Microbiology Reader
Equipment to run microbiology work automatically

Growth Curves of any strain.
Microbiological calculations.

Microbiology Home
Microbioloy Reader
Growth Curves
Photo Album
Microorganisms
Software
Download
Purchasing
Contact Us



Jpn J Antibiot, 1981 Mar, 34(3), 447 - 52
{Studies on cefotaxime (HR 756) concentration in human biliary tract and clinical effect for acute or subacute cholecystitis with cholelithiasis (author's transl)}; Kasai Y et al.; A new antibiotic drug of cephalosporin with marked resistance to beta-lactamase, cefotaxime (HR 756) for parenteral use in 8 patients with acute or subacute cholecystitis with cholelithiasis . Cefotaxime was administrated by intravenous injection or drip infusion at a daily dose of 1-4 g . Clinical response was excellent in 1 case, good in 7 cases, and fair or poor was none . Clinical adverse effect was not recognized . Cefotaxime in a dose of 1 g was given intravenously during operation to those same 8 patients . Tissue specimens of different places were taken from removed organs . The materials of A-bile and B-bile were subsequently taken at intervals . Determination of cefotaxime concentration was performed according to the bioassay method with Micrococcus luteus ATCC 9341 strain . Cefotaxime concentrations in the A-bile increased gradually until 1 hour after the intravenous administration . Cefotaxime was observed in the B-bile through the gallbladder wall after the intravenous injection.

J Gen Virol, 1981 Mar, 53(Pt 1), 133 - 43
Latency of herpesvirus of turkey and Marek's disease virus genomes in a chicken T-lymphoblastoid cell line; Hirai K et al.; The properties of latent herpesvirus of turkey (HVT) and Marek's disease virus (MDV) genomes have been studied in virus-non-producer MDCC-BO1(T) cells, a T-lymphoblastoid cell line derived from spleen cells of an HVT-vaccinated chicken . The numbers of the two virus genomes in BO1(T) cells remained stable at 1.6 to 1.8 HVT genome equivalents/cell and 3.4 to 3.8 MDV genome equivalents/cell throughout a number of passages and were not decreased by the presence of phosphonoacetic acid in the culture . When the culture temperature of the MDV-producer MDCC-MSB1 cell line was shifted from 41 to 37 degrees C, the cells cultured at 37 degrees C contained about five times as many virus genomes as those cultured at 41 degrees C . In contrast, the numbers of the two virus genomes in BO1(T) cells were not increased by culture at 37 degrees C . RNA extracted from BO1(T) whole cells and from the polyribosomal fraction hybridized to both MDV and HVT DNAs, indicating the expression of both latent virus genomes . Digestion of cell nuclei with micrococcal nuclease revealed that both latent HVT and MDV genomes possess a nucleosomal structure . Closed circular MDV DNA was demonstrated in BO1(T) by isopycnic centrifugation of DNA in ethidium-bromide-CsCl gradients.

Eur J Biochem, 1981 Mar, 114(3), 577 - 83
The mitochondrial genomes of Ustilago cynodontis and Acanthamoeba castellanii; Mery-Drugeon E et al.; Mitochondrial DNA from Ustilago cynodontis has been investigated in several of its properties . Its dG + dC content is equal to 33.5%; its buoyant density (1.698 g/cm3) is higher, by 5 mg/cm3, and its melting temperature (82.5 degrees C) is lower than expected for a bacterial DNA having the same base composition; the first derivative of its melting curve indicates a large compositional heterogeneity, its molarity of elution from hydroxyapatite is high, 0.28 M phosphate, and allows its partial separation from nuclear DNA . Degradation by micrococcal nuclease indicates that about 25% of the DNA is formed by stretches having no more than 15% dG + dC . Finally, the unit size of mitochondrial genome is about 50 X 10(6) . In most of its properties, the mitochondrial genome of U . cynodontis presents strong analogies with that of Saccharomyces cerevisiae . A parallel investigation on mitochondrial DNA from Acanthamoeba castellanii which has as genome unit size of only 27 X 10(6), has shown that this shares with the former the dG + dC content (32.9%), the melting temperature (82.5 degrees C), a large compositional heterogeneity and a very similar pattern of micrococcal nuclease degradation; its buoyant density (1.692 g/cm3) and its molarity of elution from hydroxyapatite (0.25 M phosphate) are, however, normal, probably because of a different short-sequence pattern and the fact that its dA + dT-rich stretches are shorter, on the average.

Biokhimiia, 1981 Mar, 46(3), 422 - 34
{Sensitivity of intranuclear glucocorticoid complex from normal rat liver and Zajdela ascites hepatoma to ionic strength and nuclease treatment}; Krasil'nikov MA et al.; After 30 min of intraperitoneal injection of dexamethasone to adrenectomized rats about 15% of the label are incorporated into liver homogenate and only 1% of the cytosol-bound hormone is detected in the cell nuclei . The binding of the "in vitro" injected hormone by the nuclei does not obey the second-order reactions (the Scatchard plots) . This is probably due to the existence of various ancillary mechanisms, which control the translocation of the hormone complex into cell nuclei at the level of cytoplasm and nuclear membranes . DNAase I, micrococcal nuclease and endogenous nucleolysis markedly increase the part of the nuclear hormone complex resistant to 0.4 M NaCl . In hepatocyte nuclei obtained by the collagenase method, the content of the 0.4 M NaCl-resistant receptor complex is also increased . The resistance of 0.4 M NaCl was also found in 80% of the glucocorticoid-insensitive nuclear complex from Zajdela ascite hepatoma cells . The changes in interaction of the hormone-receptor complex with nuclear acceptor sites eventually resulting in impaired sensitivity of host tissues to hormonal control can be due to the damage of chromatin structure induced by different influences and tumour growth.

Cancer Res, 1981 Mar, 41(3), 760 - 6
Excision of ultraviolet damage and the effect of irradiation on DNA synthesis in a strain of Bloom's syndrome fibroblasts; Henson P et al.; We have studied repair of ultraviolet light (UV)-induced damage in a strain of Bloom's syndrome cells which we have shown to be defective in host cell reactivation of UV-irradiated herpes simplex virus . Excision repair was monitored by following loss of sensitivity of DNA in permeabilized cells to digestion by the Micrococcus luteus UV endonuclease preparation . The Bloom's syndrome fibroblasts apparently removed endonuclease-sensitive sites from the DNA slightly less efficiently than did normal strains . After 24 hr, 38% of the sites remained in the Bloom's syndrome cells in comparison with 16% in normal fibroblasts . DNA newly synthesized in UV-irradiated Bloom's syndrome cells sedimented less far into alkaline sucrose gradients than did DNA from similarly treated normal cells . In other respects, including the effect of caffeine exposure, DNA synthesis in Bloom's syndrome cells was indistinguishable from that in normal cells . We were therefore able to detect only minor defects in the repair of UV-induced damage in Bloom's syndrome fibroblasts . This is consistent with the normal survival exhibited by these cells . The defect in excision repair may, however, be sufficient to allow the cellular repair capacity to become saturated at high infecting multiplicities of UV-irradiated herpes simplex virus.

Biochim Biophys Acta, 1981 Feb 26, 652(2), 245 - 55
Partial characterization of RNA polymerase II complex released by micrococcal nuclease digestion of rat liver nuclei; Hatayama T et al.; Two forms of RNA polymerase II were released from rat liver chromatin by micrococcal nuclease digestion of the nuclei . One from behaved like a free RNA polymerase II and the other like a complex with other nuclear components . Both forms of RNA polymerase II activity were recovered in the 0.16 M NaCl-soluble fraction of the nuclear digest, and the complexed from the RNA polymerase II could transcribe its endogenous template under conditions permitting only of elongation of the RNA synthesis . The RNA polymerase II complex was further purified by gel filtration chromatography and column electrophoresis . Analysis of protein and DNA of the partially purified complex suggested that the RNA polymerase II was bound to mono- or dinucleosomes carrying some characteristic nonhistone proteins . Furthermore, in experiments on tissues from starved rats, the two forms of RNA polymerase II were found to originate from different functional states of the chromatin-bound enzyme in vivo.

Biochim Biophys Acta, 1981 Feb 26, 652(2), 283 - 93
ATP-dependent exonuclease V from Micrococcus luteus . The enzyme-DNA complex, the processive mechanism, and the role of ATP; Cerio-Ventura G et al.; Some kinetic predictions of the proposed processive mechanism for the hydrolysis of DNA by the ATP-dependent enzyme exonuclease V have been checked . The method is to trap enzyme molecules not attached to radioactive DNA substrate with an excess of nonradioactive DNA, so that enzyme molecules attached to the radioactive substrate contribute to the liberation of radioactive products only until they dissociate from it . The experiments show that enzyme molecules remain attached to a T7 double-stranded DNA molecule, while hydrolysing it, for about 2 min under our conditions, in agreement with the predictions of the processive mechanism . However, the mechanism of degradation of single-stranded DNA is not processive . Formation of an enzyme-DNA complex is largely dependent on the presence of ATP . This formation does not appear to be synchronous . ATP analogs do not stimulate formation of, nor stabilize, the enzyme-DNA complex . EDTA causes dissociation of enzyme molecules from the DNA complex.

Nucleic Acids Res, 1981 Feb 25, 9(4), 831 - 9
The characterisation of a 5-S 'monosome' fraction from chromatin of Physarum polycephalum; Annesley M et al.; A so-called '5-S mononucleosome' fraction was isolated from nuclei of Physarum polycephalum by digestion with micrococcal nuclease and subsequent fractionation by gel filtration . This fraction had electrophoretic and sedimentation properties which were similar to DNA of approximately 140 base pairs in length . It is shown that lysis of the nuclei activates a protease which is resistant to phenyl-methyl sulphonyl fluoride, o-phenanthroline and parachloromercuri benzene sulphonate and which subsequently degrades the nucleosomes.

Biochemistry, 1981 Feb 17, 20(4), 910 - 5
Immunochemical detection of chromosomal protein HMG-17 in chromatin subunits; Tahourdin CS et al.; Chromosomal protein HMG-17, purified from calf thymus, has been used to elicit specific antibodies in rabbits . Specific serological reaction between the antigen and the antisera is demonstrated by solid-phase radioimmunoassay and by competitive inhibition assays . The antisera did not cross-react with histones or other chromosomal HMG proteins . The antisera bound specifically to chromatin subunits isolated from HeLa cells, demonstrating that it may be used to study the in situ organization of this chromosomal protein . Chromatin purified from HeLa nuclei was digested with micrococcal nuclease, and the resulting mono- and oligonucleosomes were fractionated on a sucrose gradient . Analyses of the content of chromosomal proteins HMG-1, HMG-17, and H4 in different size nucleosomal particles, by the solid-phase radioimmunoassay, reveal that the distribution of HMG-17 was the same as that of H4, but different from that of HMG-1.

Nucleic Acids Res, 1981 Feb 11, 9(3), 473 - 87
Nucleosomal structure of sea urchin and starfish sperm chromatin . Histone H2B is possibly involved in determining the length of linker DNA; Zalenskaya IA et al.; Comparison has been made between sea urchin and starfish sperm chromatin . The only protein by which chromatins from these sources differ significantly is histone H2B . Sea urchin sperm H2B is known to contain an elongated N-terminal region enriched in Arg . Analysis of the micrococcal nuclease digests of sea urchin and starfish nuclei in one- and two-dimensional electrophoresis has shown that sperm chromatin of both animals consists of repeated units similar in general features to those of rat thymus or liver . However, DNA repeat length in chromatin of sea urchin sperm (237 bp) is higher than that of starfish sperm (224 bp), while the core DNA length does not differ and is the same as in the chromatin of rat liver or thymus . A suggestion has been made that the N-terminal region of histone H2B is associated with the linker DNA and is responsible for the increased length of sea urchin linker DNA.

Biochemistry, 1981 Feb 3, 20(3), 621 - 30
Structure of chromatin at deoxyribonucleic acid replication forks: location of the first nucleosomes on newly synthesized simian virus 40 deoxyribonucleic acid; Herman TM et al.; Exonucleases specific for either 3' ends (Escherichia coli exonuclease III) or 5' ends (bacteriophage T7 gene 6 exonuclease) of nascent DNA chains have been used to determine the number of nucleotides from the actual sites of DNA synthesis to the first nucleosome on each arm of replication forks in simian virus 40 (SV40) chromosomes labeled with {3H}thymidine in whole cells . Whereas each enzyme excised all of the nascent {3H}DNA from purified replicating SV40 DNA, only a fraction of the {3H}DNA was excised from purified replicating SV40 chromosomes . The latter result was attributable to the inability of either exonuclease to digest nucleosomal DNA in native replicating SV40 chromosomes, as demonstrated by the following observations: (i) digestion with either exonuclease did not reduce the amount of newly synthesized nucleosomal DNA released by micrococcal nuclease during a subsequent digestion period; (ii) in briefly labeled molecules, as much as 40% of the {3H}DNA was excised from long nascent DNA chains; (iii) the fraction of {3H}DNA excised by exonuclease III was reduced in proportion to the actual length of the radiolabeled DNA; (iv) the effects of the two exonucleases were additive, consistent with each enzyme trimming only the 3' or 5' ends of nascent DNA chains without continued excision through to the opposite end . When the fraction of nascent {3H}DNA excised from replicating SV40 DNA by exonuclease III was compared with the fraction of {32P}DNA simultaneously excised from an SV40 DNA restriction fragment, the actual length of nascent {3H}DNA was calculated . From this number, the fraction of {3H}DNA excised from replicating SV40 chromosomes was converted into the number of nucleotides . Accordingly, the average distance from either 3' or 5' ends of long nascent DNA chains to the first nucleosome on either arm of replication forks was found to be 125 nucleotides . Furthermore, each exonuclease excised about 80% of the radiolabel in Okazaki fragments, suggesting that less than one-fifth of the Okazaki fragments were contained in nucleosomes . On the basis of these and other results, a model for eukaryotic replication forks is presented in which nucleosomes appear rapidly on both the forward and retrograde arms, about 125 and 300 nucleotides, respectively, from the actual site of DNA synthesis . In addition, it is proposed that Okazaki fragments are initiated on nonnucleosomal DNA and then assembled into nucleosomes, generally after ligation to the 5' ends of long nascent DNA chains is completed.

Br J Cancer, 1981 Feb, 43(2), 201 - 9
Successful immunotherapy with micrococcus, BCG or related polysaccharides on L1210 leukaemia after BCNU chemotherapy; Verloes R et al.; The experiments aimed at evaluating the optimal parameters in the chemo-immunotherapeutic treatment of the L1210 lymphoid leukaemia grafted to {female BALB/c (H2d) X male DBA/2 (H2d)}F1 hybrid mice, hereafter referred to as CDF1 mice . In vitro irradiation of leukaemic ascites cells by X- or gamma-rays and subsequent inoculation in mice showed that optimum immunogenicity is radiation dose-dependent . Grafting mice with 10(7) leukaemic ascites cells irradiated at optimum dose (80 GyX- or gamma-rays) delays mortality of the animals when challenged later with untreated L1210 cells, but is unable to cure mice . By contrast, specific immunoprophylaxis induced by Micrococcus, complement-triggering polysaccharides or BCG and irradiated leukaemic cells was able to protect mice against grafts of 10(4) L1210 cells . The i.p . route was notably superior to the i.v . route . When mice bearing advanced L1210 tumour were treated by chemotherapy (12 mg/kg of BCNU) on Day 6.5 after grafting 10(4) L1210 cells and subsequently treated by immunotherapy, a very high percentage (up to 90%) of mice with 10(8) leukaemic cells could be cured by repeated 1mg injections of bacterium or polysaccharide, and challenge with irradiated leukaemic cells was unnecessary . Because of the high cure rate obtained, the very regular response pattern and the non-pathogenicity, the bacterium Micrococcus lysodeikticus would seem a promising new candidate for chemo-immunotherapeutic antitumour strategies.

Biosci Rep, 1981 Feb, 1(2), 119 - 23
Influence of pH and ionic strength on the lysis of Micrococcus luteus cells by hen lysozyme at low (20 degree C) and high (physiological, 40 degree C) temperature; Saint-Blancard J et al.; From isoactivity curves (showing activity as a function of Ph and ionic strength) it was found that in the pH domain 6.7-8.6 frequently used in experiments involving hen lysozyme, the pH optimum of lysis of Micrococcus luteus cells at low ionic strength (0.02-0.05) by the high-temperature form (40 degree C, physiological temperature) was one to two pH units lower than that by the low-temperature form (20 degree C).

Biokhimiia, 1981 Feb, 46(2), 269 - 75
{Tryptic peptides of maleylated alpha-chain of histidine decarboxylase from Micrococcus sp . n.}; Prozorovskii VN et al.; The maleylated alpha-chain of histidine decarboxylase from Micrococcus sp . n., containing 10 arginine residues was hydrolyzed by trypsin, and 9 peptides were isolated from the tryptic hydrolysate . A comparative study of the amino acid sequence in the tryptic peptides of alpha- and beta-chains of histidine decarboxylase allowed to establish the intramolecular homology in the alpha-chain primary structure and homology between the alpha- and beta-chains.

Zh Mikrobiol Epidemiol Immunobiol, 1981 Feb, (2), 23 - 7
{Expression of plasmid R6K in a cell-free coupled transcription-translation system}; Lisenkov AF et al.; The modified method for obtaining E . coli extract S 30 for the coupled transcription--translation system is described . The extract treated with immobilized DNAase and micrococcal nuclease had the minimal endogenous protein synthesis and high activity in respect to exogenous DNA matrices . The synthesis of 9-12 proteins with molecular weights ranging from 14,000 to 178,000 daltons was shown to occur in this system in the presence of the DNA of R6K plasmid . The use of the modification of Novick's method allowed to identify active beta-lactamase coded by the amp-gene of R6K plasmid.

Proc Natl Acad Sci U S A, 1981 Feb, 78(2), 852 - 5
Release of 7-methylguanine residues from alkylated DNA by extracts of Micrococcus luteus and Escherichia coli; Laval J et al.; Cell extracts from Micrococcus luteus release both free 3-methyladenine and free 7-methylguanine from alkylated DNA . The glycosylase activity responsible for the liberation of 7-methylguanine is not 3-methyladenine-DNA glycosylase, which, when purified, does not liberate it . Furthermore, the heat inactivation rates of the two enzymatic activities are different . The release of 7-methylguanine by chemical depurination of ethanol-soluble oligonucleotides has been ruled out . A similar activity releasing 7-methylguanine is also found in Escherichia coli.

Mol Biochem Parasitol, 1981 Feb, 2(3-4), 167 - 76
Subunit organization of chromatin from trypanosoma cruzi sensitive and resistant to ethidium bromide; Belnat P et al.; The chromatin from Trypanosoma cruzi has been analysed from a nuclear preparation after digestion with micrococcal nuclease . The DNA repeat length is found to be equivalent to 185 +/- 5 base pairs . The organization of chromatin in T . cruzi has been compared with that of sensitive trypanosomes treated with ethidium bromide and trypanosomes resistant to ethidium bromide . No differences were found.

Mech Ageing Dev, 1981 Feb, 15(2), 141 - 52
Evidence for an increased level of DNA damage in high doubling level human diploid cells culture; Dell'Orco RT et al.; Excision repair after ultraviolet (UV) irradiation was estimated in human diploid fibroblast-like cells (HDF) by treating DNA with a crude extract from Micrococcus luteus that contained pyrimidine dimer-specific endonucleases . The assays were done before and after the cells had been arrested in an essentially nonmitotic state . When low and high population doubling level (PDL) cells were assayed under these conditions, no age-related difference in the number of UV-induced endonuclease sensitive sites was observed, but the removal of these sites was more rapid in high PDL arrested cells . There was a difference between the calculated number average molecular weights (Mn) of DNA from unirradiated low and high PDL arrested cells . The lower Mn of the DNA from high PDL cells indicated that other enzymes present in the M . luteus extract were acting upon non-UV-induced DNA distortions and that these were present to a greater extent in the chromatin associated regions of older cells . These results support the hypothesis that DNA damage accumulates as HDF progress through their in vitro life span.

Eur J Cell Biol, 1981 Feb, 23(2), 295 - 302
Distinctive features of dinoflagellate chromatin . Absence of nucleosomes in a primitive species Prorocentrum micans E; Herzog M et al.; The absence of nucleosome-like structures from purified nuclei of the primitive dinoflagellate Prorocentrum micans was demonstrated by three means . i) Electron microscopy revealed mostly thin, smooth 6-nm nucleofilaments in chromatin incubated at various ionic strengths and either fixed in 0.1% glutaraldehyde or unfixed . No "beads-on-a-string" structure was found . ii) Analysis of nuclear proteins showed that low amounts of basic proteins were present (basis proteins: DNA less than 0.1), the two major one with molecular weights 12 000 and 13 000 and that histones characteristic of eucaryotes were absent . iii) Digestion of the nuclei with micrococcal endonuclease of DNase I did not result in partially digested DNA fragment repeats . Only about 10% of the bulk of the nuclear DNA was digested by micrococcal endonuclease . The high molecular weight of the remainder suggests particular protection against this type of nuclease . In the light of these distinctive nuclear features, we discuss the evolutionary position of the dinoflagellate protists with respect to the procaryotes and eucaryotes.

Cell, 1981 Feb, 23(2), 401 - 9
Chromatin structure of the histone genes of D . melanogaster; Samal B et al.; We have examined the chromatin structure of the histone gene repeat of D . melanogaster using an indirect end-labeling technique . Our results show that each DNA segment of the repeat is packaged into a precisely defined and characteristic structure, as follows: the nontranscribed spacers display a "normal" chromatin arrangement, with each nucleosome precisely positioned on the underlying DNA sequence; the 5' ends of all five histone genes are in an exposed configuration, highly sensitive to both micrococcal nuclease and DNAase I; and the genes have an "altered" chromatin structure, as indicated by the weak and irregularly spaced nuclease cuts . This well-defined chromatin arrangement is established early in development and is stably maintained throughout the remainder of the D . melanogaster life cycle.

Biochim Biophys Acta, 1981 Jan 29, 652(1), 55 - 63
Competitive binding studies of compounds that interact with DNA utilizing fluorescence polarization; Richardson CL et al.; The increase in the fluorescence polarization of acridine orange upon binding to DNA molecules is used as the basis of a competitive method to study the interaction of a variety of fluorescent and non-fluorescent compounds with DNA . Test compounds that interact with DNA inhibit both the binding of acridine orange to DNA and the accompanying increase in fluorescence polarization . Actinomycin D exhibits a dose-dependent inhibition of acridine orange-DNA binding with Micrococcus luteus DNA, calf thymus DNA, and poly(dG-dC); no detectable inhibition of acridine orange intercalation into poly(dA-dT) is observed . In contrast, proflavine shows similar acridine orange inhibition for poly(dA-dT), calf thymus DNA and M . luteus DNA.

Biochemistry, 1981 Jan 20, 20(2), 238 - 44
Synthesis by DNA polymerase I on bleomycin-treated deoxyribonucleic acid: a requirement for exonuclease III; Niwa O et al.; phi X174 RFI DNA treated with bleomycin (BLM) under conditions permitting nicking does not serve as a template-primer for Escherichia coli DNA polymerase I . Purified exonuclease III from E . coli and extracts from wild-type E . coli strains are able to convert the BLM-treated DNA to suitable template-primer, but extracts from exonuclease III deficient strains are not . Brief digestion by exonuclease III is enough to create the template-primer, suggesting that the exonuclease III is converting the BLM-treated DNA by a modification of 3' termini . The exonucleolytic rather than the phosphatase activity of exonuclease III appears to be involved in the conversion . Comparative studies with micrococcal nuclease indicate that BLM-created nicks do not have a simple 3'-P structure . Bacterial alkaline phosphatase does not convert BLM-treated DNA to template-primer . The endonuclease VI activity associated with exonuclease III does not incise DNA treated with BLM under conditions not allowing nicking, in contrast to DNA with apurinic sites made by acid treatment, arguing that conversion does not require the endonuclease VI action on uncleaved sites.

Nature, 1981 Jan 15, 289(5794), 198 - 203
Chromatin fine structure of active and repressed genes; Levy A et al.; Study of the structural organization of chromatin during transcription and replication may reveal important aspects of these processes . At the lowest level of organization, chromatin consists of a repeating subunit, the nucleosome (for reviews see refs 1-3) . Electron microscopy indicates that the nucleosomes are arranged helically or form discrete superbeads, generating the familiar 250 A-300-A fibre . It has been suggested that this fibre is further folded into loops containing up to several hundred nucleosomes . Despite extensive study, the significance and fate of these nucleosomes remain obscure . We have used here micrococcal nuclease digestion to compare the structures of actively transcribing and inert chromatin of the genes coding for the major heat-shock protein of Drosophila melanogaster . The repressed hsp 70 genes were considerably more resistant to cleavage by micrococcal nuclease than their flanking regions and the bulk of chromatin . The active genes, previously shown to be more sensitive than the repressed genes, are also more susceptible to the nuclease than their 3'-flanking regions and bulk chromatin.

J Biol Chem, 1981 Jan 10, 256(1), 539 - 46
Structure of the filamentous bacteriophage fl . Location of the A, C, and D minor coat proteins; Grant RA et al.; The location within the virion of the A, C, and D minor coat proteins of the filamentous bacteriophage fl has been analyzed . The A protein is present in approximately 5 copies/particle and is located at the tip of normal length phage, miniphage, and fl/pBR322 chimeric phage, a longer than normal length phage . The mole ratios of the A, C, and D proteins are the same for each type of particle, consistent with a model of phage organization in which the minor coat proteins are clustered near or at the ends of the phage . Normal length phage were fragmented by passing them through a French press, and those fragments that contained the A protein were separated from those that did not by treating the mixture with anti-A protein antibody . Analysis of the protein compositions of the two populations of fragments showed that the A and D proteins were found together in one population of fragments and that most, it not all, of the C protein was found in the other . These results show that the D protein is located near or at the A protein end of the phage and that the C protein is located in a region near or at the opposite end . Treatment of the virion with proteases which lowered the infectivity of the phage resulted in particles in which only the A protein was cleaved to any detectable extent . These particles remained resistant to the action of micrococcal nuclease.

Nucleic Acids Res, 1981 Jan 10, 9(1), 203 - 13
Transient conformation changes in chromatin during excision repair of ultraviolet damage to DNA; Bodell WJ et al.; DNA labeled for 15 minutes during UV induced repair synthesis is two-fold more sensitive to micrococcal nuclease than the bulk nuclear DNA . As the length of the labeling period increases from 15 minutes to 4 hours the nuclease sensitivity of repair labeled DNA approaches that of bulk chromatin . Pulse-chase experiments indicate that the nuclease sensitivity of the repaired DNA labeled during a brief pulse decreases with a half-life of about 15 minutes . In contrast to previous interpretations, we consider these results to mean that immediately after synthesis, chromatin labeled during repair has a conformation which renders it more susceptible to nuclease digestion than the bulk chromatin . With time these repaired regions are assembled into a nucleosome structure with normal nuclease sensitivity.

Vet Med Nauki, 1981, 18(10), 41 - 5
{DNA nucleotide composition of Gram-positive cocci isolated from food products of animal origin}; Gogov I et al.; Studied was the nucleotide composition of 34 strains of gram-positive cocci isolated from slaughtered birds, sheep milk, and milk from mastitis-affected cows and ewes . The differentiation of the strains was carried out in conformity with the instructions of Bergey's Manual of Determinative Bacteriology (1974) on the basis of the following indices: morphology of colonies, morphology and staining of the cells after Gram, catalase, oxydase, respiration type, fermentation of manite, production of plas mocoagulase, thermonuclease, and phosphatase and response to novobiocin . The amount of guanine, adenine, cytosine, and thymine in the investigated strains was determined after the method of Spirin and Belozerskii . On this basis the guanine-cytosine percent was calculated . Results showed that the use of the guanine-cytosine percent made it possible to more accurately differentiate the genus with gram-positive cocci . In 88.24 per cent of the investigated strains there was coincidence between the guanine-cytosine percent and their biochemical characteristics . Two of the strains (guanine-cytosine percent 49.95 and 47.48) were shown to belong to the group of planococci . No typical micrococci (with a guanine-cytosine percent of more than 60.00) were established.

Toxicology, 1981-82, 22(4), 353 - 8
Decreased level of lysozyme in rabbit lung lavage fluid after inhalation of low nickel concentrations; Lundborg M et al.; Six rabbits were exposed for 4 months (5 days/week, 6 h/day) and 6 rabbits for 8 months to approx . 0.1 mg/m3 of metallic nickel dust (U.S . threshold limit value (TLV) 1 mg/m3) . Another 8 rabbits were exposed for 4-6 weeks (5 days/week, 6 h/day) to 0.3 mg/m3 (as Ni) of nickel chloride (U.S . TLV 0.1 mg/m3) . After exposure lungs were lavaged . Concentration of lysozyme in the lavage fluid was estimated with the lyso-plate technique (agar plates with heat-killed Micrococcus lysodeikticus) after macrophages had been removed . All 3 exposed groups had markedly lower concentrations of lysozyme than corresponding controls . Mean values in controls and exposed rabbits were: for 4 months metallic nickel dust exposure 2.3 and less than or equal to 0.04 microgram/ml; for 8 months metallic nickel dust exposure 1.4 and less than or equal to 0.5 microgram/ml; and for nickel chloride exposure 1.9 and less than or equal to 0.4 microgram/ml.

Mol Biol (Mosk), 1981 Jan-Feb, 15(1), 234 - 42
{Microinjection of non-histone chromatin protein derived from mouse spleen into L cells}; Karavanov AA et al.; Non-histone protein selectively released from mouse spleen nuclei by mild hydrolysis with micrococcal nuclease or DNase I was introduced into L cells by the microinjection method . It is shown that this protein selectively accumulates in cell nuclei . Analysis of the mitotic cells after microinjection of 125I labeled protein demonstrated its location in chromosomes of L cells.

Chromosoma, 1981, 84(2), 279 - 90
Different chromatin structures in Physarum polycephalum: a special form of transcriptionally active chromatin devoid of nucleosomal particles; Scheer U et al.; Nonnucleolar chromatin from interphase nuclei of Physarum polycephalum plasmodia occurs in two different structural configurations as seen in electron microscopic spread preparations . While the majority of the chromatin is devoid of nascent ribonucleoprotein (RNP) fibrils and compacted into nucleosomal particles, a minor proportion (10-20%) is organized differently and reveals a smooth contour . It is this form of smooth chromatin which is rich in transcription units (mean length: 1.36 +/- 0.21 micrometer) . Only occasionally are solitary nascent RNP fibrils observed which are associated with beaded strands of chromatin . In transcribed smooth chromatin nucleosomal particles are not only absent from the transcription units but also from their nontranscribed flanking regions, indicating that this special structural aspect is not merely a direct consequence of the transcriptional process . The existence of ca . 10-20% of Physarum chromatin in the smoothly contoured form is discussed in relation to reports of a preferential digestibility of a similar proportion of Physarum chromatin by DNAse I (Jalouzot et al., 1980) and to the altered configuration of "peak A" chromatin subunits after micrococcal nuclease digestion (Johnson et al., 1978 a, b).

Acta Biol Med Ger, 1981, 40(4-5), 527 - 33
Translational discrimination between embryonic and adult mouse globin mRNAs in the rabbit reticulocyte lysate system; Farace MG et al.; In the present study mouse adult (alpha, beta) and embryonic globin (x, y, z) mRNas are compared for their capacity of being translated in a micrococcus nuclease treated rabbit reticulocyte lysate . The results of these experiments indicate that: 1) alpha and beta adult RNAs are translated with a higher efficiency as compared to the alpha-like and beta-like embryonic mRNAs; 2) adult beta and embryonic beta-like messengers are translated more efficiently than their corresponding adult alpha and embryonic alpha-like messengers; 3) the alpha/beta synthetic ratio, both for adult and embryonic globins is highly dependent upon the concentration of globin mRNAs . For embryonic globins the ratio decreases from 0.21 at low mRNA concentration to 0.11 at high mRNA concentration . For adult globin mRNAs the alpha/beta chain synthetic ratio decreases from 1.4 to 0.9 within the same range of concentration.

J Supramol Struct Cell Biochem, 1981, 15(4), 395 - 402
Heparin-inhibitable lectins: marked similarities in chicken and rat; Roberson MM et al.; Extracts of young rat lung contain a heparin-inhibitable lectin that closely resembles one recently purified from chicken liver . Both lectins interact with heparin and N-acetyl-D-galactosamine, and were purified by gel filtration on Sepharose CL-2B followed by affinity chromatography on heparin-Sepharose . They both behave as high molecular weight aggregates that can be dissociated into two peptides with apparent molecular weights of 13,000 and 16,000 by gel electrophoresis in SDS . Samples of purified lectin contained up to 20% DNA by weight, and the degree of lectin aggregation and hemagglutination activity was greatly reduced by treatment with micrococcal nuclease without inhibiting heparin-binding activity . Association of lectin with DNA is an artifact of homogenization in high salt, since only 2% of the lectin is found associated with a purified nuclear fraction.

Cell Biol Int Rep, 1981 Jan, 5(1), 37 - 43
The high mobility group proteins and transcribed nucleosomes; Mathew CG et al.; Monomer nucleosomes released from nuclei during brief micrococcal nuclease digestions are enriched in transcribed sequences (Bloom and Anderson, 1978) . These nucleosomes are depleted in H1 and enriched in three high mobility group proteins HMG14, HMG17 and another HMG-like protein . Analysis of such nucleosomes by polyacrylamide gel electrophoresis reveal that they are heterogenous . Similarly, monomer nucleosomes soluble in 0.1 M NaCl separate on polyacrylamide gels into mainly two types of particle, one of which has HMG14 and HMG17 bound . However, the DNA of the HMG-nucleosomes from chick erythrocytes is not enriched in globin sequences, suggesting that protein rearrangement may have occurred.

Can J Biochem, 1981 Jan, 59(1), 22 - 9
Nuclease sensitivity of postreplicated chromatin from Ehrlich ascites tumour cells; Miki BL et al.; Chromatin appears to undergo structural modification after replication and before integration into bulk chromatin . In ascites cells, postreplicated chromatin displays a transient resistance to digestion with micrococcal nuclease . This resistance may be correlated with a shorter DNA repeat length (178 base pairs) than that found in bulk chromatin (187 base pairs) . Selective labelling or selective digestion of DNA sequence classes could not account for these observations . In both bulk and postreplicated chromatin, three electrophoretic types of mononucleosomes were found . Postreplicated mononucleosome types showed selective sensitivities to nuclease digestion whereas bulk mononucleosome types did not.

