per one nonspecific break, measured in control samples, were equal, amounting to 0.3 dTMP molecule . This value corresponded to 1.2 dNMP molecule; in our opinion, this reflects contaminating nuclease activity of the system used . The present results testify to the ability of DNA polymerase beta to repair synthesis by the "patch and cut' mechanism. Biochemistry, 1980 Sep 16, 19(19), 4387 - 94 Chromatin subunits elicit species-specific antibodies against nucleoprotein antigenic determinants; Tahourdin CS et al.; Nucleosomes composed of 195 base pairs of DNA associated with histones H2A, H2B, H3, and H4 purified from chicken erythrocyte nuclei were used to elicit antibodies in rabbits . Specific serological reaction between the antisera and the nucleosomes is demonstrated by immunodiffusion, immunofluorescence, microcomplement fixation, solid-phase radioimmunoassay, immunosedimentation, and polyacrylamide gel electrophoresis of 5'-32P end-labeled nucleosomes . The antisera did not react with DNA extracted from these nucleosomes, core histones, or the cross-linked histone octamer from chicken erythocytes, calf thymus total histones, or chromosomal proteins HMG-1 or HMG-17 . Nucleosome antigenicity was not affected by redigestion with micrococcal nuclease . Digestion with DNase I brought about 50% loss of reactivity while digestion with trypsin or proteinase K resulted in total loss of activity . The antisera reacted strongly with trimer, dimer, and monomer nucleosomes as well as with the core particle (145 base pairs of DNA) and subnucleosome (greater than 145 base pairs) obtained from chicken . It reacted less well with nucleosomes obtained from HeLa cells and was almost totally devoid of activity against chromatin particles obtained from rat liver or wheat germ . Experiments employing the technique of transferring proteins from a polyacrylamide gel to diazobenzyloxymethyl paper and visualization of antigens by autoradiography excluded the possibility that the serum contains antibodies against tissue-specific antigens which are found in small amounts but are very immunogenic . It is concluded that most of the anitbodies in the sera are directed against nucleoprotein antigenic determinants composed of the N-terminal portion of the histones and segments of DNA . Antibody binding is dependent on contact between the histone and DNA segments and is independent of the integrity of the entire nucleosome . Thus, certain histone DNA contacts remain intact even though the structure of the nucleosome has been disrupted. Nucleic Acids Res, 1980 Sep 11, 8(17), 3743 - 55 Nuclease digestion promotes structural rearrangements in H1-depleted chromatin; Weischet WO et al.; Digestion of H1-depleted chromatin with micrococcal nuclease at an ionic strength of 0.35M gives rise to structural rearrangements indicating nucleosomal sliding . The ionic strength necessary to reveal this effect is significantly lower than that required in the absence of an accompanying digestion . As an explanation, a model is presented in which the progressing terminal degradation of oligomeric nucleosomes is made responsible for promoting structural rearrangements. Nucleic Acids Res, 1980 Sep 11, 8(17), 3829 - 40 The 5'-cytosine in CCGG1 is methylated in two eukaryotic DNAs and Msp I is sensitive to methylation at this site; Sneider TW; Novikoff rat hepatoma and bovine liver DNAs were digested with Msp I or Hpa II . Restriction fragments were end-labeled using {alpha-32P}-dCTP and the Klenow fragment of E . coli DNA polymerase I and then digested to 2'-deoxyribonucleoside-3'-monophosphates using micrococcal nuclease and spleen phosphodiesterase . Mononucleotides were separated by two-dimensional thin layer chromatography, localized by radioautography, and the {32P}-label quantitated by scintillation spectrometry . This method, based on known specificities of Msp I and Hpa II, shows that CCGG, CMGG, and MCGG (M refers to 5-methylcytosine) occur at frequencies of 89.6%, 1.4%, and 9.0%, respectively, in the rat DNA and at 41.6%, 48.3%, and 10.0%, respectively, in the bovine DNA . {32P} recovery in 3'-5-MedCMP from end-labeled Msp I digests was negligible compared to recovery from Hpa II digests . Hence, Msp I is sensitive to methylation at the 5' cytosine in the sequence CCGG. Proc Natl Acad Sci U S A, 1980 Sep, 77(9), 5097 - 101 Novel histone H2A-like protein of escherichia coli; Hubscher U et al.; A histone-like protein (H) from Escherichia coli has been purified to more than 98% homogeneity by using its capacity to inhibit DNA functions . H protein behaves as a dimer of 28,000-dalton subunits . The histone H2A-like properties of