Eur J Biochem, 1981 Jan, 113(3), 569 - 73
Turnover of the major polypeptides of 40-S monomer particles; Ivanova E et al.; The pulse-chase experiments with Friend erythroleukemia cells designed to reveal the metabolic properties of the protein complex of 40-S particles showed that the major polypeptides of this complex turn over with half-lives between 19 h and 206 h . the main conclusion from the experiments is that the complex does not degrade as a single unit . Since the individual polypeptides forming the complex live much longer than hnRNA, and in addition degrade at a different rate, we considered the following two modes of degradation as most likely . (1) The complex might not be subjected to a profound degradation at the end of the processing of associated pre-mRNA . In this case it should exist as a long-lived recyclable mosaic of metabolically differing polypeptides whose replacement takes place at a specific rate . (2) Alternatively, the protein complex might be completely degraded at the end of processing, but in a way that liberates free individual polypeptides available for recycling . The further experiments indicate that the 37 000-Mr, 34 000-Mr and 32 000-Mr core proteins in isolated 40-S particles and in particles associated with a nuclear fraction released from chromatin after micrococcal nuclease digestion degrade at different rates . These experiments suggest the existence of at least a metabolic heterogeneity among the population of nuclear particles carrying pre-mRNA.

Z Naturforsch {C}, 1981 Jan-Feb, 36(1-2), 149 - 56
Binding of polylysine and ethidium bromide to nucleosomal DNA: comparison of biochemical and electron microscopical results; Marx R et al.; Ethidium bromide and polylysine interact with nucleosomal DNA and lead to change of biochemical properties and to morphological changes as to the distance between the two core particles of a nucleosome dimer . With increasing polylysine concentration, the buoyant density of nucleosomes decrease and the accessibility of the nucleosomal DNA to micrococcal nuclease is lowered . Electron microscopy of polylysine treated nucleosome dimers reveals a shortening of the internucleosomal distance as compared with controls . Treatment of nucleosomes with ethidium bromide leads to an enhanced accessibility of the nucleosomal DNA to micrococcal nuclease . Electron microscopy reveals an increase in length of the DNA connecting the two nucleosome cores in the presence of the dye . Both the binding of polylysine and the treatment with ethidium bromide apparently do not affect the histone arrangement within the nucleosome core as suggested by chemical cross-linking of histones and DNA with formaldehyde, and no obvious morphological change of the nucleosome cores can be observed.

Proc Natl Acad Sci U S A, 1981 Jan, 78(1), 83 - 7
Cytoplasmic polyadenylate processing events accompany the transfer of mRNA from the free mRNP particles to the polysomes in Physarum; Adams DS et al.; The relationship between the mRNA in the polysomes and the free cytoplasmic messenger ribonucleoprotein of Physarum polycephalum was studied by microinjection techniques . Labeled free cytoplasmic ribonucleoprotein, prepared from donor plasmodia, was microinjected into unlabeled host plasmodia, and its fat was followed in the host ribonucleoprotein particles . Approximately one-half of the poly(A)-containing RNA {poly(A)+RNA} that originated from the microinjected particles was incorporated into the host polysomes by normal translational processes within 1 hr . Very short poly(A) sequences (approximately 15 nucleotide residues) were found in these poly(A)+RNA molecules . These short poly(A) sequences were sensitive to digestion with micrococcal nuclease, suggesting that they were not associated with protein . Because the poly(A)+RNA molecules of the microinjected free cytoplasmic mRNP had originally contained poly(A) sequences 50-65 nucleotides long and were associated with protein extensive poly(A) degradation and poly(A).protein complex dissociation must have occurred during their incorporation into the polysomes or during their translation . These results demonstrate a precursor-product relationship between free cytoplasmic mRNP and polysomal mRNA and suggest that the incorporation process in Physarum is accompanied by structural modifications in the poly(A) region of mRNA . They also imply that the polysome is a site for disruption of the poly(A).protein complex and poly(A) degradation.

J Virol, 1981 Jan, 37(1), 500 - 5
Translation of black beetle virus RNA and heterologous viral RNAs in cell-free lysates derived from Drosophila melanogaster; Guarino LA et al.; A cell-free protein synthesizing system was prepared from cells of Drosophila melanogaster line 1 and made mRNA dependent by treatment with micrococcal nuclease . The system was tested with homologous RNA from black beetle virus propagated in Drosophila cells, with Drosophila heat shock mRNA, and with various heterologous viral mRNA's . Under optimal conditions amino acid incorporation programmed with black beetle virus RNAs was 30-fold higher than endogenous incorporation . RNAs 1 and 2 primarily directed the synthesis of proteins with approximately molecular weights of 120,000 and 46,000, respectively . mRNA's, prepared by transcription from vesicular stomatitis virus or vaccinia virus, were translated efficiently and yielded products that comigrated with authentic viral proteins . Brome mosaic virus RNA and encephalomyocarditis virus RNA were translated poorly . The system retained full activity after freezing.

Mol Biol (Mosk), 1981 Jan-Feb, 15(1), 220 - 33
{Properties of protein released from mouse spleen nuclei under conditions of limited hydrolysis with DNase I and micrococcal nuclease}; Karavanov AA et al.; Proteins released by mouse spleen nuclei under conditions of limited hydrolysis with DNase I and micrococcal nuclease were compared . Analysis of these proteins by polyacrylamide gel electrophoresis in the presence of SDS revealed the essential similarity in the qualitative composition of released proteins . Characteristics of the most prominent component were studied in both cases and it was shown that this component is identical . It has a molecular weight of 25 500 according to electrophoresis data and 2300 as determined by equilibrium sedimentation . Amino acids composition and N-terminal amino acid were studied . It was shown that its N-amino acid is arginine.

Vopr Med Khim, 1981, 27(4), 538 - 44
{Inhibition of chromatin autolysis in the process of isolating and incubating rat liver cell nuclei}; Khodarev NN et al.; Dependence of endogenous nuclear nuclease/nucleases/ activity on pH value and ion composition of the isolation and incubation media was studied . Change in buffer pH value up to pH 9.0 and addition of Ca2+ instead of Mg2+ significantly inhibited the endogenous nuclease activity in rat liver nuclei . On the basis of these data the procedure for isolation of nuclei developed by Shaveau was modified . Almost complete inhibition of the endogenous nuclease activity was achieved during destruction of chromatin DNA from the isolated nuclei in presence of exogenous nuclease/micrococcal/.

Acta Derm Venereol, 1981, 61(3), 267 - 9
The effect of benzoyl peroxide on acne; Cunliffe WJ et al.; A double-blind study of two commonly used (5%) benzoyl peroxide-containing preparations showed that they were equally effective in the treatment of acne . With these treatments there was a reduction in P . acnes, Micrococcaceae and surface-free fatty acids . These data support the continued use of benzoyl peroxide preparations in the treatment of acne.

J Biol Chem, 1980 Dec 25, 255(24), 12047 - 50
Comparison of the cleavage of pyrimidine dimers by the bacteriophage T4 and Micrococcus luteus UV-specific endonucleases; Gordon LK et al.; A comparison was made of the activity of the UV-specific endonucleases of bacteriophage T4 (T4 endonuclease V) and of Micrococcus luteus on ultravilet light-irradiated DNA substrates of defined sequence . The two enzymes cleave DNA at the site of pyrimidine dimers with the same frequency . The products of the cleavage reaction are the same, suggesting that the scission of DNA by T4 endonuclease V occurs via the combined actin of a pyrimidine dimer specific DNA glycosylase and an apyrimidinic-apurinic (AP) endonuclease as was recently shown for the M . luteus enzyme . The pyrimidine dimer DNA-glycosylase activity of both enzymes is more active on double-stranded DNA than it is on single-stranded DNA.

Nucleic Acids Res, 1980 Dec 20, 8(24), 6069 - 79
Histone H1o: its location in chromatin; Smith BJ et al.; Histone H1o is an H5-like protein found in mammals . Its location in chromatin from animal tissues has been studied by micrococcal nuclease digestion and by quantitation . It was found that H1o occurs in the linker region of chromatin, and replaces H1 there as it does so . As much as a third of the H1 becomes replaced, at least in some tissues . The abundance of H1o was similar in bulk chromatin and in a mononucleosome population which was putatively enriched in transcribed DNA sequences . It was concluded that H1o probably does not suppress transcription.

Biochim Biophys Acta, 1980 Dec 11, 610(2), 392 - 9
Structural rearrangement of histone-H1-depleted chromatin during thermal denaturation; Dimitrov SI et al.; The influence of thermal denaturation on the nucleosomal structure of histone-H1-depleted chromatin was studied using psoralen-treated nucleoprotein preparations subjected to partial thermal denaturation . DNA was cross-linked with psoralen to ensure its complete renaturation upon cooling . The structure of the preheated nucleoprotein was investigated by thermal denaturation, kinetics of hydrolysis and DNA fragment pattern obtained upon digestion with micrococcal nuclease . The electron micrographs of the partially denatured nucleohistone showed gross changes in the nucleosomal structure which were consistent with a sliding of histone cores along DNA as recently reported by Tsaneva et al . (Tsaneva, I., Dimitrov, S., Pashev, I . and Tsanev, R., FEBS Lett., (1980) 112, 143-146) . This interpretation is strongly supported by the following features of the partially denatured material: a, increased rate of degradation of DNA by micrococcal nuclease; b, melting of a part of DNA as a protein-free DNA; and c, shortening of the DNA repeat length upon digestion with micrococcal nuclease . The sliding of the core histones is parallelled by the denaturation of histones, which accounts for the very intensive background in the DNA digestion pattern, the loss of nucleosome morphology at higher temperatures, and the disappearance in the melting profile of the transition at 72 degrees C.

Biochemistry, 1980 Dec 9, 19(25), 5836 - 42
Carcinogen aflatoxin B1 is located preferentially in internucleosomal deoxyribonucleic acid following exposure in vivo in rainbow trout; Bailey GS et al.; The purpose of this work was to investigate the distribution in chromatin of deoxyribonucleic acid (DNA) adducts of aflatoxin B1, following exposure in vivo . Rainbow trout were injected intraperitoneally with radiolabeled aflatoxin B1, a potent procarcinogen known to readily induced hepatocellular carcinomas in these fish . After maximum incorporation, liver nuclei were prepared and digested with micrococcal nuclease . Mono-, di-, and trinucleosomal fractions were purified from several stages of nuclease digestion, and the lengths and specific activities of their DNA were determined . The results indicate that aflatoxin B1 is approximately 5 times as likely on a per nucleotide basis to localize on internucleosomal (linker) DNA as on nucleosomal core DNA in this system.

Eur J Biochem, 1980 Dec, 113(1), 15 - 25
Characterization of poly(ADP-ribose)--histone H1 complex formation in purified polynucleosomes and chromatin; Nolan NL et al.; Poly(ADP-ribose) {poly(ADP-Rib)} polymerase of HeLa nucleosomes has been shown in vitro, to catalyze the synthesis of a complex of histone H1 containing 2 H1 histones and 15-16 units of oligo(ADP-Rib) . The synthesis of the H1 complex in vitro was compared in polynucleosome populations of various sizes (3--16 and greater than 30) released from HeLa nuclei following micrococcal nuclease digestion . Poly(ADP-Rib) was synthesized from {32P}NAD and the poly(ADP-ribosyl)ation of H1 was studied by selective H1 extraction, gel electrophoresis and autoradiography . Quantitative differences in H1 complex formation occurred when either chromatin concentration or polynucleosome length was varied . The data indicated that H1 complex formation in vitro was favored in polynucleosomes 16 nucleosomes long as compared to 8 nucleosomes . A series of partially ADP-ribosylated H1 species was also detected . Partially modified H1 species migrate more slowly than pure H1 in dodecylsulfate gels . The reduced mobility is a function of the number of attached ADP-Rib moieties . Thus, molecules containing one molecule of H1 and various numbers of ADP-Rib residues can be separated . When the partially modified H1 species were incubated in alkali to cleave the linkage of ADP-Rib to protein, (ADP-Rib1-15) were detected by chain length analysis on 15% polyacrylamide gels . The intermediate H1 species could be chased, in vitro, into as H1 complex with NAD and thus were determined to be successive precursors in the formation of the H1 complex . Evidence is presented that the H1 complex is synthesized in intact cells permeabilized with lysolecithin.

Biochem J, 1980 Dec 1, 191(3), 729 - 42
Binding of quinoline analogues of echinomycin to deoxyribonucleic acid . Role of the chromophores; Fox KR et al.; Two novel antibiotics were isolated, designated compounds 1QN and 2QN respectively, having quinoline rings in place of one or both of the quinoxaline chromophores of echinomycin . Each removes and reverses the supercoiling of closed circular duplex DNA from bacteriophage PM2 in the fashion characteristic of intercalating drugs . For compound 1QN, the unwinding angle at I0.01 is almost twice that of ethidium, whereas for compound 2QN the value is indistinguishable from that of ethidium . Binding of both analogues produced changes in the viscosity of sonicated rod-like DNA fragments corresponding to double the helix extension found with ethidium, a feature characteristic of bifunctional intercalation by quinoxaline antibiotics . These results suggest that both compounds 1QN and 2QN behave as bifunctional intercalators but that compound 2QN produces only half the helix unwinding seen with compound 1QN and the natural quinoxalines . Binding curves for the interaction of both analogues with a variety of synthetic and naturally occurring nucleic acids were determined by solvent-partition analysis . Values for compound 2QN were also obtained by a fluorimetric method and found to agree well with the solvent-partition measurements . Compound 1QN bound most tightly to Micrococcus lysodeikticus DNA and, like echinomycin, exhibited a broad preference for (G + C)-rich DNA species . For compound 2QN no marked (G + C) preference was indicated, and the tightest binding among the natural DNA species studied was found with DNA from Escherichia coli . The two analogues also displayed different patterns of specificity in their interaction with synthetic nucleic acids . Compound 2QN bound to poly(dA-dT) slightly more tightly than to poly-(dG-dC), whereas compound 1QN displayed a large (approx . 11-fold) preference in the opposite sense . There was evidence of co-operativity in the binding to poly(dA-dT) . It may be concluded that the chromophore moieties play an active role in determining the capacity of quinomycin antibiotics to recognize and bind selectively to specific sequences in DNA.

Can J Microbiol, 1980 Dec, 26(12), 1408 - 11
Unusual polar lipids of Micrococcus radiodurans strain Sark; Thompson BG et al.; The polar lipids of Micrococcus radiodurans strain Sark appear to be unique in that common bacterial phospholipids such as phosphatidylethanolamine, phosphatidylserine, phosphatidylcholine, and phosphatidylinositol are absent . Of the 13 polar lipids detected, 5 contain phosphorus and carbohydrate, 4 contain carbohydrate and no phosphorus, and 1 contains phosphorus as well as sulfur . None of the polar lipids contain free choline or amino groups and none are sensitive to phospholipases C or D . Of eight selected polar lipids tested, all were found to be labile to milk alkali, suggesting the presence of ester linkages . It is suggested that the unusual lipid profile of M . radiodurans strain Sark may be useful in taxonomic considerations.

J Bacteriol, 1980 Dec, 144(3), 1061 - 7
Prophage induction in a permeabilized cell system: induction by deoxyribonucleases and the role of recBC-deoxyribonuclease; Irbe RM et al.; Permeabilized cells able to induce prophage were obtained by plasmolysis and preincubation of the cells in a reaction mixture which allows protein synthesis . These cells became permeable to low-molecular-weight proteins and oligonucleotides . We found that deoxyribonucleases (pancreatic deoxyribonuclease and micrococcal nuclease) triggered prophage (phi 80) induction . This deoxyribonuclease-triggered induction was completely dependent upon the presence of functional recBC genes in the lysogen, regardless of the recombination proficiency determined by recBC and sbcB genes . The possible role of recBC-deoxyribonuclease in prophage induction and recombination is discussed.

Jpn J Antibiot, 1980 Dec, 33(12), 1294 - 300
{Studies on cefoperazone concentration in human biliary tract and clinical effect for acute cholecystitis and cholangitis (author's transl)}; Hirasawa S et al.; A new antibiotic drug of cephalosporin, with marked resistance to beta-lactamase, cefoperazone (CPZ) for parenteral use was used in 10 patients with acute cholecystitis or cholangitis with cholelithiasis . CPZ was given by drip intravenous injection at a daily dose of 1 to 4 g . Clinical response was excellent in 1 case, good in 7 cases, fair in 2 cases and poor was none . Clinical adverse effect was not recognized . And CPZ in a dose of 1 g was given intravenously during the operation to 6 of those patients . Tissue specimens of different sites were taken from removed organs . The materials of A-bile and B-bile were subsequently taken at intervals . Determination of CPZ concentration was performed according to paper disk method with Micrococcus luteus ATCC 9341 strain . CPZ concentrations in the A-bile increased quickly soon after injection, and reached high level peak at 30-min . to 1 hour, then they were very slow decline . CPZ was observed in the B-bile through the gallbladder wall, and reached high level concentration comparative quickly after intravenous injection . CPZ concentration in the gallbladder wall, was directly proportional to the degree of pathological changes of inflammation . On the CPZ concentration in patients with acute cholecystitis, the concentration in A-bile, B-bile and gallbladder wall were observed extremely higher than the MIC or CPZ for Escherichia coli . CPZ therefore will be a very useful drug when used for chemotherapy of biliary tract infection.

Cell Biophys, 1980 Dec, 2(4), 373 - 404
The quinternary chromatin-DNA structure . Three-dimensional reconstruction and functional significance; Kendall FM et al.; Nuclear DNA-space images from Feulgen-stained HeLa cells synchronized at 1, 3, 5, 8, 12, 15, and 18 h following mitosis are digitized and their densitometric-geometric patterns are analyzed by means of a Quantimet 720-D image analyzer on line with a PDP11/40 computer . Frequency distributions of picture point optical densities for the phases and subphases as seen in nuclear images show that DNA packing changes are evident by means of ordinary optical microscopy . Radii of gyration of the images, and optical density profiles and distributions for several squashes of similar cells reveal that in particular instances chromatin DNA is distributed mostly towards the periphery, and usually with high circular isotropy . Cross power spectra of individual scan lines suggest that existence of higher order "quinternary" periodic structure for chromatin that modulates during the cell cycle . Three-dimensional reconstruction 2- micrometer sections of intact, Feulgen-stained mammalian tumor tissue show stainable material only toward the nuclear perimeter and not in the center (compatible with the evidence that initial thymidine incorporation in HeLa cells is generally at the nuclear border) . Densitometric properties of reconstructed interphase chromatin-DNA bodies are highly coupled with similar properties of the whole nucleus, showing that a more condensed nucleus is always accompanied by a more condensed interphase chromatin DNA . The effect of micrococcal nuclease digestion on the digitized nuclear images is also presented . All the above data are then discussed in terms of a quinternary chromatin-DNA structure and its modulation during the cell cycle.

Nucleic Acids Res, 1980 Nov 25, 8(22), 5363 - 75
Different repeat lengths in rat satellite I DNA containing chromatin and bulk chromatin; Omori A et al.; The nucleosome repeat structure of a rat liver chromatin component containing the satellite I DNA (repeat length 370 bp) was investigated . Digestion experiments with micrococcal nuclease, DNAase II, and the Ca2+/Mg2+-dependent endogenous nuclease of rat liver nuclei revealed a repeat unit of 185 nucleotide pairs which is shorter by approximately 10 bp than the repeat unit of the bulk chromatin of this cell type . The difference seems not to be related to the histone composition which was found to be similar in the two types of chromatin.

Nucleic Acids Res, 1980 Nov 25, 8(22), 5317 - 31
Organizational changes in chromatin at different malignant stages of Friend erythroleukemia; Leonardson KE et al.; The chromatin structure of morphologically-similar, but increasingly-malignant erythroleukemia cells was investigated using milk micrococcal nuclease digestion of isolated nuclei . The maximum solubilization of chromatin was unique for each of the three cell types: the least malignant (our Stage II) released 61% of its chromatin DNA, the most malignant (Stage IV), 46%, and the intermediate (Stage III) released 36% . An analysis of the nucleosome oligomers liberated by digestion also demonstrated differences . After 15 minutes of digestion when release was reaching its maximum, a greater proportion of large nucleosomal oligomers (sizes > trinucleosome) was released from Stage II nuclei than from Stage III or IV nuclei . The cell types also differed in the relative amount of H1-depleted mononucleosomes released . Analysis of the size of the double-stranded DNA associated with mononucleosomal particles showed that Stage III mononucleosomes were smaller (148 bp) than Stage IV (167 bp) or Stage II (190 bp) . In addition, while the DNA of mononucleosomes depleted in H1 was smaller than that in the H1-containing species, relative size differences among the different cell types were retained . These data suggested that the difference in the mononuocleosome particle size resistant to nuclease digestion was independent of histone H1 . Differences in nucleosome repeat length were also noted among the cell types . These studies have demonstrated dramatic differences in chromatin structure associated with malignant potential of an otherwise morphologically identical cell type . These findings may reflect changes in the relative amounts of H2a variants which we have previously described among the different malignant cell types.

Nucleic Acids Res, 1980 Nov 25, 8(22), 5423 - 6
The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus; Hori H et al.; The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH . When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria.

J Biol Chem, 1980 Nov 25, 255(22), 10671 - 5
Binding of the high mobility group protein, H6, to trout testis chromatin; Kuehl L et al.; When 125I-labeled H6 was incubated with trout testis nuclei under conditions of pH and ionic strength approximating those in vivo, the radioactivity bound nearly quantitatively to the chromatin . Under comparable conditions, most non-nuclear proteins do not bind . Binding was neither tissue- nor species-specific, and HMG-17, a mammalian homolog of H6, behaved similarly to H6 . The labeled and the endogenous H6 molecules were equivalent by several criteria: 1) Both were released nearly quantitatively upon treatment of the chromatin with DNase I, whereas neither was released by digestion with micrococcal nuclease, suggesting that the labeled molecules, like those of endogenous H6, were bound primarily to the core particles in transcriptionally competent portions of the genome . 2) Salt extraction curves were similar for both the labeled and unlabeled proteins, although about 15% of the labeled molecules were bound to the chromatin more loosely than those of the endogenous H6 . Taken together, these results suggest that chromatin contains specific, well defined sites to which H6 binds . Upon increasing the concentration of H6 in the incubation mixture, progressively greater numbers of low affinity, presumably nonspecific binding sites become occupied . This observation has important implications for studies in which nucleases are employed to probe chromatin structure, since they suggest that H6 molecules released from specific, high affinity sites by the action of the nuclease might rebind more loosely to other regions of the chromatin.

Nucleic Acids Res, 1980 Nov 25, 8(22), 5377 - 90
Non-random arrangement of nucleosomes in satellite I containing chromatin of rat liver; Igo-Kemenes T et al.; The location of nucleosomes on the nucleotide sequence of rat satellite I DNA was investigated using micrococcal nuclease, exonuclease III, and restriction nucleases as tools . Hae III cleaved the satellite DNA containing chromatin very preferentially in the linker region . Nucleosomes were found predominantly in three defined positions on the 370 bp satellite I monomer unit . This type of arrangement occurs on not more than half of the satellite DNA containing chromatin while the rest of this chromatin is arranged differently . The arrangement of nucleosomes with high probability in preferred frames and with low probability in less preferred frames may be a general phenomenon which can be discussed as a possible mechanism to modulate sequence recognition.

Nucleic Acids Res, 1980 Nov 25, 8(22), 5275 - 88
Selective release of HMG nonhistone proteins during DNase digestion of Tetrahymena chromatin at different stages of the cell cycle; Hamana K et al.; The possible role of LG-1, a Tetrahymena specific HMG protein found in the macronuclear chromatin (Hamana, K . and Iwai, K . (1979) J . Biochem . 86, 789-794), was examined in relation to the chromatin structure . The chromatin isolated from cells synchronized at different stages of the cell cycle contained about one molecule of LG-1 per nucleosome . Limited digestion of the chromatin with DNase I or micrococcal nuclease selectively released LG-1 with the nucleosomal core histones and H1 remained insoluble, bound to the resistant DNA . Depending on the cell stages several types of chromatin structure were distinguished by their nuclease sensitivity . However, the chromatin at different stages exhibited the similar behavior of the LG-1 release with the nucleases as a function of the degree of chromatin solubilization . The results suggest that LG-1 proteins play a role in the chromatin organization which is rather independent of the cell stages.

Nucleic Acids Res, 1980 Nov 25, 8(22), 5143 - 55
Nuclease sensitivity of active chromatin; Gazit B et al.; The active regions of chicken erythrocyte nuclei were labeled using the standard DNase I directed nick translation reaction . These nuclei were then used to study the characteristics and, in particular, the nuclease sensitivity of active genes . Although DNase I specifically attacks active genes, micrococcal nuclease solubilizes these regions to about the same degree as the total DNA . On the other hand micrococcal nuclease does selectively cut the internucleosomal regions of active genes resulting in the appearance of mononucleosomal fraction which is enriched in active gene DNA . A small percentage of the active chromatin is also released from the nucleus by low speed centrifugation following micrococcal nuclease treatment . The factors which make active genes sensitive to DNase I were shown to reside on individual nucleosomes from these regions . This was established by showing that isolated active mononucleosomes were preferentially sensitive to DNase I digestion . Although the high mobility group proteins are essential for the maintenance of DNase I sensitivity in active regions, these proteins are not necessary for the formation of the conformation which makes these genes preferentially accessible to micrococcal nuclease . The techniques employed in this paper enable one to study the chromatin structure of the entire population of actively expressed genes . Previous studies have elucidated the structure of a few special highly prevalent genes such as ovalbumin and hemoglobin . The results of this paper show that this special conformation is a general feature of all active genes irregardless of the extent of expression.

Nucleic Acids Res, 1980 Nov 11, 8(21), 5057 - 70
Ribonucleotide sequences non-adjacent to poly(A) participate in the poly(A)-protein complex in 15S duck globin mRNP particles; Goldenberg S et al.; The study of the interaction between mRNA and proteins in the polyribosomal 15 S duck globin messenger ribonucleoprotein complex showed that proteins protect specific mRNA sequences against digestion by the nonspecific micrococcal nuclease (Nucleic Acids Research 6 (8) 2787, 1979) . Here we report the isolation of the poly(A)-protein RNP complex from nuclease digested 15 S mRNP by two different methods: sucrose gradient sedimentation and oligo(dT)-cellulose chromatography . We show by fingerprint analysis, that aprt from the periodically fragmented poly(A) segment, mRNA sequences adjacent and non-adjacent to the poly(A) segment are protected by the poly(A) binding proteins against nuclease digestion . The duck globin poly(A)-protein RNP complex, with a sedimentation coefficient between 7 S and 10 S, shows a characteristic protein composition, with a major 73,000 MW polypeptide and some minor components . The results are discussed in view of a dynamic ribonucleoprotein structure.

Nucleic Acids Res, 1980 Nov 11, 8(21), 4955 - 68
Single-strand DNA binding protein from rat liver: interactions with supercoiled DNA; Bonne C et al.; As shown by competition experiments, the single-strand DNA binding protein from normal rat liver (S25) interacts preferentially with supercoiled DNA compared to relaxed DNA duplexes . When followed both by sedimentation analysis and by nitrocellulose filter assay, the binding of S25 to SV40 supercoiled DNA (FI) appears to be non-cooperative . Saturation is reached at a protein to DNA weight ratio of about 2 . The S25-DNA complexes prefixed with glutaraldehyde appear as beaded structures having an average of 14 to 16 beads per SV40 DNA molecules . Cross-linking of S25 bound to SV40 DNA by dimethyl suberimidate allows to detect oligomeric structures containing a maximum of twenty monomers of S25 . When complexes are treated by glutaraldehyde, 10% of the genome become resistant against micrococcal nuclease . Moreover, S25 affects the DNA helical structure . Superhelical forms are generated by the association of S25 with SV40 DNA, in the presence of nicking-closing enzyme.

J Biol Chem, 1980 Nov 10, 255(21), 10542 - 5
An endonuclease activity of chicken erythrocyte nuclei and mononucleosomes; Kalinski A et al.; Endogenous nuclease is present in the nuclear sap of chicken erythrocyte nuclei . This enzyme resembles the nuclease of mammalian nuclei in requirements for bivalent cations and in production of large chromatin fragments that gradually decrease in size, but differs in that the products do not go through the stage of discrete bands on gel electrophoresis . Endogenous nuclease and micrococcal nuclease are also detectable in mononucleosomes prepared from chicken erythrocytes with the aid of micrococcal nuclease . Both nucleases are extractable with 0.35 M NaCl, and both are inhibited by pTp . In the absence of Ca2+, the micrococcal nuclease is totally inactive, whereas the endogenous nuclease shows a low level of activity.

Eur J Biochem, 1980 Nov, 112(2), 353 - 62
Acetylation of nucleosomal histones in vitro; Bohm J et al.; A new histone-specific acetyltransferase, which is closely associated with nucleosomes prepared from lymphocyte nuclei by treatment with micrococcal nuclease, is described . The acetylating enzyme transfers {3H}acetyl groups from {3H}acetyl-coenzyme A to the endogenous histones H2A, H2B, H3 and H4 in nucleosomes as well as to free histones added to the reaction mixture . Histone H1 is not acetylated by this enzyme . The acetyltransferase was partially purified by DEAE-Sephadex and DNA-cellulose chromatography . The nucleosome-associated enzyme binds to DNA cellulose at low salt concentrations (DNA-binding acetyltransferase), while the previously described histone-specific acetyltransferases have no affinity to DNA under these conditions . This high affinity for DNA may explain the association of DNA-binding acetyltransferase with nucleosomes.

J Endocrinol, 1980 Nov, 87(2), 225 - 40
Distribution of acceptor sites for androgen-receptor complexes between transcriptionally active and inactive fractions of rat ventral prostate chromatin; Davies P et al.; Rat ventral prostate chromatin was separated into two main fractions by controlled digestion with micrococcal nuclease . The soluble fraction obtained after lysis of digested nuclei with EDTA (1 mmol/l), the S2 fraction, represented approximately 17% of the original nuclear DNA, and showed properties consistent with transcriptional activity, i.e . enrichment in nascent RNA, non-histone protein and endogenous RNA polymerase B activity as well as depletion in histones . The fraction sedimented after lysis of nuclei, fraction P, comprised approximately 60% of nuclear DNA, was depleted in nascent RNA, non-histone proteins and endogenous RNA polymerase B activity, but had a higher content of histones . In an attempt to relate the concentration of acceptor sites for androgen-receptor complexes with transcriptional activity, it was shown that the S2 fraction was enriched in these acceptor sites . However, if measurements were based on the intact cell the transcriptionally inactive portion contained 2.5--3 times as many 'acceptor' sites, although these sites had lower affinity for androgen-receptor complexes than had those in the transcriptionally active fraction.

Biokhimiia, 1980 Nov, 45(11), 2013 - 8
{Structural organization of chromatins from two divisions of rat brain, using micrococcal nuclease}; Grumbkova LO et al.; The cell nuclei of cerebellum and large hemispheres of rat brain were treated with micrococcal nuclease (EC 3.1.4.7); the resulting DNA fragments were separated in 4% polyacrylamide gel . The experimental data are indicative of differences in the structural organization of chromatins from different divisions of the brain: the average value of the repeating DNA sequences of chromatin from the large hemispheres was 184 base pairs against 199 in case of cerebellar chromatin . The DNA fragment incorporated into the nucleosomal nucleus contained 140 base pairs in both chromatin preparations . The dependence of the size of the DNA "bridge" between the vicinal nucleosomal nuclei on the protein composition and template activity of chromatin preparations is discussed.

Can J Biochem, 1980 Nov, 58(11), 1261 - 9
Characterization of mononucleosomes and associated glycoproteins from Ehrlich ascites tumour cells; Miki BL et al.; Mononucleosomes generated by the digestion of ascites nuclei with micrococcal nuclease were resolved into three types by polyacrylamide gel electrophoresis . All three types were present in early and late digest and a precursor-product relationship was not apparent . Each mononucleosome type was associated with a unique pattern of subnucleosome DNA fragments and differences were apparent in histone and nonhistone proteins . On the basis of reactivity ot 125I-labelled concanavalin A and labelling with {3H}glucosamine, glycoproteins were identified as components of two of the mononucleosome types . The principal glycoprotein species associated with mononucleosomes had an apparent molecular weight of 130 000.

Proc Natl Acad Sci U S A, 1980 Nov, 77(11), 6443 - 7
Aggregation of small oligonucleosomal chains into 300-A globular particles; Jorcano JL et al.; Chicken erythrocyte oligonucleosomes (trimers to about 20-mers) are able to interact with each other through the very lysine-rich histones (H1 and H5) and form heterogeneous globular particles with a mean diameter of about 300 A . These particles assemble spontaneously during micrococcal nuclease digestion of chromatin in the presence of 30 mM NaCl and contain approximately 25 nucleosomes . They are sensitive to ionic strength and unfold at lower salt concentrations but can be reconstituted by restoring the initial salt concentration . Even at 30 mM NaCl, the particles remain dynamic structures, being in equilibrium with their oligonucleosomal components as revealed by the fact that particle stability depends on the concentration of oligonucleosomes.

Proc Natl Acad Sci U S A, 1980 Nov, 77(11), 6425 - 8
Protein p3 is linked to the DNA of phage phi 29 through a phosphoester bond between serine and 5'-dAMP; Hermoso JM et al.; To investigate the role of protein p3 in bacteriophage phi 29 initiation of replication, we have studied the nature of the covalent linkage between protein p3 and phi 29 DNA . The protein-DNA compound was digested with micrococcal nuclease and pronase resulting in a nucleotidyl-peptide that was further digested by alkaline phosphatase and snake venom phosphodiesterase yielding 5'-dAMP . The DNA-protein linkage is sensitive to alkali . Treatment of the nucleotidyl-peptide with 0.1 M NaOH at 37 degrees C for 3 hr after phosphatase digestion released 5'-dAMP . Hydrolysis of the nucleotidyl-peptide with 5.8 M HCl at 110 degrees C for 90 min yielded O-phosphoserine . These results, together with the sensitivity of the DNA-protein linkage to snake venom phosphodiesterase and its resistance to hydroxylamine, indicate that protein p3 is covalently linked to phi 29 DNA through a phosphoester bond between L-serine and 5'-dAMP, namely a O,5'-deoxyadenylyl-L-serine bond.

Cell, 1980 Nov, 22(2 Pt 2), 387 - 92
Chromatin structure of the 5S RNA genes of D . melanogaster; Louis C et al.; The 5S RNA gene cluster of Drosophia melanogaster is a tandem array of a repeat unit made up of a 135 bp gene plus a 238 bp spacer . The length of the 5S repeat (373 bp) equals the average length of a Drosophila dinucleosome . Digestion of Drosophila nuclei with micrococcal nuclease generates discrete 5S RNA gene subfragments when the purified DNA is further cleaved with a single-cut restruction enzyme . We have mapped four micrococcal nuclease-sensitive sites within the 5S repeat: A1, centered at bp--110 (+1 being the G:C bp at the start of the gene); A1', at bp--80; A2, at bp +80, within the intragenic control region; and B, at --190 bp . These findings suggest that nucleosomes can be positioned on the 5S gene repeat in one of two possible phases, A or B . In the A phase a potential regulatory sequence near the center of the gene is exposed in one of the two linkers of the repeat . In the B phase, in contrast, one of the linkers includes the 5' end of the gene.

J Gen Virol, 1980 Nov, 51(Pt 1), 45 - 59
The structure of herpes simplex virus type 1 DNA as probed by micrococcal nuclease digestion; Leinbach SS et al.; Micrococcal nuclease digestion was used to probe the structures in which herpes simplex virus type I (HSV-I) DNA is found during virus replication . Parental DNA, progeny DNA and DNA in nucleocapsids were analysed . Parental DNA was examined after infection of Vero cells with 32P- or 3H-thymidine-labelled HSV-I . Progeny DNA was examined after HSV-I-infected Vero cells were pulse-labelled with 3H-thymidine during HSV-I DNA synthesis . In both cases, nuclei were isolated and digested with micrococcal nuclease . Digestion products were analysed by agarose or polacrylamide gel electrophoresis (PAGE) . Most parental DNA remained as intact molecules . However, a small amount was degraded into fragments which were heterogeneous in size or the size of nucleosomal cell DNA . These two classes of fragments were also produced upon digestion of progeny DNA . The heterogeneous fragments and nucleosomal fragments comprised major and minor fractions, respectively, of digested progeny DNA . When digested DNA from HSV-I-infected cells was transferred from composite polyacrylamide-agarose gels to diazobenzyloxymethyl paper, nucleosomal fragments hybridized to 32P-labelled HSV-I DNA as well as to 32P-labelled Vero cell DNA. . Therefore, nucleosomal fragments contained HSV-I DNA sequences . HSV-I DNA in nucleocapsids was analysed by micrococcal nuclease digestion after nucleocapsids were disrupted with PH 9.3 buffer, pyridine, Sarkosyl or NcCl/urea . Only fragments of heterogeneous size were produced . Thus, HSV-I DNA is found predominantly in structures other than nucleosomes during virus replication.

Cell, 1980 Nov, 22(1 Pt 1), 269 - 76
E . coli and M . luteus DNA topoisomerase I can catalyze catenation of decatenation of double-stranded DNA rings; Tse Y et al.; Escherichia coli and Micrococcus luteus DNA topoisomerase I are found to promote catenation of double-stranded DNA rings . At low DNA concentration dimeric catenanes are the major catenated products; at high DNA concentration or when spermidine is present, catenanes containing more than two rings are formed . There is no requirement of extensive sequence homology between the conponent rings forming a catenane; dimeric catenanes between Pseudomonas phage PM2 DNA and E . coli plasmid pBR322 are readily formed . The formation of a dimeric catenane by these type I topoisomerases, however, requires the presence of at least one preexisting single-chain scission in one of the two component rings . This is in contrast to the cases with the type II DNA topoisomerases which can form catenanes made of covalently closed rings only . The catenanes formed by the type I enzymes can be unlinked by the same enzymes, or by DNA gyrase, a type II enzyme, upon dilution of the isolated catenanes . The catenation and decatenation of duplex DNA rings adds a fourth type of reaction promoted by these type I DNA topoisomerases to the three reported previously: relaxation of superhelical DNA, interconversion between single-stranded DNA rings with and without knots and the intertwining of single-stranded DNA rings of complementary sequences into a covalently closed duplex ring with a high linking number . All four topoisomerization reactions involve the crossing of one DNA strand through a transient break of another DNA strand . The new reaction reported here suggests that such a crossover event might not require pairing of complementary nucleotide sequences.

Biochemistry, 1980 Oct 28, 19(22), 5024 - 9
Micrococcus luteus endonucleases for apurinic/apyrimidinic sites in deoxyribonucleic acid . 2 . Further studies on the substrate specificity and mechanism of action; Pierre J et al.; Two endonucleases specific for DNA-containing apurinic or apyrimidinic sites (AP-endonucleases A and B) have been isolated from Micrococcus luteus and highly purified . These enzymes have no exonuclease activity . Both AP-endonucleases hydrolyze DNA-containing apurinic or apyrimidinic sites at the 5' end of the lesion, thus generating 3'-hydroxyl and 5'-phosphoryl end groups . DNA-containing pyrimidine dimers, introduced at low doses of UV, are not hydrolyzed, whereas DNA-containing lesions, introduced at high doses of UV or by gamma irradiation are nicked by either AP-endonuclease . During hydrolysis of apurinic DNA, neither of the AP-endonucleases acts as a processive enzyme.

Biochemistry, 1980 Oct 28, 19(22), 5018 - 24
Micrococcus luteus endonucleases for apurinic/apyrimidinic sites in deoxyribonucleic acid . 1 . Purification and general properties; Pierre J et al.; Two chromatographically distinct endonucleases from Micrococcus luteus, specific for apurinic and apyrimidinic sites (AP-endonucleases A and B), have been extensively purified and characterized . Both are free from DNA glycosylase, unspecific endonuclease, and phosphatase activities . The two enzymes behave as monomeric proteins of approximately 35000 daltons . In addition to their different chromatographic properties on CM-cellulose, P-cellulose, hydroxylapatite, and DNA--Sepharose, both AP-endonucleases can be distinguished as follows: AP-endonuclease A has an isoelectric point of 4.8, shows a half-life of 4 min at 45 degrees C, reacts optimally at pH 7.5 and has a KM value of 2.3 X 10(-6) M . AP-endonuclease B has a pI of 8.8, is more stable at 45 degrees C (half-life of 10 min), and reacts optimally between pH 6.5 and pH 8.5; its KM value is 3.7 X 10(-6) M.

J Biol Chem, 1980 Oct 25, 255(20), 9659 - 65
Oligothymidylate analogues having stereoregular, alternating methylphosphonate/phosphodiester backbones . Synthesis and physical studies; Miller PS et al.; Two decathymidylate analogues, d-(TpTp)4TpT-isomer 1 and isomer 2, having stereoregular, alternating methylphosphonate/phosphodiester backbones were prepared . The phosphodiester linkages of d-(TpTp)4TpT are cleaved slowly by snake venom phosphodiesterase in a stepwise manner, while slow random cleavage occurs with micrococcal nuclease which hydrolyzes isomer 2 faster than isomer 1 . The CD spectra of isomer 1 and d-(Tp)9T are identical suggesting they have similar conformations, while that of isomer 2 shows an overall reduction of {theta} . Isomer 1 forms a 1T . 1A complex with poly(dA) and both 1T . 1A and 2T . 1A complexes with poly(rA), while isomer 2 forms a 2T . 1A complex of low thermal stability with poly(dA) and no complex with poly(rA) . The Tm values of the partially nonionic d-(TpTp)4TpT . polynucleotide complexes are less dependent on salt concentration than are those of d-(Tp)9T . The stoichiometry and CD spectra of the complexes suggest that poly(dA) . isomer 1 duplex assumes a B-type geometry while isomer 2 . poly(dA) . isomer 2 triplex and the isomer 1 . poly(rA) complexes have an A-type geometry . Although there are no apparent differences between steric restrictions to rotation about the backbones of either isomer 1 or 2, or steric restrictions to complex formation, the results suggest that the configuration of the methylphosphate linkage controls: 1) interaction with nucleases, 2) oligomer conformation, and 3) interaction with polynucleotides . The latter effects may result from differences in solvation of the two isomers.

J Biochem (Tokyo), 1980 Oct, 88(4), 1185 - 91
A new lysozyme assay based on fluorescence polarization or fluorescence intensity utilizing a fluorescent peptidoglycan substrate; Maeda H; A new sensitive, rapid and simple method for lysozyme assay is described which is based on either fluorescence polarization or fluorescence intensity using fluorescein-labeled peptidoglycan as a substrate . The peptidoglycan was obtained from Micrococcus lysodeikticus after extensive digestion with Pronase and washing with Triton X-100 followed by various solvents . Subsequently, it was labeled with fluorescein isothiocyanate (FITC) at the amino group of the peptide . When the FITC-labeled substrate was subjected to lysozyme digestion, an increase of fluorescence intensity or a decrease of fluorescence polarization value (P value) was apparent in five minutes at a lysozyme concentrations as low as 0.1 or 0.01 micrograms/ml, respectively . The effect of other hydrolytic enzymes including alpha-mannosidase, proteases and RNase on the P value was found to be negligible . The measured values represented the specificity and dose of lysozyme added . Apparent Vmax and Km values for two different lysozymes, chicken egg white and human, could be determined by this method.

Eur J Biochem, 1980 Oct, 111(1), 237 - 44
Localization of phosphoproteins and of protein kinases in chromatin from hepatoma tissue-cultured cells; Kitzis A et al.; An important role in the control of gene expression has been attributed to phosphoproteins present among chromatin non-histone proteins . In a previous work we have shown that at least part of these phosphoproteins are associated with nucleosomes . In this work we wanted to establish whether this association occurs with all nucleosomes or with the nucleosomes present in fragments preferentially released by a mild micrococcal nuclease digestion, which originated essentially from active parts of chromatin . Phosphoproteins were labelled in vivo by incubating hepatoma tissue-cultured cells with {32P}phosphate and chromatin was submitted to a limited micrococcal nuclease digestion . The released fragments were fractionated by preparative gel electrophoresis . {32P}Phosphoproteins were essentialy found in the smallest released fragments: monomers and dimers of nucleosomes . The same result was obtained when the phosphoproteins were labelled in vitro by incubating each fragment obtained by the preparative electrophoresis in the presence of {gamma-32P}ATP . It indicates that part of the protein kinase activity was strongly bound to the particles . The bound phosphoproteins were analysed by sodium dodecylsulfate/polyacrylamide gel electrophoresis . Two main polypeptides were characterized: phosphopeptide a, Mr 41000, present in all small fragments; phosphopeptide b, Mr 31000, present in all small fragments, except in the fastest moving nucleosomes . Phosvitin kinase was found associated with the small released fragments, its specific activity was by far the highest in the fraction which includes the dimers of nucleosomes . It is concluded that phosphoproteins and protein kinases are associated with the nucleosomes of the active parts of chromatin, which suggests a role of these proteins in the control of gene expression.

Cell, 1980 Oct, 21(3), 751 - 60
Nonrandom alignment of nucleosomes on 5S RNA genes of X . laevis; Gottesfeld JM et al.; Mild digestion of Xenopus nuclei with micrococcal nuclease results in the cleavage of oocyte-type 5S RNA genes once every four nucleosomes, or about once per tandem repeating unit of 5S DNA . This specific cleavage pattern is observed with nuclei from somatic cells where oocyte-type 5S genes are never transcribed (blood and liver) and with cultured cell nuclei where these genes are in a DNAase I-sensitive chromatin conformation and low level transcription is observed . Cleavage of protein-free DNA with micrococcal nuclease does not result in a specific digestion pattern . The similarity of the nuclease-generated repeat length and the sequence repeat length of oocyte-type 5S genes suggested a sequence-specific arrangement of nucleosomes on these DNA sequences . Restriction endonuclease analysis indicates that micrococcal nuclease preferentially cleaves in a restricted region within the 5S repeating unit, about 200 bp from the single Hind III site . Using specific end-labeled DNA probes derived from cloned 5S DNA we can recognize at least four possible modes of organization of the nucleosomes on 5S DNA . In each of these phase arrangements, functionally significant regions of the 5S gene (start of transcription, middle control region and transcription termination site) are found in or near nucleosome linkers.

J Cell Biol, 1980 Oct, 87(1), 227 - 36
Histone gene expression and chromatin structure in mammalian cell hybrids; Hsiung N et al.; DNA isolated from mammalian cell nuclear reveals discrete size patterns when partially digested with micrococcal nuclease . The DNA repeat lengths from different tissues within a species or from different species may vary . These differences have been attributed to the presence of different species of histone H1 . To examine the nature of regulation of DNA repeat lengths and their possible relationship to histone H1, we have selected several mouse and human cell lines that differ in their DNA repeat lengths and examined them and their cell hybrids . 24 mouse X human and five mouse X mouse hybrid cell lines were analyzed . All the interspecific hybrids exhibited the repeat pattern characteristic of the murine parent . The mouse intraspecific hybrids had a repeat pattern of only one of the parents . We conclude that the partial human chromosome complements retained in the hybrids assume the repeat lengths exhibited by the mouse cells . Because H1 histones have been implicated in the determination of DNA repeat lengths, we also investigated the regulation of H1 histone expression in these cell hybrids . Purified H1 histones were radioactively labeled in vitro, and individual subfractions were subjected to proteolysis followed by gel electrophoresis . The resulting partial peptide maps off H1 histone subfractions A and B were distinguishable from one another and from different cell lines . In the mouse X human hybrids analyzed, only the mouse H1 histones were detected . These observations were extended to H2b by analysis of the hybrid cell histone by Triton-acid-urea gels . Neither the DNA repeat length nor histone expression is affected by the presence of any specific human chromosome . The fact that human genes are expressed in these hybrids suggests that the H1 histones of one species is able to interact with the chromatin of another species in a biologically funtional conformation . Analysis of the intraspecific PG19 X B82 (mouse X mouse) hybrids reveals the presence of H1 histone subfractions of the B82 mouse cells . Because these hybrids exhibit the nucleosome repeat length only of the PG19 cells, it appears that if histone H1 plays a role in determining the repeat length it does so in consort with other nonhistone chromosomal proteins.

Biokhimiia, 1980 Oct, 45(10), 1871 - 80
{A serine proteinase from Thermoactinomyces vulgaris, strain INMI-4a}; Stepanov VM et al.; A serine proteinase was isolated from the cultural filtrate of the thermophylic actinomycet Thermoactinomycet vulgaris, strain INMI-4a . The purification procedure included affinity chromatography on bacitracin-Sepharose, ion-exchange separation on aminosilochrome, and gel-filtration on Sephadex G-25, resulting in a 194-fold purification and the 55% yield of the enzyme . The molecular weight of the enzyme as determined by polyacrylamide gel electrophoresis in the presence of Na-SDS as well as by gel-filtration on Sephadex G-75 is equal to 28 000; the amino acid composition is: Lys11, His4, Arg5, Asp33, Thr22, Ser24, Glu16, Pro16, Gly30, Ala38, Cys1-2, Val20, Met1, Ile14, Leu8, Tyr16, The4, Trp6-7 . The isoelectric point lies at pH 8--9; the pH optimum for the peptide substrate hydrolysis is Z-L-Ala-L-Ala-L-Leu-pNA is at 8.2 . The enzyme is stable at pH 7--9 . The temperature optimum of the proteolytic activity lies at 55 degrees; however, the enzyme is stable to heating for 1 h at 37 degrees . The proteinase is completely inactivated by the serine proteinase specific inhibitors--phenylmethylsulphofluoride and the protein inhibitor IT-AjT from Actinomyces, as well as by p-chloromercuribenzoate . The enzyme shows lytic activity against the cells of E . coli, Micrococcus lysodeicticus and of the yeasts . The Thermoactinomyces vulgaris serine proteinase, being definitely different from the serine proteinases from Actinomyces griseus, also reveals specific differences when compared to bacterial serine proteinases, e . g . subtilisins . There are some indications to the enzyme relationship with the family of carboxypeptidase Y-like serine proteinases.

Biophys J, 1980 Oct, 32(1), 271 - 82
DNA-histone interactions in nucleosomes; Van Holde KE et al.; We have utilized micrococcal nuclease digestion and thermal denaturation studies to investigate the binding of DNA to the histone core of the nucleosome . We conclude that a total of approximately 168 base pairs (bp) of DNA can interact with the histone core under appropriate solution conditions, even in the absence of lysine-rich histones . The interactions in this total length of DNA can be divided into three classes: (a) approximately 22 bp at the ends is bound only at moderate ionic strength . It is easily displaced, and its removal yields the 146 bp core particle . (b) approximately 46 bp near the ends of the core DNA are quite weakly bound to the core, and are displaced at quite moderate temperatures . (c) The remaining central 100 bp are strongly bound, and interact with all of the sites on the histones which strongly protect DNA against DNAse I digestion . A theoretical analysis of the cleavage of nucleosomal DNA by DNAse I has been used to develop evidence that the pattern of protection offered by the histone core is very similar in nuclei to that in isolated core particles.

J Gen Virol, 1980 Oct, 50(2), 293 - 307
the influence of the host cell on the inhibition of virus protein synthesis in cells double infected with vesicular stomatitis virus and mengovirus; Otto MJ et al.; The ability of mengovirus to inhibit the synthesis of vesicular stomatitis virus (VSV) proteins and of VSV to inhibit the synthesis of mengovirus proteins during double infection in three different cell lines was investigated . Although cellular protein synthesis was inhibited after infection of cells by each virus, the ability of one virus to decrease translation of the mRNA species of the co-infecting virus varied with the cell type . Superinfection of mengovirus-infected L-929 cells by VSV resulted in essentially no inhibition in the synthesis of either mengovirus or VSV proteins . In HeLa cells and CHO cells the synthesis of both VSV and mengovirus proteins was inhibited under conditions of simultaneous or sequential infection . The inhibition of VSV protein synthesis after infection of HeLa cells by mengovirus was not a result of a modification or inactivation of virus mRNAs . When extracted from double infected cells, the VSV mRNAs manifested normal biological activity, as determined by their ability to stimulate the synthesis of VSV proteins in a micrococcal nuclease-treated cell-free system from L cells . The interference of non-interference of one virus by another in different cell lines was also measured by quantifying the number of infectious particles produced in each cell line . The results were similar to those reported above for protein synthesis inhibition . These experiments suggest that the interference of mengovirus with VSV mRNA translation in HeLa cells is not necessarily reflective of the mechanism by which mengovirus inhibits cellular protein synthesis . Also, the host cell appears to influence the extent or nature of the interference of one virus by the other.

Eur J Biochem, 1980 Oct, 111(1), 211 - 5
Purification and properties of a DNase inhibitor from Nicotiana tabacum cell cultures; Szopa J et al.; Extraction of Nicotiana tabacum cell cultures, chromatography on DEAE-cellulose and gel filtration resulted in a homogeneous protein (Mr = 14500), which strongly reduces the hydrolysis of Escherichia coli DNA by DNase I . DNA degradation by micrococcal nuclease is not inhibited . The inhibitor protein interacts with DNase I in the absence of DNA, as determined by the partial quenching of protein intrinsic fluorescence; a 1:1 stoichiometry is deduced . From the reduction of DNase I activity with increasing inhibitor concentration apparent equilibrium constants for the inhibitor X DNase-I complex have been calculated . This interaction is strongly temperature-dependent; at 20 degrees C and 26 degrees C dissociation constants of 5 nM and 110 nM, respectively, were determined . As a consequence a rather high enthalpy of interaction can be estimated.

Endocrinology, 1980 Oct, 107(4), 994 - 9
3,5,3'-triiodothyronine receptor-containing chromatin fragments: production by nuclease digestion; Gruol DJ; Nuclear thyroid hormone (T3) receptors are nonhistone proteins which are tightly bound to rat liver chromatin . The solubilization of the T3 receptors by micrococcal nuclease was studied using an assay which allows the delection of in vitro hormone binding and which is independent of the state of solubility of the chromatin . Nuclease digestion produces a receptor containing moiety which sediments at a rate of 5--6S . This form of the receptor is different than that released from chromatin at high ionic strength (3.8S) and potentially represents the stable association of the receptor which other elements of chromatin . Partial release of chromatin compaction by the use of dilute buffer solutions increases the rate of nuclease digestion, facilitates the release of the (5--6S) T3-receptor complex, and allows the isolation of sucrose gradient fractions which are enriched with receptor.

Biochim Biophys Acta, 1980 Sep 19, 609(2), 246 - 56
The DNA polymerase beta reaction with ultraviolet-irradiated DNA incised by correndonuclease; Nowak R et al.; Covalently closed circular Col E1 DNA was ultraviolet-irradiated with a dose of 60 J/m2, thus introducing about 3.2 pyrimidine dimers per DNA molecule . Treatment of irradiated Col E1 DNA with Micrococcus luteus correndonuclease resulted, in the vicinity of pyrimidine dimers, in an average of 3.3 incisions per DNA molecule, and converted DNA to the open circular form . Incised Col E1 DNA stimulated no reaction with calf thymus DNA polymerase alpha but was recognized as a template by DNA polymerase beta . The latter enzyme incorporated about 1.6 molecules of dTMP (corresponding to 6 molecules od dNMP) per one correndonuclease incision . The length of the DNA polymerase beta product was comparable to the anticipated length of the DNA region within which the hydrogen bonds were disrupted owing to dimer formation . The enzyme required Mg(2)=nd four dNTPs for reaction and was resistant to N-ethylmaleimide or p-mercuribenzoate . The average numbers of deoxynucleotides incorporated per one DNAase I incision or per one nonspecific break, measured in control samples, were equal, amounting to 0.3 dTMP molecule . This value corresponded to 1.2 dNMP molecule; in our opinion, this reflects contaminating nuclease activity of the system used . The present results testify to the ability of DNA polymerase beta to repair synthesis by the "patch and cut' mechanism.

Biochemistry, 1980 Sep 16, 19(19), 4387 - 94
Chromatin subunits elicit species-specific antibodies against nucleoprotein antigenic determinants; Tahourdin CS et al.; Nucleosomes composed of 195 base pairs of DNA associated with histones H2A, H2B, H3, and H4 purified from chicken erythrocyte nuclei were used to elicit antibodies in rabbits . Specific serological reaction between the antisera and the nucleosomes is demonstrated by immunodiffusion, immunofluorescence, microcomplement fixation, solid-phase radioimmunoassay, immunosedimentation, and polyacrylamide gel electrophoresis of 5'-32P end-labeled nucleosomes . The antisera did not react with DNA extracted from these nucleosomes, core histones, or the cross-linked histone octamer from chicken erythocytes, calf thymus total histones, or chromosomal proteins HMG-1 or HMG-17 . Nucleosome antigenicity was not affected by redigestion with micrococcal nuclease . Digestion with DNase I brought about 50% loss of reactivity while digestion with trypsin or proteinase K resulted in total loss of activity . The antisera reacted strongly with trimer, dimer, and monomer nucleosomes as well as with the core particle (145 base pairs of DNA) and subnucleosome (greater than 145 base pairs) obtained from chicken . It reacted less well with nucleosomes obtained from HeLa cells and was almost totally devoid of activity against chromatin particles obtained from rat liver or wheat germ . Experiments employing the technique of transferring proteins from a polyacrylamide gel to diazobenzyloxymethyl paper and visualization of antigens by autoradiography excluded the possibility that the serum contains antibodies against tissue-specific antigens which are found in small amounts but are very immunogenic . It is concluded that most of the anitbodies in the sera are directed against nucleoprotein antigenic determinants composed of the N-terminal portion of the histones and segments of DNA . Antibody binding is dependent on contact between the histone and DNA segments and is independent of the integrity of the entire nucleosome . Thus, certain histone DNA contacts remain intact even though the structure of the nucleosome has been disrupted.

Nucleic Acids Res, 1980 Sep 11, 8(17), 3743 - 55
Nuclease digestion promotes structural rearrangements in H1-depleted chromatin; Weischet WO et al.; Digestion of H1-depleted chromatin with micrococcal nuclease at an ionic strength of 0.35M gives rise to structural rearrangements indicating nucleosomal sliding . The ionic strength necessary to reveal this effect is significantly lower than that required in the absence of an accompanying digestion . As an explanation, a model is presented in which the progressing terminal degradation of oligomeric nucleosomes is made responsible for promoting structural rearrangements.

Nucleic Acids Res, 1980 Sep 11, 8(17), 3829 - 40
The 5'-cytosine in CCGG1 is methylated in two eukaryotic DNAs and Msp I is sensitive to methylation at this site; Sneider TW; Novikoff rat hepatoma and bovine liver DNAs were digested with Msp I or Hpa II . Restriction fragments were end-labeled using {alpha-32P}-dCTP and the Klenow fragment of E . coli DNA polymerase I and then digested to 2'-deoxyribonucleoside-3'-monophosphates using micrococcal nuclease and spleen phosphodiesterase . Mononucleotides were separated by two-dimensional thin layer chromatography, localized by radioautography, and the {32P}-label quantitated by scintillation spectrometry . This method, based on known specificities of Msp I and Hpa II, shows that CCGG, CMGG, and MCGG (M refers to 5-methylcytosine) occur at frequencies of 89.6%, 1.4%, and 9.0%, respectively, in the rat DNA and at 41.6%, 48.3%, and 10.0%, respectively, in the bovine DNA . {32P} recovery in 3'-5-MedCMP from end-labeled Msp I digests was negligible compared to recovery from Hpa II digests . Hence, Msp I is sensitive to methylation at the 5' cytosine in the sequence CCGG.

Proc Natl Acad Sci U S A, 1980 Sep, 77(9), 5097 - 101
Novel histone H2A-like protein of escherichia coli; Hubscher U et al.; A histone-like protein (H) from Escherichia coli has been purified to more than 98% homogeneity by using its capacity to inhibit DNA functions . H protein behaves as a dimer of 28,000-dalton subunits . The histone H2A-like properties of H protein are: (i) binding to DNA at a stoichiometry of 1 H protein dimer per 75 bases; (ii) abundance of about 30,000 molecules per cell, sufficient to bind about 20% of the chromosome; (iii) limiting digestion of double-stranded DNA by micrococcal nuclease; (iv) reannealing of complementary single-stranded DNA; (v) amino acid composition resembling that of eukaryotic histone H2A; (vi) neutralization of H protein by antibody specific for H2A; (vii) heat stability; and (viii) acid solubility . The capacity of H protein to bind DNA prevents its template or substrate functions n several reactions in vitro: DNA synthesis by several polymerases; transcription by RNA polymerase; DNA topoisomerase activity; and DNA-dependent ATP hydrolysis by rep protein, dnaB protein, or protein n' . Together with other histone-like proteins of E . coli, H protein may organize the E . coli chromosome into nucleosomes, such as in eukaryotic chromatin.

Cancer Res, 1980 Sep, 40(9), 3181 - 5
Pyrimidine dimer formation and repair in human skin; Sutherland BM et al.; Cyclobutyl pyrimidine dimers have been detected in the DNA of human skin following in vivo irradiation with suberythemal doses of ultraviolet (UV) radiation from FS-20 sun lamp fluorescent tubes . Dimers were assayed by treatment of extracted DNA with Micrococcus luteus UV-specific endonuclease, alkaline agarose electrophoresis, and ethidium bromide staining . This technique, in contrast to conventional dimer assays, can be used with nonradioactive DNA and is optimal at low UV light doses . M . luteus endonuclease-sensitive sites were determined after exposure of untanned skin in two volunteers to UV light (0.97, 1.94, or 3.88 X 10(3) J/sq m; lambda, 290 to 360 nm) . At 20 min postirradiation (dose, 1.94 X 10(3) J/sq m), fewer M . luteus endonuclease-sensitive sites were found in the DNA than immediately after the irradiation . Even fewer endonuclease-sensitive sites were found at 20 min when the UV-irradiated skin was subsequently irradiated with visible light than when the area was kept in the dark . These data suggest that some dimer disappearance by excision repair occurs within 20 min of UV irradiation and that photoreactivation of dimers can make a contribution to the total repair process.

J Virol, 1980 Sep, 35(3), 790 - 6
den V gene of bacteriophage T4 determines a DNA glycosylase specific for pyrimidine dimers in DNA; Seawell PC et al.; Endonuclease V of bacteriophage T4 has been described as an enzyme, coded for by the denV gene, that incises UV-irradiated DNA . It has recently been proposed that incision of irradiated DNA by this enzyme and the analogous "correndonucleases" I and II of Micrococcus luteus requires the sequential action of a pyrimidine dimer-specific DNA glycosylase and an apyrimidinic/apurinic endonuclease . In support of this two-step mechanism, we found that our preparations of T4 endonuclease V contained a DNA glycosylase activity that produced alkali-labile sites in irradiated DNA and an apyrimidinic/apurinic endonuclease activity that converted these sites to nicks . Both activities could be detected in the presence of 10 mM EDTA . In experiments designed to determine which of the activities is coded by the denV gene, we found that the glycosylase was more heat labile in extracts of Escherichia coli infected with either of two thermosensitive denV mutants than in extracts of cells infected with wild-type T4 . In contrast, apyrimidinic/apurinic endonuclease activity was no more heat labile in extracts of the former than in extracts of the latter . Our results indicate that the denV gene codes for a DNA glycosylase specific for pyrimidine dimers.

Biochim Biophys Acta, 1980 Aug 26, 609(1), 173 - 9
Binding of ethidium monoazide to the chromatin in human lymphocytes; Cantrell CE et al.; The azide analog of {14C}ethidium bromide was mixed with lymphocytes and photolyzed with visible light . The distribution of azide in the chromatin fraction was found to be 55% in DNA, 28% in protein and 16% in RNA . Label in the DNA portion was found to be almost exclusively in the region digestible with micrococcal nuclease . The parent compound, ethidium bromide, competed with azide for binding sites, illustrating that the azide analog mimics the action of ethidium bromide.

Nucleic Acids Res, 1980 Aug 25, 8(16), 3639 - 57
The release of 40S hnRNP particles by brief digestion of HeLa nuclei with micrococcal nuclease; Walker BW et al.; Brief digestion of HeLa nuclei with mirococcal nuclease releases monomer hnRNP particles as well as monomer and polynucleosomes . Sucrose gradient analysis of the nuclease released material reveals a series of small A260 peaks overlapping a more predominant peak in the 40S region of the gradient . Analysis of the proteins, DNa, and RNA in successive gradient fractions has confirmed that the smaller peaks are monomer and polynucleosomes, and that the larger peak is 40S hnRNP . Like 40S particles isolated by low salt extraction or by sonication, the nuclease released particles are composed of rapidly labeled RNA associated with a group of non-histone proteins the most predominant of which are the 32,000-44,000 MW proteins previously identified as core hnRNP proteins . These results provide further evidence that 40S hnRNP particles exist as discrete structural components of larger in vivo ribonucleoprotein complexes.

J Membr Biol, 1980 Aug 21, 56(1), 49 - 53
Modification of cell membrane lipids in Micrococcus lysodeikticus induced by pantoyl lactone; Johnson JH et al.; Growth of Microccoccus lysodeikticus in the presence of pantoyl lactone brings about both qualitative and quantitative changes in cell membrane lipids . Significant amounts of the two major phospholipids (phosphatidylglycerol and diphosphatidylglycerol) are converted to lyso forms; the largest conversion occurs in the phosphatidylglycerol . In addition, amounts of several phospholipid fatty acids are changed . Physical alteration of the call membrane can be demonstrated using differential scanning calorimetry . Although growth and transport are significantly inhibited when pantoyl lactone is present, cells possessing altered call membrane phospholipds and phospholipid fatty acids, brought about by growth in the presence of pantoyl lactone, transport D-alanine, L-glutamic and L-aspartic acid normally when washed free of the pantoyl lactone.

Science, 1980 Aug 15, 209(4458), 811 - 3
Thyroid hormone receptor-containing fragment released from chromatin by deoxyribonuclease I and micrococcal nuclease; Jump DB et al.; Limited deoxyribonuclease I and micrococcal nuclease digestion of hepatic nuclei from euthyroid rats injected with 125I-labeled triiodothyronine ({125I}T3) releases a discrete {125I}T3-labeled chromatin fragment (5.8S) which is larger than the T3 receptor (3.5S) . These results suggest the T3 receptor is associated with a restricted fraction of hepatic chromatin that has a nuclease sensitivity characteristic of transcriptionally active chromatin.

Nucleic Acids Res, 1980 Aug 11, 8(15), 3393 - 411
The extraction by micrococcal nuclease of glucocorticoid receptors and mouse mammary tumor virus DNA sequences is dissociated; Andre J et al.; Glucocorticoid receptors (RG) and mammary tumor virus (MM-TV) DNA sequences were extracted by micrococcal nuclease digestion from the nuclei of C3H mouse mammary tumor cells in order to specify their relative distribution in chromatin . RG was labelled and translocated into the nuclei by incubating cells with 3H Dexamethasone (3H Dex) . The purified nuclei were then treated at 2 degrees C with micrococcal nuclease . Three chromatin fractions were successively obtained: an isotonic extract (ne3H1), ahypotonic extract (ne2) and the residual pellet (P) . The Dex-RG complexes were measured by the hydroxyapatite technique . The MMTV DNA sequences were titrated by molecular hybridization with an excess of MMTV radioactive cDNA probe . Up to 75% of the nuclear 3H Dex and the MMTV radioactive cDNA probe . Up to 75% of the nuclear 3H Dex and MMTV DNA sequences were extracted in a concentration dependent manner while only 10-15% of nucleic acids became soluble in 10% perchloric acid . The extracted 3H Dex-RG complex was found to be partly bound to soluble chromatin and partly free . The free complex displayed similar sedimentation constants (4S, 7S) and DNA binding ability to the cytosol receptor . The 3H Dex-RG complexes were 2 to 8 fold more concentrated in ne1, which is known to be enriched in active chromatin, than in ne2 . Conversely, the concentration of MMTV DNA sequences per microgram DNA was the same in the three nuclear fractions . These results suggest that the Dex-RG complexes are concentrated in an active fraction of chromatin . We propose that, among the 20-30 copies of MMTV genes per haploid genome, only a small proportion are transcribed or regulated.

Nucleic Acids Res, 1980 Aug 11, 8(15), 3371 - 91
Saccharomyces cerevisiae plasmid, Scp or 2 mum: intracellular distribution, stability and nucleosomal-like packaging; Seligy VL et al.; Cell fractions from yeast strains known to harbor the plasmic 2 mum or Scp were treated with nucleases used to probe eukaryotic chromosome structure . Scp and subfragments were identified by hybridization to natural or cloned Scp probes according to Southern (34) . Specificity was confirmed with non-Scp probes . Copy/haploid nuclear genome(n) was estimated from reconstructions at a resolution of 0.5/n . About 43-67% of the total cellular copy exists as nucleoprotein complexes which separate from other debris on isokinetic sucrose gradients with s-values of 67-110 . These complexes are totally degraded by DNAase I . Digestion with micrococcal nuclease produced integral-sized fragments; they are not generated by direct mixing of pure Scp with nuclear chromatin from a{cir} strain . Initial digests gave a repeat of 168 +/- 3 base pairs (bp) for both Scp and nuclear nucleoprotein; advanced digests reduced the nuclear repeat relative to Scp by 8 bp . Of a potential 37 repeat units/plasmid, 31-32 were directly measured . A strain difference in Scp autodegradation was found . A partial nuclease resistant form was also demonstrated whose abundance was cell strain and growth stage dependent . Both Scp isomers exist in these complexes which are structurally similar to simian viral 40 minichromosomes.