H protein are: (i) binding to DNA at a stoichiometry of 1 H protein dimer per 75 bases; (ii) abundance of about 30,000 molecules per cell, sufficient to bind about 20% of the chromosome; (iii) limiting digestion of double-stranded DNA by micrococcal nuclease; (iv) reannealing of complementary single-stranded DNA; (v) amino acid composition resembling that of eukaryotic histone H2A; (vi) neutralization of H protein by antibody specific for H2A; (vii) heat stability; and (viii) acid solubility . The capacity of H protein to bind DNA prevents its template or substrate functions n several reactions in vitro: DNA synthesis by several polymerases; transcription by RNA polymerase; DNA topoisomerase activity; and DNA-dependent ATP hydrolysis by rep protein, dnaB protein, or protein n' . Together with other histone-like proteins of E . coli, H protein may organize the E . coli chromosome into nucleosomes, such as in eukaryotic chromatin. Cancer Res, 1980 Sep, 40(9), 3181 - 5 Pyrimidine dimer formation and repair in human skin; Sutherland BM et al.; Cyclobutyl pyrimidine dimers have been detected in the DNA of human skin following in vivo irradiation with suberythemal doses of ultraviolet (UV) radiation from FS-20 sun lamp fluorescent tubes . Dimers were assayed by treatment of extracted DNA with Micrococcus luteus UV-specific endonuclease, alkaline agarose electrophoresis, and ethidium bromide staining . This technique, in contrast to conventional dimer assays, can be used with nonradioactive DNA and is optimal at low UV light doses . M . luteus endonuclease-sensitive sites were determined after exposure of untanned skin in two volunteers to UV light (0.97, 1.94, or 3.88 X 10(3) J/sq m; lambda, 290 to 360 nm) . At 20 min postirradiation (dose, 1.94 X 10(3) J/sq m), fewer M . luteus endonuclease-sensitive sites were found in the DNA than immediately after the irradiation . Even fewer endonuclease-sensitive sites were found at 20 min when the UV-irradiated skin was subsequently irradiated with visible light than when the area was kept in the dark . These data suggest that some dimer disappearance by excision repair occurs within 20 min of UV irradiation and that photoreactivation of dimers can make a contribution to the total repair process. J Virol, 1980 Sep, 35(3), 790 - 6 den V gene of bacteriophage T4 determines a DNA glycosylase specific for pyrimidine dimers in DNA; Seawell PC et al.; Endonuclease V of bacteriophage T4 has been described as an enzyme, coded for by the denV gene, that incises UV-irradiated DNA . It has recently been proposed that incision of irradiated DNA by this enzyme and the analogous "correndonucleases" I and II of Micrococcus luteus requires the sequential action of a pyrimidine dimer-specific DNA glycosylase and an apyrimidinic/apurinic endonuclease . In support of this two-step mechanism, we found that our preparations of T4 endonuclease V contained a DNA glycosylase activity that produced alkali-labile sites in irradiated DNA and an apyrimidinic/apurinic endonuclease activity that converted these sites to nicks . Both activities could be detected in the presence of 10 mM EDTA . In experiments designed to determine which of the activities is coded by the denV gene, we found that the glycosylase was more heat labile in extracts of Escherichia coli infected with either of two thermosensitive denV mutants than in extracts of cells infected with wild-type T4 . In contrast, apyrimidinic/apurinic endonuclease activity was no more heat labile in extracts of the former than in extracts of the latter . Our results indicate that the denV gene codes for a DNA glycosylase specific for pyrimidine dimers. Biochim Biophys Acta, 1980 Aug 26, 609(1), 173 - 9 Binding of ethidium monoazide to the chromatin in human lymphocytes; Cantrell CE et al.; The azide analog of {14C}ethidium bromide was mixed with lymphocytes and photolyzed with visible light . The distribution of azide in the chromatin fraction was found to be 55% in DNA, 28% in protein and 16% in RNA . Label in the DNA portion was found to be almost exclusively in the region digestible with micrococcal nuclease . The parent compound, ethidium bromide, competed with azide for binding sites, illustrating that the azide analog mimics the action of ethidium bromide. Nucleic Acids Res, 1980 Aug 25, 8(16), 3639 - 57 The release of 40S hnRNP particles by brief digestion of HeLa nuclei with micrococcal nuclease; Walker BW et al.; Brief digestion of HeLa nuclei with mirococcal nuclease releases monomer hnRNP particles as well as monomer and polynucleosomes . Sucrose gradient analysis of the nuclease released material reveals a series