J Antibiot (Tokyo), 1980 Aug, 33(8), 787 - 90
Isolation and characterization of sarubicin A, a new antibiotic; Reinhardt G et al.; The new antibiotic sarubicin A {red crystals, mp . 194 approximately 195 degrees C, C18H14N2O6 (I)} was isolated from fermentations of a Streptomyces strain . The compound is moderately active in vitro against Micrococcus luteus.

Biokhimiia, 1980 Aug, 45(8), 1385 - 98
{Structural heterogeneity of chromatin as revealed by electrophoretic methods}; Kharchenko EP et al.; Electrophoresis of endonuclease-split rat liver chromatin in polyacrylamide and agarose gels of a monotonous concentration revealed different separation patterns . The first pattern exhibited a spectrum of chromatin fragments of discrete sizes, while the second one -- two fractions, i . e . DNP and DNA . The polyacrylamide gel concentration gradient allowed to achieve the best resolution of individual classes of chromation fragments with individual subfractions in sub-, mono- and trinucleosomes . A comparison of micrococcal nuclease-split chromatin fragments of vertebrates revealed nucleosomes of varying sizes . The heterogeneity of the nucleosomes was also found during isotachophoresis and free flow electrophoresis . An analysis of individual subfractions of the mononucleosomes revealed differences in the composition and number of proteins as well as in the kinetics of basic and acidic titration . The chromatin fractions obtained by discontinuous endonucleolysis differed in their composition from the individual subfractions of histones.

J Virol, 1980 Aug, 35(2), 409 - 13
Cleavage of phi X174 single-stranded DNA by gene A protein and formation of a tight protein-DNA complex; Eisenberg S; The gene A protein cleaves phi X174 single-stranded DNA (ssDNA) . The cleavage appears to be stoichiometric, whereby a gene A protein molecule breaks a phosphodiester bond and binds to the 5' end . The enzyme introduces mostly a single break in a circular ssDNA molecule . However, at high enzyme-to-DNA ratios, more than one break in the DNA could be observed . The cleavage of the ssDNA by gene A protein renders the DNA sensitive to the action of terminal transferase to incorporate {alpha -32P}ATP . Thus, the 3'OH end is free . All attempts to label the 5' end by T4-induced polynucleotide kinase and {gamma-32P}ATP failed . The formation of a gene A-ssDNA complex was demonstrated directly by using 3H-labeled gene A protein and 32P-labeled ssDNA in the reaction . Such a complex is resistant to treatments with 0.2 M NaOH, banding in CsCl, and boiling in 2.5% sodium dodecyl sulfate . Only treatment with a nuclease released the bound protein . Also, after cleaving {32P}ssDNA by gene A protein, followed by either DNase I or micrococcal nuclease digestion, a fraction of the 32P label remained resistant to nuclease treatment and comigrated with gene A protein on polyacrylamide gels.

Mol Biol Rep, 1980 Jul 31, 6(2), 119 - 23
Comparative analysis of proteins selectively released from cell nuclei of different eukaryotic species under conditions of mild hydrolysis by nucleases; Afanasjev BN et al.; Nuclei of cultured Chinese hamster fibroblasts, dechoryonized eggs of Drosophila melanogaster, calf thymocytes and mouse spleen were digested with micrococcal nuclease or DNAse I under conditions when about 15-20% of nuclear DNA is hydrolyzed . Proteins released from the nuclei with this DNA were analyzed by electrophoresis in polyacrylamide gels in the presence of SDS and the most prominent components were purified in each case . It is shown that these components derived from different species have different electrophoretic mobilities but are very similar in the amino acid composition characterized by high glycine content and a low lysine/arginine ratio . Molecular weights of two of those components, from mouse spleen and thymocytes, were estimated and are shown to be 25,500 and 23,000, respectively . Notwithstanding their different molecular weights they have the same N-terminal amino acid--arginine.

Nucleic Acids Res, 1980 Jul 25, 8(14), 3175 - 91
Enzymatic synthesis of polyuridylic acid containing modified bases; Ho YK et al.; 5'Mercaptouridine-5'-diphosphate (hs5UDP) has been synthesized and investigated as a substrate of the polynucleotide phosphorylase of Micrococcus luteus . While hs5UDP is not utilized alone, it can be copolymerized with UDP; however, unusually for this enzyme, the ratio of 5'mercaptouridylate vs . uridylate residues in the polynucleotide product (MPU) is always lower than the ratio of hs5UDP v . UDP in the substrate mixture . Furthermore, hs5UDP decreases the rate of the enzymic polymerization reaction . The MPU product forms two-stranded and three-stranded complexes with poly(A) . The circular dichroic spectra of these complexes are similar to those formed between poly(U) and poly(A), but their melting profiles indicate somewhat lower stability . The physicochemical and biochemical properties of the enzymic product are qualitatively similar to those of MPU prepared by chemical modification; both are potent inhibitors of a DNA-dependent RNA polymerase.

J Biol Chem, 1980 Jul 25, 255(14), 6721 - 6
Vitellogenin as a multigene family . Not all Xenopus vitellogenin genes may be in an "expressible" configuration; Tata JR et al.; DNA-cDNA titrations suggest that the Xenopus genome comprises two albumin genes, whereas there are 12 to 16 vitellogenin-like genes . Both sets of genes are expressed in liver, those coding for albumin constitutively, but vitellogenin only when induced by estrogen in both male and female frogs . Mild micrococcal nuclease digestion of liver nuclei to separate "expressed" from "unexpressed" gene fractions (Tata, J . R., and Baker, B . S . (1978) J . Mol . Biol . 118, 249-272) revealed that the multiple vitellogenin genes are found in two chromosomal states, here termed as "expressible" and "nonexpressible." Both albumin genes were in the chromosomal state associated with expression, but of the 12 to 16 vitellogenin genes, only 4 to 6 are in the potentially expressible state . This distribution pattern is independent of sex and only slightly modified during induction or de-induction of vitellogenesis by estrogenic stimulation or withdrawal.

J Gen Microbiol, 1980 Jul, 119(1), 133 - 44
Protection of cell viability and respiratory quinone levels by carotenoid in Micrococcus lysodeikticus (M . luteus); Turner JA et al.; Viability and respiratory activity of post-exponential phase cultures of Micrococcus lysodeikticus (M . luteus) decreased with time more rapidly in carotenoidless mutants than in a parent pigmented strain . The concentration of menaquinone, the respiratory quinone, was found to be low in carotenoidless mutants and in cultures of the pigmented strain where carotenoid synthesis had been partially blocked by diphenylamine . Cell suspensions incorporated {2-14C}mevalonate into menaquinone . Carotenoidless strains incorporated label at substantially higher rates than did the pigmented wild-type strain . Gently prepared membranes of M . lysodeikticus also incorporated mevalonate into menaquinone suggesting that the enzymes for the isoprenoid pathway are bound (loosely) to the membrane . Carotenoidless membranes with low concentrations of menaquinone incorporated radioactivity from {2-14C}mevalonate into quinone more rapidly than did membranes from the wild-type . Azide inhibited the incorporation but n-heptyl-4-hydroxyquinolone-N-oxide did not . It is concluded that the low concentrations of menaquinone in carotenoidless strains are due to rapid breakdown of the quinone . Carotenoid is therefore seen as protecting menaquinone from breakdown by factors as yet unidentified.

Appl Environ Microbiol, 1980 Jul, 40(1), 133 - 44
Contamination of broiler carcass skin during commercial processing procedures: an electron microscopic study; Thomas CJ et al.; Scanning and transmission electron microscopy were used in conjunction with normal microbiological cultural techniques to examine some aspects of contamination of broiler carcass skin by bacteria during processing . The autochthonous skin microflora of poultry, before processing, was mainly Micrococcus spp . which were located in accumulations of sebum-like substances on the surface of the stratum corneum . During scalding and plucking, the skin epidermis was removed, and exposed dermal tissue was contaminated by microorganisms from the mechanical plucker and subsequent stages of processing . Major sources of psychrotrophic contamination were the immersion washer and chiller water . Microbial contaminants were found within a fluid film on the skin surface and inside deep skin channels . Skin microtopography and the presence of the liquid film were implicated as major factors controlling contamination during processing.

Int J Radiat Biol Relat Stud Phys Chem Med, 1980 Jul, 38(1), 31 - 52
DNA-membrane complex restoration in Micrococcus radiodurans after X-irradiation: relation to repair, DNA synthesis and DNA degradation; Dardalhon-Samsonoff M et al.; The DNA-membrane complex in Micrococcus radiodurans was shown to be essentially constituted of proteins, lipids and DNA . The complex was dissociated immediately after X-irradiation of cells and restored during post-incubation in complete medium . In X-irradiated protoplasts some DNA remained associated with the complex . Restoration of the complex during post-incubation was only seen in a medium favouring DNA polymerase and ligase activities . Under this condition no DNA synthesis occurred, suggesting that complex restoration may involve ligase activity . The complex restoration in the wild type and the X-ray sensitive mutant UV17 of M . radiodurans was strictly dependent on the X-ray dose . It was correlated with survival and DNA degradation but always preceded the onset of DNA synthesis after X-irradiation . At the same dose the complex restoration was about 2 fold lower in mutant than in wild type cells indicating that the restoration of the complex is related to repair capacity . The results are consistent with the idea that the complex protects X-irradiated DNA of M . radiodurans from further breakdown and, subsequently, permits DNA synthesis and repair to occur.

Nature, 1980 Jun 26, 285(5767), 634 - 41
Cleavage of pyrimidine dimers in specific DNA sequences by a pyrimidine dimer DNA-glycosylase of M . luteus; Haseltine WA et al.; Pyrimidine dimer formation in response to UV radiation is governed by the thymine content of the potential dimer and the two flanking nucleotides . An enzymatic activity can be purified from Micrococcus luteus that cleaves the N-glycosyl bond between the 5' pyrimidine of a dimer and the corresponding sugar without rupture of a phosphodiester bond . We propose that strand scission at a dimer site by the M . luteus enzyme requires two activities, a pyrimidine dimer DNA-glycosylase and an apyrimidinic/apurinic endonuclease.

Nucleic Acids Res, 1980 Jun 25, 8(12), 2737 - 50
Differential nuclease sensitivity of the ovalbumin and beta-globin chromatin regions in erythrocytes and oviduct cells of laying hen; Bellard M et al.; We have monitored the differential nuclease sensitivity of defined regions of the chicken genome in different cells using a method which combines restriction enzyme digestion and blotting to diazobenzyloxymethyl (DBM)-paper (see Ref . 11) . By using different specific probes and by scanning the bands on the autoradiograms, it is possible to compare on the same blot the digestion patterns of similar-sized fragments from different regions of the genome corresponding to "active" and reference "inactive" genes . We have demonstrated the preferential sensitivity to DNaseI and micrococcal nuclease digestion of the ovalbumin gene region in hen oviduct chromatin . The beta-globin gene region (containing both an adult and an embryonic gene) is also preferentially digested by DNaseI in hen mature erythrocyte nuclei, but at a lower rate than the ovalbumin gene region in oviduct . These observations raise the possibility that there may be several types of preferential nuclease sensitivities, all characterized by increased rates of digestion but to different levels, the highest corresponding to the very actively transcribing genes.

Nucleic Acids Res, 1980 Jun 25, 8(12), 2665 - 78
Analysis of DNA double- and single-strand breaks by two dimensional electrophoresis: action of micrococcal nuclease on chromatin and DNA, and degradation in vivo of lens fiber chromatin; Modak SP et al.; We describe a novel system for two dimensional electrophoresis at neutral and alkaline pH for determining the double-stranded and single-stranded lengths of DNA . With this system we analysed the mode of micrococcal nuclease digestion of DNA in cellular and SV40 viral chromatin and of supercoiled SV40 DNA . The enzyme reaction occurred in two steps : the enzyme first introduced single-strand breaks, then converted these to double-strand breaks by an adjacent cleavage on the opposite strand . Digestion of cellular chromatin DNA occurred by a similar mechanism . Chromatin fragments produced by limited micrococcal nuclease action contained many single-strand breaks, which may be important when this method is used to prepare chromatin fragments for biochemical and biophysical studies . Nucleosome monomer to tetramer produced at later stages of digestion contained few if any single-strand breaks.

Biochem J, 1980 Jun 15, 188(3), 585 - 92
The elongation of exogenous fatty acids and the control of phospholipid acyl chain length in Micrococcus cryophilus; Sandercock SP et al.; The synthesis of fatty acids de novo from acetate and the elongation of exogenous satuated fatty acids (C12-C18) by the psychrophilic bacterium Micrococcus cryophilus (A.T.C.C . 15174) grown at 1 or 20 degrees C was investigated . M . cryophilus normally contains only C16 and C18 acyl chains in its phospholipids, and the C18/C16 ratio is altered by changes in growth temperature . The bacterium was shown to regulate strictly its phospholipid acyl chain length and to be capable of directly elongating myristate and palmitate, and possibly laurate, to a mixture of C16 and C18 acyl chains . Retroconversion of stearate into palmitate also occurred . Fatty acid elongation could be distinguished from fatty acid synthesis de novo by the greater sensitivity of fatty acid elongation to inhibition by NaAsO2 under conditions when the supply of ATP and reduced nicotinamide nucleotides was not limiting . It is suggested that phospholipid acyl chain length may be controlled by a membrane-bound elongase enzyme, which interconverts C16 and C18 fatty acids via a C14 intermediate; the activity of the enzyme could be regulated by membrane lipid fluidity.

Biochemistry, 1980 Jun 10, 19(12), 2544 - 54
Stability and reversibility of higher ordered structure of interphase chromatin: continuity of deoxyribonucleic acid is not required for maintenance of folded structure; Ruiz-Carrillo A et al.; The organization of the higher order structure of chromatin has been examined in chicken erythrocyte . Chromatin solubilized during the time course of a gentle micrococcal nuclease digestion of nuclei shows a continuous variation in the distribution of molecular weights . Electron microscopy studies of large chromatin fragments solubilized at physiological ionic strength (0.14 M NaCl or KCl) suggest that the polynucleosome chain is folded in continuous compact structures of an average diameter of 23 nm in which the individual nucleosomes are difficult to distinguish . This compact structure is destabilized even at intermediate ionic strengths (e.g., 40 mM NaCl), resulting in looser fibers of similar diameter . At 5 mM NaCl the fiber is unraveled into a continuous filament of 10-nm diameter . These conformational changes are reversible as determined by hydrodynamic and biochemical parameters . The 10-nm leads to 23-nm transition of chromatin appears to be a cooperative process requiring the full complement of histones H1 and H5 . Micrococcal nuclease cleaves the DNA in the compact chromatin structure to an apparent limit of digestion corresponding to an average of eight to nine nucleosomes with little effect on the size of the fiber . Thus, the continuity of the DNA is not required for the stability of the folded chromatin fiber . Histones H1 and H5 exhibit a binding preference to larger chromatin fragments regardless of the length of the DNA . This behavior is not observed with relaxed chromatin, suggesting that multiple stabilizing interactions involving H1 (H5) are possible only in the compact configuration.

Biken J, 1980 Jun, 23(2), 61 - 8
Mitogenic effects of bacterial cell walls and their components on murine splenocytes; Takada H et al.; Stimulation of splenocytes from ICR mice by cell walls of 17 species of gram-positive bacteria, and peptidoglycans and water-soluble enzymatic digests prepared from some of them, and by synthetic N-acetylmuramyl-L-alanyl-D-isoglutamine (MDP) was studied in terms of mitogenic activity . All the cell walls tested except those of Micrococcus lysodeikticus, regardless of their mycolic acid content and immunopotentiating activity, had definite stimulatory activity on splenocytes . In general, the cell walls of mycobacteria, nocardia, and stretomyces had stronger mitogenic activity than other cell walls . The mitogenic activity of cell walls was mainly attributable to a peptidoglycan moiety, and the activity was retained even when the peptidoglycan had been degraded into a monomer or a dimer of its subunit, though a polymerized form of the subunits exhibited stronger activity than the monomer or dimer . Definite mitogenicity of synthetic MDP on splenocytes from ICR mice was also confirmed . The origin of the unknown principle(s) that is found in the cell walls of nocardia, mycobacteria and streptomyces and is responsible for their potent mitogenic activity on murine splenocytes was discussed.

Can J Microbiol, 1980 Jun, 26(6), 658 - 63
Cell membrane phospholipids and their constitutent fatty acids in dividing and nondividing cells of Micrococcus lysodeikticus; Johnson JH et al.; Changes occurring in the cell membrane of nondividing cells of Micrococcus lysodeikticus disIIp+ grown in the presence of the mucopeptide synthesis inhibitor D-cycloserine include (a) an increae in the relative amount of diphosphatidylglycerol with a concomitant decrease in the relative content of phosphatidylglycerol, (b) a small increase in the relative palmitic acid content of phosphatidylinositol, and (c) leakage of membrane components into the growth medium . Growth of the organism in the presence of both D-cycloserine and D-alanine (which prevents the effects of D-cycloserine on cell division and mucopeptide synthesis) prevents the above changes in the cell membrane, demonstrating that secondary damage to the cell membrane can occur as a rsult of inhibition in mucopeptide synthesis . Growth of the organism in the presence of D-cycloserine and pantoyl lactone prevents the leakage of membrne components and cell division inhibition . Possible relationships of these changes to cell division are discussed.

Can J Biochem, 1980 Jun, 58(6), 457 - 60
Passive diffusion of nucleosides into Micrococcus sodonensis membrane vesicles; Pickard MA; Nucleoside entry into isolated membrane vesicles of Micrococcus sodonensis (luteus) was studied using 14C-labelled nucleosides: adenosine, inosine, cytidine, uridine, guanosine, and thymidine . All nucleosides were recovered unmetabolized from the vesicles except adenosine and cytidine which were partly deaminated by membrane-bound enzymes . Vesicle preparations actively transported proline but no energy source was found capable of supporting concentrative nucleoside uptake . The entry of nucleosides into M . sodonensis vesicles was not saturable, nor was there competition between the nucleosides studied for entry . It was concluded that nucleoside entry into M . sodonensis vesicles occurs by passive diffusion.

Eur J Biochem, 1980 Jun, 107(2), 505 - 10
Analysis of binding interactions between histone core complex and simian virus 40 DNA . A comparison of acetylated versus non-acetylated histone core complexes; Shewmaker CK et al.; The interactions of acetylated and non-acetylated core complex histones with simian virus 40 (SV40) DNA 1 have been analyzed . A modified filter-binding assay utilizing micrococcal nuclease, which allows quantification of histone octamer binding to DNA has been developed . Using this assay it was determined that both non-acetylated core complex histones ad core complex histones acetylated with acetyl adenylate to levels existing in vivo bind cooperatively to SV40 DNA 1 . Although both interactions are cooperative, the magnitude of the cooperativity parameter, omega, is significantly less in the acetylated case . This difference in cooperativity is in contrast to the nearly identical intrinsic association constant, K, observed in both cases.

Can J Microbiol, 1980 May, 26(5), 640 - 2
Synthesis of DNA by Micrococcus luteus is resistant to 6-(p-hydroxyphenylazo)uracil; Tittle TV et al.; The DNA synthesis inhibitor 6-(p-hydroxyphenylazo)uracil (HPUra), at concentrations ranging from 0.2 to 2000 micro M, had essentially no effect on DNA synthesis in Micrococcus luteus strain ML-1 . Seven other M . luteus strains were unaffected by 200 micro M HPUra . In vitro DNA synthesis in toluene-treated M . luteus strain ML-1 ws resistant to both HPUra and reduced HPUra.

Biochem J, 1980 May 1, 187(2), 353 - 60
Digestion by micrococcal nuclease of mouse submandibular-salivary-gland chromatin; Smith GJ et al.; Nucleic prepared from mouse submandibular salivary gland show marked fragility during isolation . Hwever, intact nuclei relatively free from cytoplasmic contamination were obtained by homogenization in buffers containing 0.88 M-sucrose, Ca2+, spermine, spermidine and the proteinase inhibitor aprotinin, followed by centrifugation through 2.2 M-sucrose . The kinetics of digestion by the micrococcal nuclease of chromatin in these nuclei are similar to those of chromatin from mouse liver nuclei . Base-pair size analysis of the solubilized DNA from both organs shows a stable high-molecular weight species of chromatin, which is further digested to mononucleosome and subnucleosome species . With extensive digestion the chromatin becomes insoluble . The mononucleosomes produced from salivary-gland chromatin after the inhibition of endogenous proteinase activity exhibit an s20,w value of 11S and contain histones H1, H2A, H2B, H3 and H4.

J Med Microbiol, 1980 May, 13(2), 355 - 62
Micrococcus in the blood; Marples RR et al.; Eight isolates of micrococci from the bloodstream of six patients obtained under circumstances suggesting a pathogenic role were studied in detail . The organisms were remarkably uniform in cultural, biochemical and antibiotic-susceptibility characters . All strains showed high resistance to methicillin and hydrolysed arginine . The characters found did not correspond with those of any hitherto described species, but were closest to Micrococcus lylae.

J Gen Virol, 1980 May, 48(1), 231 - 6
Catalysis of adenovirus DNA synthesis in vitro by DNA polymerase gamma; Shaw CH et al.; DNA replication complexes were purified from adenovirus type 5 (Ad5)-infected HeLa cells . DNA synthesis by these complexes in vitro was extremely sensitive to the inhibitors dideoxythymidine triphosphate, N-ethyl maleimide and p-hydroxymercuribenzoate . The bound DNA polymerase was released from the complexes by limited digestion with micrococcal nuclease . This released polymerase preferred poly(rA):(dT)12-18 as template over activated calf thymus DNA . These results are compatible with the major polymerase in the replication complex being of the gamma class.

J Bacteriol, 1980 May, 142(2), 651 - 8
Electrochemical proton gradient in Micrococcus lysodeikticus cells and membrane vesicles; Friedberg I et al.; Using the distribution of weak acids to measure the pH gradient (delta pH; interior alkaline) and the distribution of the lipophilic cation {3H}tetraphenylphosphonium+ to monitor the membrane potential (delta psi; interior negative), we studied the electrochemical gradient or protons (delta mu- H+) across the membrane of Micrococcus lysodeikticus cells and plasma membrane vesicles . With reduced phenazine methosulfate as electron donor, intact cells exhibited a relatively constant delta mu- H+ (interior negative and alkaline) of -193 mV to -223 mV from pH 5.5 to pH 8.5 . On the other hand, in membrane vesicles under the same conditions, delta mu- H+ decreased from a maximum value of -166 mV at pH 5.5 to -107 mV at pH 8.0 and above . This difference is related to a differential effect of external pH on the components of delta mu- H+ . In intact cells, delta pH decreased from about -86 mV (i.e., 1.4 units) at pH 5.5 to zero at pH 7.8 and above, and the decreases in delta pH was accompanied by a reciprocal increase in delta psi from -110 mV at pH 5.5 to -211 mV at pH 8.0 and above . In membrane vesicles, the decrease in delta pH with increasing external pH was similar to that described for intact cells; however, delta psi increased from -82 mV at pH 5.5 to only -107 mV at pH 8.0 and above.

Proc Natl Acad Sci U S A, 1980 May, 77(5), 2984 - 8
Electrophoretic properties of the scrapie agent in agarose gels; Prusiner SB et al.; The molecular properties of the scrapie agent were investigated by subjecting partially purified preparations to electrophoresis on agarose gels . When electrophoresis was performed at room temperature in the presence of sodium dodecyl sulfate (NaDodSO4), most of the recoverable agent was found at the top of the gel, consistent with previous studies indicating aggregation of the agent upon exposure to elevated temperatures . In addition, less than 5% of the agent applied to the gel was found after electrophoresis, even though the study was performed with a low concentration of NaDodSO4 (0.1%) . Further studies on the inactivation of the agent by NaDodSO4 suggest that this may be, in part, a function of the NaDodSO4: protein ratio in the sample . In contrast, sodium N-lauroyl sarcosinate (Sarkosyl) did not inactivate the agent in concentrations as high as 5% (wt/vol) . Virtually all of the infectivity could be recovered after electrophoresis of the agent into 0.6% agarose gels at 4 degrees C in the presence of 0.2% Sarkosyl . Digestion of the preparations with micrococcal nuclease and proteinase K prior to Sarkosyl electrophoresis caused a substantial portion of the agent to migrate ahead of DNA fragments of 1 x 10(6) daltons . The behavior of the scrapie agent in electrophoretic gels is consistent with earlier studies showing that the monomeric form of the agent has a sedimentation coefficient of less than or equal to 40 S . Thus, the smallest or monomeric form of the agent is smaller than any known animal virus.

Eur J Biochem, 1980 May, 106(2), 593 - 601
Extraction and translation of collagen mRNA from fetal calf skin; Kaufmann R et al.; RNA was extracted from fetal calf skin by two different procedures, using phenol or guanidine hydrochloride . Poly(A)-rich RNA was separated by oligo(dT)-cellulose affinity chromatography and was further fractionated by sucrose density gradient centrifugation . When translated in an optimized wheat germ extract cell-free system, unfractionated guanidine-hydrochloride-extracted poly(A)-rich RNA directed the synthesis of two collagenase-sensitive protein bands, while phenol-extracted poly(A)-rich RNA with a sedimentation coefficient higher than 25 S was the only fraction to direct the same synthesis . On the basis of their electrophoretic mobility on a sodium dodecylsulfate/urea/polyacrylamide gel, these proteins were identified with procollagen alpha 1(I) and procollagen alpha 2 . Inhibition of translation by phenol-extracted poly(A)-rich RNA with a sedimentation coefficient lower than 25 S was also observed . Guanidine-hydrochloride-extracted poly(A)-rich RNA from fetal skin directed the synthesis of three distinct collagenase-sensitive proteins in the micrococcal-nuclease-digested rabbit reticulocyte cell-free system; these seemed to correspond to procollagen alpha 1(I), procollagen alpha 2 and procollagen alpha 1 (III).

Biochem J, 1980 May 1, 187(2), 467 - 7
Subnuclear fractionation by mild micrococcal-nuclease treatment of nuclei of different transcriptional activities causes a partition of expressed and non-expressed genes; Dimitriadis GJ et al.; Extremely mild treatment with micrococcal nuclease of isolated nuclei yields subnuclear fractions in which the majority of RNA polymerase II transcriptional complexes formed in vivo are segregated {Tata & Baker (1978) J . Mol . Biol . 118, 249-272} . We now describe different approaches followed to established whether or not the nuclei are thus resolved into transcribed and non-transcribed DNA . First, we have compared the sensitivity to deoxyribonuclease I, which is known to digest preferably expressed genes as present in nuclei or chromatin, of three micrococcal-nuclease-derived fractions from nuclei of different transcriptional activities . In transcriptionally active nuclei (rat liver, hen liver and oviduct, and Xenopus liver), the DNA in a polynucleosomal fraction comprising 6-15% of DNA and the majority of template-engaged RNA polymerase II (fraction P2) was 10-50 times as sensitive to deoxyribonuclease I as the DNA in the other two fractions (fractions P1 and S, comprising 78-88% of total nuclear DNA as large polynucleosomal aggregates and 2-6% of DNA mostly as mononucleosomes, respectively) . In transcriptionally inactive nuclei obtained from hen erythrocytes, micrococcal nuclease did not separate DNA into fractions exhibiting such differential sensitivities . Second, we have monitored the partition of an expressed gene . Hybridization of complementary DNA to Xenopus albumin mRNA revealed a 5-10-fold enrichment of the albumin (but not the globin) gene in the P2 fraction of nuclei from Xenopus liver in which this gene is fully expressed . Third, a large part of the nascent rapidly labelled RNA synthesized in vivo in rat liver nuclei was recovered in the micrococcal-nuclease-derived fraction that is more susceptible to digestion with deoxyribonuclease I . It is concluded that mild micrococcal-nuclease treatment of nuclei causes their separation into transcribed and non-transcribed DNA as determined by a number of very different criteria.

Biochemistry, 1980 Apr 29, 19(9), 1965 - 70
The poly(adenylic acid)-protein complex is restricted to the nonpolysomal messenger ribonucleoprotein of Physarum polycephalum; Adams DS et al.; The distribution of poly(adenylic acid) {poly(A)}-protein complexes in the polysomal and nonpolysomal messenger ribonucleoprotein (mRNP) fractions of Physarum polycephalum was examined in the present study . Poly-(A)-containing components released from the nonpolysomal mRNP by ribonuclease (RNase) digestion were quantitatively adsorbed to nitrocellulose filters at low ionic strength, were highly resistant to micrococcal nuclease under conditions in which free poly(A) was completely degraded, and sedimented as a 10-15S particle which was disrupted by sodium dodecyl sulfate and protease treatment . These are characteristics of the poly(A)-protein complex . In contrast,poly(A)-containing molecules released from the polysomes by RNase were refractive to nitrocellulose, were completely sensitive to micrococcal nuclease, and sedimented at 2-4 S, identical with the sedimentation exhibited by protein-free poly(A) . Examination of the poly(A) sequences present in polysomal and nonpolysomal mRNP by polyacylamide gel electrophoresis showed that the former contained only very short sequences, averaging approximately 15 nucleotides, while the latter exhibited only much longer segments, averaging approximately 65 nucleotides . It is concluded that poly(A)-protein complexes are restricted to the nonpolysomal mRNP of Physarum and that the limiting factor in complex formation may be the length of the available poly(A) binding site.

Nucleic Acids Res, 1980 Apr 25, 8(8), 1745 - 63
Segregation of rapidly acetylated histones into a chromatin fraction released from intact nuclei by the action of micrococcal nuclease; Nelson D et al.; It has been previously shown that micrococcal nuclease digestion and subsequent fractionation of hen oviduct nuclei generates fractions enriched (first supernatant fraction - 1SF) and depleted (second supernatant fraction - 2SF) in ovalbumin genes, while a third fraction, the pellet fraction, contains about the same level of this gene as whole chromatin (Bloom and Anderson (1978) Cell 15, 141-150) . We have utilized this fractionation method in an attempt to assess the extent and kinetics of histone acetylation associated with chromatin from the 1SF, 2SF, and pellet fraction . Hepatoma Tissue Culture (HTC) cells were labelled for 30 minutes in vivo with 3H-acetate, nuclei isolated and the chromatin fractionated . The specific activity of the histones in the 1SF was slightly greater than that of the 2SF (1.2 to 1.6 fold difference) independent of the length of nuclease digestion . If the labelling period is followed by short (10 to 60 minute) treatment of the cells with sodium butyrate, the more rapidly as well as more extensively acetylated histones are also preferentially found in the 1SF . This is in part the result of segregation of chromatin particles into the 1SF as the histones associated with these particles become hyperacetylated . That is, the extent of histone acetylation regulates the distribution of chromatin in the 1SF, 2SF and pellet fraction.

J Biol Chem, 1980 Apr 25, 255(8), 3673 - 84
Subunit structures of different electrophoretic forms of nucleosomes; Albright SC et al.; We have reported previously that five different electrophoretic forms of mononucleosomes (MI to MV) are produced upon treatment of mammalian chromatin with micrococcal nuclease . We show here that each of these mononucleosome classes possesses internal heterogeneity due to the presence of a variety of minor protein species . Defined subsets of mononucleosome classes MII to MV have been reconstituted by reassociating stripped nucleosomes with histone H1 and non-histone protein HMG-17 . This procedure leads to the generation of the same five major electrophoretic forms of mononucleosomes found in native chromatin . From the results of one- and two-dimensional electrophoretic analyses on reconstituted samples, it is concluded that different mononucleosome classes possess the following subunit structures: MI, core histone octamer (8-mer); MII, 8-mer plus one copy of HMG-17; MIIIA, 8-mer plus one copy of histone H1; MIIIB, 8-mer plus two copies of HMG-17; MIV, 8-mer plus one copy each of histone H1 and HMG-17; and MV, 8-mer plus one copy of histone H1 and two copies of HMG-17 . Equal numbers of HMG-14 molecules can substitute for HMG-17 and generate the same nucleosome components . Thus, mononucleosomes possess independent binding sites for at least 1 histone H1 molecule and 2 nonhistone chromosomal protein molecules . We show further that reassociated HMG-17 molecules can exhibit a rapid interchange between binding sites, even under conditions of low ionic strength.

J Cell Sci, 1980 Apr, 42, 291 - 304
Organization of chromosomes in HeLa cells: isolation of histone-depleted nuclei and nuclear scaffolds; Adolph KW; Histone-depleted nuclei were prepared from isolate HeLa nuclei by extracting the histones and other proteins with polyanions (dextran sulphate and heparin) or with high salt concentrations as used previously . The particles were characterized by sucrose density gradient sedimentation, thin sectioning and electron microscopy, and by polyacrylamide gel electrophoresis . The general result of the experiments is that the DNA in the histone-depleted nuclei is highly organized, and that this residual, higher-order structure is maintained by a reproducible subset of nuclear proteins, and perhaps by RNA . Furthermore, the residual proteins remain associated, in some conditions, as rapidly sedimenting structures even when the DNA is digested with nucleases . These nuclear scaffolds can resemble extracted nuclei . Histone-depleted HeLa nuclei sediment in sucrose density gradients as well defined peaks with sedimentation coefficients of around 12 000 S, when 2M NaCl is used to extract the histones, or 6 000 S, when dextran sulphate is used . The rate of sedimentation is drastically decreased by treating the particles with trypsin, and reduced to a lesser extent with RNase A . Thin sectioning and electron microscopy show that histone-depleted nuclei possess the nuclear periphery and that internal material is also present . These general features are also seen in thin sections of nuclear scaffolds, which are prepared by treating the nuclei with micrococcal nuclease of DNase I in addition to extracting the histones . Two groups of major proteins are associated with histone-depleted HeLa nuclei and the nuclear scaffolds: One group has molecular weights of 50 000-55 000 Daltons . The major species of this latter group of proteins have mobilities that are similar to the proteins of the metaphase chromosomal scaffold.

J Biol Chem, 1980 Mar 25, 255(6), 2499 - 508
Thyroid hormone nuclear receptor levels are influenced by the acetylation of chromatin-associated proteins; Samuels HH et al.; The thyroid hormone receptor is a chromatin-associated protein which appears to mediate the actions of the thyroid hormones in mammalian cells . Unlike steroid hormone receptors, a cytoplasmic form of the receptor has not been identified, and the factors which govern the nuclear concentrations of the receptor are poorly understood . Using cultured GH1 cells, a rat pituitary cell line, we having previously demonstrated that thyroid hormones reduces the concentration of its receptor by a mechanism which involves the association of the ligand with the receptor binding site (Samuels, H.H., Stanley, F., and Shapiro, L.E . (1977) J . Biol . Chem . 252, 6052-6060) . In this study, we demonstrate that n-butyrate and other aliphatic carboxylic acids elicit a reduction of thyroid hormone nuclear receptor levels without altering total cell protein synthetic rates . In contrast, the nuclear association and total cell level of the glucocorticoid receptor is not altered by n-butyrate . Evidence is presented that the aliphatic carboxylic acid-mediated reduction of thyroid hormone nuclear receptor levels is secondary to the inhibitory effect of these compounds on chromatin-associated deacetylases which is reflected as an increase in the acetylation of the nucleosome core histones . Isokinetic gradient centrifugation of chromatin solubilized from GH1 cell nuclei by micrococcal nuclease indicates that the receptor exists as a form associated with high molecular weight chromatin, as a 12.5 S form that sediments slightly faster than the bulk of the mononucleosomes, and as a 6.5 S form which appears to remain associated with low molecular weight chromatin components . Exclusive of the receptor associated with the high molecular weight chromatin, the 6.5 S form represents 80% and the 12.5 S form 10% of the receptor resolved in the gradient . n-Butyrate decreases both forms to the same degree suggesting that they are generated from the same "entity" of chromatin structure . Studies on the reappearance of receptor after restoration of the chromatin to the "normal" acetylated state are consistent with a model in which the affinity of chromatin for newly synthesized receptor is diminished in the "hyperacetylated" state.

Biochem J, 1980 Mar 15, 186(3), 713 - 23
Role of the subunits of the energy-transducing adenosine triphosphatase from Micrococcus lysodeikticus membranes studied by proteolytic digestion and immunological approaches; Mollinedo F et al.; An energy-transducing adenosine triphosphatase (ATPase, EC 3.6.1.3) that contains an extra polypeptide (delta) as well as three intrinsic subunits (alpha, beta, gamma) was purified from Micrococcus lysodeikticus membranes . The apparent subunit stoichiometry of this soluble ATPase complex is alpha 3 beta 3 gamma delta . The functional role of the subunits was studied by correlating subunit sensitivity to trypsin and effect of antibodies raised against holo-ATPase and its alpha, beta and gamma subunits with changes in ATPase activity and ATPase rebinding to membranes . A form of the ATPase with the subunit proportions 1.67(alpha):3.00(beta:0.17(gamma) was isolated after trypsin treatment of purified ATPase . This form has more than twice the specific activity of native enzyme . Other forms with less relative proportion of alpha subunits and absence of gamma subunit are not active . Of the antisera to subunits, only anti-(beta-subunit) serum shows a slight inhibitory effect on ATPase activity, but its combination with either anti-(alpha-subunit) or anti-(gamma-subunit) serum increases the effect . The results suggest that beta subunit is required for full ATPase activity, although a minor proportion of alpha and perhaps gamma subunit(s) is also required, probably to impart an active conformation to the protein . The additional polypeptide not hitherto described in Micrococcus lysodeikticus ATPase had a molecular weight of 20 000 and was found to be involved in ATPase binding to membranes . This 20 000-dalton component can be equated with the delta subunit of other energy-transducing ATPases and its association with the (alpha, beta, gamma) M . lysodeikticus ATPase complex appears to be dependent on bivalent cations . The present results do not preclude the possibility that the gamma subunit also plays a role in ATPase binding, in which, however, the major subunits do not seem to play a role.

Res Commun Chem Pathol Pharmacol, 1980 Mar, 27(3), 497 - 506
Competitive fluorescence polarization study of the binding of 1,4-dihydroxy-5,8-bis{(2-{(2-hydroxyethyl) amino} ethyl}amino} 9-10-anthracenedione to DNA; Richardson CL et al.; The title compound is now undergoing Phase I clinical trials as an experimental antitumor agent . Fluorescent polarization was used to determine the extent of inhibition of the binding of acridine orange to DNA . Displacement of 50% of the acridine orange was achieved by 0.21 microM of the title compound, 0.32 microM daunorubicin, 0.41 microM doxorubicin, 0.61 microM dactinomycin, and 7.8 microM cis-platinum . Binding inhibition was essentially equivalent with natural DNAs (calf thymus and Micrococcus luteus) and synthetic polymers {poly d(A):d(T) and poly d(G):d(C)} of widely differing adenine plus thymidine content.

Biull Eksp Biol Med, 1980 Mar, 89(3), 307 - 9
{Probing the structure of bacterial deoxyribonucleoproteins with exogenous and endogenous nucleases}; Kharchenko EP et al.; During digestion of deoxyribonucleoproteins (DNP) of gram-negative bacteria by micrococcal nuclease and Ca2+, Mg2+-dependent endonuclease in situ regular series fragments-and large nuclease-resistent fragments of DNP were revealed by electrophoresis . The DNP length of the smallest DNP-fragment was tentatively 120-140 base pairs . In investigated bacterial species DNP contained at least two basic proteins which had electrophoretic mobility similar to that of histone H4 of eucaryot . It is suggested that bacterial DNPs have common regular structure.

Nucleic Acids Res, 1980 Feb 25, 8(4), 905 - 22
Organization of 5S genes in chromatin of Xenopus laevis; Gottesfeld JM; The chromatin organization of the genes coding for 5S RNA in Xenopus laevis has been investigated with restriction endonucleases and micrococcal nuclease . Digestion of nuclei from liver, kidney, blood and kidney cells maintained in culture with micrococcal nuclease reveals that these Xenopus cells and tissues have shorter nucleosome repeat lengths than the corresponding cells and tissues from other higher organisms . 5S genes are organized in nucleosomes with repeat lengths similar to those of the bulk chromatin in liver (178 bp) and cultured cells (165 bp); however, 5S gene chromatin in blood cells has a shorter nucleosome repeat (176 bp) than the bulk of the genome in these cells (184 bp) . From an analysis of the 5S DNA fragments produced by extensive restriction endonuclease cleavage of chromatin in situ, no special arrangement of the nucleosomes with respect to the sequence of 5S DNA can be detected . The relative abundance of 5S gene multimers follows a Kuhn distribution, with about 57% of all HindIII sites cleaved . This suggests that HindIII sites can be cleaved both in the nucleosome core and linker regions.

Biochemistry, 1980 Feb 19, 19(4), 785 - 9
Conversion of o-succinylbenzoate to dihydroxynaphthoate by extracts of Micrococcus luteus; Meganathan R et al.; Cell-free extracts were prepared from either freshly grown or spray-dried cells of Micrococcus luteus ATCC 4698 by treatment with deoxyribonuclease and lysozyme . These extracts converted o-succinylbenzoic acid (OSB) to 1,4-dihydroxy-2-naphthoic acid (DHNA) as shown by spectrophotofluorometric and radioactivity assays . The conversion required the presence of ATP, CoA, and Mg2+ . By use of {2-14C}OSB, the simultaneous production of the spirodilactone form of OSB was also demonstrated . The two products formed from OSB was also demonstrated . The two products formed from OSB were further characterized by gas chromatography combined with mass spectrometry . The production of the spirodilactone was suppressed by the addition of a preparation of the enzyme DHNA synthase obtained from Mycobacterium phlei . (This enzyme catalyzes the conversion of a CoA derivative of OSB to DHNA.) On mild acid treatment, the M . luteus extracts retained the ability to produce spirodilactone but lost the ability to form DHNA . These results are interpreted to mean that an OSB-CoA derivative is an intermediate in the conversion of OSB to DHNA by M . luteus and that two enzymes are involved, one to form the OSB-CoA derivative and the second to carry out a cyclization reaction.

Biochemistry, 1980 Feb 19, 19(4), 635 - 42
T4 ribonucleic acid ligase joins single-strand oligo(deoxyribonucleotides); McCoy MI et al.; T4 RNA ligase joins a 3'-hydroxyl-terminated acceptor oligoribonucleotide to a 5'-phosphate-terminated donor oligoribonucleotide . An analogous reaction with single-strand DNA oligonucleotides would be useful for the synthesis of defined sequences of DNA because it would eliminate the need to synthesize complementary sequences to form the duplex substrates required by DNA ligase . We have studied the model reaction dA(pdA)5 + {5'-32P} (pdT)4pdCp leads to dA(pdA)5 {3' leads to 5'-32P}pdT(pdT)3pdCp and have obtained 40-60% yields at equimolar concentrations (100 microM to 1 mM) of the two substrates . Higher yields have been obtained when acceptor concentrations in excess of those of the donor are used . The use of a 5'-hydroxyl, 3'-hydroxyl terminated acceptor and a 5'-phosphate, 3'-phosphate terminated donor limits the reaction to a unique product . The 3'-phosphate-terminated donor was prepared by using RNA ligase to add a single deoxyribonucleoside 3',5'-bisphosphate donor to an oligo(deoxyribonucleotide) acceptor {Hinton, D.M., Baez, J.A., & Gumport, R.I . (1978) Biochemistry 17, 5091} . The DNA oligomer joining reaction requires low concentrations of ATP and an ATP regenerating system, Mn2+, high levels of nuclease-free RNA ligase (30 microM), and incubation for several days at 17 degrees C . The product of the reaction was characterized by its resistance to alkaline phosphatase, degradation by micrococcal nuclease to the expected product {3'-32P}dAMP, and mobility during high-pressure liquid chromatography on RPC-5 . The joining of several other deoxyoligomers was also demonstrated . We anticipate that this reaction of RNA ligase will contribute to its usefulness as a reagent for the synthesis of DNA of defined sequence.

Nucleic Acids Res, 1980 Feb 11, 8(3), 529 - 42
DNA repeat lengths of erythrocyte chromatins differing in content of histones H1 and H5; Miki BL et al.; Among the erythrocytes of chicken, trout, carp, and sucker, the relative proportion of the lysine-rich histone H5 varied from 20 to 0% of the total histones . Following digestion of nuclear chromatin with micrococcal nuclease, each of them displayed a longer DNA repeat length and greater repeat length heterogeneity than found in liver chromatin . Fish erythrocytes possessed similar repeat lengths of 207-209 base pairs which was 10-12 base pairs shorter than in chicken erythrocyte chromatin and approximately 10 base pairs longer than in liver chromatin . No correlation existed between the DNA repeat length or repeat length heterogeneity and the relative proportion of H5.

J Biol Chem, 1980 Feb 10, 255(3), 1090 - 5
Distribution of high mobility group proteins among domains of trout testis chromatin differing in their susceptibility to micrococcal nuclease; Kuehl L et al.; Trout testis nuclei were treated with micrococcal nuclease, an enzyme which is known to digest preferentially the linker regions in transcriptionally competent portions of the chromatin . The digested nuclei were fractionated by two different methods, and the distribution of histones and high mobility group proteins among the various fractions was quantitated . The results obtained indicate that the linker regions of transcriptionally active nucleosomes are depleted in H1 and enriched in HMG (high mobility group)-T and ubiquitin . The core particles in transcribed regions of the chromatin are depleted in unacetylated H4 and enriched in the highly acetylated forms of H4 and also in the small basic non-histone, H6 . Our results also suggest that one-fourth of the total H6 and one-half of the total HMG-T of chromatin are present in a different domain probably comprising nontranscribed regions.

Biochemistry, 1980 Feb 5, 19(3), 532 - 41
Dependence of mononucleosome deoxyribonucleic acid conformation on the deoxyribonucleic acid length and H1/H5 content . Circular dichroism and thermal denaturation studies; Cowman MK et al.; Four mononucleosome preparations were isolated from micrococcal nuclease digests of chicken erythrocyte nuclei which differed in average deoxyribonucleic acid (DNA) length and in H1 and H5 content . The circular dichroism properties of the unperturbed mononucleosome preparations and the corresponding H1- and H5-depleted species demonstrate that the nucleoprotein spectra above 250 nm are all altered relative to protein-free DNA by the addition of a single negative band at 275 nm, similar to the band observed for psi-DNA . The quantitative analysis of the psi-type band intensity for any of the higher molecular weight unperturbed samples relative to core particle mononucleosomes yielded a constant number of DNA base pairs (approximately 140) contributing to this new band . Upon removal of H1 and H5 from the mononucleosome preparations which have sufficiently long linker DNA, the psi-type band intensity indicates an approximately 30 base pair reduction in the number of core DNA base pairs contributing to the altered circular dichroism properties . The psi-type band is proposed to be due to the compact DNA tertiary structure, i.e., the manner in which the DNA is wound around the histone core allowing interactions between adjacent turns of the superhelix . This interpretation implies that approximately 30 base pairs of core DNA are removed from the unique core tertiary structure when the linker DNA is not bound by H1 or H5 . The circular dichroism analysis correlates well with the thermal denaturation properties of mononucleosomes . Removal of H1 and H5 causes an overall reduction in the thermal stability of both core and linker DNA . The degree of destabilization is greatest when the average DNA length is maximum . Some core DNA is lost from the highest temperature melting bands when histone-free DNA is present . These results indicate two regions of different conformational and thermodynamic stability in core DNA . The length of attached linker DNA and its histone content influence the two regions of the core to differing extents.

Cell Biol Int Rep, 1980 Feb, 4(2), 201 - 10
Unusual properties of sea urchin unfertilized egg chromatin; Albanese I et al.; A typical nucleosomal pattern is not detected by electrophoretic analysis of sea urchin mature egg chromatin, following digestion with micrococcal nuclease . Moreover, at least 80% of the egg nuclear DNA is resistant to nuclease attack . These unusual features of unfertilized egg chromatin, not shared by oocytes or sperms, are discussed in view of the unique properties and fate of mature female germ cells.

Biokhimiia, 1980 Feb, 45(2), 363 - 70
{Proteolysis as an approach to the study of protein distribution in the membrane of Micrococcus lysodeikticus}; Simakova IM et al.; Treatment of M . lysodeikticus protoplasts with subtilisin or pronase did not affect their permeability and led to a digestion of 20--30% of protein . DS-Na electrophoresis of protoplast membranes resulted in disappearance of three protein bands . This suggests that the outer surface of M . lysodeikticus protoplasts contains three proteins other than respiratory chain enzymes, which are subjected to an attack by proteinases . Treatment of the M . lysodeikticus membranes, isolated by osmotic shock, with proteinases resulted in a digestion of 20--50% of protein . The factors preventing the interaction between the membrane components (e.g . decrease of Mg2+ concentration, ultrasound, KCl, EDTA and particularly detergents) favoured the proteolysis; however, the bulk of the proteins remained insensitive to the effect of proteinases . The membranes pretreated with DS-Na or chlorophorm--methanol mixture proved to be good substrates for proteinases . Treatment of the membrane fraction with proteolytic enzymes allowed to obtain some data on localization of respiratory chain enzymes in the membrane stroma of M . lysodeikticus . Thus, cytochrome c is localized nearer to the membrane surface than cytochromes a and b, while malate dehydrogenase is plunged deeper into the membrane stroma as compared to NADH dehydrogenase.

Med Microbiol Immunol (Berl), 1980 Feb, 168(1), 55 - 62
Abnormal lysozyme production of peritoneal macrophages from mastocytoma P-815 bearing C3D2F1-mice; Bandlow G et al.; Sodium thioglycollate-induced peritoneal macrophages from C3D2F1 mice were examined for their ability to produce and secrete lysozyme in vitro . Lysozyme was quantitated by use of a "lysoplate assay", in which lyophilized Micrococcus lysodeicticus suspended in agar were lysed by the enzyme . The ability to secrete lysozyme decreased in mice bearing a subcutaneous or intraperitoneal mastocytoma P-815 with progressive tumour growth.

J Clin Invest, 1980 Feb, 65(2), 469 - 77
Reaction of systemic lupus erythematosus antinative DNA antibodies with native DNA fragments from 20 to 1,200 base pairs; Papalian M et al.; Double-stranded DNA fragments of varying sizes were isolated and tested for binding to systemic lupus erythematosus (SLE) antinative DNA antibodies . Fragments of 20-25, 40-50, 90-110, and 160-180 base pairs (bp), along with intermediate-size pieces were isolated by preparative gel electrophoresis of a limited micrococcal nuclease digest of calf thymus DNA . Larger helical polynucleotides of 160-200, 380, 600-1,000, and 1,200 bp were isolated by preparative gel electrophoresis of DNA from chicken erythrocyte nucleosomes and oligonucleosomes . The fragments behaved as base-paired structures as tested by thermal denaturation, resistance to S1 nuclease, and serological assays with antibodies to native or denatured DNA . At a concentration of 0.27 muM, fragments of 20-25 bp were able to react with two SLE sera in competition with native DNA . With these and two other sera, DNA of 40-50 bp was a much more effective competitor . One serum required DNA greater than 180 bp for competition in the concentration range tested . Denatured fragments were much less effective than native fragments . The results emphasize the heterogeneity of SLE antinative DNA antibodies, confirm that secondary structure of the antigen is important for specific binding to these antibodies, and support the suggestion that bivalent binding to one molecule may be important for high functional affinity.

J Biol Chem, 1980 Jan 25, 255(2), 681 - 5
Transcriptionally active mononucleosomes from trout testis are heterogeneous in composition; Hutcheon T et al.; Limited micrococcal nuclease action on trout testis nuclei yields two mononucleosome subsets, MN1 and MN2, enriched in transcribed DNA sequences . MN1 is soluble and MN2 insoluble in 0.1 M NaCl . Electrophoresis of intact MN1 and MN2 mononucleosomes in 4% polyacrylamide gels shows that each fraction is heterogeneous and four major and several minor subcomponents can be resolved . Dissociation of the protein components of these nucleosomal particles by two-dimensional electrophoresis shows that the major component of MN1 possesses stoichiometric amounts of the four inner histones and of the high mobility group protein H6, associated with DNA fragments of 140 base pairs in length . The major component of MN2 possesses equimolar amounts of the four inner histones plus 1 molecule of H1 and H6, complexed with DNA fragments of 220 base pairs in size.

J Biol Chem, 1980 Jan 25, 255(2), 771 - 82
Structure, spacing, and phasing of nucleosomes on isolated forms of mature simian virus 40 chromosomes; Shelton ER et al.; Mature Simian virus 40 (SV40) chromosomes were isolated from infected CV-1 monkey cells by a hypotonic extraction method that not only allowed replicating viral chromosomes to faithfully continue DNA replication in vitro, but also was found to assemble nascent DNA into nucleosomes with a structure and arrangement typical of native viral chromosomes . Detailed analysis of the DNA and nucleoprotein products from micrococcal nuclease and DNase I digestion of mature viral chromosomes assembled in intact cells showed that the structure of SV40 and CV-1 cellular nucleosomes was the same . Furthermore, the histone composition of viral chromosome was indistinguishable from that of its host . In contrast to the identity in nucleosome structure, nucleosome spacing on isolated SV40 chromosomes was not as regular as on cellular chromatin . When 1% of the DNA was solubilized by micrococcal nuclease, as many as 20 cellular DNA bands were clearly resolved by gel electrophoresis, but only 6 to 7 viral DNA bands were observed and they were broader and less well resolved . In addition, micrococcal nuclease digested SV40 chromosomes at a faster initial rate and to a greater extent than CV-1 chromatin present in the same tube . Either BglI or EcoRI restriction endonuclease cut a single site in 30% of the SV40 chromosomes which suggested that viral nucleosomes were not located in a unique phase with respect to DNA sequence, but appeared to be randomly spaced around the genome . Viral chromosome structure was basically unaltered in hypotonically extracted chromosomes exposed to 200 or 600 mM NaCl and in isotonically extracted chromosomes prepared in the presence of Triton X-100 and EDTA . These results confirm and extend our previous data on the arrangement of SV40 nucleosomes inside isolated nuclei and demonstrate that the structure of viral chromosomes was not altered by the isolation procedures employed . The data are consistent with a model in which an average of 22 nucleosomes, randomly distributed around the SV40 genome, are separated by non-nucleosomal spacer regions which account for about 20% of the total DNA.

J Biol Chem, 1980 Jan 25, 255(2), 468 - 74
Solid phase radioimmunoassay for chromosomal components; Romani M et al.; This manuscript describes the use of a solid phase radioimmunoassay for serological analysis of chromosomal components . The applicability of this assay for various studies on nonhistone chromosomal proteins, histones, and chromatin subunits is illustrated . By this technique it is possible to detect and quantify nuclear antigens in the nanogram range . The assay has all the inherent sensitivity and precision of radioimmunoassays and, as such, introduces a new, convenient method for serological analyses of chromosomal components . The results presented reconfirm the serological similarity among the HMG (high mobility group) proteins derived from various sources . The amount of HMG proteins present in mononucleosomes purified from calf thymus is similar to that present in mononucleosomes purified from HeLa cells, suggesting that various tissues contain similar amounts of these proteins . Per nucleosome, dinucleosomes and trinucleosomes contain as much HMG-1 protein as mononucleosomes, suggesting that the protein is not exclusively associated with those regions of DNA which have been solubilized by micrococcal nuclease . Part of the antigenic determinants present in HMG-1 forming a complex in the nucleosomal conformation do not interact with antibodies.

Biochim Biophys Acta, 1980 Jan 24, 621(1), 138 - 46
Micrococcus radiodurans surface exonuclease . Dimer to monomer conversion by ionizing radiation-generated aqueous free radicals; Mitchel RE; Micrococcus radiodurans possesses an exonuclease firmly bound to a middle cell wall membrane layer . Aqueous OH . radicals generated chemically or by ionizing radiation cause the immediate release of this enzyme into the surrounding medium . The enzyme is located in a hydrophobic site and can also be released by aqueous n-butanol . When extracted by this solvent it is a non-covalently linker dimer and has a molecular weight of 260 000 as determined by gel filtration . When released by radiation generated OH . radicals, the enzyme initially appears in solution as the dimer but is rapidly split by further aqueous radical attack into two 130 000 molecular weight subunits . Hydroxyl radicals are most effective but reducing radicals are also able to monomerize the enzyme . Only the released dimer enzyme is subject to free radical monomerization . Bound dimer enzyme is not split prior to release . No detectable loss of activity or change in catalytic properties accompanies the free radical cleavage of the enzyme . Both subunits of the dimer enzyme possess a tightly bound metal ion (probably Ca2+) required for activity . The monomer but not the dimer enzyme will bind to an anion exchanger . The monomer is susceptible to loss of its metal ion, and consequent inactivation, when exposed to the exchanger in the absence of Ca2+ . Besides providing information on some of the immediate non-lethal effects of ionizing radiation, the behavior of this enzyme system demonstrates a potential cellular mechanism by which internally or externally generated free radicals could be utilized by the cell to control various enzymic reactions.

Nucleic Acids Res, 1980 Jan 11, 8(1), 21 - 42
Self-assembly of single and closely spaced nucleosome core particles; Noll M et al.; Self-assembly of DNA with the four core histones but in the absence of H1 generates nucleosome core particles which are spaced randomly over large distances . Closely spaced core particles, however, exhibit a preferred short linkage which is not a multiple of 10 base pairs . They bind about 140 base pairs whereas apparently shorter DNA lengths per nucleosome observed after digestion with micrococcal nuclease are the result of degradation from the ends . The DNA length of one superhelical turn in the core particle is 83 +/- 4 base pairs . Single core particles may bind more DNA than closely spaced core particles but probably less than two full turns of 168 base pairs . The internal structures of single and of native core particles are very similar as judged by their amount of DNA, sedimentation coefficient, appearance in the electron microscope, and digestion with DNase I . In addition to core particles, a particle is described which sediments at 9 S and consists of 108 base pairs of DNA bound to the histone octamer . It appears to be the smallest stable "core particle" but it is not a degradation product of the 146-base-pair core particle . Digestion of end-labeled 9 S and nucleosome core particles with DNase I shows distinct differences.

Acta Biochim Pol, 1980, 27(2), 143 - 51
Isolation and susceptibility to nucleases of transcriptionally active and inactive chromatin fractions from Physarum polycephalum; Czupryn M et al.; Transcriptionally active and inactive chromatin fractions were isolated from Physarum polycephalum after depolymerization of chromatin with DNAase II or micrococcal nuclease, followed by fractionation in 5 mM-MgCl2 . The active fraction of chromatin comprised up to 21% of nuclear DNA and was enriched 22-fold in the labelled nascent RNA . Both chromatin fractions were shown to have the nucleosomal structure . DNA of the active fraction of chromatin was degraded much faster with DNAase I and micrococcal nuclease than the DNA of the inactive fraction.

Acta Biochim Pol, 1980, 27(2), 123 - 34
Aminoacylase from Micrococcus agilis; Szwajcer E et al.; Intracellular aminoacylase from Micrococcus agilis CCM 2131 was purified 430-fold with a 23% yield . The purified enzyme was homogeneous on polyacrylamide-gel electrophoresis and it smolecular weight was 58000 . The enzyme hydrolysed stereospecifically a number of acylated L-amino acids . Its activity towards N-acetyl-L-phenylglycine was strongly inhibited by 1,10-phenanthroline, N-bromosuccinimide and mercaptoethanol, and was inhibited competitively by glycylglycine.

Mikrobiologiia, 1980 Jan-Feb, 49(1), 175 - 7
{Resistance of microorganisms of upper layers of the atmosphere to ultraviolet radiation and a high vacuum}; Lysenko SV; Solar radiation and high vacuum are the main factors affecting the incidence of microorganisms in the stratosphere and mesophere . It has been established in experiments that the conidia of Aspergillus niger are most resistant of UV irradiation . The conidia of Penicillium, the spores of Papulaspora anomala and Circinella muscae, and the vegetative cells of Micrococcus and Mycobacterium are more susceptible to UV radiation . All of the isolated microorganisms have been shown to be resistant to high vacuum . Their inactivation varied within the range of 2 to 16%, with an exception of Micrococcus cells (40%).

Mech Ageing Dev, 1980 Jan, 12(1), 65 - 80
Disulfide bonds and the structure of the chromatin complex in relation to aging; Tas S et al.; Triton X-100 washed nuclei from livers of young-adult and old mice were digested with micrococcal nuclease and pelleted . Supernatants (1SF) were saved and the pellets lysed in a hypotonic EDTA buffer . A second supernatant (2SF) and a final pellet (P) were obtained by recentrifugation (7000 g, 7 minutes) . The 1SF/2SF ratio, which has been shown to be an index of the transcriptionally active to inactive chromatin ratio, was lower in older mice . The fraction relatively resistant to solubilization by the nuclease (P) was found by isopycnic sucrose gradient centrifugation to be in a more compatc, condensed state when prepared from older mice . Higher amounts of heavy density chromatin were obtained from nuclei of old than young mice by hypotonic lysis plus minimal mechanical shearing . 2-Mercaptoethanol (2ME) treatment brought the density of the material of P from old mice back to the levels of young mice . In both age groups 2ME decreased the densities of mechanically sheared chromatin as well as of the whole Triton X-100 washed nuclei . In nuclease digestion experiments treatment of the nuclei from both age groups with S-S reducing agents increased the release of DNA from P into the supernatants . The results are consistent with S-S bonds being involved in the condensed structure of chromatin in young and old mice and in the shift of the chromatin complex towards a more compact, condensed state in old age.

J Nutr, 1980 Jan, 110(1), 105 - 16
Alteration of higher order structure of rat liver chromatin by dietary composition; Castro CE et al.; The higher order structure of rat liver chromatin from nuclei of animals fed stock or semi-synthetic diets for 5 days was investigated by a specific enzymatic probe, micrococcal nuclease (EC 3.1.4.7) . Micrococcal nuclease digests 50% of DNA in eukaryotic chromatin into acid-soluble nucleotides while 50% of the DNA is resistant to digestion because of associated nucleoproteins . This selective digestion of DNA reflects higher orders of structure of the universal chromatin subunit, the nucleosome, found in lower eukaryotes, plants and animals . When rats were fed a commercial stock diet, 50.3% of the DNA in liver chromatin was digested by micrococcal nuclease . However, when rats were fed various semi-synthetic diets, the amount of DNA susceptible to micrococcal nuclease digestion varied as a function of diet (P less than 0.0001) . Differences in the amount of DNA susceptible to micrococcal nuclease ranged from 71.4% for chromatin of rats fed a high carbohydrate/fat-free diet to 38.8% for chromatin of those fed a low carbohydrate/protein-free diet . DNA fragments generated by brief micrococcal nuclease digestion were analyzed by electrophoresis on 2.5% polyacrylamide--0.5% agarose gels . Chromatin from rats fed the high carbohydrate/fat-free diet was more rapidly digested to the monomer nucleosomin-free diet . To our knowledge, these diet-induced alterations in the higher order structure of chromatin are the first to be reported as occurring by in vivo modulation.

J Bacteriol, 1980 Jan, 141(1), 81 - 6
Four proteins synthesized in response to deoxyribonucleic acid damage in Micrococcus radiodurans; Hansen MT; Four proteins, alpha beta, gamma, and delta, preferentially synthesized in ultraviolet light-treated cells of Micrococcus radiodurans, were characterized in terms of their molecular weights and isoelectric points . Within the sublethal-dose range, the differential rate of synthesis for these proteins increased linearly with the inducing UV dose . The degree of induction reached 100-fold, and the most abundant protein beta, amounted to approximately 2% of the total newly synthesized protein after irradiation . Damage caused by ionizing radiation or by treatment with mitomycin C also provoked the synthesis of the four proteins . The proportions between the individual proteins, however, varied strikingly with the damaging agent . In contrast to treatments which introduced damage in the cellular deoxyribonucleic acid, the mere arrest of deoxyribonucleic acid replication, caused by nalidixic acid or by starvation for thymine, failed to elicit the synthesis of either protein . Repair of deoxyribonucleic acid damage requires that a number of versatile and efficient processes by employed . It is proposed that the induced proteins participate in deoxyribonucleic acid repair in M . radiodurans . Mechanisms are discussed which would allow a differentiated cellular response to damages of sufficiently distinctive nature.

J Neurosurg, 1980 Jan, 52(1), 126 - 8
Cerebral cyst infection with Micrococcus sedentarius . Case report; Greene GR et al.; A 7-year-old boy with congenital hydrocephalus and a left septate cerebral cyst presented with a shunt infection due to Micrococcus sedentarius, resistant to all penicillins . The shunt infection was persistent despite several courses of parenteral, intraventricular, and intracyst antibiotics . Evaluation of the ventricular fluid revealed adequate "killing power" against the patient's microorganism . No extracranial focus of infection could be found . Computerized tomographic scanning, along with air ventriculography, identified a noncommunicating area of the cerebral cyst . Only when communication between this location and the rest of the cyst was established were the antibiotics efficacious . Undercirculated areas of cerebrospinal fluid should be sought when shunt infections and ventriculitis persist in spite of adequate parenteral and local therapy in patients with brain cysts.

Acta Biochim Pol, 1980, 27(3-4), 413 - 20
Some unusual features of Physarum polycephalum chromatin are due to the presence of slime; Staron K et al.; Chromatin of lower eukaryote Physarum polycephalum, while showing typical nucleosomal organization, reveals upon digestion with micrococcal nuclease certain features not found in chromatins of higher eukaryotes, the most pronounced of which is the unusual pattern of degradation of core-size DNA, without accumulation of subcore fragments . It has been shown that these peculiarities are not due to intrinsic features of Physarum nucleohistone complex but to the presence of a specific polysaccharide, the main component of Physarum slime, contaminating chromatin preparations.

Mol Gen Genet, 1980, 179(1), 191 - 9
Defective excision repair in a mutant of Micrococcus radiodurans hypermutable by some monofunctional alkylating agents; Tempest PR et al.; The lethal and mutagenic effects of methyl methanesulphonate (MMS), ethyl methanesulphonate (EMS), and N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) can be dissociated in a mitomycin C (MTC)-sensitive mutant, strain 302, of Micrococcus radiodurans . As regards lethality 302 is extremely sensitive, compared with the wild type, to MTC and decarbamoyl MTC (DCMTC), slightly sensitive to EMS, MNNG, nitrous acid, 7-bromomethylbenz{alpha}anthracene (BrMBA), and N-acetoxy-N-2-acetylaminofluorene (AAAF), and resistant to MMS, hydroxylamine, and ICR 191G . As regards mutability it is, compared to the wild type, very sensitive to MMS, EMS, and MNNG, and slightly sensitive to hydroxylamine and nitrous acid but not to any other agent examined . Alkaline sucrose gradient studies indicate the 302 does not incise DNA containing BrMBA adducts, although it does incise DNA damaged by AAAF but probably not to the same extent as wild type . We put forward the hypothesis that the hypermutability of 302 is due to the non-removal of bases or nucleotides, modified in exocyclic positions, which have altered base-pairing capabilities, while lethality results from the non-removal of bases or nucleotides, also modified in exocyclic positions, which no longer form hydrogen-bonded base pairs.

Biochem J, 1980 Jan 1, 185(1), 277 - 9
DNA-binding specificity of a chromatin non-histone protein fraction of HeLa cells; Dunn JH et al.; The DNA-binding site of a previously characterized non-histone chromosomal protein antigen(s) from HeLa cells was investigated for its species specificity . Treatment with large amounts of micrococcal nuclease abolishes immunoactivity, which can then be recovered by the subsequent addition of human or HeLa DNA to reconstitute the immune complex . Neither rat nor calif DNA exhibits this property, but DNA from monkey cells gives considerable activity . The antigen is not, however, detectable in monkey chromatin.

Mol Biol (Mosk), 1980, 14(1), 223 - 33
{Isolation and comparative characteristics of the DNA attached to the axial structures of interphase nuclei and metaphase chromosomes}; Razin SV et al.; DNA fractions enriched in sequences located closely to the sites of attachment of DNA loops to the axial protein structures of interphase nuclei ad metaphase chromosomes were isolated with the aid of two techniques . The method involving treatment with EcorI endonuclease has been described earlier . The new method is based on the mild treatment of the preparations with micrococcal nuclease . The latter method allows one to obtain the fraction of attached DNA of different length and to compare their properties . The average distance between two attachment sites was measured . It is equal to about 6.10(4) base pairs in the both interphase nuclei and metaphase chromosomes . The attached DNA obtained with the aid of micrococcal nuclease treatment is not enriched in satellite but contains a high amount of middle repetitive sequences renaturing in the Cot interval from 10(-2) to 10(0) . According to renaturation properties and distribution in CsCl density gradient the fractions of attached DNA of similar size from metaphase chromosomes and from interphase nuclei are virtually identical . The data obtained indicate that the DNA sequences involved in the attachment of DNA loops to the matrix of interphase nucleus are the same as in the case of metaphase chromosomes.