of small A260 peaks overlapping a more predominant peak in the 40S region of the gradient . Analysis of the proteins, DNa, and RNA in successive gradient fractions has confirmed that the smaller peaks are monomer and polynucleosomes, and that the larger peak is 40S hnRNP . Like 40S particles isolated by low salt extraction or by sonication, the nuclease released particles are composed of rapidly labeled RNA associated with a group of non-histone proteins the most predominant of which are the 32,000-44,000 MW proteins previously identified as core hnRNP proteins . These results provide further evidence that 40S hnRNP particles exist as discrete structural components of larger in vivo ribonucleoprotein complexes. J Membr Biol, 1980 Aug 21, 56(1), 49 - 53 Modification of cell membrane lipids in Micrococcus lysodeikticus induced by pantoyl lactone; Johnson JH et al.; Growth of Microccoccus lysodeikticus in the presence of pantoyl lactone brings about both qualitative and quantitative changes in cell membrane lipids . Significant amounts of the two major phospholipids (phosphatidylglycerol and diphosphatidylglycerol) are converted to lyso forms; the largest conversion occurs in the phosphatidylglycerol . In addition, amounts of several phospholipid fatty acids are changed . Physical alteration of the call membrane can be demonstrated using differential scanning calorimetry . Although growth and transport are significantly inhibited when pantoyl lactone is present, cells possessing altered call membrane phospholipds and phospholipid fatty acids, brought about by growth in the presence of pantoyl lactone, transport D-alanine, L-glutamic and L-aspartic acid normally when washed free of the pantoyl lactone. Science, 1980 Aug 15, 209(4458), 811 - 3 Thyroid hormone receptor-containing fragment released from chromatin by deoxyribonuclease I and micrococcal nuclease; Jump DB et al.; Limited deoxyribonuclease I and micrococcal nuclease digestion of hepatic nuclei from euthyroid rats injected with 125I-labeled triiodothyronine ({125I}T3) releases a discrete {125I}T3-labeled chromatin fragment (5.8S) which is larger than the T3 receptor (3.5S) . These results suggest the T3 receptor is associated with a restricted fraction of hepatic chromatin that has a nuclease sensitivity characteristic of transcriptionally active chromatin. Nucleic Acids Res, 1980 Aug 11, 8(15), 3393 - 411 The extraction by micrococcal nuclease of glucocorticoid receptors and mouse mammary tumor virus DNA sequences is dissociated; Andre J et al.; Glucocorticoid receptors (RG) and mammary tumor virus (MM-TV) DNA sequences were extracted by micrococcal nuclease digestion from the nuclei of C3H mouse mammary tumor cells in order to specify their relative distribution in chromatin . RG was labelled and translocated into the nuclei by incubating cells with 3H Dexamethasone (3H Dex) . The purified nuclei were then treated at 2 degrees C with micrococcal nuclease . Three chromatin fractions were successively obtained: an isotonic extract (ne3H1), ahypotonic extract (ne2) and the residual pellet (P) . The Dex-RG complexes were measured by the hydroxyapatite technique . The MMTV DNA sequences were titrated by molecular hybridization with an excess of MMTV radioactive cDNA probe . Up to 75% of the nuclear 3H Dex and the MMTV radioactive cDNA probe . Up to 75% of the nuclear 3H Dex and MMTV DNA sequences were extracted in a concentration dependent manner while only 10-15% of nucleic acids became soluble in 10% perchloric acid . The extracted 3H Dex-RG complex was found to be partly bound to soluble chromatin and partly free . The free complex displayed similar sedimentation constants (4S, 7S) and DNA binding ability to the cytosol receptor . The 3H Dex-RG complexes were 2 to 8 fold more concentrated in ne1, which is known to be enriched in active chromatin, than in ne2 . Conversely, the concentration of MMTV DNA sequences per microgram DNA was the same in the three nuclear fractions . These results suggest that the Dex-RG complexes are concentrated in an active fraction of chromatin . We propose that, among the 20-30 copies of MMTV genes per haploid genome, only a small proportion are transcribed or regulated. Nucleic Acids Res, 1980 Aug 11, 8(15), 3371 - 91 Saccharomyces cerevisiae plasmid, Scp or 2 mum: intracellular distribution, stability and nucleosomal-like packaging; Seligy VL et al.; Cell fractions from yeast strains known to harbor the plasmic 2 mum or Scp were treated with nucleases used to probe eukaryotic chromosome structure . Scp and subfragments were identified by hybridization to natural or cloned Scp probes according to