Int J Radiat Biol Relat Stud Phys Chem Med, 1980 Jan, 37(1), 11 - 18
Properties of an endonuclease activity in Micrococcus luteus acting on gamma-irradiated DNA and on apurinic DNA; Schafer G et al.; A protein fraction from Micrococcus luteus with endonuclease activity against gamma-irradiated DNA was isolated and characterized . An additional activity on apurinic sites could not be separated, either by sucrose gradient sedimentation or by gel filtration through Sephadex G 100 . From gel filtration, a molecular weight of about 25 000 was calculated for both endonuclease activities . The endonuclease activity against gamma-irradiated DNA was stimulated five-fold with 5 mM Mg++, whereas that against apurinic sites was less dependent on the Mg++ concentration . 100 mM KCl inhibited the gamma-ray endonuclease, but not the apurinic endonuclease activity . In gamma-irradiated RNA the protein recognized 1.65 endonuclease sensitive sites per radiation induced single-strand break, among which are 0.45 alkali labile lesions in the nucleotide strand . The affinity of the enzyme for the endonuclease sensitive site was evaluated resulting in a Km-value of 73 nM.

Acta Biol Med Ger, 1980, 39(4), 343 - 54
Isolation and characterization of salt-soluble, unsheared chromatin; Fenske H et al.; From rat liver nuclei depending on the extraction time, 10 to 20% of total chromatin has been extracted with a solution containing 0.1 M ammonium sulfate, 2 mM MnCl2, 0.1 M Tris-HCl, pH 7.9 . We term this chromatin chromatin S . It has a protein: DNA ratio of 1.3, the full amount of the 5 histones in an undegraded state, and a RNA: DNA ratio of approximately 0.2 . Its nonhistone protein pattern, obtained by gel electrophoresis exhibits a rich spectrum of proteins in a broad range of molecular weights . Electrophoretic analysis of the DNA fragments obtained by micrococcus nuclease digestion of chromatin S yields the same digestion pattern as that of nuclei . Thus, chromatin S fulfils an essential criterion of unsheared chromatin . In contrast to other chromatin preparations described so far, this chromatin is soluble at a salt concentration of 0.1 M ammonium sulfate . We have shown previously that it exhibits a compact conformation, low intrinsic viscosity and low radius of gyration obtained by light scattering measurements . Its mean molecular weight was determined to be nearly 10(8).

Scand J Immunol, 1980, 11(6), 635 - 42
Idiotypic lymphocytes in the rabbit: occurrence and nature of idiotypic lymphocytes in normal and hyperimmunized rabbits; Bast EJ et al.; Rabbits were hyperimmunized with Micrococcus Pysodeicticus, leading to homogeneous antibody responses . Peripheral blood lymphocytes were taken from the rabbits before and monthly (during 3 months) after the start of the immunization . The cells were stored frozen . Lymphocytes were tested with anti-idiotypic conjugates for the presence of surface idiotypic structures . The nature of the idiotype-positive cells was determined with respect to the presence of IgM or T-cell antigenic determinants on their surface . A sharp rise and fall in the percentage of idiotypic lymphocytes was found, ranging between 1/40,000 and 1/1,000 . Initially almost all idiotypic lymphocytes were IgM-positive . In the blood taken 2 months after the start of the immunization 20% of the idiotypic cells belonged to the T-cell population and 10% were negative for both IgM and T-cell antigenic determinants.

Acta Virol, 1980 Jan, 24(1), 1 - 11
Translation of genomic avian myeloblastosis virus RNA in a cell-free protein synthesis system from rabbit reticulocytes; Maly A et al.; Reaction conditions suitable for translation of genomic avian myeloblastosis virus RNA in micrococcal nuclease-pretreated reticulocyte lysates are described . The products of translation were characterized by immunoprecipitation and gel electrophoresis and compared with virus-specific products formed in host cells . Genomic viral RNA directed in a cell-free system the synthesis of precursors to viral structural proteins, namely Pr76gag and Pr180gag,pol.

Nucleic Acids Res, 1979 Dec 20, 7(8), 2239 - 54
Effects of nuclear disruption on the macromolecular composition of nucleosome subfractions; Levy-Wilson B; The macromolecular composition of nucleosomal subfractions obtained by limited action of micrococcal nuclease upon trout testis chromatin has been analyzed with the purpose of comparison with the properties of transcriptionally active nucleosomal fractions derived by similar treatment of intact nuclei . The results indicate that when the native chromatin structure of intact nuclei is disrupted prior to the nuclease action, the nucleosomal subfractions that are subsequently generated have an altered composition.

Biochim Biophys Acta, 1979 Dec 17, 565(2), 387 - 90
Similar distributions of repaired sites in chromatin of normal and xeroderma pigmentosum variant cells damaged by ultraviolet light; Cleaver JE; Excision repair of damage from ultraviolet light in both normal and xeroderma pigmentosum variant fibroblasts at early times after irradiation occurred preferentially in regions of DNA accessible to micrococcal nuclease digestion . These regions are predominantly the linker regions between nucleosomes in chromatin . The alterations reported at polymerization and ligation steps of excision repair in the variant are therefore not associated with changes in the relative distributions of repair sites in linker and core particle regions of DNA.

Klin Monatsbl Augenheilkd, 1979 Dec, 175(6), 841 - 5
{Endemic eye diseases in Samoa, 1910-1913}; Kluxen G et al.; In the years 1910/13 two endemic infections of the conjunctiva were found in Samoa in addition to ocular manifestations of filiariosis . One of these infections was obviously trachoma, the other an acute micrococcus catarrhalis conjunctivitis by diplococcus samoensis.

J Biochem (Tokyo), 1979 Dec, 86(6), 1651 - 7
Isolation and characterization of chromatin subfractions from rat liver; Sugano N et al.; Rat-liver chromatin was digested with micrococcal nuclease at low ionic strength in the presence of a low concentration of CaCl2 . The nuclease digest was successfully separated into three fractions, P1, P2, and P3, by gel filtration on a column of Sepharose 2B . P1 fraction was shown to be a mixture of long fragments of partially digested chromatin by the sedimentation profile or by electrophoresis of DNA . P2 fraction contained four histones H2A, H2B, H3, and H4 in almost equal amounts, together with nonhistone protein of low molecular weight . The DNA was composed of three or four fragments less than 300 base pairs long . From the Kav value of the P2 fraction, the average size was estimated to be about 240 base pairs . On analytical ultracentrifugation, this fraction exhibited a monophasic boundary and a sedimentation value of 13.7S . P3 fraction contained nonhistone proteins which showed a molecular weight larger than that of H1 histone . The size of DNA was estimated to be less than 50 base pairs from the Kav value . Based on these results, the P2 fraction was concluded to consist of nucleosome monomer enriched in nonhistone proteins . The P3 fraction is presumably the nuclease-sensitive or internucleosome portion, which contains small amounts of nonhistone proteins.

Infect Immun, 1979 Dec, 26(3), 991 - 5
Simple and rapid procedure for the selective removal of lysozyme from human saliva; Germaine GR et al.; A simple and rapid method is described for the removal of lysozyme from human whole salivary supernatant . Saliva specimens were adsorbed with Micrococcus lysodeikticus . The saliva so treated was depleted of 95% of the lysozyme activity . Changes in total protein, lactoperoxidase, lactoferrin, immunoglobulin A, and the proportions of several anionic proteins were less than 10% . It is concluded that adsorption of saliva with M . lysodeikticus is a suitable procedure for the preparation of saliva that is selectively deficient in lysozyme.

Proc Natl Acad Sci U S A, 1979 Dec, 76(12), 6515 - 9
Nucleosome organization of the yeast 2-micrometer DNA plasmid: a eukaryotic minichromosome; Nelson RG et al.; The eukaryotic microorganism Saccharomyces cerevisiae contains 50-100 copies per cell of a circular plasmid called 2-micrometer DNA . The intracellular structure of these molecules, which represent about 4% of the total DNA, was examined by digestion of total cellular chromatin with micrococcal nuclease (nucleate 3'-oligonucleotidohydrolase, EC 3.1.31.1) . Nuclease-resistant DNA fragments were fractionated by gel electrophoresis and 2-micrometer DNA sequences were detected by hybridization . The 2-micrometer and chromosomal DNA digestion patterns were very similar indicating that both types of DNA are condensed into nucleosomes . An analysis of these digestion patterns showed that the kinetics of digestion of 2-micrometer chromatin and total chromatin are similar and that both have the same nucleosome repeat length of about 165 base pairs . Native 2-micrometer plasmids were examined by zone sedimentation in sucrose gradients containing 0.15 M NaCl and were found to have a sedimentation constant of 75 S, about 3 times the sedimentation constant of protein-free 2-micrometer DNA . This sedimentation property is what would be expected for a 2-micrometer DNA minichromosome . We conclude that within the cell 2-micrometer DNA molecules are organized in a chromatin structure very similar to that of the yeast chromosomes.

Proc Natl Acad Sci U S A, 1979 Dec, 76(12), 6110 - 4
A topoisomerase from Escherichia coli related to DNA gyrase; Brown PO et al.; We have identified a topoisomerase activity from Escherichia coli related to DNA gyrase (topoisomerase II): we designate it topoisomerase II' . It was constructed of two subunits, which were purified separately . One is the product of the gyrA (formerly nalA) gene and is identical to subunit A of DNA gyrase . The other is a 50,000-dalton protein, which we have purified to homogeneity and call v . v may be a processed form of the much larger gyrase subunit B or may be derived from a transcript of part of the subunit B structural gene, because preliminary peptide maps of the two subunits are similar . Topoisomerase II' relaxes negatively supercoiled DNA and, uniquely among E . coli topoisomerases, relaxes positive supercoils efficiently . It is the only topoisomerase that can introduce positive supercoils; these are stoichiometric with enzyme molecules . Topoisomerase II' resembles gyrase in its sensitivity to oxolinic acid, the wrapping of DNA in an apparent positive supercoil around the enzyme, and the introduction in an aborted reaction of site-specific double-strand breaks in the DNA with concomitant covalent attachment of protein to both newly created 5' ends . Unlike DNA gyrase, topoisomerase II' has no negative supercoiling activity . Functional chimeric topoisomerases were constructed with the alpha subunit of the Micrococcus luteus gyrase and v or gyrase subunit B from E . coli . We discuss the implications of the dual of the gyrA gene product.

Chem Biol Interact, 1979 Dec, 28(2-3), 225 - 36
Interaction of benzo{alpha}pyrene diol-epoxide with nuclei and isolated chromatin; Kootstra A et al.; Chicken erythrocyte chromatin and nuclei were labeled with benzo{alpha}-pyrene (B{alpha}P) diol-epoxide (anti) and digested with micrococcal nuclease to mono- and dinucleosomes . Analysis of the distribution of the carcinogen showed that the internucleosomal region bound 3-4 times more carcinogen per unit DNA than did nucleosomes . The enhanced binding of the 'ultimate' carcinogen to the internucleosomal region was similar when isolated chromatin or nuclei were used for in vitro labeling . Furthermore, isolation of the histone core proteins, H2A, H2B, H3 and H4, revealed that only 15% of the carcinogen was associated with the histones and that the majority of the carcinogen was bound to chromosomal DNA . Fluorography of purified nucleosomal histones showed that the covalent association of the carcinogen was mainly with histones H3 and H2B.

Biochim Biophys Acta, 1979 Nov 22, 565(1), 192 - 8
A method for the synthesis of oligonucleotide by single addition of 2'-O-(o-nitrobenzyl)nucleoside 5'-diphosphates using polynucleotide phosphorylase; Ohtsuka E et al.; Two hexanucleotides A-U-G-U-G-A and C-A-A-U-U-G were synthesized from the chemically synthesized trimers C-A-A and A-U-G by addition of 2'-O-(o-nitrobenzyl)nucleoside diphosphates using polynucleotide phosphorylase isolated from either Escherichia coli or Micrococcus luteus . In each reaction the preference of the enzyme was tested . The o-nitrobenzyl group was removed after addition of the mononucleotide and the deblocked product was isolated by chromatography on DEAE-Sephadex in high yields.

J Biol Chem, 1979 Nov 10, 254(21), 11119 - 25
Differential expression of gizzard actin genes during chick embryogenesis; Saborio JL et al.; The iso forms of gizzard actin present during chicken embryogenesis were analyzed by two-dimensional electrophoresis . During chick embryogenesis there are conspicuous changes in the content of the iso forms of actin . Gizzards from 8-day-old embryos contain almost exclusively beta-actin . After 8 days of embryonic age, there is a continuous increase in the amount of gamma-actin and an apparent decrease in the amount of beta-actin . These changes in the content of beta- and gamma-actin in gizzard tissue are paralleled by changes in the content of the corresponding mRNAs, as detected by the ability of the RNAs to direct the synthesis of these proteins in micrococcal nuclease-digested reticulocyte lysates . The correlation of the in vivo and in vitro experiments indicates that during chick embryogenesis there is a differential expression of the genes coding for the iso forms of gizzard actin and that this expression is controlled at the transcriptional level.

Appl Environ Microbiol, 1979 Nov, 38(5), 902 - 5
Science of hemolytic activity of some radiation-resistant micrococci in food; Welch AB et al.; Micrococci resistant to 1 Mrad of gamma radiation were isolated from irradiated chicken . Three isolates were hemolytic on blood agar plates and were selected for further study . Two other radiation-resistant micrococci, Micrococcus radiodurans and Micrococcus radiophilus, were included in the study because there is only a very limited amount of information regarding hemolytic activity of these organisms and their potential role of public health importance . Tests to determine hemolytic patterns, hemolytic activity of extracellular substances, leukocytic activity, presence of enzymes commonly associated with pathogenicity (coagulase, deoxyribonuclease, phosphatase), and pathogenicity for laboratory animals all suggested that the organisms would not be of public health significance.

Ann Microbiol (Paris), 1979 Nov-Dec, 130B(4), 407 - 14
{Lipids and lipopolysaccharides of "Micrococcus radiodurans" (author's transl)}; Rebeyrotte N et al.; Studies were carried out on lipid composition of Micrococcus radiodurans . The polar lipid components were found to be 4 glycolipids, 3 phospholipids and 2 phosphoglycolipids . The major fraction belongs to the last group . Correlation between these components and lipoteichoic acid was not observed . A lipid-polysaccharidic complex was isolated . It was not of this type.

Eur J Biochem, 1979 Nov, 101(2), 377 - 83
Preferential interstrand cross-linking of DNA rich in guanine and cytosine by cis-dichlorodiammineplatinum(II); Ganguli PK et al.; Two native DNAs differing in G + C content were bound equally with the antitumour drug cis-Pt(NH3)2Cl2 at increasing Pt/P ratios . Resulting changes in their ultraviolet absorption spectra show equal fractional decreases in the initially different values of A250/A270 for the two DNAs, and less prominent bathochromic and hyperchromic shifts for DNA richer in G + C . Changes in the absorbance (A260) observed before and after subjecting the DNA samples to the conditions of denaturation (with alkali) and renaturation, indicate the following effects of the platinum binding . Maximum renaturation occurs at 50% lower Pt/P ratio of 0.03 for Micrococcus lysodeikticus DNA (72% G + C) than 0.06 for salmon sperm DNA (41% G + C) and is maintained at higher Pt/P ratios . Interstrand cross-links that facilitate renaturation, cause an incomplete melting of DNA so that the platinum-DNA complex at pH 12.5 has a reduced absorbance . This effect is more evident for the platinum complex with DNA richer in G + C due to more interstrand cross-links . Platinum-induced destabilisation of DNA, shown by its hyperchromicity at the pre-melting state (pH 6--7, 25 degrees C) and also by a lowering of the pH corresponding to the mid-point of its melting, is less evident for DNA richer in G + C.

Antibiotiki, 1979 Nov, 24(11), 841 - 6
{Carminomycin induction of single-stranded DNA breaks in Micrococcus luteus cells}; Trenin AS; The effect of carminomycin, an amtitumor antibiotic from the anthracycline group on DNA of M . luteus cells was studied . It was shown that carminomycin induced one-thread breaks in DNA . The antibiotic effect was proportional to its concentration and depended on the time of the cell exposure . When the incubation time with carminomycin was longer, there was observed disappearance of a significant part of the breaks . The lower was the antibiotic concentration, the rapider was the process, especially after removal of the antibiotic from the medium . Induction of the one-thread breaks by carminomycin in DNA of the cells of the mutant strain DB-7 of M . luteus was more difficult than in that of the cells of the wild type strain which was indicative of the enzymatic character of most of the breaks and of a special role of UV-endonuclease of M . luteus in this process . On the basis of carminomycin hypersensitivity of the mutant it was concluded that the above enzyme was probably involved in reparation of the DNA damages induced by carminomycin . No two-thread breaks induced by the antibiotic were detected.

Mol Gen Genet, 1979 Nov, 176(3), 351 - 9
Three additional genes involved in pyrimidine dimer removal in Saccharomyces cerevisiae: RAD7, RAD14 and MMS19; Prakash L et al.; The ability to remove ultraviolet (UV)-induced pyrimidine dimers from the nuclear DNA of yeast was examined in two radiation-sensitive (rad) mutants and one methyl methanesulfonate-sensitive (mms) mutant of the yeast Saccharomyces cerevisiae . The susceptibility of DNA from irradiated cells to nicking by an endonuclease activity prepared from crude extracts of Micrococcus luteus was used to measure the presence of dimers in DNA . The rad7, rad14 and mms19 mutants were found to be defective in their ability to remove UV-induced dimers from nuclear DNA . All three mutants belong to the same epistatic group as the other mutants involved in excision-repair . All three mutants show enhanced UV-induced mutations . The rad14 mutant also shows epistatic interactions with genes in the other two UV repair pathways.

Proc Natl Acad Sci U S A, 1979 Nov, 76(11), 5500 - 4
Endonucleolytic activity directed towards 8-(2-hydroxy-2-propyl) purines in double-stranded DNA; Livneh Z et al.; Photoalkylation of circular covalently closed DNA from phage PM2 with isopropyl alcohol by using a free radical photoinitiator and UV light of lambda greater than 305 nm led to the specific 8-substitution of purine moieties in the DNA, yielding 8-(2-hydroxy-2-propyl)adenine and 8-(2-hydroxy-2-propyl)guanine as the only detectable damage in the DNA . Using this specifically photoalkylated DNA as a substrate, we discovered in extracts of Micrococcus luteus an endonucleolytic activity that is directed towards 8-(2-hydroxy-2-propyl) purines in DNA . The activity is not a combination of a DNA-glycosylase and an apurinic site endonuclease . It is not inhibited by single-stranded DNA, by UV- or gamma-irradiated single-stranded DNA, or by normal or depurinated double-stranded DNA . however, gamma- or UV-(254 nm) irradiated double-stranded DNAs to inhibit the activity, hinting at the possibility of a common type of lesion in these damaged DNAs . Divalent cations are not required for the incising activity, and it is fully active in 1 mM EDTA, whereas caffeine and ATP cause inhibition . Extracts of mutant M . luteus lacking pyrimidine-dimer-directed endonucleases were found to contain the endonucleolytic activity in levels comparable to those present in the wild type . After the incision, we could demonstrate the specific excision of the 8-alkylated purines from the damaged DNA . The special conformational consequences of the 8-alkylation of purines, at the nucleotide level, namely their nonregular syn conformation, suggest that it is the distortion in the DNA that is recognized by the endonuclease.

Proc Natl Acad Sci U S A, 1979 Nov, 76(11), 5510 - 4
Extracts of Drosophila embryos mediate chromatin assembly in vitro; Nelson T et al.; Extracts of Drosophila embryos can mediate the assembly of a chromatinlike structure from histones and DNA under physiological conditions . The histone-DNA complex formed in vitro contains micrococcal nuclease-sensitive sites spaced at 200-base pair intervals . More extensive digestion of the complex by micrococcal nuclease generates 11S particles which cosediment with nucleosome core particles isolated from native chromatin . These particles contain 140-base pair DNA fragments which upon further cleavage with micrococcal nuclease give rise to a pattern of discretely sized DNA fragments characteristic of nucleosome core particles . We have assayed the chromatin assembly process both qualitatively by measuring the induction of supertwists into a relaxed circular DNA (a process requiring a nicking-closing enzyme) and quantitatively by measuring the formation of micrococcal nuclease-resistant DNA fragments from radioactively labeled linear DNA . The amount of chromatin formed depends primarily on the amount of histones, whereas the rate of assembly depends on the amount of extract protein added . The factors in the extract that mediate chromatin assembly appear to interact first with the DNA because preincubation of the DNA with the extract markedly increases the extent of assembly.

Biokhimiia, 1979 Nov, 44(11), 2039 - 47
{Study of membrane proteins from Microccus lysodeikticus using immunochemical methods}; Turgenbaeva DA et al.; Using immunoelectrophoresis, the antigenicity of various protein fractions of the Micrococcus lysodeikticus membranes was evaluated . It was shown that both the peripheral and integral membrane proteins possess the antigenic determinants . The antiserum exhausted by the M . lysodeikticus mebranes loses its ability to interact with intergral proteins, which are not solubilized by Triton X-100 . It was thus assumed that the integral proteins are exposed on the membrane surface constantly or periodically and that there exist no proteins which are completely and permanently incorporated into the lipid bilayer . The respiratory chain of the M . lysodeikticus membrane is inhibited by membrane immunoglobulins by 50% . This is probably due to the presence in the membrane antiserum of antibodies specific to the respiratory chain enzymes . Evidence for this assumption can be derived from the fact that partially purified cytochrome b556 forms a precipitation zone with the membrane antiserum and that the activity of membrane NADH-dehydrogenase is inhibited by a monoserum against NADH-dehydrogenase.

Eur J Biochem, 1979 Oct 15, 100(2), 531 - 9
Relaxation of chromatin structure induced by ethidium binding . Involvement of the intercalation process; Paoletti J; In this paper we study the effects of the binding of ethidium on the structure of chromatin, using micrococcal nuclease as a structural probe . This binding induces two structural changes of chromatin either isolated or in the nuclei . (a) An unfolding of the overall structure which results in an activation of the rate of degradation by the nuclease . (b) A disorganisation of the core particle structure which has the effect of unwrapping the DNA from the histone core, this disruption can go on so far as to leave only 90 base pairs . By comparing the bindings of ethidium and tetramethylethidium, we conclude that the first type of structural change is due to an electrostatic effect and does not depend upon intercalation . On the other hand, the second one is due to the intercalation process and to the change of topological constraints on the DNA that such a process involves.

J Biol Chem, 1979 Oct 10, 254(19), 9477 - 87
Superstructural differences between chromatin in nuclei and in solution are revealed by kinetics of micrococcal nuclease digestion; Levinger LF et al.; Digestion of chromatin in nuclei by micrococcal nuclease, measured as the change in the concentration of monomer-length DNA with time, displays Michaelis-Menten kinetics . Redigestion of soluble chromatin prepared from nuclei by micrococcal nuclease treatment, however, is apparently first order in enzyme and independent of chromatin concentration . This qualitative difference results from an increase in the apparent second order rate constant, kcat/Km, for liberation of monomer DNA: the apparent Km for soluble chromatin is lower by close to 3 orders of magnitude than that for chromatin in nuclei, whereas kcat decreases by less than 1 order of magnitude . Neither the integrity of the nuclear membrane nor the presence of histone H1 contributes to the high Michaelis constant characteristic of chromatin in nuclei . Moreover, differences due to the buffers used for digestion and redigestion are minimal . Low catalytic efficiency is, however, correlated with the presence of higher order chromatin superstructure . Micrococcal nuclease added to soluble chromatin under nondigesting conditions at low ionic strength (I = 0.002) co-sediments with chromatin in sucrose gradients . In 0.15 M NaCl, added nuclease no longer sediments with chromatin and redigestion kinetics become first order in both enzyme and substrate . Kinetic analysis of this type may afford an assay for native, higher order structures in chromatin . Our results suggest that micrococcal nuclease binds to soluble chromatin through additional interactions not present in nuclei, which may be partly ionic in nature.

Appl Environ Microbiol, 1979 Oct, 38(4), 626 - 36
Transformation of mercuric chloride and methylmercury by the rumen microflora; Kozak S et al.; The microflora in strained rumen fluid did not methylate or volatilize 203Hg2+ at detectable rates . However, there was an exponential decay in the concentration of added CH3Hg+, which was attributed to demethylation . The major product of demethylation was metallic mercury (Hg0), and it was released as a volatile product from the reaction mixture . Demethylation occurred under both anaerobic and aerobic conditions . The rate of demethylation was proportional to the concentration of added CH3Hg+-Hg from 0.02 to 100 microgram of Hg per ml . The presence of HgCl2 had almost no inhibitory effect on the rate of cleavage of the carbon-mercury bond of CH2HgCl, but it completely inhibited volatilization of the Hg formed, when the concentration of HgCl2-Hg reached 100 micrograms/ml . Three of 11 species of anaerobic rumen bacteria catalyzed demethylation . These were Desulfovibrio desulfuricans, Selenomonas ruminantium, and Megasphaera elsdenii . None of the 11 species caused detectable methylation, and only two caused limited volatilization of Hg2+ . Three species of bacteria out of 90 fresh aerobic isolates from rumen contents were demethylators: two were identified as Pseudomonas sp., and the third was a Micrococcus sp . Demethylation by the rumen microflora appeared to be carried out by both aerobic and anaerobic bacteria and, on the basis of Hg2+ sensitivity, probably resulted from the activity of two enzymes, a CH3-Hg+ hydrolase and a Hg2+ reductase.

Chem Biol Interact, 1979 Oct, 27(2-3), 177 - 90
In vivo binding of N-2-acetylaminofluorene and its N-hydroxy derivative to the DNA of fractionated rat liver chromatin; Walker MS et al.; The in vivo binding of radioactive N-2-acetylaminofluorene (AAF) and N-hydroxy-2-acetylaminofluorene (N-OH-AAF) to the DNA of rat liver chromatin was examined . The chromatin was fractionated into putative transcriptionally active and inactive fractions by hydrodynamic shearing and subsequent glycerol gradient centrifugation, DNAase II digestion followed by MgCl2 aggregation of transcriptionally inactive chromatin, or mild digestion with micrococcal nuclease . Carcinogens were administered for various times prior to sacrifice . Irrespective of the duration of exposure, no preferential binding of either carcinogen to DNA was detected in any of the fractions prepared by hydrodynamic shearing of DNAase II digestion . When micrococcal nuclease was utilized, a 2-fold increase in carcinogen bound to the DNA of that chromatin fraction containing the smallest molecular weight fragments was detected . These small molecular weight fragments produced by micrococcal nuclease have been postulated to be derived from in vivo transcriptional units . Additionally, when DNAase II was used to probe chromatin from rat livers which had been exposed to a carcinogenic regimen of AAF, no preferential binding of radioactive N-OH-AAF to the DNA of any chromatin fraction was detected.

Eur J Biochem, 1979 Oct, 100(1), 225 - 35
Rearrangement of chromatin structure induced by increasing ionic strength and temperature; Spadafora C et al.; Native rat liver chromatin fragments exposed to 600 mM NaCl at 37 degrees C for 45 min exhibit substantial modification of their original (approximately 200 base pairs) repeating subunit structure: a new repeat of 140 base pairs, superimposed on a high background, is observed after micrococcal nuclease digestion . The same material appears, in the electron microscope, as clusters of tightly packed beads connected by stretches of 'free' DNA . These modifications are not observed when the native chromatin is incubated at 37 degrees C at NaCl concentrations up to 400 mM . When native rat liver chromatin depleted of histone H1 by tRNA extraction is exposed to ionic strengths up to 600 mM NaCl at 4 degrees C, almost no modifications of the original native repeating structure are observed . However, when the incubation is carried out at 37 degrees C in 150, 300 or 400 mM NaCl, rearrangements of the native structure occur as indicated by micrococcal nuclease digestion and electron microscopic studies . Incubation of H1-depleted chromatin at 600 mM NaCl for 45 min at 37 degrees C induces, as for the native chromatin, a complete rearrangement characterized by the appearance of a 140-base-pair repeat superimposed on a high background upon digestion by micrococcal nuclease . It is suggested that these rearrangements are mediated by hydrophobic interactions between the histone cores and are prevented at ionic strengths lower than 500 mM by the presence of histone H1.

Nucleic Acids Res, 1979 Sep 25, 7(2), 347 - 59
The distribution of histone H1 subfractions in chromatin subunits; Gorka C et al.; Rat liver chromatin was digested with micrococcal nuclease to various extents and fractionated into nucleosomes, di and trimers of nucleosomes on an isokinetic sucrose gradient . In conditions under which degradation of linker DNA within the particles was limited, the electrophoretic analysis of the histone content showed that the overall content of H1 histone increased from nucleosomes to higher order oligomers . Moreover, the histone H1 subfractions were found unevenly distributed among the chromatin subunits, one of them, H1--3 showing most variation . A more regular distribution of these subfractions was found in subunits obtained from a more extended digestion level of chromatin . It is suggested that the H1 subfractions differ in the protection they confer upon DNA.

Nucleic Acids Res, 1979 Sep 11, 7(1), 49 - 67
A partial characterization of DNA fragments protected from nuclease degradation in histone depleted metaphase chromosomes of the Chinese hamster; Jeppesen PG et al.; A small proportion (0.1-0.5%) of the total DNA content of native Chinese hamster metaphase chromosomes is protected from nucleolytic degradation following the removal of histones by extraction with either 0.2 N HCl or 2 M NaCl, and remains attached to the nonhistone protein core . Acid extraction followed by DNase I digestion leads to small fragments of 10-30 bases . Salt extraction followed by micrococcal nuclease digestion gives approx . 140 b.p . fragments which are undistinguishable in size from nucleosome core DNA fragments . Furthermore, DNase I treatment of salt extracted chromosomes gives DNA fragments containing single strands which are multiples of 10 bases in length, again characteristic of the nucleosome structure . Reassociation kinetics using the 32P-labelled 140 b.p . fragments as probes suggests they are enriched for rapidly reassociating sequences.

Nucleic Acids Res, 1979 Sep 11, 7(1), 31 - 48
The non-histone proteins of the rat liver nucleus and their distribution amongst chromatin fractions as produced by nuclease digestion; Hyde JE et al.; The search for proteins involved in maintaining higher order chromatin structures has led to a systematic examination of the non-histone proteins (NHP) of rat liver nuclei in the context of nuclease digestion studies . 40-45% of the 3H-tryptophan labelled NHP originally present could be removed by extensive washing in a "physiological" buffer, incubation at 37 degrees C with or without nuclease and a further wash step . Nuclei at this stage had a remarkably constant NHP content (ca . 0.73 micrograms/micrograms DNA), independent of the degree of digestion with micrococcal nuclease or HaeIII . The solubilized chromatin produced by limited digestion with either nuclease contained 0.3-0.5 microgram NHP/microgram DNA, this value falling to ca . 0.16 after more extensive cleavage . Insoluble chromatin fractions were between 2-fold (very limited digestion) and 16-fold (extensive digestion) richer in NHP than the corresponding soluble fractions . Gel electrophoresis revealed about 12 NHP bands in soluble fractions, the most prominent of M.Wt . 41.400, while the insoluble material had at least 50 components . These properties were independent of whether lysis of nuclei occurred in 0.2 or 50 mM ionic strength . The large disparity in NHP content between complementary soluble and insoluble chromatin fractions is considered in terms of chromatin organization in vivo and the possible role of NHP migration.

Nucleic Acids Res, 1979 Sep 11, 7(1), 1 - 13
Subunit structure of alpha-satellite DNA containing chromatin from African green monkey cells; Fittler F et al.; alpha-Satellite DNA containing chromatin from African green monkey cells (CV-1 cells) has been used to study the question whether or not nucleosomes are arranged in phase with the 172 bp repeat unit of the satellite DNA . Digestion experiments with DNAase II led us to exclude a simple phase relationship between the nucleosomal and the satellite DNA repeats . Digestion of CV-1 nuclei with micrococcal nuclease and endogenous nuclease (s) produced a series of sharp bands in the satellite DNA register over a background of heterogeneous length fragments . This observation is explained by a preferential cleavage of certain nucleotide sequences by these nucleases and is not in contradiction to our conclusion that a simple phase relationship does not exist.

Nucleic Acids Res, 1979 Sep 11, 7(1), 239 - 49
alpha 1-Fetoprotein mRNA of rat yolk sac and hepatoma; Chiu JF et al.; Rat alpha 1-fetoprotein mRNA was isolated and purified to apparent homogeneity by means of immunoadsorption and oligo (dT) cellulose affinity chromatography . Purified AFP mRNA migrated as a 21S peak in 2.5% SDS-polyacrylamide gels . The translation product of this mRNA in micrococcal nuclease treated reticulocyte lysate was identified as AFP by specific immunoprecipitation, SDS-gel electrophoresis and tryptic digestion analysis . DNA complimentary to AFP mRNA was synthesized with avian meyloblastosis virus RNA-dependent DNA polymerase . This AFP cDNA was used as a probe to quantitate AFP mRNA in the developing rat liver and to compare the complexity and diversity of AFP mRNA derived from the normal rat liver and Morris hepatoma 7777 . We found that the amount of functional AFP mRNA is decreasing during liver development . There is very little, if any, AFP mRNA in the adult rat liver . A high degree of homology between the AFP mRNA sequences of yolk sac and hepatoma was also found.

J Biol Chem, 1979 Sep 10, 254(17), 8125 - 8
An alternating conformation characterizes the phosphodiester backbone of poly(dA-dT) in solution; Shindo H et al.; A highly homogeneous 145-base-pair fragment of double helical poly(dA-dT) . poly(dA-dT) was obtained by micrococcal nuclease digestion of a semisynthetic chromatin prepared from the nucleosome core histones (H2A, H2B, H3, H4) and the synthetic polydeoxyribonucleotide . In contrast to higher molecular weight alternating copolymers, this fragment displayed two resolved 31P NMR signals, separated by 24 Hz at 10.93 MHz . The two signals were of equal intensity at all temperatures less than the Tm for the fragment . Analyses of the possible origins for the two reasonances leads to the conclusion that the phosphodiester backbone of this DNA contains two distinct phosphorus environments, probably in an alternating array . We suggest that this may indicate the presence of sequence-dependent local variation in the helical structure of DNA in general.

Biochemistry, 1979 Sep 4, 18(18), 3965 - 72
Deoxyribonucleic acid excision repair in chromatin after ultraviolet irradiation of human fibroblasts in culture; Williams JI et al.; We have exposed confluent normal human fibroblasts to ultraviolet (UV) fluences of 5, 14, or 40 J/m2 and monitored the specific activity of post-UV repair synthesis in chromatin with {3H}thymidine pulses . We have shown that under conditions where no semiconservative deoxyribonucleic acid (DNA) synthesis is detectable, the specific activity of repair label in micrococcal nuclease resistant (core particle) DNA is about one-fifth that in bulk DNA at all three UV fluences . On the other hand, the distribution of thymine-containing pyrimidine dimers in bulk and nuclease-resistant regions measured either immediately after irradiation or at later times showed no significant differences; preferential labeling of linker (nuclease-sensitive) DNA during repair synthesis is thus apparently not due to a predominance of UV-induced photoproducts in linker relative to core particle DNA in the nucleosome . Pulse and pulse--chase experiments at 14 or 40 J/m2 with normal human or repair-deficient xeroderma pigmentosum (XP) cells showed that at most 30% of repair label in all these cells shifts from nuclease-sensitive (linker) DNA to nuclease-resistant (core particle) DNA.

Can J Microbiol, 1979 Sep, 25(9), 1027 - 35
DNA base composition, nature of intracellular DNA, morphology, and classification of bacteriophages infecting Micrococcus luteus; Compton SW et al.; Ten bacteriophages infecting Micrococcus luteus have been characterized . All phages contain double-stranded DNA, of 64.3--73.5 mol% guanine plus cytosine (GC) . The DNA of phage N7 has the highest GC content reported for any bacterial virus . No unusual bases have been found . The intracellular replicating DNAs of six phages are covalently closed circular molecules . All 10 phages have isometric, probably icosahedral, heads and long, flexible, noncontractile tails and can be sorted into two morphological groups based on size and presence or absence of a collar . Host-range studies indicate six host-range groups.

Biochem J, 1979 Sep 1, 181(3), 585 - 91
Studies on the high-mobility-group non-histone proteins from hen oviduct; Teng CS et al.; Nuclear high-mobility-group (HMG) proteins were isolated from hen oviduct . These were proteins HMG-1, -2, -3, -14 and -17, which are equivalent to the classification of calf thymus HMG proteins . Hen oviduct proteins HMG-1 and -2 were individually isolated by HCIO4.extraction and CM-Sephadex chromatographic separation . Their mol.wts . were determined as 28 000 and 27 000, respectively . The proteins have a high content of acidic and basic amino acids . The association of proteins HMG-1 and -2 with the genome of hen oviduct nuclei was probed by a limited digestion with nucleases . Hen oviduct nuclei were incubated with deoxyribonuclease I or micrococcal nuclease until 10% of the DNA was digested . The nuclear suspension was centrifuged and the contents of proteins HMG-1 and -2 in the supernatant and sediment fractions were analysed by polyacrylamide-gel electrophoresis . HMG proteins were found to be preferentially released by micrococcal-nuclease digestion rather than by deoxyribonuclease I.

J Clin Pathol, 1979 Sep, 32(9), 951 - 2
Endocarditis due to Micrococcus sedentarius incertae sedis; Old DC et al.; The clinical and bacteriological features of a case of endocarditis are described in which a Gram-positive coccus, presently designated Micrococcus sedentarius incertae sedis, was repeatedly isolated.

J Gerontol, 1979 Sep, 34(5), 672 - 9
Nuclease digestion studies of mouse chromatin as a function of age; Gaubatz J et al.; Chromatin is organized into a repeating structure (nucleosome) made up of proteins and DNA . Micrococcal nuclease and DNAase I have been used to probe this structure in nuclear populations from three tissues (liver, brain and heart) of the inbred mouse strain C57BL at different ages . For those parameters examined in each tissue, chromatin contained essentially the same features of nucleosomal organization, regardless of the age of the mouse . Thus, the rate and extent of nuclease digestion, the size of the DNA repeat unit and nucleosome core are not significantly different as a function of age . However, the accessibility of internucleosomal DNA to micrococcal nuclease, as determined by measuring the DNA size distribution after nuclease cutting, may be partially limited in brain chromatin (but not liver or heart) of older animals . These results indicate that there are no gross, age-related changes in the conformational state or organization of chromatin in these tissues . The results do not exclude smaller alterations in chromatin which might occur with age and which the methodology employed might not be sensitive enough to detect.

Nucleic Acids Res, 1979 Aug 24, 6(12), 3831 - 43
Reverse transcriptase mediated binding of primer tRNA to the viral genome; Araya A et al.; A complex between tRNATrp (beef) and 35 S RNA from avian myeloblastosis virus is obtained when the mixture is preincubated in the presence of reverse transcriptase at 35 degrees C . The tRNA-RNA complex is active in initiating DNA synthesis catalyzed by reverse transcriptase . The interaction of tRNA with reverse transcriptase involves the partial unwinding of the acceptor stem of tRNA, as evidenced by nuclease digestion with RNAase T1 and micrococcal nuclease . When tRNA2Glu (coli), having a high degree of similarity with primer tRNA at the level of the acceptor stem, was used as primer for DNA synthesis, a low but significant level of incorporation was obtained, if the reaction was performed at 35 degrees C, while a high incorporation, similar to the one obtained with tRNATrp was obtained when the annealing between tRNA2Glu and 35 S RNA was performed at 80 degrees C . Our evidences point out to an important role of the viral DNA polymerase in positioning the primer on the RNA genome.

Biochemistry, 1979 Aug 21, 18(17), 3739 - 48
Chromatin fractionation procedure that yields nucleosomes containing near-stoichiometric amounts of high mobility group nonhistone chromosomal proteins; Jackson JB et al.; Initial results of an approach to the isolation of functionally active chromatin are described . Slight digestion of mouse myeloma nuclei at 0 degrees C with micrococcal nuclease, followed by dialysis against near-physiological saline solution containing 1 mM Mg2+, caused release of up to 17% of the nuclear DNA as soluble nucleoproteins . This soluble (S) fraction was relatively depleted in H1 histones and methylated DNA (5-methylcytosine) but highly enriched in RNA, single-stranded DNA, and nonhistone chromosomal proteins, particularly two species of the high mobility group identified as HMG 1 and HMG 2 . The S fraction released most rapidly (6--8% of the total DNA) consisted mainly of mono- and small oligonucleosomes . The mononucleosomes appeared normal in terms of sedimentation behavior, DNA length, and content of histones H2A, H2B, H3, and H4, but lacked H1, and instead were associated with approximately stoichiometric amounts of HMG 1 and HMG 2 . Studies using isolated, fluorescence-labeled, total mouse HMG proteins indicated that added HMG 1 and HMG 2 do not bind strongly to S-fraction nucleoproteins but that two smaller HMG species (probably HMG 14 and HMG 17) do bind preferentially to S-fraction mono- and dinucleosomes . These results argue against artifactual redistribution of HMG 1 and HMG 2 during this fractionation but suggest caution in interpreting the distribution of smaller HMG proteins after digestion of chromatin . The potential relationship of this soluble fraction to transcriptionally active chromatin is discussed.

Biochemistry, 1979 Aug 21, 18(17), 3724 - 32
Nucleosome organization during germ cell development in the sea cucumber Holothuria tubulosa; Cornudella L et al.; Conformational changes that occur in chromatin from developing germ cells of the echinoderm Holothuria tubulosa have been probed with micrococcal nuclease . The results indicate that the extent of DNA degradation to acid-soluble nucleotides is highest in chromatin at the early stages of gonad growth, being drastically subdued in the mature sperm cell . Production of nucleosomal particles also varies with development, involving at least 70% of the chromatin at the final stage of maturation, whereas in immature germ cells it remains much lower . In contrast, electrophoretic analysis for DNA size has shown that the average nucleosome repeat length, about 227 base pairs, does not change throughout the maturation process . However, kinetics of the enzyme reaction have revealed that, although brief digestion of chromatin from both immature gonads and sperm yields comparable series of higher oligomers, extensive digest patterns differ widely . Sperm chromatin, highly protected, releases a 275 base pair intermediate fragment, wholly absent in immature gonads . The 145 base pair core released in both chromatins is not further digested in sperm . In comparison to sperm chromatin, that of immature germ cells is much more susceptible to fragmentation, yielding the usual set of smaller subnucleosomal fragments . These data suggest the induction of differential accessibilities of chromatin DNA with maturation, which is not accompanied by displacement of the histone complement . The histone variants present in this species may well be instrumental in the process.

Biochim Biophys Acta, 1979 Aug 14, 547(2), 230 - 40
Purification and properties of the latent F1-APTase of Micrococcus lysodeikticus; Huberman M et al.; The latent coupling factor (F1)-ATPase of Micrococcus lysodeikticus has been purified to homogeneity as determined by a number of criteria including, nondenaturing polyacrylamide gel electrophoresis, crossed immunoelectrophoresis and analytical ultracentrifugation . By inclusion of 1 mM phenylmethyl sulfonyl fluoride, a serine protease inhibitor, in the shock-wash step of release of F1 from the membranes, the spontaneous activation of both crude and purified ATPase by endogenous membrane protease(s) can be prevented, thereby yielding a highly latent ATPase preparation . Equilibrium ultracentrifugation of the latent ATPase gave a molecular weight of 400 000 . The ATPase contained five different subunits alpha, beta, gamma, delta, and espsilon and their molecular weights determined by SDS-polyacrylamide gel electrophoresis were 60 000, 54 000, 37 000, 27 000 and 9000, respectively . The subunit composition was determined with 14C-labelled, F1-ATPase prepared from cells grown on medium containing {U-14C}-labelled algal protein hydrolysate . Within the limitations of this method the results tentatively suggest a subunit composition of 3 : 3 : 1 : 1 : 3.

J Biol Chem, 1979 Aug 10, 254(15), 7405 - 10
Accessibility of some regions of DNA in chromatin (chicken erythrocytes) to single strand-specific nucleases; Fujimoto M et al.; The susceptibility of the DNA in chromatin to single strand-specific nucleases was examined using nuclease P1, mung bean nuclease, and venom phosphodiesterase . A stage in the reaction exists where the size range of the solubilized products is similar for each of the three nucleases and is nearly independent of incubation time . During this stage, the chromatin fragments sediment in the range of 30 to 100 S and contain duplex DNA ranging from 1 to 10 million daltons . Starting with chromatin depleted of histones H1 and H5 similar fragments are generated . In both cases these nucleoprotein fragments are reduced to nucleosomes and their multimers by micrococcal nuclease . Thus, chromatin contains a limited number of DNA sites which are susceptible to single strand-specific nucleases . These sites occur at intervals of 8 to 80 nucleosomes and are distributed throughout the chromatin . Nucleosome monomers, dimers, or trimers were not observed at any stage of single strand-specific nuclease digestion of nuclei, H1- and H5-depleted chromatin, or micrococcal nuclease-generated oligonucleosomes . Each of the three nucleases converted mononucleosomes (approximately 160 base pairs) to nucleosome cores (approximately 140 base pairs) probably by exonucleolytic action that was facilitated by the prior removal of H1 and H5 . The minichromosome of SV40 is highly resistant to digestion by nuclease P1.

Proc Natl Acad Sci U S A, 1979 Aug, 76(8), 3727 - 31
Isolation of a condensed, intracellular form of the 2-micrometer DNA plasmid of Saccharomyces cerevisiae; Livingston DM et al.; We have initiated an investigation of the proteins bound in vivo to the 2-micrometer DNA plasmid found in the yeast Saccharomyces cerevisiae by examining its intracellular form . To isolate 2-micrometer DNA without disturbing proteins bound to the plasmid, an extract was prepared from a strain lacking mitochondrial DNA and the nuclear chromatin was removed from the extract by centrifugation . When the DNA in this extract was sedimented through a sucrose gradient containing 0.15 M NaCl, plasmid DNA had a sedimentation coefficient of approximately 70 . This S value is greater than the S value of 25 for naked, superhelical 2-micrometer DNA . Cosedimenting with the DNA were proteins of the same size as the histone proteins associated with yeast nuclear chromatin . Digestion of the plasmid DNA with micrococcal nuclease and electrophoresis of the resulting DNA fragments revealed that segments of discrete sizes are protected from degradation . Examination of the plasmid DNA protein complex by electron microscopy showed nucleosome structures . We conclude that 2-micron DNA exists as a condensed chromosome body within the cell.

Proc Natl Acad Sci U S A, 1979 Aug, 76(8), 3779 - 83
Nicking-closing enzyme assembles nucleosome-like structures in vitro; Germond JE et al.; The four core histones (H2A, H2B, H3, and H4) and DNA were assembled into nucleosome-like particles at physiological ionic strengths either by an extract of chromatin rich in nicking-closing activity or by the purified nicking-closing enzyme itself . When histone-DNA complexes were assembled in vitro from relaxed circular DNA, nearly physiological numbers of superhelical turns were induced in the DNA molecule . Electron microscopy of the complexes assembled by the chromatin extract revealed a beaded structure and a reduction of the contour length compared to free DNA . Micrococcal nuclease digestion of the histone-DNA complexes yielded 145-base-pair DNA fragments typical of nucleosome core particles and shorter subnucleosomal DNA fragments of discrete length.

Z Naturforsch {C}, 1979 Aug, 34(7-8), 565 - 9
{gamma-Irradiated ribosomes from Micrococcus radiodurans in a cell-free protein synthesizing system (author's transl)}; Sussmuth R et al.; gamma-irradiation inactivation of isolated ribosomes of Micrococcus radiodurans was studied by examining poly U directed synthesis of polyphenylalanine . Ribosomes of M . radiodurans did not show significant gamma-radiation sensitivity up to a dose of approx . 11.6 k Gy . Cells of M . radiodurans take up more magnesium than E . coli cells unter the same conditions . The magnesium content of ribosomes of M . radiodurans was 18% higher than that of E . coli ribosomes . A possible relation between Mg2+-content and gamma-resistance is discussed.

Biochim Biophys Acta, 1979 Jul 26, 563(2), 375 - 84
Actions of human DNA glycosylases on uracil-containing DNA, methylated DNA and their reconstituted chromatins; Ishiwata K et al.; Extracts of human lymphoblastoid cells catalyzed complete release of uracil (Ura) from PBS1 DNA, which contains Ura instead of thymine as a normal component (Ura-DNA), and 3-methyladenine (3-MeAde) from DNA methylated with methyl methanesulfonate (Me-DNA) . These two activities, Ura-DNA glycosylase and 3-MeAde-DNA glycosylase, differed in heat stability . Cell extracts released Ura more rapidly and 3-MeAde more slowly from alkali-denatured preparations of Ura- and Me-DNA, respectively, than from native DNA's . On incubation with reconstituted chromatins, prepared from Ura-DNA and Me-DNA, respectively, with calf thymus chromosomal protein by salt gradient dialysis, cell extracts released all the Ura but only about half of the 3-MeAde residues, although both these chromatins were degraded by micrococcal nuclease until about half of the nucleotides became acid soluble . The activities of Ura-DNA and 3-MeAde-DNA glycosylase of xeroderma pigmentosum cells were similar to those of normal cells.

J Biochem (Tokyo), 1979 Jul, 86(1), 97 - 104
Substrate specificity and reaction mechanism of putrescine oxidase; Okada M et al.; Putrescine oxidase {EC 1.4.3.4} of Micrococcus rubens oxidizes many kinds of synthetic polyamines: triamines (spermidine types), tetramines (spermine types), and N-substituted putrescines . Polyamines possessing terminal 4-aminobutylimino groups in their structures were more active as substrates . Putreanine was oxidized at a rate comparable to that of putrescine, and was converted to 1-pyrroline and beta=alanine . Activities and Km values for polyamines were affected by the substituent attached to the 4-aminobutylimino group of the polyamine, and especially by its methylene chain length . It was also found that two types of oxidation occurred in the oxidation of polyamines by putrescine oxidase . When the moieties attached to the 4-aminobutylimino groups in polyamines were less hydrophobic, these polyamines were oxidized at the secondary amino groups to form 1-pyrroline . Polyamines which contained a hydrophobic substituent attached to the 4-aminobutylimino moiety to form ammonia . N,N'-Bis (4-aminobutyl)-1,3-diaminopropane ({II, 4-3-4}) and N-(4-aminobutyl)-N'-(3-aminopropyl)-1,3-diaminopropane ({II, 4-3-3}) were oxidized to form 1-pyrrolinium salt derivatives as a result of oxidation of the terminal primary amino groups . It was concluded that the essential structure for substrates of putrescine oxidase is a 4-aminobutylimino group (NH2(CH2)4NH-).

Eur J Biochem, 1979 Jul, 97(2), 425 - 33
The excision of N-methyl-N-nitrosourea-induced lesions from the DNA of Chinese hamster cells as measured by the loss of sites sensitive to an enzyme extract that excises 3-methylpurines but not O6-methylguanine; Shackleton J et al.; An enzyme extract from Micrococcus luteus excises 3-methyladenine and 3-methylguanine but not O6-methylguanine, 7-methylguanine, 1-methyladenine or 7-methyladenine from DNA reacted with N-methyl-N-nitrosourea . The extract was used to detect lesions in the DNA of Chinese hamster cells treated in culture with N-methyl-N-nitrosourea . It was concluded that 3-methyladenine is excised from these cells with a half-life of about 2.3 h.

Proc Natl Acad Sci U S A, 1979 Jul, 76(7), 3284 - 8
In vitro core particle and nucleosome assembly at physiological ionic strength; Ruiz-Carrillo A et al.; Nucleosome core particles have been efficiently assembled in vitro by direct interaction of histones and DNA at physiological ionic strength, as assayed by digestion with DNases, supercoiling of relaxed circular DNA, and electron microscopy . Reconstitution was achieved either by the simultaneous addition of all core histones, or by the sequential binding of H3 . H4 tetramer and H2A . H2B dimer to DNA . Micrococcal nuclease digestion and electron microscopy studies indicated that there is heterogeneity in the spacings at which core particles are assembly on the DNA . Length measurements of oligomeric DNA produced during the course of the digestion suggest that the core histone octamer can organize 167 (+/- 4) rather than 145 base pairs of DNA, the extra 20 base pairs being quickly digested . Binding of histone H1 to core particles resulted in the protection of about 165 base pairs of DNA from nuclease attack . Because the core histone octamer is fully dissociated into H3 . H4 tetramer and H2A . H2B dimer at physiological ionic strength, our results would suggest that in vivo core particle assembly may also occur by interaction of these two complexes on the nascent DNA.

Mikrobiologiia, 1979 Jul-Aug, 48(4), 699 - 704
{Lysis of Micrococcus lysodeikticus protoplasts by gramicidin S derivatives}; Polin AN et al.; Gramicidin S derivatives with the substituted amino groups of ornithines (carbamoylgramicidin and diacetylgramicidin) possess nearly the same level of the lytic activity when acting on Micrococcus lysodeikticus protoplasts in a 1 M sucrose solution as the original antibiotic . The lytic activity of gramicidin S and these derivatives considerably increases in a solution of sucrose in phosphate buffer . The dependence of the lytic activity of gramicidin on its concentration is of a complex character: two "peaks" of activity and a region of "nonlyzing" concentrations . The lytic activity of gramicidin derivatives with substituted amino groups directly depends on the concentration . When gramicidin S acts upon the intact cells of M . lysodeikticus, it impair with the permeability of their membranes and causes a loss of compounds absorbing at 260 nm; the derivatives with the substituted amino groups change the permeability of the cellular membranes only to a slight extent.

Appl Environ Microbiol, 1979 Jul, 38(1), 35 - 8
Biochemical properties of penicillin amidohydrolase from Micrococcus luteus; Nam DH et al.; Some biochemical properties of whole-cell penicillin amidohydrolase from Micrococcus luteus have been studied . This whole-cell enzyme showed its maximal activity at 36 degrees C at pH 7.5 . It was found that the activation energy of this enzyme was 8.03 kcal (ca . 33.6 kJ) per mol, and this amidohydrolase showed first-order decay at 36 degrees C . The penicillin amidohydrolase was deactivated rapidly at temperatures above 50 degrees C during storage or preincubation for 24 h . The Michaelis constant, Km, for penicillin G was determined as 2.26 mM, and the substrate inhibition constant, Kis, was 155 mM . The whole-cell penicillin amidohydrolase from M . luteus was capable of hydrolyzing penicillin G, penicillin V, ampicillin, and cephalexin, but not cephalosporin C and cloxacillin . This whole-cell enzyme also had synthetic activity for semisynthetic penicillins or cephalosporins from D-(--)-alpha-phenylglycine methyl ester and 6-alpha-aminopenicillanic acid or 7-amino-3-deacetoxycephalosporanic acid.

Nucleic Acids Res, 1979 Jun 25, 6(8), 2929 - 45
Cations and the accessibility of chromatin to nucleases; Billett MA et al.; When rat liver nuclei prepared with polyamines as stabilising cations are digested with DNAase II, release of both inactive chromatin and Mg-soluble, active chromatin is greatly reduced, in comparison to digestion of liver nuclei prepared with Mg2+ as stabilising cation . Chromatin release from polyamine stabilised nuclei is also inhibited relative to Mg-stabilised nuclei following digestion with micrococcal nuclease under two very different cation conditions . Nuclei prepared with polyamines and monovalent ions as stabilising cations exhibit properties intermediate between these two extremes with both nucleases . These effects are due to residual binding of polyamines to chromatin, which is thus maintained in a condensed state, inaccessible to nucleases . Since polyamine binding is not easily reversed, concentrations of polyamines and other cations must be rigidly controlled in experiments on chromatin structure if artefacts are to be avoided . The significance of these findings to the nature and properties of active chromatin within the intact nucleus is considered.

Nucleic Acids Res, 1979 Jun 25, 6(8), 2769 - 85
Parental adenovirus DNA accumulates in nucleosome-like structures in infected cells; Tate VE et al.; Micrococcal-nuclease digestion of adenovirus 2(ad 2) infected HeLa cell nuclei early after infection has been used to investigate the nucleoprotein nature of parental viral DNA . Viral DNA is more susceptible to nuclease digestion than cellular DNA . The pattern of digestion products changes as digestion proceeds from an indistinct pattern 1 hour post infection(pi) to a nucleosome-like pattern at 6 hours pi . The major differences between viral and cellular nucleoprotein products were i) a subnucleosome fraction from viral DNA and ii) the repeat size of DNA in viral nucleosomes was 165 base pairs and in cellular nucleosomes, 195 base pairs . Up to 50% viral DNA in nuclei 6 hours pi seems to be in nucleosome-like structures . Such patterns are not seen on digestion of partially-uncoated virus or isolated cores.

J Biol Chem, 1979 Jun 25, 254(12), 5328 - 32
Purification and characterization of phiX174 gene A protein . A multifunctional enzyme of duplex DNA replication; Eisenberg S et al.; Synthesis of phiX174 viral (+) strand circles in vitro requires gene A protein, rep protein, DNA binding protein, and DNA polymerase III holoenzyme (Eisenberg, S., Scott, J . F., and Kornberg, A., (1976) Proc . Natl . Acad . Sci . U.S.A . 73, 3151-3155) . We have used this reaction as an assay to isolate gene A protein in greater than 90% purity . Its molecular weight under denaturing conditions is 59,000 . The protein tends to aggregate and lose activity at low ionic strength . Tritium-labeled gene A protein cleaves the phiX174 duplex replicative form and is bound to it in a 1:1 ratio as part of an active replication complex . The attachment, at the 5' phosphoryl end of the cleavage point, is apparently covalent . The complex was not dissociated by: (i) banding in CsCl, (ii) treatment with 0.2 M NaOH, or (iii) boiling in 1% sodium dodecyl sulfate and electrophoresis on a sodium dodecyl sulfate-acrylamide gel; only micrococcal nuclease digestion of the DNA released the protein.

J Biol Chem, 1979 Jun 25, 254(12), 5527 - 34
Construction and mapping of recombinant plasmids used for the preparation of DNA fragments containing the Escherichia coli lactose operator and promoter; Hardies SC et al.; Three DNA restriction fragments of established sequence containing the Escherichia coli lac genetic controlling regions were cloned . In each case a recombinant plasmid was constructed which was suitable for the subsequent large scale purification of the lac fragment . A 789-base pair HindII fragment, containing the lac operator, promoter, and cyclic AMP receptor protein binding site, was ligated into the single HindII site of the amplifiable plasmid minicolicin E1 DNA (pVH51) . A 203-base pair Hae III fragment containing the same genetic sites was ligated into the single Eco RI site of pVH51 which had been "filled in" by the Micrococcus luteus DNA polymerase . Thus, the lac fragment was inserted between two Eco RI sites . Plasmids containing multiple copies of this Eco RI fragment were then constructed . A 95-base pair Alu I fragment containing the lac promoter and operator was cloned similarly . Also, the 203-base pair fragment was cloned into the Eco RI site of pVH51 using a 300-base pair linker fragment (isolated by RPC-5 column chromatography) which permitted retention of its Hae III ends . Mapping studies on pVH51 DNA with a number of DNA restriction endonucleases, including Alu I, Taq I, and Hpa II, are described.

Eur J Biochem, 1979 Jun, 97(1), 147 - 53
The kinetics of ATP-dependent exonuclease V from Micrococcus lysodeikticus . A Michaelian dependence on DNA concentration; Palitti F et al.; The ATP-dependent exonuclease V from Micrococcus lysodekticus shows a Michaelian relation between steady-state velocity and the concentration of T7 DNA substrate . The Km (expressed as a mass concentration) does not change when the T7 DNA is broken into smaller fragments by a restriction enzyme . This is interpreted to mean that the predominant process by which the exonuclease-V--DNA complex breaks down is digestion of the entire DNA molecule rather than physical dissociation, in accord with the already known processive nature of degradation by this enzyme . The way that the V and Km towards DNA vary with ATP and ADP concentration suggests that enzyme-DNA complex is predominantly formed by reaction of DNA with an enzyme-ATP complex rather than with bare enzyme.

Can J Biochem, 1979 Jun, 57(6), 666 - 72
Identification of nonhistone chromatin proteins in chromatin subunits (or mononucleosomes) devoid of histone H1; Chan PK et al.; Rat liver chromatin was digested by micrococcal nuclease . Chromatin subunits (or mononucleosomes) were isolated by sucrose density gradient and subsequently fractionated by 6% polyacrylamide gel electrophoresis into two major components . One component (MN1) of the mononucleosomes had a higher mobility, contained histones H2A, H2B, H3, H4, and shorter DNA fragments (140 base pairs) while the other (MN2) contained all five histones and longer DNA fragments (180 base pairs) . Both submononucleosomes (MN1 and MN2) were found to contain nonhistone chromatin proteins (NHCP) . By electrophoresis in 15% sodium dodecyl sulfate-polyacrylamide gel, 9 and 11 major fractions of NHCP were identified in the submononucleosomes MN1 and MN2, respectively . It was also observed that treatment of mononucleosomes with 0.6 M NaCl removes most of these NHCP and histone H1 except for two major NHCP which remain in the core particles.

Cell Differ, 1979 Jun, 8(3), 203 - 10
DNAase hydrolysis of chromatin DNA in intact sea urchin sperm cells . Effect of the ionic strength on the digestion parameters; Geraci G et al.; Chromatin DNA in intact functional Sphaerechinus granularis sperm cells has been digested with micrococcal nuclease at three different ionic strength conditions . The results show a highly-flexible chromatin organization similar to that found in sperm heads . The rate of digestion, the limit value of acid-soluble material and the fragmentation pattern show that the sensitivity of nucleosome and internucleosome DNA regions to nuclease hydrolysis depends on a delicate balance of polar and non polar interactions . At low ionic strength, both nucleosome and internucleosome regions are rapidly and completely hydrolysed at the same time and a transient subunit fragment of 120 b.p . average length is formed . At high ionic strength, internucleosome regions are preferentially hydrolysed; there is a limit digest value and a stable subunit fragment of 140 b.p . average length is formed . A supernucleosome organization in the high ionic strength environment of the sperm cells is suggested by the transient preferential formation of heptamers of nucleosome DNA fragments.

Eur J Biochem, 1979 Jun, 97(1), 133 - 9
Two chromatin fractions with different metabolic properties of non-histone proteins and of newly synthesized RNA; Djondjurov L et al.; Digestion of chromatin with micrococcal nuclease under mild conditions results in the release of a minor chromatin fraction showing an increased RNA and non-histone protein content, a fast turnover of the non-histone proteins and the presence of rapidly labelled heterogeneous nuclear RNA (hnRNA) with half-life of about 20 min . Further digestion of the chromatin leads to the elimination of about 19% of the initial chromosomal DNA, thus leaving a second chromatin fraction relatively resistant to nuclease attack . This fraction has a low protein and RNA content and contains only metabolically stable non-histone proteins . No differences in the histone complement of the two fractions was found except for a 40% deficiency of H1 in the minor fraction.

Eur J Biochem, 1979 Jun 1, 96(3), 477 - 82
Biochemical properties and localization of the chromosomal protein IP25; Keppel F et al.; The protein IP25, which has previously been reported to accumulate in the chromatin during erythroid differentiation of Friend-virus-transformed erythroleukemia cells (FL cells), is shown to behave like histone H1 without being structurally related to it . Like H1, IP25 is not released by digestion of FL cells nuclei with DNAse I . After micrococcal digestion IP25 and H1 are differentially distributed in the nucleosome monomers and dimers . This distribution suggests an internucleosomal location for IP25 and H1 . Different rates of digestion are observed between nuclei of differentiating and non-differentiating FL cells with both DNAse I and micrococcal nuclease . These differences could be due to the presence of IP25 in the chromatin of differentiating cells.

Biokhimiia, 1979 Jun, 44(6), 1036 - 40
{Heterogeneity in organization of lipids in the bacterial membrane}; Kulikov VI et al.; The lipids of Micrococcus lysodeikticus membranes were 50%-substituted by phosphatidyl choline using lipid-exchanging proteins isolated from rat liver . The incorporation of phosphatidyl choline into the membrane did not significantly change the malate dehydrogenase activity and the temperature dependence activity in the Arrhenius plots for the enzyme . Gramicidin S--modifier of membrane lipids--had similar effects both on the intact membranes and on the phosphatidyl-enriched membranes . A conclusion is made on structural heterogeneity of the bacterial membrane and on the presence of a boundary lipid fraction, which controls the functioning of malate dehydrogenase and is characterized by a low-rate exchange with other lipids.

J Biol Chem, 1979 May 25, 254(10), 3947 - 52
Binding of androgen receptor to prostatic chromatin requires intact linker DNA; Rennie PS; Receptor-chromatin complexes were recovered from prostatic chromatin digested with micrococcal nuclease . The fragments of chromatin were separated on linear 7.6 to 76% (v/v) glycerol density gradients . With extensive digestion of DNA, receptor labeled with {1,2-3H}dihydrotestosterone was released from the chromatin . After 5% digestion of DNA to acid-soluble products, only a trace amount of labeled receptor was detected in the unbound form . In the latter instance, most of the labeled receptor was recovered from the gradients in association with five A260 peaks representing oligomeric and monomeric nucleosomes with a repeat length of 182 +/- 14 (mean +/- S.D.) base pairs . The concentration of receptors was highest in the A260 peaks, which contained large oligomers of nucleosomes, and lowest in fractions containing primarily monomer structures . Hence, the extent to which receptors remained bound to chromatin was dependent on the relative amount of intact, linker DNA present.

J Biol Chem, 1979 May 25, 254(10), 3965 - 9
The preparation and characterization of a cell-free system from Saccharomyces cerevisiae that translates natural messenger ribonucleic acid; Gasior E et al.; A cell-free protein-synthesizing system has been prepared from Saccharomyces cerevisiae by differential centrifugation of lysed spheroplasts . The preparation, a modified 100,000 x g supernatant fraction, contains ribosomes and monosomes, ribosomal subunits, translation factors, and aminoacyl-tRNA synthetases, but no polysomes . After removal of small amounts of remaining mRNA with micrococcal nuclease, protein synthesis is stringently dependent on the addition of mRNA, as well as amino acids and an energy-generating system . The 5'-cap analogue, 7-methylguanosine 5'-phosphate, inhibits translation of several natural mRNAs, but has no effect on chain elongation . Incubation of the polysome-free extract with natural mRNA leads to the formation of protein-synthesizing polysomes and eventually, to the release of protein; the molecular weight of the protein synthesized in the presence of BMV (brome mosaic virus) RNA is consistent with that of BMV coat protein.

Biochim Biophys Acta, 1979 May 3, 553(1), 40 - 53
Solubility characteristics of Micrococcus lysodeikticus membrane components in detergents and chaotropic salts analyzed by immunoelectrophoresis; Collins ML et al.; In order to evalute the effectiveness and selectivity of various reagents in the solubilization of bacterial membranes, membranes of Micrococcus lysodeikticus were treated with detergents and chaotropic agents . The composition of the extracts so obtained was analyzed by rocket and two-dimensional immunoelectrophoretic techniques . Recoveery of succinate-, malate-, and reduced nicotinamide adenine dinucleotide- (NADH) dehydrogenases, ATPase, succinylated lipomannan and cytochromes in the extracts was measured . Treatment with a variety of non-denaturing detergents produced extracts that were generally qualitatively uniform although quantitative differences were observed . The degree of extraction of various components was correlated with the hydrophile-lipophile balance . Several chaotropic agents were also evaluated as reagents for membrane solubilization . These agents were less effective in extraction of bulk protein, but produced extracts enriched in some membrane components.

Biochem J, 1979 May 1, 179(2), 291 - 8
The variation with age of the structure of chromatin in three cell types from rat liver; Zongza V et al.; The organization of chromatin in three rat liver nuclear populations, namely diploid stromal, diploid parenchymal, and tetraploid parenchymal nuclei, which were separated by zonal centrifugation, was studied by digestion with micrococcal nuclease and pancreatic deoxyribonuclease in 3-week-old rats in which the parenchymal cells contain diploid nuclei and in 2-and 4-month-old rats with a high proportion of tetraploid nuclei . Digestion by micrococcal nuclease allowed the estimation of DNA-repeat length in chromatin . Parenchymal nuclei have shorter repeat length than stromal nuclei and DNA-repeat length increases with the age in all three nuclei populations . The kinetics of digestion by micrococcal nuclease showed that nuclei with shorter repeat length are more sensitive to micrococcal nuclease and that the sensitivity of chromatin decreases with age for all the types of nuclei in this study . The kinetics of digestion by pancreatic deoxyribonuclease showed that sensitivity of chromatin is related to the repeat length and that the sensitivity decreases with the ages.

Biokhimiia, 1979 May, 44(5), 811 - 5
{Bacterial membrane proteins . Properties of Micrococcus lysodeikticus NADH dehydrogenase}; Zhukova IG et al.; NADH dehydrogenase was isolated from M . lysodeikticus membranes with FAD as a prosthetic group . It was found the enzyme molecular weight is about 140000 in 0,01 M phosphate buffer, pH 7,4 in 1% Triton X-100 . The enzyme molecules are dimers consisting of two subunits with molecular weight of 70000 . The content of alpha-helical regions is 30%, that of beta-forms is 13% . The protein globule is cross-linked with the disulfide bonds and has hydrophobic regions on its surface.

Fed Proc, 1979 May, 38(6), 1973 - 8
The structural organization of mouse chromatin as a function of age; Gaubatz J et al.; Chromatin is organized into a repeating structure (nucleosome) made up of proteins and DNA . Micrococcal nuclease and DNAase I have been used to probe this structure in nuclear populations from three tissues (liver, brain, and heart) of the inbred mouse strain C57BL at different ages . For those parameters examined, for each tissue, chromatin contained essentially the same features of nucleosomal organization, regardless of the age of the mouse . Thus, the rate and extent of nuclease digestion and the size of the DNA repeat unit and nucleosome core are not significantly different as a function of age . However, the accessibility of internucleosomal DNA to micrococcal nuclease, as determined by measuring the DNA size distribution after nuclease cutting, may be partially limited in chromatin of brain (but not liver or heart) of older animals . These results indicate that there are no gross, age-related changes in the conformational state or organization of chromatin in these tissues . The results do not exclude smaller alterations in chromatin that might occur with age, which the current methodology might not be sensitive enough to detect.

Zentralbl Bakteriol {B}, 1979 May, 168(3-4), 377 - 85
Micrococcaceae isolated from meat and dairy products (taxonomic study); Delarras C et al.; 149 Micrococcaceae strains (35 reference strains and 114 strains isolated from meat and dairy products) have been studied using 61 biochemical microtests . Numerical taxonomy has distinguished two main biochemical groups which may be characterized by their varying ability to use heteroside compounds . -- A small number of biochemical tests in each group enable the differentiation of 17 taxa corresponding to diverse origins . The wild strains of Micrococcaceae found in foods are very different from reference strains in collections . -- With regard to the present study, it seems that a central biotype exists which may be represented by the taxa 13, 14, 15 and 16 in Fig . 1 . -- Given this central biotype, various biochemical differences may be considered as ecological adaptability . Group I corresponds to meat orgin -- Taxa No . 1, 2, correspond to collection strains -- Taxon No . 12 corresponds to cheese origin -- Taxa No . 8, 9 and 10 correspond to milk origin.

J Biol Chem, 1979 Apr 25, 254(8), 3074 - 83
Overall pathway of mononucleosome production; Todd RD et al.; Five electrophoretically distinguishable classes of mononucleosomes (MI, MII, ...MV) are produced upon treatment of mammalian nuclear chromatin with micrococcal nuclease . These five forms differ in their initial DNA lengths, relative mass proportions, stability, contents of histone H1, and presence of certain nonhistone proteins . A new "chromatin fingerprinting" technique has been developed in order to trace nuclease-mediated interconversions between these mononucleosomes and their polynucleosomal precursors . Application of this technique, together with earlier findings from this laboratory, has made possible the elucidation of the overall pathway of nuclease cleavage of chromatin which leads to the production and interconversion of these mononucleosomes, and has permitted reconstruction of the organization of these mononucleosomes in undigested chromatin...

Biochemistry, 1979 Apr 17, 18(8), 1588 - 94
Cell-free protein synthesis in lysates of Drosophila melanogaster cells; Scott MP et al.; A procedure is described for preparing cell-free protein synthesizing lysates from Drosophila melanogaster tissue culture cells and embryos . Preparation of translationally active lysates from tissue culture cells is dependent on the presence of rat liver supernatant during cell lysis to inhibit ribonuclease activity . After micrococcal nuclease treatment of the lysate, protein synthesis is dependent on the addition of exogenous messenger RNA . The fidelity of translation is very high . The conditions for optimal translation have been determined . In addition, the effects on translation of a variety of supplements, including rat liver supernatant, have been analyzed . The products of translation by the Drosophila lysate have been compared with those of wheat germ extracts and of micrococcal nuclease treated rabbit reticulocyte lysates . Translation in vitro of bovine parathyroid hormone messenger RNA yielded two products tentatively identified as preproparathyroid hormone and proparathyroid hormone, as well as an unidentified third product . This result suggests that insect enzymes can accurately process mammalian precursor proteins.

Cell, 1979 Apr, 16(4), 807 - 14
The chromatin structure of specific genes: II . Disruption of chromatin structure during gene activity; Wu C et al.; We have compared the chromatin structure in the active and inactive states at loci encoding the major heat shock protein in Drosophila . DNAase I and micrococcal nuclease were used as probes of higher order organization and nucleosomal integrity . Such integrity is gauged here by the characteristic pattern of discrete DNA fragments produced at specific chromosomal loci by nucleolytic cleavage . The specific fragment patterns are visualized by gel electrophoresis, Southern blotting onto nitrocellulose sheets, hybridization with 32P-labeled cloned DNA containing the heat shock genes and autoradiography . Using this criterion, a disruption in nucleosomal and possibly in higher order organization are observed as indicated by a relative loss or smearing of the characteristic discrete DNA fragment patterns from the heat shock loci in the active state . The fragment patterns are restored when cells are allowed to recover from heat shock and these loci return to the inactive state.

Biull Eksp Biol Med, 1979 Apr, 87(4), 308 - 11
{Multiple forms of DNA-ase activity in the nuclei of spleen lymphocytes}; Kharchenko EP; The nuclei of spleen lymphocytes showed nuclease activity becoming manifest under conditions optimal for different types of DNA-ase (DNA-ase I, DNA-ase II, micrococcal nuclease and Ca, Mg-dependent endonuclease) . No diversity of nuclease activity was found in the liver or kidney nuclei . A high nuclease activity in the lymphocyte nuclei provides for a deeper endonucleolysis of the lymphocyte chromatin as compared to that in the liver nuclei . The variety of nucleic activity and more advanced chromatin endonucleolysis in the spleen lymphocyte nuclei may be associated with rapid cell renewal of the lymphocyte pool in lymphoid organs and with necessity for autolysis of degraded lymphocyte genome . It may also ensure the somatomutagenic mechanism of diverse V-genes and of V- and C-gene combination.

Biokhimiia, 1979 Apr, 44(4), 729 - 37
{Cytochrome b556 complexes solubilized from Micrococcus lysodeikticus membranes by triton X-100}; Turgenbaeva DA et al.; The integral protein of cytochrome b556 after its solubilization with Triton X-100 from M . lysodeikticus membranes was studied . The cytochrome was found in complexes differing in charge and size during preparative gel electrophoresis and centrifugation in a sucrose concentration gradient . Cytochrome b556, being in complexes, retains its ability to be reduced by NADH dehydrogenase . The electron micrographs of the membranes after solubilization by Triton X-100 demonstrated the maintenance of the membrane structure . It is concluded that native protein complexes marked with cytochrome b556 are extracted from the membranes under their solubilization.

Proc Natl Acad Sci U S A, 1979 Apr, 76(4), 1682 - 6
Limited action of micrococcal nuclease on trout testis nuclei generates two mononucleosome subsets enriched in transcribed DNA sequences; Levy-Wilson B et al.; Hybridization experiments show that DNA extracted from two distinct subsets of mononucleosomes (MNI and MN2) generated by a limited action of micrococcal nuclease on trout testis nuclei is enriched approximately 7-fold in sequences that are transcribed into cytoplasmic polyadenylated RNA in trout testis cells . Both subsets of mononucleosomes contain eight core histones, but MNI also possesses one or two molecules of a small, basic, high-mobility-group (HMG) protein H6 {Levy W., B., Connor, W . & Dixon, G . H . (1979) J . Biol . Chem . 254, 609-620}, bound to a DNA fragment of 140 base pairs . In contrast, MN2 contains 1 molecule of H1 but no H6, and its DNA length is somewhat longer at 140-190 base pairs . The preferential release of these two subsets of mononucleosomes is correlated with the presence of a second larger HMG protein, HMG-T, in the linker regions flanking both types of mononucleosomes . The HMG-T-containing linker regions appear to be considerably more susceptible to attack by micrococcal nuclease than H1-containing linkers . Cross-reassociation reactions between the DNA from MN1 and MN2 subsets indicate that they share a significant extent of sequence overlap but also that each subset contains specific sequences that are absent in the other subset.

Cancer Res, 1979 Apr, 39(4), 1411 - 7
Nitrosourea interaction with chromatin and effect on poly(adenosine diphosphate ribose) polymerase activity; Sudhakar S et al.; Poly(adenosine diphosphate ribose) polymerase, a chromatin-bound enzyme, was stimulated 150 to 200% after treatment of HeLa cells with methylnitrosourea (MNU) . In contrast, a slight inhibitory effect on enzyme activity was observed after treatment of cells with various concentrations of chloroethylnitrosoureas . To define precisely the differential effects of nitrosoureas on the enzyme activity, their interactions with chromatin substructure were studied . A nonrandom, in vivo alkylation of chromatin DNA by equimolar concentrations of MNU and 1-(2-chloroethyl)-3-cyclohexyl-1-nitrosourea (CCNU) was revealed by digestion of nuclei from drug-treated cells with micrococcal nuclease and DNase I . {methyl-14C}MNU interacted preferentially with the more accessible regions of chromatin, the internucleosome linkers, whereas, the {chloroethyl-14C}CCNU alkylated the nucleosomal core DNA to a greater extent . These two drugs also differed in their extent of covalent modification of histone and nonhistone chromosomal protein . The binding of MNU to histones was greater than of CCNU . CCNU mainly affected nonhistone proteins . This difference in the reactivity of methyl and chloroethyl nitrosoureas with chromatin may relate to their differential effect on poly(adenosine diphosphate ribose) polymerase activity, as well as to their carcinogenic and antitumor properties.

Proc Natl Acad Sci U S A, 1979 Apr, 76(4), 1628 - 32
Nucleosome periodicity in HeLa cell chromatin as probed by micrococcal nuclease; Butt TR et al.; When HeLa cell nuclei were treated with micrococcal nuclease (nucleate 3-oligonucleotidohydrolase, EC 3.1.4.7), lysed, and centrifuged, the supernatant from early digests contained two predominant classes of polynucleosomes of repeat size 8N and 16N . With increasing digestion time, the 16 N polynucleosome appeared to be cleaved to the 8N species and finally to the basic subunit of chromatin . The size of the polynucleosomes has been determined by DNA analysis and on polyacrylamide electrophoretic gels of native chromatin particles . The 16N polynucleosome appears to be a unique higher ordered structural component of HeLa cell chromatin . Our recent report, showing that the nuclear protein-modifying enzyme poly(ADP-ribose) polymerase increases in specific activity progressively with increasing nucleosome repeat size up to 8-10N, has been extended in the present study . Activity was also elevated in the polynucleosomes of the 16N structure preferentially cleaved by micrococcal nuclease, although specific activity of the enzyme was highest in octanucleosomes . Acceptors for poly(ADP-ribose) have also been determined in these particles.

Biochemistry, 1979 Mar 20, 18(6), 1068 - 74
DNA sequence directs placement of histone cores on restriction fragments during nucleosome formation; Chao MV et al.; Restriction fragments, 203 and 144 base pairs in length, bearing the Escherichia coli lac control region have been reconstituted with the core histones from calf thymus to form nucleosomes . By several criteria the reconstituted nucleosomes are similar to native nucleosomes obtained by micrococcal nuclease digestion of calf thymus nuclei . However, sensitive nuclease digestion studies reveal subtle and important differences between native monosomes and the lac reconstitutes . Each reconstitute consists mainly of nucleosomes containing histone cores placed nonrandomly with respect to the DNA sequence . The shorter reconstitute forms asymmetric nucleosomes as evidenced by the DNase I digestion pattern . Exonuclease III digestion followed by 5'-end analysis of the larger reconstitute suggests that, of the many possible arrangements of histone core with DNA sequence, only two are highly favored.

Biochemistry, 1979 Mar 20, 18(6), 983 - 90
Nuclear protein modification and chromatin substructure . 3 . Relationship between poly(adenosine diphosphate) ribosylation and different functional forms of chromatin; Jump DB et al.; The relationship between poly(adenosine diphosphate) ribosylation of nuclear proteins and functionally different forms of chromatin from mid-S-phase HeLa nuclei was investigated . The major observations emerging from this study were that unique nonhistone proteins were modified in mid-S-phase HeLa nuclei . The major acceptor for poly(adenosine diphosphate-ribose) {poly(ADP-Rib)} was an internucleosomal nonhistone protein (protein C; 125 000 molecular weight) . Histones H3, H1, H2b, and H2a but not H4 were ADP-ribosylated in S-phase nuclei . Chromatin fragments preferentially released by micrococcal nuclease were enriched in nonhistone proteins, poly(ADP)-ribosylated nuclear proteins, poly(ADP-Rib) polymerase activity and nascent DNA from the DNA replicating fork . In extended forms of chromatin, contiguous to the DNA replicating fork, poly(ADP-Rib) polymerase was maximally active . However, in chromatin distal to the replicating fork (i.e., more condensed structures), nucleosomal histones and histone H1 were not significantly ADP-ribosylated, and poly(ADP-Rib) polymerase activity was depressed two- to threefold . The data suggest that a subset of nucleosomes in extended regions of chromatin is subject to extensive ADP ribosylation.

J Virol, 1979 Mar, 29(3), 888 - 98
Nucleosome-like structural subunits of intranuclear parental adenovirus type 2 DNA; Sergeant A et al.; The intranuclear structure of parental adenovirus 2 DNA was studied using digestion with micrococcal nuclease as a probe . When cultures were infected with 32P-labeled virions, at a multiplicity of 3,000 particles per cell, 14 to 21% of parental DNA penetrated the cell and reached the nucleus . Of this parental DNA, 60% could be solubilized by extensive digestion with micrococcal nuclease . The nuclease-resistant fraction contained viral deoxyribonucleoprotein monomers and oligomers . These nucleosome-like structures contained DNA fragments which are integral multiples of a unit-length DNA of approximately 185 base pairs . The monomeric DNA is similar in length to the unit-length DNA contained in cellular nucleosomes . However, the viral oligomers are slightly smaller than their cellular counterparts . DNA-DNA hybridization demonstrated that all segments of the viral genome, including those expressed as mRNA only at late times, are represented in the nucleosomal viral DNA . The amount of early intranuclear viral chromatin was proportional to multiplicity of infection up to multiplicities of 4,000 particles per cell . However, viral transcriptional activity did not increase in direct proportion to the amount of viral chromatin . Maximum accumulation of intranuclear viral chromatin was achieved by 3 h after infection . The intranuclear parental viral chromatin remained resistant to nuclease digestion even at late times in infection, after viral DNA replication had begun.

Nucleic Acids Res, 1979 Mar, 6(3), 953 - 66
Comparison of non histone proteins selectively associated with nucleosomes with proteins released during limited DNase digestions; Defer N et al.; Cultured mammary cells from GR mouse were used to analyse proteins associated with the mononucleosomes and released by a short micrococcal DNase treatment of nuclei . On metrizamide density gradients, mononucleosomes appear to be heterogeneous according to their content of associated non-histone proteins . Proteins associated with the denser fraction (1.22 - 1.24 g/ml) were analysed by two dimensional electrophoresis and compared to the proteins released by DNase I treatment . All the proteins associated with mononucleosomes were also released by DNase I treatment . It could then be assumed that these proteins are associated with the active part of the genome . Additional proteins were released by micrococcal DNase treatment of the nuclei . They could be involved in a higher order organization of chromatin.

Int J Radiat Biol Relat Stud Phys Chem Med, 1979 Mar, 35(3), 253 - 63
Excision repair of gamma-ray-induced alkali-stable DNA lesions with the help of gamma-endonuclease from Micrococcus luteus; Tomilin NV et al.; gamma-Endonuclease Y, an enzyme that hydrolyses phosphodiester bonds at alkalistable lesions in gamma-irradiated (N2, tris buffer) DNA, has been partially purified from Micrococcus luteus . The enzyme has a molecular weight of about 19 000, induces single-strand breaks with 3'OH-5'PO4 termini and contains endonuclease activity towards DNA treated with 7-bromomethylbenz(a)anthracene . gamma-Endonuclease Y induces breaks in OsO4-treated poly(dA-dT) and apparently is specific towards gamma-ray-induced base lesions of the t' type . The complete excision repair of gamma-endonuclease Y substrate sites has been performed in vitro by gamma-endonuclease Y, DNA polymerase and ligase.

Clin Chem, 1979 Mar, 25(3), 484 - 5
Improved lysozyme assay in biological fluids; Grossowicz N et al.; We describe a simple, rapid, sensitive, and highly reproducible assay for lysozyme, with use of concentrated cell suspensions of Micrococcus lysodeikticus in Tris-buffered glycerol/water (40/60 by vol), pH 7.5 . Stored at -20 degrees C, the cells' susceptibility to lysozyme remains unaltered over long periods . Almost identical concentration curves were obtained with different aliquots of the same preparation during eight months . Lysozyme activity was reflected in the decrease in absorbance of the reaction mixture after incubation for 15 min at 37 degrees C . Concentrations of egg-white lysozyme as low as 0.02 mg/L can be accurately assayed.

Biokhimiia, 1979 Mar, 44(3), 548 - 54
{Compartmentation of gramicidin 5 in membranes of sensitive bacteria and protein-lipid interactions}; Eremin VA et al.; Gramicidin S is sorbed on the isolated membranes of granicidin-sensitive Micrococcus lysodeikticus strain . The antibiotic inhibits the membrane malate dehydrogenase within the temperature range of 9--42 degrees C, i.e . under conditions of gel and liquid-crystalline lipid state; however its effect at 10 degrees C is 10 times as low as is observed at 42 degrees C . The inhibitory effect of gramicidin S on malate dehydrogenase can be eliminated and the antibiotic can be removed from the membrane by an excess of different phospholipids . No transfer of the membrane components on exogenous phospholipids is observed . A prolonged (about 2 hrs, 30 degrees C) incubation of the membranes with gramicidin S results in irreversible inactivation of malate dehydrogenase, although the antibiotic can be still eliminated by an addition of phospholipid emulsions . It is suggested that gramicidin S forms complexes with phospholipids, in which the antibiotic is oriented to water . These complexes disturb the lipid-protein interactions, resulting in relaxation of the binding between the boundary phospholipids and proteins, in the loosening of near-protein lipid zones and simultaneous condensation of acid phospholipids in the whole membrane . Destruction of the lipid zone is accompanied by changes in the enzyme activity, by separation of lipid and protein regions and by transphase enzyme transitions (expulsion or immersion) . A slow formation of secondary protein-protein associates may be irreversible.

J Virol, 1979 Mar, 29(3), 1087 - 98
Translation of bovine leukemia virus virion RNAs in heterologous protein-synthesizing systems; Ghysdael J et al.; Bovine leukemia virus 60 to 70S RNA was heat denatured, the polyadenylic acid-containing species were separated by velocity sedimentation, and several size classes were translated in a micrococcal nuclease-treated cell-free system from rabbit reticulocytes . The major RNA species sedimented at 38S and migrated as a single component of molecular weight 2.95 x 10(6) when analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis . The predominant polypeptides of the in vitro translation of bovine leukemia virus 38S RNA were products with molecular weights of 70,000 and 45,000; minor components with molecular weights of 145,000 and 18,000 were also observed . Two lines of evidence indicate that the 70,000- and 45,000-molecular weight polypeptides represent translation products of the gag gene of the bovine leukemia virus genome (Pr70gag and Pr45gag) . First, they are specifically precipitated by a monospecific antiserum to the major internal protein, p24, and second, they are synthesized and correctly processed into virion proteins p24, p15, and p10 in Xenopus laevis oocytes microinjected with bovine leukemia virus 38S RNA . The 145,000-molecular weight polypeptide was immunoprecipitated by the anti-p24 serum and not by an antiserum to the major envelope glycoprotein, gp60 . It contained all the tryptic peptides of Pr70gag and additional peptides unique to it, and thus represents in elongation product of Pr70gag in an adjacent gene, presumably the pol gene . The 18,000-molecular weight product was antigenically unrelated to p24 and gp60 and shared no peptides in common with Pr70gag, Pr45gag, or the 145,000-molecular weight polypeptide . It was maximally synthesized on a polyadenylic acid-containing virion 16 to 18S RNA, and we present evidence that this RNA is a 3' end-derived subgenomic fragment of the bovine leukemia virus genome rather than a contaminating cellular RNA.

Biochim Biophys Acta, 1979 Feb 27, 561(2), 517 - 25
Histone deacetylation in nuclei isolated from hepatoma tissue culture cells . Inhibition by sodium butyrate; Perry M et al.; Nuclei from hepatoma tissue culture (HTC) cells were isolated by standard methods and incubated in media commonly used for nuclease digestions (DNAase I and micrococcal nuclease) and for in vitro RNA synthesis . During the incubation, histones can be deacetylated from both control cells and cells treated with 6 mM sodium butyrate to enhance the levels of histone acetylation . Deacetylation of histone is much more apparent in nuclei isolated from sodium butyrate-treated cells . Inclusion of 6 mM sodium butyrate in the incubation medium effectively inhibits the endogenous deacetylase activity acting on histones H3 and H4, whereas sodium acetate at the same concentration has very little inhibitory effect.

Biochim Biophys Acta, 1979 Feb 27, 561(2), 452 - 63
Accessibility of the ribosomal genes to micrococcal nuclease in Physarum polycephalum; Stalder J et al.; In Physarum polycephalum most genes coding for ribosomal RNA are not integrated in chromosomes, but are located in many copies in the nucleolus as plasmid-like palindromic DNA molecules . To find out whether coding sequences of rDNA are organized in a chromatin-like structure similar to that of bulk chromatin, nuclei were treated with micrococcal nuclease and DNA fragments were isolated . From bulk chromatin multimers of a basic unit of 170-180 base pairs were obtained . Nuclease fragmented DNA hybridized with labelled 19-S + 26-S rRNA was found to give the same saturation value as did unfragmented control DNA . No preferential degradation of ribosomal genes to acid soluble products was observed . A more detailed analysis of the nuclease degradation products was carried out with fragments separated by preparative gel electrophoresis . DNA eluted from the gels was hybridized in solution with labelled 19-S + 26-S rRNA . The coding sequences of rRNA were found to be degraded to approximately nucleosome size slightly more quickly than was the DNA of bulk chromatin . However, the distribution of the rDNA fragments on the gels did not coincide with the distribution of the fragments derived from bulk chromatin nucleosomes and their oligomers . The amount of rDNA in the interband regions was about intermediate between that found in the two adjacent bands . These results lead to the conclusion that the ribosomal genes, most of which are presumably active during rapid growth, are protected by proteins, probably histones . However, the ribosomal genes are present in a structure differing in some way from that of bulk chromatin.

J Biol Chem, 1979 Feb 25, 254(4), 1227 - 32
Processiveness of DNA polymerases . A comparative study using a simple procedure; Das SK et al.; In this communication, we describe a simple procedure for analyzing the processiveness of DNA polymerases in general . By choosing conditions for which the number of incorporations per available primer is less than 1, we have reduced the probability of a primer molecule being utilized by the enzyme more than once . The primer-template used was poly(dA)300:oligo(dT)10, and the product was isolated by oligo(dT)-cellulose chromatography . The number of dTMP residues added per association was determined from the {3H}dThd + {3'-3H}dTMP/{3H}dThd ratio of the product after its digestion by micrococcal nuclease and spleen phosphodiesterase . Using this procedure, we have found that Escherichia coli DNA polymerase I, T4 DNA polymerase, and calf thymus alpha- and beta-DNA polymerase are "quasi-processive." Most of these enzymes add on the average approximately 10 to 15 nucleotides before dissociating from the template . T5 DNA polymerase, on the other hand, is processive, i.e . it continues to replicate a given template until it is very close to the 5' end of the template . With "nicked DNA-like" poly(dA):oligo(dT), the processiveness of E . coli DNA polymerase I is increased 2- to 2.5-fold . The significance of this increase in determining the "patch size" during DNA repair is discussed.

Biochemistry, 1979 Feb 20, 18(4), 659 - 68
Analysis of chromatin reconstitutiion; Fulmer AW et al.; The ability of high molecular weight chicken erythrocyte chromatin to spontaneously self-assemble into native-like material, after dissociation by high ionic strength and reassociation by salt gradient dialysis, was critically examined . The native conformational state of the reassembled nucleoprotein complex was regenerated to the extent reflected by circular dichroism spectra and thermally induced helix--coil transition of the nucleoprotein DNA . However, internucleosomal packing of approximately 205 base pairs of DNA per repeating unit, as probed by digestion with micrococcal nuclease, was not regenerated upon reassembly and was replaced by a packing of approximately 160 base pairs per repeating unit . Thus, high molecular weight chromatin containing only lysine-rich histones (H1 and H5) and core histones (H2A, H2B, H3, and H4) is not a true self-assembling system in vitro using the salt gradient dialysis system used herein . Circular dichroism and thermal denaturation studies on core chromatin (lysine-rich histones removed) showed that core histones alone are not capable of reassembling high molecular weight DNA into native-like core particles at low temperature (4 degree C) . Reassembly at 21 degree C restored the circular dichroism but not the thermal denaturation properties to those characteristic of undissociated core chromatin . Nonetheless, micrococcal nuclease digestions of both reassembled core chromatin products were identical with undissociated native core chromatin . Ressembly in the presence of the complete complement of histones, followed by removal of the lysine-rich histones, did regenerate the thermal denaturation properties of undissociated native core particles . These results indicated multiple functions of the lysine-rich histones in the in vitro assembly of high molecular weight chromatin.

J Biol Chem, 1979 Feb 10, 254(3), 609 - 20
A subset of trout testis nucleosomes enriched in transcribed DNA sequences contains high mobility group proteins as major structural components; Levy BW et al.; Mononucleosomes greatly enriched in non-histone proteins were prepared by limited digestion of testis nuclei with micrococcal nuclease . Five to fifteen per cent of the chromatin was solubilized and could be separated by adjustment to 0.1 M NaCl, into a soluble fraction MN1, consisting of mononucleosomes containing the four inner histones and the small basic non-histone, H6, associated with a 140-base-pair DNA fragment . H1 was notably absent in MN1 . The fraction insoluble in 0.1 M NaCl (MN2) comprised a mixture of mono-, di-, tri-, and oligosomes . MN2 monosome fraction contained the four inner histones plus H1 and lacked H6 and the length of its DNA was 170 base-pairs . Previous work had shown that limited micrococcal nuclease digestion of trout testis nuclei released a great proportion of the non-histone protein, high mobility group protein T (HMG-T) . It seems likely that HMG-T is the major non-histone protein located in the linker regions of a subset of nucleosomes containing the non-histone protein H6 as a major structural component . Moreover, the presence of HMG-T renders this subset of nucleosomes very sensitive to micrococcal nuclease . Hybridization experiments were performed to demonstrate that the DNA from MN1 monosomes corresponds to a subset of the trout testis genome . This DNA subset is greatly enriched in sequences that are present in cytoplasmic RNA . Chromatin subunits enriched in their content of H6 and HMG-T could also be obtained by limited digestion of trout testis chromatin with DNase II followed by precipitation with MgCl2.

Biochemistry, 1979 Feb 6, 18(3), 450 - 4
Stereochemistry of internucleotide bond formation by polynucleotide phosphorylase from Micrococcus luteus; Burgers PM et al.; Polynucleotide phosphorylase catalyzes the formation of polynucleotides from the Sp diastereomer of adenosine 5'-O-(l-thiodiphosphate) ADPalphaS), whereas the Rp diastereomer is a competitive inhibitor . The absolute configuration of the phosphorothioate diester bond in the polymer was determined by copolymerizing ADPalpha S, Sp isomer with UDP and degrading the resulting copolymer with R Nase A and spleen phosphodiesterase to give, inter alia, uridine 2',-3'-cyclic phosphorothioate . The latter product was shown to be the endo isomer by high-performance liquid chromatography . No evidence for the presence of the exo isomer was obtained . It can thus be concluded that the Sp diastereomer of ADPalphaS polymerizes with inversion of configuration at phosphorus without racemization to give a phosphorothioate diester bond with the Rp configuration.

Am J Ophthalmol, 1979 Feb, 87(2), 148 - 51
Lysozyme content of tears in patients with Sjögren's syndrome and rheumatoid arthritis; Avisar R et al.; In 37 patients and 143 control patients we estimated tear fluid lysozyme content by the Micrococcus lysodeikticus agar diffusion assay . We found no correlation between the titer of lysozyme in tear fluid and the rate of tear flow . Decrease in lysozyme production was found to be a sensitive indicator of the involvement of the lacrimal system in Sjogren's syndrome.

Nucleic Acids Res, 1979 Feb, 6(2), 645 - 56
DNA-histone interaction in the vicinity of replication points; Schlaeger EJ et al.; Chromatin replication was studied in isolated nuclei from Concanavalin A activated lymphocytes . Digestion with micrococcal nuclease revealed that the resistant fraction of in vitro replicated DNA is associated with nucleosomes . Earlier experiments had shown that the nuclease resistant fraction of nascent DNA is composed of fragments which are shorter than the nuclease resistant fragments of bulk DNA . In this communication we demonstrate that the short fragments of nascent DNA are differently bound to nucleosome like structures compared to bulk DNA . At 0.5 M NaCl a fraction of pulse labeled labeled DNA is released from these structures and appears as free double stranded DNA of about 140 base pair length (5S DNA) while the 185 pair fragments of mature replicated DNA remain attached to nucleosomes under these conditions . The experiments may indicate that the interaction of a fraction of replicating DNA with histones differs from that of bulk DNA.

Nucleic Acids Res, 1979 Feb, 6(2), 561 - 74
A correlation between nucleosome spacer region susceptibility to DNase I and histone acetylation; Nelson D et al.; Hepatoma tissue culture (HTC) cell nuclei were digested with either DNase I or micrococcal nuclease and the nucleohistone digestion products fractionated by gel electrophoresis or exclusion chromatography . Under appropriate conditions, gel electrophoresis demonstrates that for both nucleases, only cleavages within the nucleosome spacer regions and not within the nucleosome core lead to freely migrating nucleohistone particles . These particles consist of nucleosome cores, nucleosomes and nucleosome oligomers . Following DNase I digestion and fractionation by exclusion chromatography, analysis of the histones indicates a direct relationship between increased spacer region susceptibility to nuclease and increased nucleosomal histone acetylation . Evidently digestion sites outside the regions of DNA protected by core histones can reflect the degree of acetylation of core histones . Such a relationship is not found when micrococcal nuclease is used to digest the samples.

J Virol, 1979 Feb, 29(2), 657 - 65
Nucleosomal structure of Epstein-Barr virus DNA in transformed cell lines; Shaw JE et al.; Micrococcal nuclease digestion was used to analyze Epstein-Barr virus (EBV) DNA structure in nuclei of transformed cells . Digests of virus-producing (P3HR-1), non-virus-producing (Raji), and superinfected Rajii cell nuclei were fractionated by electrophoresis on agarose gels, transferred to nitrocellulose, and hybridized to 32P-labeled EBV DNA . The viral DNA of Raji nuclei produced a series of bands on electrophoresis whose lengths were integral multiples of a unit size, which was the same as the repeat length of host DNA . Viral DNA in nuclei of P3HR-1 and superinfected Raji cells produced faintly visible bands superimposed on a smear of viral DNA which dominated the hybridization pattern . No differences were detected in the patterns when total DNA digests from Raji, P3HR-1, and an EBV DNA-negative cell line (U-698M) were analyzed by ethidium bromide staining or by hybridization with the use of 32P-labeled lymphoblastoid cell DNA as probe . We conclude that the EBV episomal DNA of Raji cells is folded into nucleosomes, whereas most of the viral DNA of P3HR-1 and superinfected Raji cells is not . This pattern of DNA organization differs signficantly from that in papova group viruses.

Biochim Biophys Acta, 1979 Jan 26, 561(1), 261 - 4
Chromatin organization in the oomycete Achlya ambisexualis; Silver JC; Nuclei from the Oomycete Achlya ambisexualis and rabbit kidney nuclei were digested with micrococcal nuclease and the resultant DNA fragments analyzed on slab gels . The average DNA repeat size was found to be 159 +/- 1.2 base pairs for Achlya and 199.8 +/- 3.7 base pairs for rabbit kidney . The presence of a DNA repeat size of 159 base pairs for Achlya extends the characterization of eukaryotic chromatins to this most primitive and perhaps unique microbe.






What Is Environmental Microbiology?, What Is Bioremediation?, What Is Genome?, What Is Botulism?, What Is Bioengineering?, c, Bacterium, o, Microorganisms, e, Microbes, s, Bacteriology, i, Microorganism, n, Thermophiles, n, Staphylococcus, i, Thermophile, c, Pseudomonas, o, Escherichia coli, r, Eubacterium, o, Bacteriophage, n, Bacillus subtilis, i, Escherichia coli, a, Haemophilus, c, Streptococci, a, Thermophiles, s, Salmonella typhimurium, e, Bacteriophage, s, Bacillus subtilis, c, Cell suspensions, e, Salmonella, s, Cell suspensions, i, Salmonella typhimurium, n, Bacteria, n, Cell cultures




 

   Scientific Publications - Work Done by Microbiology Reader Bioscreen C

Agricultural Microbiology
Anaerobic Microbiology
Antimicrobial Susceptibility
Artificial Atmosphere
Bioassay of Antibiotics
Biofilm Microbiology
Bioreactor Technology
Biotechnology
Cell Biology
Clinical Microbiology
Environmental Microbiology
Experiments with Yeast
Fermentation
Food Microbiology
Functional Genomics
Gene Technology
Growth Media Development
Growth Rate and Lag Time
Industrial Microbiology
Medical/Pharmaceutical Field
Microbiological Assay
Microbiological Research
Microbiology of Cosmetics

go to a specific theme...

Military Microbiology
Molecular Microbiology
Mutagenicity and Genotoxicity
Oral Microbiology
Patents
Postantibiotic Studies
Soil Microbiology
Spore Microbiology
Veterinary Microbiology
Waste/Wastewater Treatment
Water Microbiology
Wine Microbiology

 


 

© 2005 Transgalactic Ltd (manufacturer of Bioscreen C software) | Privacy Statement | P.O. Box 1393, 00101 Helsinki, Finland, phone: +358 9 85172920, fax: +358 9 8749481, e-mail: microbiology@bionewsonline.com
 

 

 

Last modified: May 25, 2005